GLUCOSE OXIDASE GOD MUTANT AND GENE AND APPLICATION THEREOF

Abstract

The present invention takes the glucose oxidase GOD from Aspergillus niger as the mutation template to obtain the glucose oxidase GOD mutants with improved catalytic efficiency and thermal stability by site directed mutagenesis. The specific activity of the mutant of the present invention is 66% higher than that of the wild type GOD; the enzyme activity of the mutant of the present invention is 13.6 times higher than that of the wild type after being treated at 70° C. for 10 min; and the enzyme activity of the mutant of the present invention is 29.4 times higher than that of the wild type after being treated at 80° C. for 2 min.

Claims

1. The glucose oxidase GOD mutant which is obtained by muting the amino acid at the site of 82 of the glucose oxidase GOD having the amino acid sequence of SEQ ID No: 1.

2. The glucose oxidase GOD mutant according to claim 1, wherein the amino acid Glu at the site of 82 of the glucose oxidase GOD having the amino acid sequence of SEQ ID No:1 is substituted by the amino acid Cys.

3. The glucose oxidase GOD mutant according to claim 1, which is obtained by muting the amino acids at the sites of 82 and 418 of the glucose oxidase GOD having the amino acid sequence of SEQ ID No: 1.

4. The glucose oxidase GOD mutant according to claim 3, wherein the amino acid Glu at the site of 82 of the glucose oxidase GOD having the amino acid sequence of SEQ ID No:1 is substituted by the amino acid Cys, and the amino acid Val at the position 418 of the glucose GOD having the amino acid sequence of SEQ ID No: is substituted by the amino acid Glu.

5. The glucose oxidase GOD mutant according to claim 1, which is obtained by muting the amino acids at the sites of 82, 418 and 508 of the glucose oxidase GOD having the amino acid sequence of SEQ ID No: 1.

6. The glucose oxidase GOD mutant according to claim 4, wherein the amino acid Glu at the site of 82 of the glucose oxidase GOD having the amino acid sequence of SEQ ID No:1 is substituted by the amino acid Cys, the amino acid Val at the position 418 of the glucose GOD having the amino acid sequence of SEQ ID No:1 is substituted by the amino acid Glu, and the amino acid Asn at the site of 508 of glucose GOD having the amino acid sequence of SEQ ID No: 1 is substituted by the amino acid His.

7. The glucose oxidase GOD mutant according to claim 1, which is obtained by muting the amino acids at the sites of 82, 418, 508 and 32 of the glucose oxidase GOD having the amino acid sequence of SEQ ID No: 1.

8. The glucose oxidase GOD mutant according to claim 7, wherein the amino acid Glu at the site of 82 of the glucose oxidase GOD having the amino acid sequence of SEQ ID No:1 is substituted by the amino acid Cys, the amino acid Val at the position 418 of glucose GOD having the amino acid sequence of SEQ ID No:1 is substituted by the amino acid Glu, the amino acid Asn at the site of 508 of the glucose GOD having the amino acid sequence of SEQ ID No:1 is substituted by the amino acid His, and the amino acid Thr at the site of 32 of the glucose GOD having the amino acid sequence of SEQ ID No:1 is substituted by the amino acid Val.

9. The glucose oxidase GOD mutant according to claim 1, which is obtained by muting the amino acids at the sites of 82, 418, 508, 32 and 313 of the glucose oxidase GOD having the amino acid sequence of SEQ ID No: 1.

10. The glucose oxidase GOD mutant according to claim 9, wherein the amino acid Glu at the site of 82 of the glucose oxidase GOD having the amino acid sequence of SEQ ID No:1 is substituted by the amino acid Cys, the amino acid Val at the position 418 of the glucose GOD having the amino acid sequence of SEQ ID No:1 is substituted by the amino acid Glu, the amino acid Asn at the site of 508 of the glucose GOD having the amino acid sequence of SEQ ID No:1 is substituted by the amino acid His, the amino acid Thr at the site of 32 of the glucose GOD having the amino acid sequence of SEQ ID No:1 is substituted by the amino acid Val, and the amino acid Asp at the site of 313 of the glucose GOD having the amino acid sequence of SEQ ID No:1 is substituted by the amino acid Lys.

11. The glucose oxidase GOD mutant gene encoding the glucose oxidase GOD mutant of claim 1.

12. The recombinant expression vector comprising the glucose oxidase GOD mutant gene of claim 11.

13. The recombinant strain comprising the glucose oxidase GOD mutant gene of claim 11.

14. The method for preparing glucose oxidase GOD mutant of claim 1 including the f steps of transforming the host cell with the recombinant vector comprising the mutant gene of glucose oxidase GOD to obtain the recombinant strain; culturing the obtained recombinant strain to induce the expression of glucose oxidase GOD mutant; and recovering and purifying the glucose oxidase GOD mutant.

15. Application of the glucose oxidase GOD mutant of claim 1.

Description

BRIEF DESCRIPTIONS OF THE DRAWINGS

[0035] FIG. 1 shows the thermal stability of the wild type glucose oxidase and the mutants at 70° C. for 10 min, and

[0036] FIG. 2 shows the thermal stability of the wild type glucose oxidase and the mutants at 80° C. for 2 min.

EMBODIMENT

[0037] Test Materials and Reagents

[0038] 1. Strains and vectors: host: Pichia pastoris GS115; and vector pPIC9.

[0039] 2. Enzymes and other biochemical reagents: point mutation kit and other biochemical reagents were purchased by biochemical reagent company.

[0040] 3. Medium:

[0041] LB medium: 5% yeast extract, 1% peptone, 1% NaCL, pH 7.0;

[0042] YPD medium: 1% yeast extract, 2% peptone, 2% glucose;

[0043] MD solid medium: 2% glucose, 1.5% agarose, 1.34% YNB, 0.00004% Biotin;

[0044] MM solid medium: 1.5% agarose, 1.34% YNB, 0.00004% Biotin, 0.5% methanol;

[0045] BMGY medium: 1% yeast extract, 2% peptone, 1% glycerol (V/V), 1.34% YNB, 0.00004% Biotin;

[0046] BMMY medium: 1% yeast extract, 2% peptone, 1.34% YNB, 0.00004% Biotin, 0.5% methanol (V/V).

Example 1 Site Directed Mutagenesis

[0047] The glucose oxidase GOD having the acid sequence of SEQ ID No:1 from Aspergillus niger was performed the substation of the 82.sup.nd amino acid Glu with the amino acid Cys to obtain the mutant GOD-M1; the amino acid Val at the site of 418 of GOD-M1 was substituted by the amino acid Glu to obtain the mutant GOD-M2; the 508.sup.th amino acid Asn of GOD-M2 was substituted by the amino acid His to obtain the mutant GOD-M3; the amino acid Thr at the 32.sup.nd position of GOD-M3 was substituted by the amino acid Val to obtain the mutant GOD-M4; the amino acid Asp at the site of 313 of GOD-M4 was substituted by the amino acid Lys to obtain the mutant GOD-M5.

[0048] The mutation sites were introduced by site directed mutagenesis PCR and verified by sequencing. The primers for PCR were shown in Table 1:

TABLE-US-00007 TABLE 1 The mutant specific primers Primers Sequences (5′.fwdarw.3′).sup.a Size (bp) T32V-F ACTGGTTTGACTGTCGCTGCCAGATTGACT 30 T32V-R CAATCTGGCAGCGACAGTCAAACCAGTCAA 30 E82C-F TACGAGACTGTCTGCCTTGCCACTAACAAT 30 E82C-R GTTAGTGGCAAGGCAGACAGTCTCGTAAGC 30 D313K-F CCACTTGGTATTAAGACCGTCGTTGACTTG 30 D313K-R GTCAACGACGGTCTTAATACCAAGTGGTTC 30 V418E-F GACACTGCCGGTGAGGCTTCCTTCGACGTC 30 V418E-R GTCGAAGGAAGCCTCACCGGCAGTGTCCAA 30 N508H-F TACATTCCATACCACTTCAGACCTAACTAC 30 N508H-R GTTAGGTCTGAAGTGGTATGGAATGTATTC 30

Example 2 Preparation of Glucose Oxidase GOD Mutant

[0049] The PCR products were added with 1 μL DMT enzyme and incubated at 37° C. for 1 h. 2-5 μL of DMT digestion products was transformed into competent cells by heat-shocking, followed by sequencing. And the recombinant plasmids containing the mutant gene were transformed into Pichia pastoris GS115 competent cells to obtain recombinant yeast strains GS115/GOD-M1, GS115/GOD-M2, GS115/GOD-M3, GS115/GOD-M4, and GS115/GOD-M5 respectively.

[0050] GS115 strain containing recombinant plasmid was inoculated into 300 mL of BMGY medium and incubated for 48 h at 30° C. and 220 rpm, followed by centrifuging at 3000 g for 5 min to remove the supernatant. The obtained precipitate was suspended in 100 mL of BMMY medium containing 0.5% of methanol to induce at 30° C. and 220 rpm with addition of 0.5 mL of methanol every 12 h to keep the concentration of methanol in the bacterial solution as 0.5%. After induction, the supernatant was recovered by spinning to test the activity of the enzyme

Example 3 Analysis of the Activity of Glucose Oxidase GOD Mutant and Wild-Type Glucose Oxidase

[0051] I. Determining the Activity of the Glucose Oxidase GOD with o-Anisidine

[0052] The enzyme activity was determined by mixing 2.5 mL of o-anisidine buffer prepared by adding 0.2 mL of 1% o-anisidine to 25 mL of phosphate buffer in 0.1 M, 300 μL of 18% of glucose solution, 100 μL of 0.03% of horseradish peroxidase, and 100 μL of appropriate diluted release enzyme solution at pH6.0 to react for 3 min at 30° C., followed by adding 2 ml of H.sub.2SO.sub.4 in 2M to terminate the reaction and measuring the absorbance value at 540 nm. A unit of enzyme activity (U) is defined as the amount of enzyme required to produce 1 μmol gluconic acid and hydrogen peroxide per unit time under given conditions.

[0053] II. Measuring the Enzyme Activity and Thermal Stability of Glucose Oxidase GOD Mutant and Wild-Type Glucose Oxidase

[0054] 1. Determining the Enzyme Activity of Glucose Oxidase GOD Mutant and Wild Type

[0055] The enzyme activities of the glucose oxidase GOD mutant purified in example 2 and the wild-type glucose oxidase GOD were determined by performing the enzymatic reaction at pH 6.0 and 30° C.

[0056] The specific activity of the wild-type glucose oxidase GOD was 29.6 U/mg, and the activities of the mutants GOD-M1, GOD-M2, GOD-M3, GOD-M4 and GOD-M5 were increased to 352.5 U/mg, 366.8 U/mg, 379.8 U/mg, 392.1 U/mg, and 381.2 U/mg, respectively, with the increase rates of 54%, 59.8%, 65.4%, 70.8% and 66%, respectively.

[0057] 2. Measuring the Thermal Stability of the Mutant and Wild-Type Glucose Oxidase GOD at 70° C. or 80° C.

the mutant glucose oxidase GOD and wild-type glucose oxidase GOD were treated at 70° C. for 10 min and 80° C. for 2 min in 0.1 mol/L of citric acid disodium hydrogen phosphate buffer (pH 6.0), respectively, followed by measuring the residual enzyme activity at 30° C.

[0058] As shown in FIG. 1, the residual enzyme activity of wild-type glucose oxidase GOD was 14.5 U/mg, and the residual enzyme activities of glucose oxidase mutants GOD-M1, GOD-M2, GOD-M3, GOD-M4 and GOD-M5 were 55.9 U/mg, 73.1 U/mg, 179.2 U/mg, 189.8 U/mg, 211.2 U/mg, respectively, increasing 2.6, 4.0, 11.4, 12.1 and 13.6 times, respectively, after 10 min treatment at 70° C.

[0059] And, as shown in FIG. 2, the residual enzyme activity of wild-type glucose oxidase GOD was 4.5 U/mg, and the residual enzyme activities of GOD-M1, GOD-M2, GOD-M3, GOD-M4 and GOD-M5 were 23.6 U/mg, 35.5 U/mg, 98.6 U/mg, 117.2 U/mg, 137.0 U/mg, respectively, increasing 4.2, 6.9, 20.9, 25.0 and 29.4 times, respectively, after treatment at 80° C. for 2 min.