A TRANSGENIC INVERTEBRATE MODEL FOR ALZHEIMER'S DISEASE AND USE THEREOF
20210227814 · 2021-07-29
Inventors
Cpc classification
A01K2217/15
HUMAN NECESSITIES
A61K49/0008
HUMAN NECESSITIES
A01K2227/706
HUMAN NECESSITIES
C12N9/1081
CHEMISTRY; METALLURGY
C12Y204/01274
CHEMISTRY; METALLURGY
C12Y204/99004
CHEMISTRY; METALLURGY
International classification
Abstract
The present invention provides a transgenic invertebrate model for Alzheimer's disease and a method for screening a therapeutic agent for Alzheimer's disease using the model. The present invention provides a transgenic invertebrate, in which genes encoding enzymes involved in production of a ganglioside are introduced and the ganglioside is expressed.
Claims
1. A transgenic invertebrate, wherein genes encoding enzymes involved in production of a ganglioside have been introduced, and the ganglioside is expressed.
2. The transgenic invertebrate according to claim 1, wherein the enzymes involved in production of a ganglioside are β-1,4-galactose transferase and α-2,3-sialyltransferase, and the ganglioside is GM3 ganglioside.
3. The transgenic invertebrate according to claim 1, wherein a gene encoding an enzyme involved in synthesis of sialic acid has been further introduced.
4. The transgenic invertebrate according to claim 1, wherein a gene encoding amyloid β has been further introduced, and the ganglioside, and amyloid β are co-expressed.
5. The transgenic invertebrate according to claim 4, wherein the amyloid β is a Dutch amyloid β mutant.
6. The transgenic invertebrate according to claim 1, wherein the invertebrate is an insect or a nematode.
7. The transgenic invertebrate according to claim 6, wherein the insect is Drosophila.
8. A method for screening a therapeutic agent for Alzheimer's disease, comprising the steps of: (1) providing the transgenic invertebrate according to claim 4; (2) administering a candidate compound to the transgenic invertebrate; and (3) analyzing the transgenic invertebrate after administration of the candidate compound in step (2).
9. A method for screening a therapeutic agent for Alzheimer's disease, comprising the steps of: (1) providing the transgenic invertebrate according claim 5; (2) administering a candidate compound to the transgenic invertebrate; and (3) analyzing the transgenic invertebrate after administration of the candidate compound in step (2).
10. A method for screening a therapeutic agent for Alzheimer's disease, comprising the steps of: (1) providing the transgenic invertebrate according to claim 6; (2) administering a candidate compound to the transgenic invertebrate; and (3) analyzing the transgenic invertebrate after administration of the candidate compound in step (2).
11. A method for screening a therapeutic agent for Alzheimer's disease, comprising the steps of: (1) providing the transgenic invertebrate according to claim 7; (2) administering a candidate compound to the transgenic invertebrate; and (3) analyzing the transgenic invertebrate after administration of the candidate compound in step (2).
Description
BRIEF DESCRIPTION OF DRAWINGS
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
DESCRIPTION OF EMBODIMENTS
[0027] Hereinafter, the present invention will be described in detail. However, the present invention is not limited by the embodiments described in the present specification.
[0028] According to the first embodiment, the present invention is directed to a transgenic invertebrate expressing a ganglioside, in which genes encoding enzymes involved in production of a ganglioside are introduced.
[0029] The “invertebrate” that can be used in the embodiment may be any invertebrate as long as it does not substantially express an endogenous ganglioside, i.e., an invertebrate of lower rank than an echinoderm. The phrase “not substantially express an endogenous ganglioside” means that an endogenous ganglioside cannot be detected by a detection means ordinarily used (for example, immunochemical method). Examples of an invertebrate which does not substantially express an endogenous ganglioside include arthropods such as insects, and nemathelminths such as nematodes, annelids and mollusks. The invertebrate that can be used in the embodiment is preferably an insect or a nematode (Caenorhabditis elegans). Examples of a preferable insect include an insect in the Diptera such as Drosophila, an insect of the Lepidoptera such as a silkworm, an insect of the Hymenoptera such as a bee and an insect of the Coleoptera such as a flour beetle. The insect that can be used in the embodiment is preferably a fly such as Drosophila, and particularly preferably, Drosophila melanogaster.
[0030] The “ganglioside” refers to a glycosphingolipid, which is a glycolipid obtained by binding a sugar to a ceramide and containing at least one sialic acid in the sugar chain moiety. Gangliosides are classified into, e.g., a ganglio series, a lacto series and globo series according to the structure of the sugar chain moiety, and further classified based on the number of sialic acids contained in the sugar chain moiety. Examples of the ganglio-series ganglioside containing a single sialic acid include GM1a, GM1b, GM2 and GM3. Examples of a ganglioside-series ganglioside containing two sialic acids include GD1a, GD1b, GD2 and GD3. Examples of a ganglioside-series ganglioside containing three sialic acids include GT1a, GT1b, GT1c, GT2 and GT3. Examples of a ganglioside-series ganglioside containing four sialic acids include GQ1b and GQ1c. Examples of a ganglioside-series ganglioside containing five sialic acids include GP1c. The ganglioside in the embodiment is preferably a monosialoganglio-series ganglioside such as GM1a, GM1b, GM2 and GM3 and particularly preferably GM3.
[0031] Examples of the “enzyme involved in production of a ganglioside” may include glycosyltransferase and glycoside hydrolase. Examples of the glycosyltransferase include galactosyltransferase, sialyltransferase, fucosyltransferase and N-acetylgalactosamine transferase. Examples of the glycoside hydrolase include galactosidase, glucosidase and N-acetylglucosaminidase. As the biosynthesis pathway of a ganglioside has been elucidated and suitable enzymes can be selected in accordance with the ganglioside to be desirably expressed. For example, GM3 can be produced by expressing β-1,4-galactose transferase and α-2,3-sialyltransferase. For example, GM2 can be produced by expressing β-1,4-N-acetylgalactosamine transferase. For example, GM1a can be produced by expressing β-1,3-galactose transferase 2.
[0032] Enzymes involved in production of a ganglioside in the embodiment may be derived from any animal species, preferably a mammal such as a mouse, a rat, a rabbit, a dog, a non-human primate and a human, and particularly preferably, a human. Genes encoding enzymes involved in production of a ganglioside have already been cloned and the information of the nucleotide sequences is available from a predetermined database. For example, for human β-1,4-galactose transferase, accession number BC069620.1 in the GenBank is available. For human α 2,3-sialyltransferase, accession numbers NM_003896 and NM_001042437 in the GenBank are available. For human β 1,4-N-acetylgalactosamine transferase, accession numbers NM_153446, NM_001159387.1 and NM_001159388.1 in the GenBank are available. For human β 1,3-galactose transferase 2, accession number AF288390 in the GenBank is available.
[0033] Examples of the enzymes involved in production of a ganglioside in the embodiment may include a protein consisting of an amino acid sequence having an identity of 80% or more, preferably 90% or more, more preferably about 95% or more with the above amino acid sequences registered in the database as long as it maintains enzymatic activity. The amino acid sequence identity can be determined using sequence analysis software, or using a program commonly used in the present technical field (FASTA, BLAST, etc.). Also, the enzyme involved in production of a ganglioside in the embodiment may include a protein consisting of an amino acid sequence registered in the database having a substitution, deletion, insertion and/or addition of one to several amino acids as long as it maintains the enzymatic activity. The “one to several” herein refers to, for example “1 to 30”, preferably “1 to 10” and particularly preferably, “1 to 5”.
[0034] A gene encoding an enzyme involved in production of a ganglioside can be introduced into an invertebrate by a method well-known in the art; for example, by subcloning the sequence of the gene desired to be introduced into a vector known in the art, e.g., a plasmid, a virus or a transposon, together with a transcription regulatory sequence such as a promoter, and introducing the vector into a target invertebrate. Particularly, in the case of an insect, a genetic recombination technique using a transposon is sufficiently established. For example, if Drosophila is used, GAL4-UAS expression system sufficiently established in the art can be used. More specifically, a transgenic Drosophila expressing a ganglioside can be prepared by crossing a Drosophila strain expressing a transcription factor GAL4, with a Drosophila strain, in which a vector having a gene encoding an enzyme involved in production of a ganglioside is introduced in the downstream of UAS (a target sequence of GAL4).
[0035] The Drosophila strain introduced a vector having a gene encoding an enzyme involved in production of a ganglioside downstream of UAS can be prepared by introducing a vector for transformation, such as pUAST, in which a gene encoding a desired enzyme is integrated, into an embryo of Drosophila. An existing Drosophila strain expressing GAL4 may be available. Alternatively, the Drosophila strain expressing GAL4 may be prepared by introducing a vector comprising a GAL4 gene in the downstream of a promoter/enhancer in accordance with a method known in the art. In the embodiment, preferably, a neuron-specific promoter/enhancer can be used. Although it is not particularly limited, e.g., elav, Appl and R57C10 can be used, and preferably elav can be used. When an existing strain is used as a Drosophila strain expressing GAL4 specifically to neurons, for example, elav.sup.C155-gal4 strain (Lin, D. M. et al., Neuron, 13: 507-523 (1994)) which is a strain expressing GAL4 specifically to neurons; and mb247-gal4 strain (Schulz, R A. et al., Oncogene, 12: 1827-1831(1996)) expressing GAL4 specifically to neurons of the brain mushroom body, can be used.
[0036] The Drosophila strains mentioned above can be available from, for example, domestic or international public stock centers such as Drosophila Genetic Resource Center of the Kyoto Institute of Technology (http://www.dgrc.kit.ac.jp/) and the Bloomington Drosophila Stock Center (http://flystocks.bio.indiana.edu/).
[0037] In order for a transgenic invertebrate according to the embodiment to sufficiently and successfully produce a ganglioside, it is preferable to sufficiently supply a sialic acid donor substrate for supplying sialic acid, which is a constitution component of a ganglioside. The sialic acid donor substrate may be supplied by adding it to feed or by further introducing a gene encoding an enzyme involved in synthesis of a sialic acid donor substrate to the transgenic invertebrate so as to biologically synthesize the sialic acid donor substrate. More specifically, in a transgenic invertebrate according to the embodiment, a gene encoding an enzyme involved in synthesis a sialic acid donor substrate may be introduced in addition to a gene encoding an enzyme involved in production of a ganglioside. Examples of the gene encoding an enzyme involved in synthesis of a sialic acid donor substrate may include a gene (GenBank Accession Number NG_008246.1) encoding human UDP-N-acetylglucosamine 2-epimerase/N-acetylmannosamine kinase.
[0038] In a transgenic invertebrate according to the embodiment, it is preferable that a gene encoding amyloid β is further introduced, and the ganglioside and the amyloid β are co-expressed. Amyloid β (hereinafter referred to as “Aβ”) refers to a peptide produced by cleaving an amyloid precursor protein fragment (APP) with β-secretase and γ-secretase. Aβ40 and Aβ42 different in number of amino acids, which are produced by cleaving APP at different points, are included.
[0039] Examples of “APP” may include not only human APP isoforms consisting of amino acid sequences registered in the RefSeq database of the NCBI (http://www.ncbi.nlm.nih.gov/RefSeq/) under RefSeq Accession Numbers NP_001129601.1, NP_001129602.1, NP_958817.1, NP_001191231.1, NP_958816.1, NP_001191230.1, NP_000475.1, NP_001129488.1 and NP_001129603.1, but also an isoform containing a mutation known in the art and found in familial Alzheimer's disease.
[0040] Examples of “APP” may include a protein consisting of an amino acid sequence having an identity of 80% or more, preferably 90% or more, more preferably about 95% or more with the amino acid sequence as mentioned above, as long as it can be cleaved with β-secretase and γ-secretase to produce Aβ. The amino acid sequence identity can be determined using sequence analysis software, or using a program commonly used in the present technical field (FASTA, BLAST, etc.).
[0041] Examples of “APP” may include a protein consisting of an amino acid sequence as mentioned above having a substitution, deletion, insertion and/or addition of one to several amino acids as long as it is cleaved with β-secretase and γ-secretase to produce Aβ. The “one to several” herein refers to, for example “1 to 30”, preferably “1 to 10” and particularly preferably, “1 to 5”.
[0042] More specifically, examples of Aβ in the embodiment may include, but are not limited to, a wild type, Aβ40 or Aβ42 such as Dutch mutant (E22Q), Arctic mutant (E22G), Italian mutant (E22K), Flemish mutant (A21G) and Iowa mutant (D23N). In the embodiment, Aβ is preferably Dutch mutant, Aβ40 or Aβ42.
[0043] The transgenic invertebrate according to the embodiment can be used as a model animal for analyzing various physiological functions such as a neural function in which ganglioside is involved. Also, a transgenic invertebrate according to the embodiment can reproduce the aggregation of Aβ under the physiological conditions of the human brain, when Aβ is co-expressed therein at a level as low as in the human brain. Thus, the transgenic invertebrate according to the embodiment is useful' as a model animal for Alzheimer's disease.
[0044] According to the second embodiment, the present invention is directed to a method for screening a therapeutic agent for Alzheimer's disease, including the steps of: (1) providing a transgenic invertebrate co-expressing a ganglioside as mentioned above and amyloid β; (2) administering a candidate compound to the transgenic invertebrate; and (3) analyzing the transgenic invertebrate after administration of the candidate compound in the step (2). The screening method of the embodiment makes it possible to obtain a compound inhibiting interaction between Aβ and a ganglioside as an Aβ aggregation inhibitor for use in definitive treatment or prevention for Alzheimer's disease.
[0045] The terms “invertebrate”, “ganglioside” and “amyloid β (Aβ)” used in the embodiment are the same as those defined in the first embodiment.
[0046] The screening method of the embodiment employs a transgenic invertebrate co-expressing a ganglioside and Aβ. In the embodiment, the transgenic invertebrate co-expressing a ganglioside and Aβ can be prepared in the same manner as described above.
[0047] Then, a candidate compound is administered to the transgenic invertebrate co-expressing a ganglioside and Aβ. Examples of the candidate compound may include synthetic compounds, peptide compounds, nucleic acids and antibodies, and these candidate compounds may be novel compounds or compounds known in the art. For administering a candidate compound to a transgenic invertebrate, the candidate compound may be added to feed in various concentrations and allowed to eat. The concentration of the candidate compound to be added to the feed may vary depending on the type of compound. The concentration can be appropriately selected from, for example, the range of 0.1 to 100 mM. A candidate compound can be administered over the period from, e.g., 7 to 30 days.
[0048] Then, the transgenic invertebrate after administration of the candidate compound is analyzed so as to evaluate the Aβ aggregation inhibition effect of the candidate compound. Accumulation of aggregated Aβ can be detected and quantified by analyzing a brain tissue biochemically or pathologically in accordance with a procedure known in the art, e.g., by using an anti-Aβ antibody. In the embodiment, the degree of accumulation of aggregated Aβ in the brain tissue can be evaluated by determining motor function and learning and memory abilities because the transgenic invertebrate deteriorates in motor function and learning and memory abilities in correlation to accumulation of aggregated Aβ. The methods for determining motor function and learning and memory abilities have already been sufficiently established, and an appropriate method can be selected from those known in the art. For example, when Drosophila is used as an invertebrate, motor function can be determined by a climbing assay, sufficiently established in the art, based on evaluation of negative geotaxis. The learning and memory abilities can be determined by the odor-aversion learning test using odor and electric shock in combination.
[0049] Whether the accumulation of aggregated Aβ in the transgenic invertebrate received a candidate compound is decreased can be determined by comparing to the results of concurrent analysis of a transgenic invertebrate not administered the candidate compound, or by comparing to the results of past analysis of a transgenic invertebrate not administered the candidate compound.
[0050] In the screening method of the embodiment, when the accumulation amount of aggregated Aβ is significantly decreased by administration of a candidate compound, compared to the case in transgenic invertebrate not administered the candidate compound, the candidate compound can be evaluated to be a promising Aβ aggregation inhibitor which is useful for definite treatment or prevention for Alzheimer's disease. In contrast, when the accumulation amount of aggregated Aβ did not change or increased by administration of a candidate compound, compared to the case of a transgenic invertebrate to which the candidate compound not administered, the candidate compound cannot be evaluated as a promising Aβ aggregation inhibitor which is useful for definite treatment or prevention for Alzheimer's disease.
[0051] The method of the embodiment is schematically shown in
EXAMPLES
[0052] The present invention will now be further described with Examples, but is not limited to the following Examples. Note that, these examples should not be construed as limiting the present invention.
1. Preparation of Transgenic Drosophila and Breeding Thereof
[0053] Transgenic Drosophila, which expresses enzymes involved in the synthesis pathway for GM3 ganglioside in mammals, i.e., β-1,4-galactose transferase (official abbreviation: B4GALT6, hereinafter referred to as “GALT6”), α-2,3-sialyltransferase (official abbreviation: ST3GAL5, hereinafter referred to as “SAT1”), and UDP-N-acetylglucosamine 2-epimerase/N-acetylmannosamine kinase (official abbreviation: GNE), was prepared in the following procedure.
[0054] The coding sequences of human GALT6, human SAT1, and human GNE were obtained by PCR amplification using a human brain cDNA library (code number 9503, Takara Bio Inc.) as templates and the following primer sets.
TABLE-US-00001 (i) GALT6 [Formula 1] (SEQ ID NO: 1) Forward: 5′ ATGTCTGTGCTCAGGCGGAT 3′ (SEQ ID NO: 2) Reverse: 5′ CTTGCCACGACAGCCACTTC 3′ (ii) SAT1 [Formula 2] (SEQ ID NO: 3) Forward: 5′ CATTAGTATGCGGACGAAGG 3′ (SEQ ID NO: 4) Reverse: 5′ GCTCTCAGAGTTAGAGTTGC 3′ (iii) GNE [Formula 3] (SEQ ID NO: 5) Forward: 5′ CATGGAGAAGAATGGAAATAACCGA 3′ (SEQ ID NO: 6) Reverse: 5′ QTAGTAGATCCTGCGTGTTG 3′
[0055] PCR products were each cloned in pCR-Blunt-II TOPO vector (Thermo Fisher Scientific) and subsequently subcloned at an EcoRI site of pUAST vector (Brand and Perrimon, Development, 1993). The pUAST vector was injected into the embryo of Drosophila, yw-strain. The adult Drosophila obtained was further crossed with Drosophila, w.sup.1118-strain. In this manner, transgenic Drosophila strains UAS-GALT6, UAS-SAT1 and UAS-GNE were obtained.
[0056] A transgenic Drosophila expressing Dutch mutant (E22Q) Aβ40 (hereinafter referred to as “Dut40”) was prepared in the following procedure. The coding sequence of human Aβ was prepared by amplifying cDNA of HeLa cells by PCR and the peptide sequence of a secretory signal of rat proenkephalin A (Finelli et al., Mol. Cell. Neurosci., 2004) was fused. Further, Dutch mutant (E22Q) was introduced by PCR using the following primer set. The resultant PCR product was subcloned at a BglII site of pUAST vector. A transgenic Drosophila UAS-Dut40 was obtained in the same manner as above.
(iv) Dut40 (Mutation Introduction Sites Were Underlined)
[0057]
TABLE-US-00002 [Formula 4] (SEQ ID NO: 7) Forward: 5′ GTGTTCTTTGCACAAGATGTGGGTTCAA 3′ (SEQ ID NO: 8) Reverse: 5′ TTGAACCCACATCTTGTGCAAAGAACAC 3′
[0058] Each of the UAS strains obtained above was crossed with GAL4 strain to prepare Drosophila strains expressing the above transgenes. The elav.sup.C155-gal4 strain (obtained from Bloomington Drosophila stock center) was used as a Drosophila strain expressing GAL4, specifically in neurons.
[0059] The Drosophila expressing the above transgenes were further crossed to prepare a transgenic Drosophila expressing GALT6 and SAT1; a transgenic Drosophila expressing GALT6, SAT1 and GNE; and a transgenic Drosophila expressing GALT6, SAT1 and Dut40. Expressions of GALT6, SAT1 and GNE were checked by immunostaining and the immunostaining results are shown in
[0060] The obtained Drosophila strains were grown on Ebios Cornmeal Sucrose Agar medium at a temperature of 25° C., and in a light-dark cycle of 12 hours. In order to provide a sialic acid donor substrate Neu5Ac, Drosophila was allowed to freely lick filter paper soaked with a 10 mM Neu5Ac/150 mM sucrose solution for 24 hours every other day for 1 to 2 weeks.
2. Production of GM3 Ganglioside in Transgenic Drosophila
[0061] In order to check whether GM3 ganglioside is produced in the transgenic Drosophila strains prepared, liquid chromatography mass spectrometry (LC-MS) was carried out. The spectrometry was carried out with respect to the following Drosophila strains: (1) wild type (Neu5Ac feeding (−)) (negative control) (2) transgenic Drosophila expressing GALT6 alone (Neu5Ac feeding (−)), (3) transgenic Drosophila expressing GALT6 and SAT1 (Neu5Ac feeding (−)), (4) transgenic Drosophila expressing GALT6 and SAT1 (Neu5Ac feeding (+)), (5) transgenic Drosophila expressing SAT1 alone (Neu5Ac feeding (+)), and (6) transgenic Drosophila expressing GALT6, SAT1 and GNE (Neu5Ac feeding (−)).
[0062] For each of the transgenic Drosophila strains, 200 to 1000 heads of adults were collected. To the heads, TBS buffer (50 mM Tris-HCl (pH7.6), 150 mM NaCl) was added, and the mixture was homogenized, and then dried. The obtained pellet was suspended in a solution mixture of chloroform: methanol (v/v=2:1) and a lipid extraction liquid was collected. The pellet was further resuspended in a solution mixture of chloroform: methanol: water (v/v/v=2:1:0.8) and a lipid extraction liquid was collected. The collected lipid extraction liquid was dried in nitrogen gas at 42° C. to obtain a lipid extract. The lipid extract was dissolved in 0.1 N NaOH/methanol, treated at 40° C. for 2 hours, neutralized with 0.1 mL of 2N acetic acid, evaporated/concentrated in nitrogen gas, and desalted in C18 BondElut 300 mg cartridge (Agilent Technologies). Thereafter, the lipid extract was dissolved with methanol and used as a sample for LC-MS. LC-MS was carried out by a liquid chromatograph mass spectrometer LCMS-8050 (Shimadzu Corporation).
[0063] The results are shown in
TABLE-US-00003 TABLE 1 Production of LacCer and GM3 in transgenic Drosophila Genotype Neu5Ac Feed LacCer GM3 Wild type − ND ND GALT6 − + ND GALT6, SAT1 − + ND GALT6, SAT1 + + + SAT1 + ND ND GALT6, SAT1, GNE − + + ND: Not detected
3. GM3 Ganglioside-Dependent Aβ-Aggregation in Transgenic Drosophila
[0064] To confirm whether of GM3 ganglioside-dependent aggregated Aβ is accumulated in the transgenic Drosophila co-expressing GM3 ganglioside and Dut40, a sample prepared from the brain tissue of a transgenic Drosophila strain expressing GALT6, SAT1 and Dut40, was subjected to western blotting. From 100 heads of adults of each of the transgenic Drosophila strain expressing GALT6, SAT1 and Dut40 (Neu5Ac feeding (−)) and the transgenic Drosophila expressing GALT6, SAT1 and Dut40 (Neu5Ac feeding (+)), were collected, homogenized in TBS buffer and subjected to ultracentrifugation (100,000 g, one hour, 4° C.). The supernatant was collected (TBS soluble fraction). The remaining sediment was again homogenized in 100% formic acid and centrifuged (14,000 rpm, 20 minutes, 25° C.) to remove unnecessary components. The supernatant was collected and dried (TBS insoluble fraction). Aβ not aggregated is separated as the TBS soluble fraction and Aβ aggregated and insolubilized is separated as the TBS insoluble fraction.
[0065] Samples of individual fractions prepared with Laemmli buffer, and synthesized Aβ-peptide (control), were subjected to 4-20% tris-tricine gel (Cosmo Bio), electrophoresed by SDS-PAGE, and thereafter, transferred to nitrocellulose membrane (NitroBind, MSI). Thereafter, the nitrocellulose membrane was boiled in PSB for 5 minutes and blocked by a 5% skim milk and 0.1% Tween20/PBS solution. Western blotting was carried out using an anti-Aβ monoclonal antibody (clone 82E1, Immuno-Biological Laboratories Co., Ltd.) (1: 100 dilution) as a primary antibody and HRP labeled goat anti-mouse IgG (Cell Signaling Technology Inc.) (1:3000 dilution) as a secondary antibody. Bands were detected by ECL western blotting detection system (GE Healthcare Life Sciences). The bands detected were analyzed by Image Analysis Software (ImageJ, made by the National Institutes of Health) to convert into numerical values. In this manner, the Aβ amounts of individual groups were compared.
[0066] The results are shown in
[0067] To confirm that Dut40 aggregation is not due to feeding with Neu5Ac, samples were prepared from the transgenic Drosophila strains expressing Dut40 (Neu5Ac feeding (−) or (+)) in the same manner as above and subjected to western blotting. The results are shown in FIG. 6. As a result, it was confirmed that feeding of Neu5Ac does not have an effect on the aggregation of Dut40.
[0068] The results demonstrated that accumulation of ganglioside-dependent aggregated Aβ in the human brain can be reproduced in a transgenic Drosophila co-expressing ganglioside and Aβ.