RNAi Agents And Compositions for Inhibiting Expression of Angiopoietin-Like 3 (ANGPTL3), And Methods Of Use
20210238602 · 2021-08-05
Inventors
Cpc classification
C12N15/113
CHEMISTRY; METALLURGY
C12N2310/317
CHEMISTRY; METALLURGY
International classification
C12N15/113
CHEMISTRY; METALLURGY
Abstract
The present disclosure relates to RNAi agents, e.g., double stranded RNAi agents, able to inhibit Angiopoietin-like 3 (also called ANGPTL3, ANGPL3, angiopoietin-like protein 3) gene expression, and compositions that include ANGPTL3 RNAi agents. Also disclosed are methods of use of ANGPTL3 RNAi agents and compositions. The ANGPTL3 RNAi agents disclosed herein may be conjugated to targeting ligands to facilitate the delivery to cells, including to hepatocytes. Pharmaceutical compositions that include one or more ANGPTL3 RNAi agents, optionally with one or more additional therapeutics, are described. Delivery of the ANGPTL3 RNAi agents in vivo provides for inhibition of ANGPTL3 gene expression, and can result in lower triglycerides and/or cholesterol levels in the subject. The RNAi agents can be used in methods of treatment of ANGPTL3-related diseases and disorders, including cardiometabolic diseases such as hypertriglyceridemia and hyperlipidemia.
Claims
1. An RNAi agent for inhibiting expression of an ANGPTL3 gene, comprising: an antisense strand comprising at least 17 contiguous nucleotides differing by 0 or 1 nucleotides from any one of the sequences provided in Table 2 or Table 3; and a sense strand comprising a nucleotide sequence that is at least partially complementary to the antisense strand.
2. The RNAi agent of claim 1, wherein the antisense strand comprises nucleotides 2-18 of any one of the sequences provided in Table 2 or Table 3.
3. The RNAi agent of claim 1, wherein the sense strand comprises a nucleotide sequence of at least 17 contiguous nucleotides differing by 0 or 1 nucleotides from any one of the sense strand sequences provided in Table 2 or Table 4, and wherein the sense strand has a region of at least 85% complementarity over the 17 contiguous nucleotides to the antisense strand.
4. The RNAi agent of claim 1, wherein at least one nucleotide of the RNAi agent is a modified nucleotide or includes a modified internucleoside linkage.
5. The RNAi agent of claim 1, wherein all or substantially all of the nucleotides of the sense and/or antisense strand of the RNAi agent are modified nucleotides.
6. The RNAi agent of claim 4, wherein the modified nucleotide is selected from the group consisting of: 2′-O-methyl nucleotide, 2′-fluoro nucleotide, 2′-deoxy nucleotide, 2′,3′-seco nucleotide mimic, locked nucleotide, 2′-F-arabino nucleotide. 2′-methoxyethyl nucleotide, abasic nucleotide, ribitol, inverted nucleotide, inverted 2′-O-methyl nucleotide, inverted 2′-deoxy nucleotide, 2′-amino-modified nucleotide, 2′-alkyl-modified nucleotide, morpholino nucleotide, vinyl phosphonate deoxyribonucleotide, and 3′-O-methyl nucleotide.
7. The RNAi agent of claim 5, wherein all or substantially all of the modified nucleotides are 2′-O-methyl nucleotides and 2′-fluoro nucleotides.
8. The RNAi agent of claim 1, wherein the antisense strand comprises the nucleotide sequence of any one of the modified antisense strand sequences provided in Table 3.
9. The RNAi agent of claim 1, wherein the sense strand comprises the nucleotide sequence of any of the modified sense strand sequences provided in Table 4.
10. The RNAi agent of claim 1, wherein the antisense strand comprises the nucleotide sequence of any one of the modified sequences provided in Table 3 and the sense strand comprises the nucleotide sequence of any one of the modified sequences provided in Table 4.
11. The RNAi agent of claim 1, wherein the RNAi agent is linked to a targeting ligand.
12. The RNAi agent of claim 11, wherein the targeting ligand comprises n-acetyl-galactosamine.
13. The RNAi agent of claim 11, wherein the targeting ligand comprises a structure selected from the group consisting of: (NAG13), (NAG13)s, (NAG18), (NAG18)s, (NAG24), (NAG24)s, (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG30), (NAG30)s, (NAG31), (NAG31)s, (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s, (NAG39), (NAG39)s.
14. The RNAi agent of claim 13, wherein the targeting ligand comprises the structure of (NAG37) or (NAG37)s.
15. The RNAi agent of claim 11, wherein the targeting ligand is linked to the sense strand.
16. The RNAi agent of claim 15, wherein the targeting ligand is linked to the 5′ terminal end of the sense strand.
17. The RNAi agent of claim 1, wherein the sense strand is between 18 and 30 nucleotides in length, and the antisense strand is between 18 and 30 nucleotides in length.
18. The RNAi agent of claim 17, wherein the sense strand and the antisense strand are each between 18 and 27 nucleotides in length.
19. The RNAi agent of claim 18, wherein the sense strand and the antisense strand are each between 18 and 24 nucleotides in length.
20. The RNAi agent of claim 19, wherein the sense strand and the antisense strand are each 21 nucleotides in length.
21. The RNAi agent of claim 17, wherein the RNAi agent has two blunt ends.
22. The RNAi agent of claim 1, wherein the sense strand comprises one or two terminal caps.
23. The RNAi agent of claim 1, wherein the sense strand comprises one or two inverted abasic residues.
24. The RNAi agent of claim 1, wherein the RNAi agent is comprised of a sense strand and an antisense strand that form a duplex having the structure of any one of the duplexes in Table 5.
25. The RNAi agent of claim 1, comprising an antisense strand that consists of, consists essentially of, or comprises a nucleotide sequence that differs by 0 or 1 nucleotides from one of the following nucleotide sequences (5′.fwdarw.3′): TABLE-US-00092 (SEQ ID NO: 3) UACUGAUCAAAUAUGUUGAGC; (SEQ ID NO: 6) UACUGAUCAAAUAUGUUGAGU; (SEQ ID NO: 8) UUUGAAUUAAUGUCCAUGGGC; (SEQ ID NO: 10) UUUGAAUUAAUGUCCAUGGGU; (SEQ ID NO: 12) UGUUGAAUUAAUGUCCAUGGA; or (SEQ ID NO: 15) ACAUCGUCUAACAUAGCAACC.
26. The RNAi agent of claim 25, wherein the sense strand consists of, consists essentially of, or comprises a nucleotide sequence that differs by 0 or 1 nucleotides from one of the following nucleotide sequences (5′.fwdarw.3′): TABLE-US-00093 (SEQ ID NO: 17) GCUCAACAUAUUUGAUCAGUA; (SEQ ID NO: 19) GCUCAACAU(A.sup.2N)UUUGAUCAGUA, wherein (A.sup.2N) represents a 2-aminoadenosine nucleotide; (SEQ ID NO: 21) GCUCAAC(A.sup.2N)U(A.sup.2N)UUUGAUCAGUA wherein (A.sup.2N) represents a 2-aminoadenosine nucleotide; (SEQ ID NO: 24) ACUCAACAUAUUUGAUCAGUA; (SEQ ID NO: 26) GCCCAUGGACAUUAAUUCAAA; (SEQ ID NO: 28) ACCCAUGGACAUUAAUUCAAA; (SEQ ID NO: 30) UCCAUGGACAUUAAUUCAACA; or (SEQ ID NO: 32) GGUUGCUAUGUUAGACGAUGU.
27. The RNAi agent of claim 25, wherein all or substantially all of the nucleotides are modified nucleotides.
28. The RNAi agent of claim 25, wherein the sense strand further includes inverted abasic residues at the 3′ terminal end of the nucleotide sequence, at the 5′ end of the nucleotide sequence, or at both.
29. The RNAi agent of claim 1, comprising an antisense strand that comprises, consists of, or consists essentially of a modified nucleotide sequence that differs by 0 or 1 nucleotides from one of the following nucleotide sequences (5′.fwdarw.3′): TABLE-US-00094 (SEQ ID NO: 2) usAfscsUfgAfuCfaAfaUfaUfgUfuGfaGfsc; (SEQ ID NO: 4) usAfscUfgAfuCfaAfaUfaUfgUfuGfasGfsc; (SEQ ID NO: 5) usAfscsUfgAfuCfaAfaUfaUfgUfuGfaGfsu; (SEQ ID NO: 7) usUfsusGfaAfuUfaAfuGfuCfcAfuGfggsc; (SEQ ID NO: 9) usUfsusGfaAfuUfaAfuGfuCfcAfuGfgGfsu; (SEQ ID NO: 11) usGfsusugaauuaaUfgUfcCfaUfgGfsa; (SEQ ID NO: 13) usGfsusUfgAfaUfuAfaUfgUfcCfaUfgGfsa; or (SEQ ID NO: 14) asCfsasUfcGfucuaaCfaUfaGfcAfaCfsc; wherein a, c, g, and u represent 2′-O-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2′-fluoro adenosine, cytidine, guanosine, or uridine, respectively; s represents a phosphorothioate linkage; and wherein all or substantially all of the nucleotides on the sense strand are modified nucleotides.
30. The RNAi agent of claim 32, wherein the sense strand comprises, consists of, or consists essentially of a modified nucleotide sequence that differs by 0 or 1 nucleotides from one of the following nucleotide sequences (5′.fwdarw.3′): TABLE-US-00095 (SEQ ID NO: 16) gcucaacaUfAfUfuugaucagua; (SEQ ID NO: 18) gcucaacaUfa_2NUfuugaucagua; (SEQ ID NO: 20) gcucaaca_2NUfa_2NUfuugaucagua; (SEQ ID NO: 22) gcUfcAfaCfaUfAfUfuugaucagua; (SEQ ID NO: 23) acucaacaUfAfUfuugaucagua; (SEQ ID NO: 25) gcccauggAfCfAfuuaauucaaa; (SEQ ID NO: 27) acccauggAfCfAfuuaauucaaa; (SEQ ID NO: 29) uccauggaCfAfUfuaauucaaca; or (SEQ ID NO: 31) gguugcuaUfGfUfuagacgaugu; wherein a, c, g, and u represent 2′-O-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2′-fluoro adenosine, cytidine, guanosine, or uridine, respectively; s represents a phosphorothioate linkage; a_2N represents a 2′-O-methyl-2-aminoadenosine; and wherein all or substantially all of the nucleotides on the sense strand are modified nucleotides.
31. The RNAi agent of claim 29, wherein the sense strand further includes inverted abasic residues at the 3′ terminal end of the nucleotide sequence, at the 5′ end of the nucleotide sequence, or at both.
32. The RNAi agent of any one of claim 25, wherein the sense strand of the RNAi agent is linked to a targeting ligand.
33. The RNAi agent of claim 32, wherein the targeting ligand has affinity for the asialoglycoprotein receptor.
34. The RNAi agent of claim 33, wherein the targeting ligand comprises N-acetyl-galactosamine.
35. The RNAi agent of claim 1, wherein the RNAi agent has the duplex structure selected from the group consisting of: AD05488 (SEQ ID NOs: 2 and 300) and AD05775 (SEQ ID NOs: 2 and 334); AD05791 (SEQ ID NOs: 4 and 300); AD05777 (SEQ ID NOs: 2 and 336); AD05743 (SEQ ID NOs: 2 and 326); AD05487 (SEQ ID NOs: 5 and 299); AD05307 (SEQ ID NOs: 7 and 278); AD05418 (SEQ ID NOs: 9 and 292); AD05577 (SEQ ID NOs: 11 and 279); AD05308 (SEQ ID NOs: 13 and 279); and AD05840 (SEQ ID NOs: 15 and 357).
36. The RNAi agent of claim 35, wherein the RNAi agent has the duplex structure selected from the group consisting of: AD05488 (SEQ ID NOs: 2 and 300) and AD05775 (SEQ ID NOs: 2 and 334).
37. A composition comprising the RNAi agent of claim 1, wherein the composition comprises a pharmaceutically acceptable excipient.
38. The composition of claim 37, further comprising a second RNAi agent for inhibiting the expression of ANGPTL3.
39. The composition of claim 37, further comprising one or more additional therapeutics.
40. A method for inhibiting expression of an ANGPTL3 gene in a cell, the method comprising introducing into a cell an effective amount of an RNAi agent of claim 1.
41. The method of claim 40, wherein the cell is within a subject.
42. The method of claim 41, wherein the subject is a human subject.
43. The method of claim 40, wherein the ANGPTL3 gene expression is inhibited by at least about 30%.
44. A method of treating an ANGPTL3-related disease or disorder, the method comprising administering to a human subject in need thereof a therapeutically effective amount of the composition of claim 37.
45. The method of claim 44, wherein the disease is a cardiometabolic disease.
46. The method of claim 44, wherein disease is hypertriglyceridemia, obesity, hyperlipidemia, abnormal lipid and/or cholesterol metabolism, atherosclerosis, type II diabetes mellitus, cardiovascular disease, coronary artery disease, non-alcoholic steatohepatitis, non-alcoholic fatty liver disease, homozygous and heterozygous familial hypercholesterolemia, or statin resistant hypercholesterolemia.
47. The method of claim 44, wherein the RNAi agent is administered at a dose of about 0.05 mg/kg to about 5.0 mg/kg of body weight of the human subject.
48. The method of claim 44, wherein the RNAi agent is administered in two or more doses.
49. A method of lowering triglyceride levels in a subject, the method comprising administering to the subject an effective amount of a composition of claim 37.
50. A method of lowering cholesterol levels in a subject, the method comprising administering to the subject an effective amount of a composition of claim 37.
51. A method of lowering low density lipoprotein (LDL) levels in a subject, the method comprising administering to the subject an effective amount of a composition of claim 37.
52. The method of claim 44, wherein the method further comprises administration of a statin.
53. The method of claim 52, wherein the statin is selected from the group consisting of: atorvastatin, fluvastatin, pravastatin, pitavastatin, rosuvastatin, and simvastatin.
54. A method for inhibiting expression of an ANGPTL3 gene in a cell, the method comprising introducing into a cell an effective amount of the composition of claim 37.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0118]
[0119]
[0120]
[0121]
[0122]
[0124]
[0125]
[0126]
[0127]
[0128]
[0129]
[0130]
[0131]
[0132]
[0133]
DETAILED DESCRIPTION
[0134] RNAi Agents
[0135] Described herein are RNAi agents for inhibiting expression of an ANGPTL3 gene (referred to herein as ANGPTL3 RNAi agents or ANGPTL3 RNAi triggers). Each ANGPTL3 RNAi agent comprises a sense strand and an antisense strand. The sense strand and the antisense strand each can be 16 to 30 nucleotides in length. The sense and antisense strands can be either the same length or they can be different lengths. In some embodiments, the sense and antisense strands are each independently 17 to 27 nucleotides in length. In some embodiments, the sense and antisense strands are each independently 17-21 nucleotides in length. In some embodiments, both the sense and antisense strands are each 21-26 nucleotides in length. In some embodiments, the sense and antisense strands are each 21-24 nucleotides in length. In some embodiments, the sense strand is about 19 nucleotides in length while the antisense strand is about 21 nucleotides in length. In some embodiments, the sense strand is about 21 nucleotides in length while the antisense strand is about 23 nucleotides in length. In some embodiments, a sense strand is 23 nucleotides in length and an antisense strand is 21 nucleotides in length. In some embodiments, both the sense and antisense strands are each 21 nucleotides in length. In some embodiments, the RNAi agent sense and antisense strands are each independently 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, or 27 nucleotides in length. In some embodiments, a double-stranded RNAi agent has a duplex length of about 16, 17, 18, 19, 20, 21, 22, 23 or 24 nucleotides.
[0136] In some embodiments, the region of perfect, substantial, or partial complementarity between the sense strand and the antisense strand is 16-26 (e.g., 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26) nucleotides in length and occurs at or near the 5′ end of the antisense strand (e.g., this region may be separated from the 5′ end of the antisense strand by 0, 1, 2, 3, or 4 nucleotides that are not perfectly, substantially, or partially complementary).
[0137] The sense strand and antisense strand each contain a core stretch (also referred to herein as a “core sequence” or a “core stretch sequence”) that is 16 to 23 nucleotides in length. An antisense strand core stretch is 100% (perfectly) complementary or at least about 85% (substantially) complementary to a nucleotide sequence (sometimes referred to, e.g., as a target sequence) present in the ANGPTL3 mRNA target. A sense strand core stretch sequence is 100% (perfectly) complementary or at least about 85% (substantially) complementary to a core stretch sequence in the antisense strand, and thus the sense strand core stretch sequence is typically perfectly identical or at least about 85% identical to a nucleotide sequence (target sequence) present in the ANGPTL3 mRNA target. A sense strand core stretch sequence can be the same length as a corresponding antisense core sequence or it can be a different length. In some embodiments, the antisense strand core stretch sequence is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length. In some embodiments, the sense strand core stretch sequence is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length.
[0138] Examples of nucleotide sequences used in forming ANGPTL3 RNAi agents are provided in Tables 2, 3, and 4. Examples of RNAi agent duplexes, that include the sense strand and antisense strand sequences in Tables 2, 3, and 4, are shown in Table 5.
[0139] The ANGPTL3 RNAi agent sense and antisense strands anneal to form a duplex. A sense strand and an antisense strand of an ANGPTL3 RNAi agent can be partially, substantially, or fully complementary to each other. Within the complementary duplex region, the sense strand core stretch sequence is at least 85% complementary or 100% complementary to the antisense core stretch sequence. In some embodiments, the sense strand core stretch sequence contains a sequence of at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 nucleotides that is at least 85% or 100% complementary to a corresponding 16, 17, 18, 19, 20, 21, 22, or 23 nucleotide sequence of the antisense strand core stretch sequence (i.e., the sense and antisense core stretch sequences of an ANGPTL3 RNAi agent have a region of at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 nucleotides that is at least 85% base paired or 100% base paired.)
[0140] In some embodiments, the antisense strand of an ANGPTL3 RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the antisense strand sequences in Table 2 or Table 3. In some embodiments, the sense strand of an ANGPTL3 RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the sense strand sequences in Table 2 or Table 4.
[0141] The sense strand and/or the antisense strand can optionally and independently contain an additional 1, 2, 3, 4, 5, or 6 nucleotides (extension) at the 3′ end, the 5′ end, or both the 3′ and 5′ ends of the core stretch sequences. The antisense strand additional nucleotides, if present, may or may not be complementary to the corresponding sequence in the ANGPTL3 mRNA.
[0142] The sense strand additional nucleotides, if present, may or may not be identical to the corresponding sequence in the ANGPTL3 mRNA. The antisense strand additional nucleotides, if present, may or may not be complementary to the corresponding, sense strand's additional nucleotides, if present.
[0143] As used herein, an extension comprises 1, 2, 3, 4, 5, or 6 nucleotides at the 5′ and/or 3′ end of the sense strand core stretch sequence and/or antisense strand core stretch sequence. The extension nucleotides on a sense strand may or may not be complementary to nucleotides, either core stretch sequence nucleotides or extension nucleotides, in the corresponding antisense strand. Conversely, the extension nucleotides on an antisense strand may or may not be complementary to nucleotides, either core stretch nucleotides or extension nucleotides, in the corresponding sense strand. In some embodiments, both the sense strand and the antisense strand of an RNAi agent contain 3′ and 5′ extensions. In some embodiments, one or more of the 3′ extension nucleotides of one strand base pairs with one or more 5′ extension nucleotides of the other strand. In other embodiments, one or more of 3′ extension nucleotides of one strand do not base pair with one or more 5′ extension nucleotides of the other strand. In some embodiments, an ANGPTL3 RNAi agent has an antisense strand having a 3′ extension and a sense strand having a 5′ extension. In some embodiments, the extension nucleotide(s) are unpaired and form an overhang. As used herein, an “overhang” refers to a stretch of one or more unpaired nucleotides located at a terminal end of either the sense strand or the antisense strand that does not form part of the hybridized or duplexed portion of an RNAi agent disclosed herein.
[0144] In some embodiments, an ANGPTL3 RNAi agent comprises an antisense strand having a 3′ extension of 1, 2, 3, 4, 5, or 6 nucleotides in length. In other embodiments, an ANGPTL3 RNAi agent comprises an antisense strand having a 3′ extension of 1, 2, or 3 nucleotides in length. In some embodiments, one or more of the antisense strand extension nucleotides comprise uracil or thymidine nucleotides or nucleotides that are complementary to the corresponding ANGPTL3 mRNA sequence.
[0145] In some embodiments, the 3′ end of the antisense strand can include abasic residues (Ab), which can also be referred to as an “abasic site” or “abasic nucleotide.” An abasic residue (Ab) is a nucleotide or nucleoside that lacks a nucleobase at the 1′ position of the sugar moiety. (See, e.g., U.S. Pat. No. 5,998,203). In some embodiments, Ab or AbAb can be added to the 3′ end of the antisense strand.
[0146] In some embodiments, the sense strand or the antisense strand may include a “terminal cap,” which as used herein is a non-nucleotide compound or other moiety that can be incorporated at one or more termini of a strand of an RNAi agent disclosed herein, and can provide the RNAi agent, in some instances, with certain beneficial properties, such as, for example, protection against exonuclease degradation. In some embodiments, inverted abasic residues (invAb) are added as terminal caps (see Table 6). (See, e.g., F. Czauderna, Nucleic Acids Res., 2003, 31(11), 2705-16). Terminal caps are generally known in the art, and include, for example, inverted abasic residues as well as carbon chains such as a terminal C3, C6, or C12 groups. In some embodiments, a terminal cap is present at either the 5′ terminal end, the 3′ terminal end, or both the 5′ and 3′ terminal ends of the sense strand.
[0147] In some embodiments, an ANGPTL3 RNAi agent comprises a sense strand having a 3′ extension of 1, 2, 3, 4, or 5 nucleotides in length. In some embodiments, one or more of the sense strand extension nucleotides comprises adenosine, uracil, or thymidine nucleotides, AT dinucleotide, or nucleotides that correspond to nucleotides in the ANGPTL3 mRNA sequence. In some embodiments, the 3′ sense strand extension includes or consists of one of the following sequences, but is not limited to: T, UT, TT, UU, UUT, TTT, or TTTT (each listed 5′ to 3′).
[0148] In some embodiments, the 3′ end of the sense strand may include additional abasic residues or inverted abasic terminal caps. In some embodiments, UUAb, UAb, or Ab are added to the 3′ end of the sense strand.
[0149] In some embodiments, one or more inverted abasic residues (invAb) are added to the 3′ end of the sense strand. In some embodiments, one or more inverted abasic residues (invAb) are added to the 5′ end of the sense strand. In some embodiments, one or more inverted abasic residues or inverted abasic sites are inserted between the targeting ligand and the nucleobase sequence of the sense strand of the RNAi agent. In some embodiments, the inclusion of one or more inverted abasic residues or inverted abasic sites at or near the terminal end or terminal ends of the sense strand of an RNAi agent allows for enhanced activity or other desired properties of an RNAi agent.
[0150] In some embodiments, an ANGPTL3 RNAi agent comprises a sense strand having a 5′ extension of 1, 2, 3, 4, 5, or 6 nucleotides in length. In some embodiments, one or more of the sense strand extension nucleotides comprise uracil or adenosine nucleotides or nucleotides that correspond to nucleotides in the ANGPTL3 mRNA sequence. In some embodiments, the sense strand 5′ extension is one of the following sequences, but is not limited to: CA, AUAGGC, AUAGG, AUAG, AUA, A, AA, AC, GCA, GGCA, GGC, UAUCA, UAUC, UCA, UAU, U, UU (each listed 5′ to 3′). A sense strand can have a 3′ extension and/or a 5′ extension.
[0151] In some embodiments, the 5′ end of the sense strand can include one or more additional abasic residues (e.g., (Ab) or (AbAb)). In some embodiments, one or more inverted abasic residues (invAb) are added to the 5′ end of the sense strand. In some embodiments, one or more inverted abasic residues can be inserted between the targeting ligand and the nucleobase sequence of the sense strand of the RNAi agent. In some embodiments, the inclusion of one or more inverted abasic residues at or near the terminal end or terminal ends of the sense strand of an RNAi agent may allow for enhanced activity or other desired properties of an RNAi agent. In some embodiments, an abasic (deoxyribose) residue can be replaced with a ribitol (abasic ribose) residue.
[0152] In some embodiments, the 3′ end of the antisense strand core stretch sequence, or the 3′ end of the antisense strand sequence, may include an inverted abasic residue (invAb (see Table 6)).
[0153] Examples of sequences used in forming ANGPTL3 RNAi agents are provided in Tables 2, 3, and 4. In some embodiments, an ANGPTL3 RNAi agent antisense strand includes a sequence of any of the sequences in Tables 2 or 3. In certain embodiments, an ANGPTL3 RNAi agent antisense strand comprises or consists of any one of the modified sequences in Table 3. In some embodiments, an ANGPTL3 RNAi agent antisense strand includes the sequence of nucleotides (from 5′ end .fwdarw.3′ end) 1-17, 2-15, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, 2-21, 1-22, 2-22, 1-23, 2-23, 1-24, or 2-24 of any of the sequences in Tables 2 or 3. In some embodiments, an ANGPTL3 RNAi agent sense strand includes the sequence of any of the sequences in Tables 2 or 4. In some embodiments, an ANGPTL3 RNAi agent sense strand includes the sequence of nucleotides (from 5′ end .fwdarw.3′ end) 1-18, 1-19, 1-20, 1-21, 1-22, 1-23, 1-24, 1-25, 1-26, 2-19, 2-20, 2-21, 2-22, 2-23, 2-24, 3-20, 3-21, 3-22, 3-23, 3-24, 4-21, 4-22, 4-23, 4-24, 5-22, 5-23, or 5-24 of any of the sequences in Tables 2 or 4. In certain embodiments, an ANGPTL3 RNAi agent sense strand comprises or consists of a modified sequence of any one of the modified sequences in Table 4.
[0154] In some embodiments, the sense and antisense strands of the RNAi agents described herein contain the same number of nucleotides. In some embodiments, the sense and antisense strands of the RNAi agents described herein contain different numbers of nucleotides. In some embodiments, the sense strand 5′ end and the antisense strand 3′ end of an RNAi agent form a blunt end. In some embodiments, the sense strand 3′ end and the antisense strand 5′ end of an RNAi agent form a blunt end. In some embodiments, both ends of an RNAi agent form blunt ends. In some embodiments, neither end of an RNAi agent is blunt-ended. As used herein a “blunt end” refers to an end of a double stranded RNAi agent in which the terminal nucleotides of the two annealed strands are complementary (form a complementary base-pair).
[0155] In some embodiments, the sense strand 5′ end and the antisense strand 3′ end of an RNAi agent form a frayed end. In some embodiments, the sense strand 3′ end and the antisense strand 5′ end of an RNAi agent form a frayed end. In some embodiments, both ends of an RNAi agent form a frayed end. In some embodiments, neither end of an RNAi agent is a frayed end. As used herein a frayed end refers to an end of a double stranded RNAi agent in which the terminal nucleotides of the two annealed strands from a pair (i.e., do not form an overhang) but are not complementary (i.e. form a non-complementary pair). In some embodiments, one or more unpaired nucleotides at the end of one strand of a double stranded RNAi agent form an overhang. The unpaired nucleotides may be on the sense strand or the antisense strand, creating either 3′ or 5′ overhangs. In some embodiments, the RNAi agent contains: a blunt end and a frayed end, a blunt end and 5′ overhang end, a blunt end and a 3′ overhang end, a frayed end and a 5′ overhang end, a frayed end and a 3′ overhang end, two 5′ overhang ends, two 3′ overhang ends, a 5′ overhang end and a 3′ overhang end, two frayed ends, or two blunt ends. Typically, when present, overhangs are located at the 3′ terminal ends of the sense strand, the antisense strand, or both the sense strand and the antisense strand.
[0156] Modified nucleotides, when used in various polynucleotide or oligonucleotide constructs, can preserve activity of the compound in cells while at the same time increasing the serum stability of these compounds, and can also minimize the possibility of activating interferon activity in humans upon administering of the polynucleotide or oligonucleotide construct.
[0157] In some embodiments, an ANGPTL3 RNAi agent is prepared or provided as a salt, mixed salt, or a free-acid. In some embodiments, an ANGPTL3 RNAi agent is prepared as a sodium salt. Such forms that are well known in the art are within the scope of the inventions disclosed herein.
[0158] Modified Nucleotides
[0159] In some embodiments, an ANGPTL3 RNAi agent contains one or more modified nucleotides. As used herein, a “modified nucleotide” is a nucleotide other than a ribonucleotide (2′-hydroxyl nucleotide). In some embodiments, at least 50% (e.g., at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100%) of the nucleotides are modified nucleotides. As used herein, modified nucleotides can include, but are not limited to, deoxyribonucleotides, nucleotide mimics, abasic nucleotides (represented herein as Ab), 2′-modified nucleotides, 3′ to 3′ linkages (inverted) nucleotides (represented herein as invdN, invN, invn), modified nucleobase-comprising nucleotides, bridged nucleotides, peptide nucleic acids (PNAs), 2′,3′-seco nucleotide mimics (unlocked nucleobase analogues, represented herein as N.sub.UNA or NUNA), locked nucleotides (represented herein as N.sub.LNA or NLNA), 3′-O-methoxy (2′ internucleoside linked) nucleotides (represented herein as 3′-OMen), 2′-F-Arabino nucleotides (represented herein as NfANA or Nf.sub.ANA), 5′-Me, 2′-fluoro nucleotide (represented herein as 5Me-Nf), morpholino nucleotides, vinyl phosphonate deoxyribonucleotides (represented herein as vpdN), vinyl phosphonate containing nucleotides, and cyclopropyl phosphonate containing nucleotides (cPrpN). 2′-modified nucleotides (i.e., a nucleotide with a group other than a hydroxyl group at the 2′ position of the five-membered sugar ring) include, but are not limited to, 2′-O-methyl nucleotides (represented herein as a lower case letter ‘n’ in a nucleotide sequence), 2′-deoxy-2′-fluoro nucleotides (also referred to herein as 2′-fluoro nucleotide, and represented herein as NO, 2′-deoxy nucleotides (represented herein as dN), 2′-methoxyethyl (2′-O-2-methoxylethyl) nucleotides (also referred to herein as 2′-MOE, and represented herein as NM), 2′-amino nucleotides, and 2′-alkyl nucleotides. It is not necessary for all positions in a given compound to be uniformly modified. Conversely, more than one modification can be incorporated in a single ANGPTL3 RNAi agent or even in a single nucleotide thereof. The ANGPTL3 RNAi agent sense strands and antisense strands can be synthesized and/or modified by methods known in the art. Modification at one nucleotide is independent of modification at another nucleotide.
[0160] Modified nucleobases include synthetic and natural nucleobases, such as 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6 substituted purines, (e.g., 2-aminopropyladenine, 5-propynyluracil, or 5-propynylcytosine), 5-methylcytosine (5-me-C), 5-hydroxy methyl cytosine, inosine, xanthine, hypoxanthine, 2-aminoadenine, 6-alkyl (e.g., 6-methyl, 6-ethyl, 6-isopropyl, or 6-n-butyl) derivatives of adenine and guanine, 2-alkyl (e.g., 2-methyl, 2-ethyl, 2-isopropyl, or 2-n-butyl) and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine, 2-thiocytosine, 5-halouracil, cytosine, 5-propynyl uracil, 5-propynyl cytosine, 6-azo uracil, 6-azo cytosine, 6-azo thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-sulfhydryl, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo (e.g., 5-bromo), 5-trifluoromethyl, and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, and 3-deazaadenine.
[0161] In some embodiments, all or substantially all of the nucleotides of an RNAi agent are modified nucleotides. As used herein, an RNAi agent wherein substantially all of the nucleotides present are modified nucleotides is an RNAi agent having four or fewer (i.e., 0, 1, 2, 3, or 4) nucleotides in both the sense strand and the antisense strand being ribonucleotides (i.e., unmodified). As used herein, a sense strand wherein substantially all of the nucleotides present are modified nucleotides is a sense strand having two or fewer (i.e., 0, 1, or 2) nucleotides in the sense strand being unmodified ribonucleotides. As used herein, an antisense sense strand wherein substantially all of the nucleotides present are modified nucleotides is an antisense strand having two or fewer (i.e., 0, 1, or 2) nucleotides in the sense strand being unmodified ribonucleotides. In some embodiments, one or more nucleotides of an RNAi agent is an unmodified ribonucleotide.
[0162] Modified Internucleoside Linkages
[0163] In some embodiments, one or more nucleotides of an ANGPTL3 RNAi agent are linked by non-standard linkages or backbones (i.e., modified internucleoside linkages or modified backbones). Modified internucleoside linkages or backbones include, but are not limited to, phosphorothioate groups (represented herein as a lower case “s”), chiral phosphorothioates, thiophosphates, phosphorodithioates, phosphotriesters, aminoalkyl-phosphotriesters, alkyl phosphonates (e.g., methyl phosphonates or 3′-alkylene phosphonates), chiral phosphonates, phosphinates, phosphoramidates (e.g., 3′-amino phosphoramidate, aminoalkylphosphoramidates, or thionophosphoramidates), thionoalkyl-phosphonates, thionoalkylphosphotriesters, morpholino linkages, boranophosphates having normal 3′-5′ linkages, 2′-5′ linked analogs of boranophosphates, or boranophosphates having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3′-5′ to 5′-3′ or 2′-5′ to 5′-2′. In some embodiments, a modified internucleoside linkage or backbone lacks a phosphorus atom. Modified internucleoside linkages lacking a phosphorus atom include, but are not limited to, short chain alkyl or cycloalkyl inter-sugar linkages, mixed heteroatom and alkyl or cycloalkyl inter-sugar linkages, or one or more short chain heteroatomic or heterocyclic inter-sugar linkages. In some embodiments, modified internucleoside backbones include, but are not limited to, siloxane backbones, sulfide backbones, sulfoxide backbones, sulfone backbones, formacetyl and thioformacetyl backbones, methylene formacetyl and thioformacetyl backbones, alkene-containing backbones, sulfamate backbones, methyleneimino and methylenehydrazino backbones, sulfonate and sulfonamide backbones, amide backbones, and other backbones having mixed N, O, S, and CH2 components.
[0164] In some embodiments, a sense strand of an ANGPTL3 RNAi agent can contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages, an antisense strand of an ANGPTL3 RNAi agent can contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages, or both the sense strand and the antisense strand independently can contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages. In some embodiments, a sense strand of an ANGPTL3 RNAi agent can contain 1, 2, 3, or 4 phosphorothioate linkages, an antisense strand of an ANGPTL3 RNAi agent can contain 1, 2, 3, or 4 phosphorothioate linkages, or both the sense strand and the antisense strand independently can contain 1, 2, 3, or 4 phosphorothioate linkages.
[0165] In some embodiments, an ANGPTL3 RNAi agent sense strand contains at least two phosphorothioate internucleoside linkages. In some embodiments, the at least two phosphorothioate internucleoside linkages are between the nucleotides at positions 1-3 from the 3′ end of the sense strand. In some embodiments, one phosphorothioate internucleoside linkage is at the 5′ end of the sense strand, and another phosphorothioate linkage is at the 3′ end of the sense strand. In some embodiments, two phosphorothioate internucleoside linkage are located at the 5′ end of the sense strand, and another phosphorothioate linkage is at the 3′ end of the sense strand. In some embodiments, the sense strand dose not include any phosphorothioate internucleoside linkages between the nucleotides, but contains one, two, or three phosphorothioate linkages between the terminal nucleotides on both the 5′ and 3′ ends and the optionally present inverted abasic residue terminal caps. In some embodiments, the targeting ligand is linked to the sense strand via a phosphorothioate linkage.
[0166] In some embodiments, an ANGPTL3 RNAi agent antisense strand contains four phosphorothioate internucleoside linkages. In some embodiments, the four phosphorothioate internucleoside linkages are between the nucleotides at positions 1-3 from the 5′ end of the antisense strand and between the nucleotides at positions 19-21, 20-22, 21-23, 22-24, 23-25, or 24-26 from the 5′ end. In some embodiments, three phosphorothioate internucleoside linkages are located between positions 1-4 from the 5′ end of the antisense strand, and a fourth phosphorothioate internucleoside linkage is located between positions 20-21 from the 5′ end of the antisense strand. In some embodiments, an ANGPTL3 RNAi agent contains at least three or four phosphorothioate internucleoside linkages in the antisense strand.
[0167] In some embodiments, an ANGPTL3 RNAi agent contains one or more modified nucleotides and one or more modified internucleoside linkages. In some embodiments, a 2′-modified nucleoside is combined with modified internucleoside linkage.
[0168] ANGPTL3 RNAi Agents
[0169] In some embodiments, the ANGPTL3 RNAi agents disclosed herein target an ANGPTL3 gene at or near the positions of the ANGPTL3 gene sequence shown in Table 1. In some embodiments, the antisense strand of an ANGPTL3 RNAi agent disclosed herein includes a core stretch sequence that is fully, substantially, or at least partially complementary to a target ANGPTL3 19-mer sequence disclosed in Table 1.
TABLE-US-00015 TABLE 1 ANGPTL3 19-mer mRNA Target Sequences (taken from homo sapiens angiopoietin like 3 (ANGPTL3) transcript, GenBank NM_014495.3 (SEQ ID NO: 1)) ANGPTL3 19-mer Corresponding SEQ ID Target Sequences Positions on No. (5′ .fwdarw. 3′) SEQ ID NO: 1 33 UCAACAUAUUUGAUCAGUC 304-322 34 CAUGGACAUUAAUUCAACA 922-940 35 CCAUGGACAUUAAUUCAAC 921-939 36 UUGCUAUGUUAGACGAUGU 190-208 37 AAGAUAUACUCCAUAGUGA 1035-1053 38 CAGAGCCAAAAUCAAGAUU 172-190 39 GACAUGGUCUUAAAGACUU 241-259 40 AGCACCAAGAACUACUCCC 743-761 41 GCACCAAGAACUACUCCCU 744-762 42 GAUGGAGAAUUUUGGUUGG 1008-1026 43 AUGGAGAAUUUUGGUUGGG 1009-1027 44 ACUCCAUAGUGAAGCAAUC 1042-1060 45 CACGAAACCAACUAUACGC 1140-1158 46 CUACUUGGGAUCACAAAGC 1225-1243 47 CUUGGGAUCACAAAGCAAA 1228-1246 48 UGUGGAGAAAACAACCUAA 1302-1320 49 UGGAGAAAACAACCUAAAU 1304-1322
[0170] In some embodiments, an ANGPTL3 RNAi agent includes an antisense strand wherein position 19 of the antisense strand (5′.fwdarw.3′) is capable of forming a base pair with position 1 of a 19-mer target sequence disclosed in Table 1. In some embodiments, an ANGPTL3 RNAi agent includes an antisense strand wherein position 1 of the antisense strand (5′.fwdarw.3′) is capable of forming a base pair with position 19 of the 19-mer target sequence disclosed in Table 1.
[0171] In some embodiments, an ANGPTL3 RNAi agent includes an antisense strand wherein position 2 of the antisense strand (5′.fwdarw.3′) is capable of forming a base pair with position 18 of the 19-mer target sequence disclosed in Table 1. In some embodiments, an ANGPTL3 RNAi agent includes an antisense strand wherein positions 2 through 18 of the antisense strand (5′.fwdarw.3′) are capable of forming base pairs with each of the respective complementary bases located at positions 18 through 2 of the 19-mer target sequence disclosed in Table 1.
[0172] For the RNAi agents disclosed herein, the nucleotide at position 1 of the antisense strand (from 5′ end .fwdarw.3′ end) can be perfectly complementary to the ANGPTL3 gene, or can be non-complementary to the ANGPTL3 gene. In some embodiments, the nucleotide at position 1 of the antisense strand (from 5′ end .fwdarw.3′ end) is a U, A, or dT. In some embodiments, the nucleotide at position 1 of the antisense strand (from 5′ end .fwdarw.3′ end) forms an A:U or U:A base pair with the sense strand.
[0173] In some embodiments, an ANGPTL3 RNAi agent antisense strand comprises the sequence of nucleotides (from 5′ end .fwdarw.3′ end) 2-18 or 2-19 of any of the antisense strand sequences in Table 2 or Table 3. In some embodiments, an ANGPTL3 RNAi sense strand comprises the sequence of nucleotides (from 5′ end .fwdarw.3′ end) 1-17, 1-18, or 2-18 of any of the sense strand sequences in Table 2 or Table 4.
[0174] In some embodiments, an ANGPTL3 RNAi agent is comprised of (i) an antisense strand comprising the sequence of nucleotides (from 5′ end .fwdarw.3′ end) 2-18 or 2-19 of any of the antisense strand sequences in Table 2 or Table 3, and (ii) a sense strand comprising the sequence of nucleotides (from 5′ end .fwdarw.3′ end) 1-17 or 1-18 of any of the sense strand sequences in Table 2 or Table 4.
[0175] In some embodiments, the ANGPTL3 RNAi agents include core 19-mer nucleotide sequences shown in the following Table 2.
TABLE-US-00016 TABLE 2 ANGPTL3 RNAi Agent Antisense Strand and Sense Strand Core Stretch Base Sequences (N = any nucleobase) Antisense Sense Strand Base Strand Sequence Base (5′ .fwdarw. 3′) Sequence Corre- (Shown (5′ .fwdarw. 3′) sponding as an (Shown as an Positions SEQ Unmodified SEQ Unmodified on ID Nucleotide ID Nucleotide SEQ ID No. Sequence) No. Sequence) NO: 1 50 UACUGAUCAA 130 UCAACAUAUU 304-322 AUAUGUUGA UGAUCAGUA 50 UACUGAUCAA 131 UCAACAU(A.sup.2N) 304-322 AUAUGUUGA UUUGAUCAGUA 50 UACUGAUCAA 132 UCAAC(A.sup.2N) 304-322 AUAUGUUGA U(A.sup.2N)UUUG AUCAGUA 51 AACUGAUCAA 133 UCAACAUAUU 304-322 AUAUGUUGA UGAUCAGUU 51 AACUGAUCAA 134 UCAACAU(A.sup.2N) 304-322 AUAUGUUGA UUUGAUCAGUU 51 AACUGAUCAA 135 UCAAC(A.sup.2N) 304-322 AUAUGUUGA U(A.sup.2N)UUUG AUCAGUU 52 GACUGAUCAA 136 UCAACAUAUU 304-322 AUAUGUUGA UGAUCAGUC 52 GACUGAUCAA 137 UCAACAU(A.sup.2N) 304-322 AUAUGUUGA UUUGAUCAGUC 52 GACUGAUCAA 138 UCAAC(A.sup.2N) 304-322 AUAUGUUGA U(A.sup.2N)UUUGA UCAGUC 53 NACUGAUCAA 139 UCAACAUAUUU 304-322 AUAUGUUGA GAUCAGUN 53 NACUGAUCAA 140 UCAACAU(A.sup.2N) 304-322 AUAUGUUGA UUUGAUCAGUN 53 NACUGAUCAA 141 UCAAC(A.sup.2N) 304-322 AUAUGUUGA U(A.sup.2N)UUUGA UCAGUN 54 NACUGAUCAA 142 NCAACAUAUUU 304-322 AUAUGUUGN GAUCAGUN 54 NACUGAUCAA 143 NCAACAU(A.sup.2N) 304-322 AUAUGUUGN UUUGAUCAGUN 54 NACUGAUCAA 144 NCAAC(A.sup.2N) 304-322 AUAUGUUGN U(A.sup.2N)UUUGA UCAGUN 55 UGUUGAAUUA 145 CAUGGACAUU 922-940 AUGUCCAUG AAUUCAACA 56 AGUUGAAUUA 146 CAUGGACAUU 922-940 AUGUCCAUG AAUUCAACU 57 NGUUGAAUUA 147 CAUGGACAUU 922-940 AUGUCCAUG AAUUCAACN 58 NGUUGAAUUA 148 NAUGGACAUU 922-940 AUGUCCAUN AAUUCAACN 59 GUUGAAUUAA 149 CCAUGGACAU 921-939 UGUCCAUGG UAAUUCAAC 60 UUUGAAUUAA 150 CCAUGGACAU 921-939 UGUCCAUGG UAAUUCAAA 61 AUUGAAUUAA 151 CCAUGGACAU 921-939 UGUCCAUGG UAAUUCAAU 62 NUUGAAUUAA 152 CCAUGGACAU 921-939 UGUCCAUGG UAAUUCAAN 63 NUUGAAUUAA 153 NCAUGGACAU 921-939 UGUCCAUGN UAAUUCAAN 64 ACAUCGUCUA 154 UUGCUAUGUU 190-208 ACAUAGCAA AGACGAUGU 65 UCAUCGUCUA 155 UUGCUAUGUU 190-208 ACAUAGCAA AGACGAUGA 66 NCAUCGUCUA 156 UUGCUAUGUU 190-208 ACAUAGCAA AGACGAUGN 67 NCAUCGUCUA 157 NUGCUAUGUU 190-208 ACAUAGCAN AGACGAUGN 68 UCACUAUGGA 158 AAGAUAUACU 1035-1053 GUAUAUCUU CCAUAGUGA 69 ACACUAUGGA 159 AAGAUAUACU 1035-1053 GUAUAUCUU CCAUAGUGU 70 NCACUAUGGA 160 AAGAUAUACU 1035-1053 GUAUAUCUU CCAUAGUGN 71 NCACUAUGGA 161 NAGAUAUACU 1035-1053 GUAUAUCUN CCAUAGUGN 72 AAUCUUGAUU 162 CAGAGCCAAA 172-190 UUGGCUCUG AUCAAGAUU 73 UAUCUUGAUU 163 CAGAGCCAAA 172-190 UUGGCUCUG AUCAAGAUA 74 NAUCUUGAUU 164 CAGAGCCAAA 172-190 UUGGCUCUG AUCAAGAUN 75 NAUCUUGAUU 165 NAGAGCCAAA 172-190 UUGGCUCUN AUCAAGAUN 76 AAGUCUUUAA 166 GACAUGGUCU 241-259 GACCAUGUC UAAAGACUU 77 UAGUCUUUAA 167 GACAUGGUCU 241-259 GACCAUGUC UAAAGACUA 78 NAGUCUUUAA 168 GACAUGGUCU 241-259 GACCAUGUC UAAAGACUN 79 NAGUCUUUAA 169 NACAUGGUCU 241-259 GACCAUGUN UAAAGACUN 80 GGGAGUAGUU 170 AGCACCAAGA 743-761 CUUGGUGCU ACUACUCCC 81 UGGAGUAGUU 171 AGCACCAAGA 743-761 CUUGGUGCU ACUACUCCA 82 AGGAGUAGUU 172 AGCACCAAGA 743-761 CUUGGUGCU ACUACUCCU 83 NGGAGUAGUU 173 AGCACCAAGA 743-761 CUUGGUGCU ACUACUCCN 84 NGGAGUAGUU 174 NGCACCAAGA 743-761 CUUGGUGCN ACUACUCCN 85 AGGGAGUAGU 175 GCACCAAGAA 744-762 UCUUGGUGC CUACUCCCU 86 UGGGAGUAGU 176 GCACCAAGAA 744-762 UCUUGGUGC CUACUCCCA 87 NGGGAGUAGU 177 GCACCAAGAA 744-762 UCUUGGUGC CUACUCCCN 88 NGGGAGUAGU 178 NCACCAAGAA 744-762 UCUUGGUGN CUACUCCCN 89 AGAGAGUAGU 179 GCACCAAGAA 744-762 UCUUGGUGC CUACUCUCU 90 UGAGAGUAGU 180 GCACCAAGAA 744-762 UCUUGGUGC CUACUCUCA 91 NGAGAGUAGU 181 GCACCAAGAA 744-762 UCUUGGUGC CUACUCUCN 92 NGAGAGUAGU 182 NCACCAAGAA 744-762 UCUUGGUGN CUACUCUCN 93 CCAACCAAAA 183 GAUGGAGAAU 1008-1026 UUCUCCAUC UUUGGUUGG 94 UCAACCAAAA 184 GAUGGAGAAU 1008-1026 UUCUCCAUC UUUGGUUGA 95 ACAACCAAAA 185 GAUGGAGAAU 1008-1026 UUCUCCAUC UUUGGUUGU 96 NCAACCAAAA 186 GAUGGAGAAU 1008-1026 UUCUCCAUC UUUGGUUGN 97 NCAACCAAAA 187 NAUGGAGAAU 1008-1026 UUCUCCAUN UUUGGUUGN 98 CCCAACCAAA 188 AUGGAGAAUU 1009-1027 AUUCUCCAU UUGGUUGGG 99 UCCAACCAAA 189 AUGGAGAAUU 1009-1027 AUUCUCCAU UUGGUUGGA 100 ACCAACCAAA 190 AUGGAGAAUU 1009-1027 AUUCUCCAU UUGGUUGGU 101 NCCAACCAAA 191 AUGGAGAAUU 1009-1027 AUUCUCCAU UUGGUUGGN 102 NCCAACCAAA 192 NUGGAGAAUU 1009-1027 AUUCUCCAN UUGGUUGGN 103 UAUUGCUUCA 193 ACUCCAUAGU 1042-1060 CUAUGGAGU GAAGCAAUA 104 AAUUGCUUCA 194 ACUCCAUAGU 1042-1060 CUAUGGAGU GAAGCAAUU 105 GAUUGCUUCA 195 ACUCCAUAGU 1042-1060 CUAUGGAGU GAAGCAAUC 106 NAUUGCUUCA 196 ACUCCAUAGU 1042-1060 CUAUGGAGU GAAGCAAUN 107 NAUUGCUUCA 197 ACUCCAUAGU 1042-1060 CUAUGGAGN GAAGCAAUN 108 UCGUAUAGUU 198 CACGAAACCA 1140-1158 GGUUUCGUG ACUAUACGA 109 ACGUAUAGUU 199 CACGAAACCA 1140-1158 GGUUUCGUG ACUAUACGU 110 GCGUAUAGUU 200 CACGAAACCA 1140-1158 GGUUUCGUG ACUAUACGC 111 NCGUAUAGUU 201 CACGAAACCA 1140-1158 GGUUUCGUG ACUAUACGN 112 NCGUAUAGUU 202 NACGAAACCA 1140-1158 GGUUUCGUN ACUAUACGN 113 UCUUUGUGAU 203 CUACUUGGGA 1225-1243 CCCAAGUAG UCACAAAGA 114 ACUUUGUGAU 204 CUACUUGGGA 1225-1243 CCCAAGUAG UCACAAAGU 115 GCUUUGUGAU 205 CUACUUGGGA 1225-1243 CCCAAGUAG UCACAAAGC 116 NCUUUGUGAU 206 CUACUUGGGA 1225-1243 CCCAAGUAG UCACAAAGN 117 NCUUUGUGAU 207 NUACUUGGGA 1225-1243 CCCAAGUAN UCACAAAGN 118 UUUGCUUUGU 208 CUUGGGAUCA 1228-1246 GAUCCCAAG CAAAGCAAA 119 AUUGCUUUGU 209 CUUGGGAUCA 1228-1246 GAUCCCAAG CAAAGCAAU 120 NUUGCUUUGU 210 CUUGGGAUCA 1228-1246 GAUCCCAAG CAAAGCAAN 121 NUUGCUUUGU 211 NUUGGGAUCA 1228-1246 GAUCCCAAN CAAAGCAAN 122 UUAGGUUGUU 212 UGUGGAGAAA 1302-1320 UUCUCCACA ACAACCUAA 123 AUAGGUUGUU 213 UGUGGAGAAA 1302-1320 UUCUCCACA ACAACCUAU 124 NUAGGUUGUU 214 UGUGGAGAAA 1302-1320 UUCUCCACA ACAACCUAN 125 NUAGGUUGUU 215 NGUGGAGAAA 1302-1320 UUCUCCACN ACAACCUAN 126 AUUUAGGUUG 216 UGGAGAAAAC 1304-1322 UUUUCUCCA AACCUAAAU 127 UUUUAGGUUG 217 UGGAGAAAAC 1304-1322 UUUUCUCCA AACCUAAAA 128 NUUUAGGUUG 218 UGGAGAAAAC 1304-1322 UUUUCUCCA AACCUAAAN 129 NUUUAGGUUG 219 NGGAGAAAAC 1304-1322 UUUUCUCCN AACCUAAAN (A.sup.2N) = 2-aminoadenine nucleotide
[0176] The ANGPTL3 RNAi agent sense strands and antisense strands that comprise or consist of the sequences in Table 2 can be modified nucleotides or unmodified nucleotides. In some embodiments, the ANGPTL3 RNAi agents having the sense and anti sense strand sequences that comprise or consist of the sequences in Table 2 are all or substantially all modified nucleotides.
[0177] In some embodiments, the antisense strand of an ANGPTL3 RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the antisense strand sequences in Table 2. In some embodiments, the sense strand of an ANGPTL3 RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the sense strand sequences in Table 2.
[0178] As used herein, each N listed in a sequence disclosed in Table 2 may be independently selected from any and all nucleobases (including those found on both modified and unmodified nucleotides). In some embodiments, an N nucleotide listed in a sequence disclosed in Table 2 has a nucleobase that is complementary to the N nucleotide at the corresponding position on the other strand. In some embodiments, an N nucleotide listed in a sequence disclosed in Table 2 has a nucleobase that is not complementary to the N nucleotide at the corresponding position on the other strand. In some embodiments, an N nucleotide listed in a sequence disclosed in Table 2 has a nucleobase that is the same as the N nucleotide at the corresponding position on the other strand. In some embodiments, an N nucleotide listed in a sequence disclosed in Table 2 has a nucleobase that is different from the N nucleotide at the corresponding position on the other strand.
[0179] Certain modified ANGPTL3 RNAi agent antisense strands, as well as their underlying unmodified nucleobase sequences, are provided in Table 3. Certain modified ANGPTL3 RNAi agent sense strands, as well as their underlying unmodified nucleobase sequences, are provided in Table 4. In forming ANGPTL3 RNAi agents, each of the nucleotides in each of the underlying base sequences listed in Tables 3 and 4, as well as in Table 2, above, can be a modified nucleotide.
[0180] The ANGPTL3 RNAi agents described herein are formed by annealing an antisense strand with a sense strand. A sense strand containing a sequence listed in Table 2 or Table 4, can be hybridized to any antisense strand containing a sequence listed in Table 2 or Table 3, provided the two sequences have a region of at least 85% complementarity over a contiguous 16, 17, 18, 19, 20, or 21 nucleotide sequence.
[0181] In some embodiments, an ANGPTL3 RNAi agent antisense strand comprises a nucleotide sequence of any of the sequences in Table 2 or Table 3.
[0182] In some embodiments, an ANGPTL3 RNAi agent comprises or consists of a duplex having the nucleobase sequences of the sense strand and the antisense strand of any of the sequences in Table 2, Table 3 or Table 4.
[0183] Examples of antisense strands containing modified nucleotides are provided in Table 3. Examples of sense strands containing modified nucleotides are provided in Table 4.
[0184] As used in Tables 3 and 4, the following notations are used to indicate modified nucleotides, targeting groups, and linking groups:
TABLE-US-00017 A = adenosine-3′-phosphate; C = cytidine-3′-phosphate; G = guanosine-3′-phosphate; U = uridine-3′-phosphate I = inosine-3′-phosphate n = any 2′-OMe modified nucleotide a = 2′-O-methyladenosine-3′-phosphate as = 2′-O-methyladenosine-3′-phosphorothioate c = 2′-O-methylcytidine-3′-phosphate cs = 2′-O-methylcytidine-3′-phosphorothioate g = 2′-O-methylguanosine-3′-phosphate gs = 2′-O-methylguanosine-3′-phosphorothioate t = 2′-O-methyl-5-methyluridine-3′-phosphate ts = 2′-O-methyl-5-methyluridine-3′-phosphorothioate u = 2′-O-methyluridine-3′-phosphate us = 2′-O-methyluridine-3′-phosphorothioate i = 2′-O-methylinosine-3′-phosphate is = 2′-O-methylinosine-3′-phosphorothioate Nf = any 2′-fluoro modified nucleotide Af = 2′-fluoroadenosine-3′-phosphate Afs = 2′-fluoroadenosine-3′-phosporothioate Cf = 2′-fluorocytidine-3′-phosphate Cfs = 2′-fluorocytidine-3′-phosphorothioate Gf = 2′-fluoroguanosine-3′-phosphate Gfs = 2′-fluoroguanosine-3′-phosphorothioate Tf = 2′-fluoro-5′-methyluridine-3′-phosphate Tfs = 2′-fluoro-5′-methyluridine-3′-phosphorothioate Uf = 2′-fluorouridine-3′-phosphate Ufs = 2′-fluorouridine-3′-phosphorothioate dN = any 2′-deoxyribonucleotide dA = 2′-deoxyadenosine-3′-phosphate dAs = 2′-deoxyadenosine-3′-phosphorothioate dC = 2′-deoxycytidine-3′-phosphate dCs = 2′-deoxycytidine-3′-phosphorothioate dG = 2′-deoxyguanosine-3′-phosphate dGs = 2′-deoxyguanosine-3′-phosphorothioate dT = 2′-deoxythymidine-3′-phosphate dTs = 2′-deoxythymidine-3′-phosphorothioate dU = 2′-deoxyuridine-3′-phosphate dUs = 2′-deoxyuridine-3′-phosphorothioate N.sub.UNA = 2′,3′-seco nucleotide mimics (unlocked nucleobase analogs)-3′- Phosphate N.sub.UNAs = 2′,3′-seco nucleotide mimics (unlocked nucleobase analogs)-3′- phosphorothioate A.sub.UNA = 2′,3′-seco-adenosine-3′-phosphate A.sub.UNAs = 2′,3′-seco-adenosine-3′-phosphorothioate C.sub.UNA = 2′,3′-seco-cytidine-3′-phosphate C.sub.UNAs = 2′,3′-seco-cytidine-3′-phosphorothioate G.sub.UNA = 2′,3′-seco-guanosine-3′-phosphate G.sub.UNAs = 2′,3′-seco-guanosine-3′-phosphorothioate U.sub.UNA = 2′,3′-seco-uridine-3′-phosphate U.sub.UNAs = 2′,3′-seco-uridine-3′-phosphorothioate a_2N = see Table 6 a_2Ns = see Table 6 pu_2N = see Table 6 pu_2Ns = see Table 6 N.sub.LNA = locked nucleotide Nf.sub.ANA = 2′-F-Arabino nucleotide NM = 2′-O-methoxyethyl nucleotide AM = 2′-O-methoxyethyladenosine-3′-phosphate AMs = 2′-O-methoxyethyladenosine-3′-phosphorothioate GM = 2′-O-methoxyethylguanosine-3′-phosphate GMs = 2′-O-methoxyethylguanosine-3′-phosphorothioate TM = 2′-O-methoxyethylthymidine-3′-phosphate TMs = 2′-O-methoxyethylthymidine-3′-phosphorothioate mCM = see Table 6 mCMs = see Table 6 R = ribitol (invdN) = any inverted deoxyribonucleotide (3′-3′ linked nucleotide) (invAb) = inverted (3′-3′ linked) abasic deoxyribonucleotide, see Table 6 (invAb)s = inverted (3′-3′ linked) abasic deoxyribonucleotide-5′- phosphorothioate, see Table 6 (invn) = any inverted 2′-OMe nucleotide (3′-3′ linked nucleotide) s = phosphorothioate linkage sp = see Table 6 D2u = see Table 6 pD2u = see Table 6 vpdN = vinyl phosphonate deoxyribonucleotide (5Me-Nf) = 5′-Me, 2′-fluoro nucleotide cPrp = cyclopropyl phosphonate, see Table 6 epTcPr = see Table 6 epTM = see Table 6
[0185] As the person of ordinary skill in the art would readily understand, unless otherwise indicated by the sequence (such as, for example, by a phosphorothioate linkage “s”), when present in an oligonucleotide, the nucleotide monomers are mutually linked by 5′-3′-phosphodiester bonds. As the person of ordinary skill in the art would clearly understand, the inclusion of a phosphorothioate linkage as shown in the modified nucleotide sequences disclosed herein replaces the phosphodiester linkage typically present in oligonucleotides (see, e.g.,
[0186] Certain examples of targeting groups and linking groups used with the ANGPTL3 RNAi agents disclosed herein are provided below in Table 6. More specifically, targeting groups and linking groups include the following, for which their chemical structures are provided below in Table 6: (PAZ), (NAG13), (NAG13)s, (NAG18), (NAG18)s, (NAG24), (NAG24)s, (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG30), (NAG30)s, (NAG31), (NAG31)s, (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s, (NAG39), (NAG39)s. Each sense strand and/or antisense strand can have any targeting groups or linking groups listed herein, as well as other targeting or linking groups, conjugated to the 5′ and/or 3′ end of the sequence.
TABLE-US-00018 TABLE 3 ANGPTL3 RNAi Agent Antisense Strand Sequences Underlying Base Sequence (5′ .fwdarw. 3′) Modified (Shown as an Antisense Antisense SEQ Unmodified SEQ Strand Strand ID Nucleotide ID ID: (5′ .fwdarw. 3′) NO. Sequence) NO. AM06999-AS usUfsusGf 220 UUUGAAUUAAU 363 aAfuUfaAf GUCCAUGGAC uGfuCfcAf uGfgAfsc AM07001-AS usUfsusGf 7 UUUGAAUUAAU 8 aAfuUfaAf GUCCAUGGGC uGfuCfcAf uGfggsc AM07003-AS usGfsusUf 13 UGUUGAAUUAA 12 gAfaUfuAf UGUCCAUGGA aUfgUfcCf aUfgGfsa AM07005-AS usGfsusUf 221 UGUUGAAUUAA 364 gAfaUfuAf UGUCCAUGGC aUfgUfcCf aUfgGfsc AM07007-AS usUfsasGf 222 UUAGGUUGUUU 365 gUfuGfuUf UCUCCACACU uUfcUfcCf aCfaCfsu AM07009-AS usUfsasGf 223 UUAGGUUGUUU 366 gUfuGfuUf UCUCCACACC uUfcUfcCf aCfaCfsc AM07011-AS usUfsusUf 224 UUUUAGGUUGU 367 aGfgUfuGf UUUCUCCACC uUfuUfcUf cCfaCfsc AM07061-AS usGfsgsAf 225 UGGAGUAGUUC 368 gUfaguucU UUGGUGCUCU fuGfgUfgC fuCfsu AM07062-AS usGfsgsAf 226 UGGAGUAGUUC 369 gUfaguucU UUGGUGCUCC fuGfgUfgC fuCfsc AM07063-AS asGfsgsGf 227 AGGGAGUAGUU 370 aGfuaguuC CUUGGUGCUC fuUfgGfuG fcUfsc AM07148-AS usUfsusGf 228 UUUGAAUUAAU 371 aAfuUfaAf GUCCAUGGAG uGfuCfcAf uGfgAfsg AM07149-AS usUfsusGf 229 UUUGAAUUAAU 371 aAfUuNAUf GUCCAUGGAG aAfuGfuCf cAfuGfgAf sg AM07155-AS usUfsusGf 230 UUUGAAUUAAU 372 aAfuUfaAf GUCCAUGGCG uGfuCfcAf uGfgCfsg AM07157-AS usUfsusGf 231 UUUGAAUUAAU 373 aAfuUfaAf GUCCAUGGGG uGfuCfcAf uGfgGfsg AM07159-AS usUfsusGf 9 UUUGAAUUAAU 10 aAfuUfaAf GUCCAUGGGU uGfuCfcAf uGfgGfsu AM07161-AS usGfsusUf 232 UGUUGAAUUAA 374 gAfaUfuAf UGUCCAUGGG aUfgUfcCf aUfgGfsg AM07163-AS usGfsusUf 233 UGUUGAAUUAA 375 gAfaUfuAf UGUCCAUGGU aUfgUfcCf aUfgGfsu AM07164-AS usGfsusUf 234 UGUUGAAUUAA 375 gAfAuNAUf UGUCCAUGGU uAfaUfgUf cCfaUfgGf su AM07233-AS usAfscsUf 5 UACUGAUCAAA 6 gAfuCfaAf UAUGUUGAGU aUfaUfgUf uGfaGfsu AM07235-AS usAfscsUf 2 UACUGAUCAAA 3 gAfuCfaAf UAUGUUGAGC aUfaUfgUf uGfaGfsc AM07237-AS asAfsusCf 235 AAUCUUGAUUU 376 uUfgAfuUf UGGCUCUGGA uUfgGfcUf cUfgGfsa AM07239-AS asAfsusCf 236 AAUCUUGAUUU 377 uUfgAfuUf UGGCUCUGGU uUfgGfcUf cUfgGfsu AM07241-AS usCfsasAf 237 UCAACCAAAAU 378 cCfaAfaAf UCUCCAUCAC uUfcUfcCf aUfcAfsc AM07243-AS usCfsasAf 238 UCAACCAAAAU 379 cCfaAfaAf UCUCCAUCGC uUfcUfcCf aUfcGfsc AM07245-AS usCfscsAf 239 UCCAACCAAAA 380 aCfcAfaAf UUCUCCAUCA aUfuCfuCf cAfuCfsa AM07347-AS usGfsusUf 240 UGUUGAAUUAA 12 gAfauuaaU UGUCCAUGGA fgUfcCfaU fgGfsa AM07348-AS usGfsusug 241 UGUUGAAUUAA 12 AfauuaaUf UGUCCAUGGA gUfcCfaUf gGfsa AM07349-AS usGfsusUf 242 UGUUGAAUUAA 12 gaauuaaUf UGUCCAUGGA gUfcCfaUf gGfsa AM07350-AS usGfsusug 11 UGUUGAAUUAA 12 aauuaaUfg UGUCCAUGGA UfcCfaUfg Gfsa AM07351-AS usGfsusug 243 UGUUGAAUUAA 12 AfauuAfaU UGUCCAUGGA fgUfcCfau ggsa AM07352-AS usGfsusUf 244 UGUUGAAUUAA 12 gAfaUfuAf UGUCCAUGGA aUfgUfcca uggsa AM07356-AS usGfsusug 245 UGUUGAAUUAA 12 Afauuaaug UGUCCAUGGA UfcCfaugg sa AM07357-AS usGfsusug 246 UGUUGAAUUAA 12 aauuaaUfg UGUCCAUGGG UfcCfaUfg Gfsg AM07454-AS asAfscsUf 247 AACUGAUCAAA 382 gAfuCfaAf UAUGUUGAGC aUfaUfgUf uGfaGfsc AM07456-AS D2usAfscs 248 UACUGAUCAAA 3 UfgAfuCfa UAUGUUGAGC AfaUfaUfg UfuGfaGfs c AM07457-AS pD2usAfsc 249 UACUGAUCAAA 3 sUfgAfuCf UAUGUUGAGC aAfaUfaUf gUfuGfaGf sc AM07458-AS pusAfscsU 250 UACUGAUCAAA 3 fgAfuCfaA UAUGUUGAGC faUfaUfgU fuGfaGfsc AM07461-AS usAfscsUf 251 UACUGAUCAAA 385 gAfuCfaAf UAUGUUGAGG aUfaUfgUf uGfaGfsg AM07463-AS usAfscsUf 252 UACUGAUCAAA 386 gAfuCfaAf UAUGUUGGGC aUfaUfgUf uGfgGfsc AM07465-AS usAfscsUf 253 UACUGAUCAAA 387 gAfuCfaAf UAUGUUGCGC aUfaUfgUf uGfcGfsc AM07467-AS usAfscsUf 254 UACUGAUCAAA 388 gAfuCfaAf UAUGUUGGGU aUfaUfgUf uGfgGfsu AM07469-AS usAfscsUf 255 UACUGAUCAAA 389 gAfuCfaAf UAUGUUGCGU aUfaUfgUf uGfcGfsu AM07505-AS usUfsTMs 256 UUTGAAUUAAU 390 GfaAfuUf GUCCAUGGGU aAfuGfuC fcAfuGfg Gfsu AM07506-AS usUfsusG 257 UUUGAAUUAAU 10 fAMAfuUf GUCCAUGGGU aAfuGfuC fcAfuGfg Gfsu AM07507-AS usUfsusG 258 UUUGAATUAAU 392 faAfTMUf GUCCAUGGGU aAfuGfuC fcAfuGfg Gfsu AM07508-AS usUfsTMs 259 UUTGAAUUAAU 390 GfAMAfuU GUCCAUGGGU faAfuGfu CfcAfuGf gGfsu AM07581-AS usAfscsu 260 UACUGAUCAAA 3 gaucaaaU UAUGUUGAGC faUfgUfu GfaGfsc AM07583-AS Usascsug 261 UACUGAUCAAA 3 aucaaaUf UAUGUUGAGC aUfgUfuG faGfsc AM07588-AS usAfscsu 262 UACUGAUCAA 3 gaucaaau AUAUGUUGAGC aUfgUfuG faGfsc AM07589-AS usAfscsU 263 UACUGAUCAAI 393 fgAfuCfa UAUGUUGAGC AfiUfaUf gUfuGfaG fsc AM07623-AS usAfscsU 264 UACUGAUCAAA 3 fgAfuCfa UAUGUUGAGC AfaUfaUf gUfuGfas Gfsc AM07624-AS usAfscUf 265 UACUGAUCAAA 3 gAfuCfaA UAUGUUGAGC faUfaUfg UfuGfasG fsc AM07634-AS usUfsusg 266 UUUGAAUUAA 10 aauuaauG UGUCCAUGGGU fuCfcAfu GfgGfsu AM07660-AS asAfsgsU 267 AAGUCUUUAAG 394 fcUfuuaa ACCAUGUCCC gAfcCfaU fgUfcCfs c AM07662-AS usAfsusU 268 UAUUGCUUCAC 395 fgCfuuca UAUGGAGUAG cUfaUfgG faGfuAfs g AM07664-AS usUfsusGf 269 UUUGCUUUGUG 396 cUfuugugA AUCCCAAGUC fuCfcCfaA fgUfsc AM07681-AS asCfsasUf 14 ACAUCGUCUA 15 cGfucuaaC ACAUAGCAACC faUfaGfcA faCfsc AM07683-AS usCfsasCf 270 UCACUAUGGAG 397 uAfuggagU UAUAUCUUCC faUfaUfcU fuCfsc AM07685-AS usCfsgsUf 271 UCGUAUAGUUG 398 aUfaguugG GUUUCGUGAC fuUfuCfgU fgAfsc AM07687-AS usCfsusUf 272 UCUUUGUGAUC 399 uGfugaucC CCAAGUAGAC fcAfaGfuA fgAfsc AM07911-AS usCfsasCf 273 UCACUAUGGAG 397 uAfuGuNAg UAUAUCUUCC agUfaUfaU fcUfuCfsc
TABLE-US-00019 TABLE 4 ANGPTL3 RNAi Agent Sense Strand Sequences Underlying Base Sequence (5′ .fwdarw. 3′) (Shown Modified as an Sense Sense SEQ Unmodified SEQ Strand Strand ID Nucleotide ID ID: (5′ .fwdarw. 3′) NO. Sequence) NO. AM06992-SS (NAG37)s(invAb) 274 AGAGCACCAAG 400 sagagcaccAfAfGf AACUACUCCA aacuacuccas (invAb) AM06994-SS (NAG37)s(invAb) 275 GGAGCACCAAG 401 sggagcaccAfAfG AACUACUUCA faacuacuucas (invAb) AM06996-SS (NAG37)s(invAb) 276 GAGCACCAAGA 402 sgagcaccaAfGfA ACUACUCUCU facuacucucus (invAb) AM06998-SS (NAG37)s(invAb) 277 GUCCAUGGACA 403 sguccauggAfCf UUAAUUCAAA Afuuaauucaaas (invAb) AM07000-SS (NAG37)s(invAb) 278 GCCCAUGGACA 26 sgcccauggAfCfA UUAAUUCAAA fuuaauucaaas (invAb) AM07002-SS (NAG37)s(invAb) 279 UCCAUGGACAU 30 succauggaCfAfU UAAUUCAACA fuaauucaacas (invAb) AM07004-SS (NAG37)s(invAb) 280 GCCAUGGACAU 406 sgccauggaCfAfU UAAUUCAACA fuaauucaacas (invAb) AM07006-SS (NAG37)s(invAb) 281 AGUGUGGAGAA 407 saguguggaGfAfA AACAACCUAA faacaaccuaas (invAb) AM07008-SS (NAG37)s(invAb) 282 GGUGUGGAGAA 408 sgguguggaGfAfA AACAACCUAA faacaaccuaas (invAb) AM07010-SS (NAG37)s(invAb) 283 GGUGGAGAAAA 409 sgguggagaAfAfA CAACCUAAAA fcaaccuaaaas (invAb) AM07147-SS (NAG37)s(invAb) 284 CUCCAUGGACA 410 scuccauggAfCfA UUAAUUCAAA fuuaauucaaas (invAb) AM07147-SS (NAG37)s(invAb) 285 CUCCAUGGACA 410 scuccauggAfCfA UUAAUUCAAA fuuaauucaaas (invAb) AM07150-SS (NAG37)s(invAb) 286 CUCCAUGGACA 410 scuccauggAfCfA UUAAUUCAAA fuUaauucaaas (invAb) AM07151-SS (NAG37)s(invAb) 287 CUCCAUGGACA 411 scuccauggAfCfA UUAAUUCA(A.sup.2N) fuuaauucaa_2N A as(invAb) AM07152-SS (NAG37)s(invAb) 288 CUCCAUGGACA 412 scuccauggAfCfA UUAAUUC(A.sup.2N) fuuaauuca_2Naa AA s(invAb) AM07153-SS (NAG37)s(invAb) 289 CUCCAUGGACA 413 scuccauggAfCfA UU(A.sup.2N)AUUC fuua_2Nauucaaa AAA s(invAb) AM07154-SS (NAG37)s(invAb) 290 CGCCAUGGACA 414 scgccauggAfCfA UUAAUUCAAA fuuaauucaaas (invAb) AM07156-SS (NAG37)s(invAb) 291 CCCCAUGGACA 415 sccccauggAfCfA UUAAUUCAAA fuuaauucaaas (invAb) AM07158-SS (NAG37)s(invAb) 292 ACCCAUGGACA 28 sacccauggAfCfA UUAAUUCAAA fuuaauucaaas (invAb) AM07160-SS (NAG37)s(invAb) 293 CCCAUGGACAU 417 scccauggaCfAfU UAAUUCAACA fuaauucaacas (invAb) AM07162-SS (NAG37)s(invAb) 294 ACCAUGGACAU 418 saccauggaCfAfU UAAUUCAACA fuaauucaacas (invAb) AM07165-SS (NAG37)s(invAb) 295 ACCAUGGACAU 418 saccauggaCfAfU UAAUUCAACA fuAauucaacas (invAb) AM07166-SS (NAG37)s(invAb) 296 ACCAUGGACAU 419 saccauggaCfAfU UA(A.sup.2N)UUCA fuaa_2Nuucaaca ACA s(invAb) AM07167-SS (NAG37)s(invAb) 297 ACC(A.sup.2N)UGG 420 sacca_2NuggaCf ACAUUAAUUCA AfUfuaauucaaca ACA s(invAb) AM07168-SS (NAG37)s(invAb) 298 (A.sup.2N)CCAUGG 421 sa_2NccauggaCf ACAUUAAUUCA AfUfuaauucaaca ACA s(invAb) AM07232-SS (NAG37)s(invAb) 299 ACUCAACAUAU 24 sacucaacaUfAfU UUGAUCAGUA fuugaucaguas (invAb) AM07234-SS (NAG37)s(invAb) 300 GCUCAACAUAU 17 sgcucaacaUfAfU UUGAUCAGUA fuugaucaguas (invAb) AM07236-SS (NAG37)s(invAb 301 UCCAGAGCCAA 424 )succagagcCfAf AAUCAAGAUU Afaaucaagauus (invAb) AM07238-SS (NAG37)s(invAb) 302 ACCAGAGCCAA 425 saccagagcCfAfA AAUCAAGAUU faaucaagauus (invAb) AM07240-SS (NAG37)s(invAb) 303 GUGAUGGAGAA 426 sgugauggaGfAfA UUUUGGUUGA fuuuugguugas (invAb) AM07242-SS (NAG37)s(invAb) 304 GCGAUGGAGAA 427 sgcgauggaGfAfA UUUUGGUUGA fuuuugguugas (invAb) AM07244-SS (NAG37)s(invAb) 305 UGAUGGAGAAU 428 sugauggagAfAfU UUUGGUUGGA fuuugguuggas (invAb) AM07246-SS (NAG37)usccaug 306 UCCAUGGACAU 30 gaCfAfUfuaauu UAAUUCAACA caacas(invAb) AM07247-SS (NAG37)asccaug 307 ACCAUGGACAU 418 gaCfAfUfuaauuc UAAUUCAACA aacas(invAb) AM07345-SS (NAG37)s(invAb) 308 UCCAUGGACAU 429 succauggaCfAfU UAAUUCA(A.sup.2N) fuaauucaa_2Nca CA s(invAb) AM07346-SS (NAG37)s(invAb) 309 UCCAUGGACAU 430 succauggaCfAfU UAAUUC(A.sup.2N) fuaauuca_2Naca ACA s(invAb) AM07353-SS (NAG37)s(invAb) 310 UCCAUGGACAU 30 succauggaCfaUf UAAUUCAACA uAfauucaacas (invAb) AM07354-SS (NAG37)s(invAb) 311 UCCAUGGACAU 30 succauggaCfaUfU UAAUUCAACA faauucaacas (invAb) AM07355-SS (NAG37)s(invAb) 312 UCCAUGGACAU 30 succaugGfaCfaU UAAUUCAACA fuaauucaacas (invAb) AM07358-SS (NAG37)s(invAb) 313 CCCAUGGACAU 417 scccauggaCfaUfu UAAUUCAACA Afauucaacas (invAb) AM07359-SS (NAG37)ascccau 314 ACCCAUGGACA 28 ggAfCfAfuuaauu UUAAUUCAAA caaas(invAb) AM07453-SS (NAG37)s(invAb) 315 GCUCAACAUAU 431 sgcucaacaUfAfUf UUGAUCAGUU uugaucaguus (invAb) AM07455-SS (NAG37)s(invAb) 316 GCUCAACAUAU 432 sgcucaacaUfAfUf UUGAUCAIUA uugaucaiuas (invAb) AM07459-SS (NAG37)gscucaa 317 GCUCAACAUAU 17 caUfAfUfuugauc UUGAUCAGUA aguas(invAb) AM07460-SS (NAG37)s(invAb) 318 CCUCAACAUAU 433 sccucaacaUfAfU UUGAUCAGUA fuugaucaguas (invAb) AM07462-SS (NAG37)s(invAb) 319 GCCCAACAUAU 434 sgcccaacaUfAfU UUGAUCAGUA fuugaucaguas (invAb) AM07464-SS (NAG37)s(invAb) 320 GCGCAACAUAU 435 sgcgcaacaUfAfU UUGAUCAGUA fuugaucaguas (invAb) AM07466-SS (NAG37)s(invAb) 321 ACCCAACAUAU 436 sacccaacaUfAfU UUGAUCAGUA fuugaucaguas (invAb) AM07468-SS (NAG37)s(invAb) 322 ACGCAACAUAU 437 sacgcaacaUfAfU UUGAUCAGUA fuugaucaguas (invAb) AM07502-SS (NAG37)s(invAb) 323 ACCCAUGGACA 28 sacCfcAfuGfgAf UUAAUUCAAA CfAfuuaauucaa as(invAb) AM07503-SS (NAG37)s(invAb) 324 ACCCAUGGACA 28 sacccauggAfCfA UUAAUUCAAA fuuaauucaAMas (invAb) AM07504-SS (NAG37)s(invAb) 325 ACCCAUGGACA 438 sacccauggAfCf UUAATUCAAA AfuuaaTMumCMa AMas(invAb) AM07579-SS (NAG37)s(invAb) 326 GCUCAACAUAU 17 sgcUfcAfaCfaUfA UUGAUCAGUA fUfuugaucaguas (invAb) AM07580-SS (NAG37)s(invAb) 327 GCUCAACAUAU 17 sgcUfcAfaCfaUfa UUGAUCAGUA Ufuugaucaguas (invAb) AM07582-SS (NAG37)s(invAb) 328 GCUCAACAUAU 17 sgcucaacaUfaUf UUGAUCAGUA uUfgaucaguas (invAb) AM07584-SS (NAG37)s(invAb) 329 GCUCAACAUAU 17 sgcucaacaUfaUfu UUGAUCAGUA ugaucaguas (invAb) AM07585-SS (NAG37)s(invAb) 330 GCUCAACAUAU 17 sgcucaacaUfauu UUGAUCAGUA ugaucaguas (invAb) AM07586-SS (NAG37)s(invAb) 331 GCUCAACAUAU 17 usgcucaacauaUf UUGAUCAGUA ugaucaguas (invAb) AM07587-SS (NAG37)s(invAb) 332 GCUCAACAUAU 17 sgcUfcAfaCfaUf UUGAUCAGUA auuugaucaguas (invAb) AM07607-SS (NAG37)s(invAb) 333 GCUCAACAUAU 439 sgcucaacaUfAfU UUG(A.sup.2N)UCA fuuga_2Nucagua GUA s(invAb) AM07608-SS (NAG37)s(invAb) 334 GCUCAACA 19 sgcucaacaUfa_2 U(A.sup.2N)UU Nufuugaucagua UGAUCAGUA s(invAb) AM07609-SS (NAG37)s(invAb) 335 GCUCAA 441 sgcucaaca_2Nuf C(A.sup.2N)UA AfUfuugaucagua UUUGAUCA s(invAb) GUA AM07610-SS (NAG37)s(invAb) 336 GCUCAA 21 sgcucaaca_2Nuf C(A.sup.2N)U(A.sup.2N) a_2Nufuugaucag UUUGAU uas(invAb) CAGUA AM07625-SS (NAG25)s(invAb) 337 GCUCAACA 17 sgcucaacaUfAfU UAUUUGAU fuugaucaguas CAGUA (invAb) AM07626-SS (NAG37)s(invAb) 338 GCUCAACA 17 sgcucaacaUfAfU UAUUUGAU fuUfgaucaguas CAGUA (invAb) AM07627-SS (NAG37)s(invAb) 339 GCUCAACAUAUU 17 sgcucaacaUfAfU UGAUCAGUA fUfugaucaguas (invAb) AM07628-SS (NAG37)s(invAb) 340 GCUCAACAUAUU 17 sgcucaacAfUfAf UGAUCAGUA Ufuugaucaguas (invAb) AM07629-SS (NAG37)s(invAb) 341 GCUCAACAUAUU 17 sgcUfcAfaCfaUf UGAUCAGUA AfUfuUfgaucagu as(invAb) AM07630-SS (NAG37)s(invAb) 342 GCUCAACAUAU 17 sgcUfcAfaCfaUf UUGAUCAGUA AfUfUfugaucagu as(invAb) AM07631-SS (NAG37)s(invAb) 343 GCUCAACAU 17 sgcucaacAMUfAf AUUUGAUCA Ufuugaucaguas GUA (invAb) AM07632-SS (NAG37)s(invAb) 344 GCUCAACAU 17 sgcucaacaUfAfU AUUUGAUCA fuugaucaGMuas GUA (invAb) AM07633-SS (NAG37)s(invAb) 345 GCUCAACAU 17 sgmCMumCMaAMca AUUUGAUCA UfAfUfuugaucag GUA uas(invAb) AM07635-SS (NAG37)s(invAb) 346 ACCCAUGGA 28 sacccauggAfCfA CAUUAAUUC fuUfaAfuucaaas AAA (invAb) AM07636-SS (NAG37)s(invAb) 347 ACCCAUGGA 28 sacccauggAfCfA CAUUAAUUC fuUfAfAfuucaaa AAA s(invAb) AM07637-SS (NAG37)s(invAb) 348 ACCCAUGGA 28 sacccauggAfCfA CAUUAAUUC fuUfaAfuUfcaaa AAA s(invAb) AM07638-SS (NAG37)s(invAb) 349 ACCCAUGGA 28 sacccauggAfCfA CAUUAAUUC fuuAMauucaaas AAA (invAb) AM07639-SS (NAG37)s(invAb) 350 ACCCAUGGA 438 sacccauggAfCfA CAUUAATUC fuuAMaTMucaaas AAA (invAb) AM07640-SS (NAG37)s(invAb) 351 ACCCAUGGA 28 sacccauggAfCfAf CAUUAAUUC uUfAMAfuucaaas AAA (invAb) AM07641-SS (NAG37)s(invAb) 352 ACCCAUGGA 438 sacccauggAfCfA CAUUAATUC fuuAMaTMucaAMa AAA s(invAb) AM07642-SS (NAG25)s(invAb) 353 ACCCAUGGA 28 sacccauggAfCfA CAUUAAUUC fuuaauucaaas AAA (invAb) AM07659-SS (NAG37)s(invAb) 354 GGGACAUGG 443 sgggacaugGfUfC UCUUAAAGA fuuaaagacuus CUU (invAb) AM07661-SS (NAG37)s(invAb) 355 CUACUCCAU 444 scuacuccaUfAfG AGUGAAGCA fugaagcaauas AUA (invAb) AM07663-SS (NAG37)s(invAb) 356 GACUUGGGA 445 sgacuugggAfUfC UCACAAAGC facaaagcaaas AAA (invAb) AM07680-SS (NAG37)s(invAb) 357 GGUUGCUAU 32 sgguugcuaUfGfU GUUAGACGA fuagacgaugus UGU (invAb) AM07682-SS (NAG37)s(invAb) 358 GGAAGAUAU 447 sggaagauaUfAfC ACUCCAUAG fuccauagugas UGA (invAb) AM07684-SS (NAG37)s(invAb) 359 GUCACGAAA 448 sgucacgaaAfCfC CCAACUAUA faacuauacgas CGA (invAb) AM07686-SS (NAG37)s(invAb) 360 GUCUACUUG 449 sgucuacuuGfGfG GGAUCACAA faucacaaagas AGA (invAb) AM07910-SS (NAG37)s(invAb) 361 GGAAGAUAU 447 sggaagauaUfAfC ACUCCAUAG fucCuNAauaguga UGA s(invAb) AM07912-SS (NAG37)s(invAb) 362 GGAAGAUAU 450 sggaagauaUfAfC ACUCCAUAI fuccauaiugas UGA (invAb) (A.sup.2N) = 2-aminoadenine nucleotide
[0187] The ANGPTL3 RNAi agents described herein are formed by annealing an antisense strand with a sense strand. A sense strand containing a sequence listed in Table 2 or Table 4 can be hybridized to any antisense strand containing a sequence listed in Table 2 or Table 3, provided the two sequences have a region of at least 85% complementarity over a contiguous 16, 17, 18, 19, 20, or 21 nucleotide sequence.
[0188] In some embodiments, the antisense strand of an ANGPTL3 RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the antisense strand sequences in Table 3. In some embodiments, the sense strand of an ANGPTL3 RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the sense strand sequences in Table 4.
[0189] In some embodiments, an ANGPTL3 RNAi agent antisense strand comprises a nucleotide sequence of any of the sequences in Table 2 or Table 3. In some embodiments, an ANGPTL3 RNAi agent antisense strand comprises the sequence of nucleotides (from 5′ end .fwdarw.3′ end) 1-17, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, 2-21, 1-22, 2-22, 1-23, 2-23, 1-24, or 2-24 of any of the sequences in Table 2 or Table 3. In certain embodiments, an ANGPTL3 RNAi agent antisense strand comprises or consists of a modified sequence of any one of the modified sequences in Table 3.
[0190] In some embodiments, an ANGPTL3 RNAi agent sense strand comprises the nucleotide sequence of any of the sequences in Table 2 or Table 4. In some embodiments, an ANGPTL3 RNAi agent sense strand comprises the sequence of nucleotides (from 5′ end .fwdarw.3′ end) 1-17, 2-17, 3-17, 4-17, 1-18, 2-18, 3-18, 4-18, 1-19, 2-19, 3-19, 4-19, 1-20, 2-20, 3-20, 4-20, 1-21, 2-21, 3-21, 4-21, 1-22, 2-22, 3-22, 4-22, 1-23, 2-23, 3-23, 4-23, 1-24, 2-24, 3-24, or 4-24 of any of the sequences in Table 2 or Table 4. In certain embodiments, an ANGPTL3 RNAi agent sense strand comprises or consists of a modified sequence of any one of the modified sequences in Table 4.
[0191] For the ANGPTL3 RNAi agents disclosed herein, the nucleotide at position 1 of the antisense strand (from 5′ end .fwdarw.3′ end) can be perfectly complementary to an ANGPTL3 gene, or can be non-complementary to an ANGPTL3 gene. In some embodiments, the nucleotide at position 1 of the antisense strand (from 5′ end .fwdarw.3′ end) is a U, A, or dT (or a modified version thereof). In some embodiments, the nucleotide at position 1 of the antisense strand (from 5′ end .fwdarw.3′ end) forms an A:U or U:A base pair with the sense strand.
[0192] In some embodiments, an ANGPTL3 RNAi agent antisense strand comprises the sequence of nucleotides (from 5′ end .fwdarw.3′ end) 2-18 or 2-19 of any of the antisense strand sequences in Table 2 or Table 3. In some embodiments, an ANGPTL3 RNAi sense strand comprises the sequence of nucleotides (from 5′ end .fwdarw.3′ end) 1-17 or 1-18 of any of the sense strand sequences in Table 2 or Table 4.
[0193] In some embodiments, an ANGPTL3 RNAi agent includes (i) an antisense strand comprising the sequence of nucleotides (from 5′ end .fwdarw.3′ end) 2-18 or 2-19 of any of the antisense strand sequences in Table 2 or Table 3, and (ii) a sense strand comprising the sequence of nucleotides (from 5′ end .fwdarw.3′ end) 1-17 or 1-18 of any of the sense strand sequences in Table 2 or Table 4.
[0194] A sense strand containing a sequence listed in Table 2 or Table 4 can be hybridized to any antisense strand containing a sequence listed in Table 2 or Table 3, provided the two sequences have a region of at least 85% complementarity over a contiguous 16, 17, 18, 19, 20, or 21 nucleotide sequence. In some embodiments, the ANGPTL3 RNAi agent has a sense strand consisting of the modified sequence of any of the modified sequences in Table 4, and an antisense strand consisting of the modified sequence of any of the modified sequences in Table 3. Certain representative sequence pairings are exemplified by the Duplex ID Nos. shown in Table 5.
[0195] In some embodiments, an ANGPTL3 RNAi agent comprises, consists of, or consists essentially of a duplex represented by any one of the Duplex ID Nos. presented herein. In some embodiments, an ANGPTL3 RNAi agent comprises the sense strand and antisense strand nucleotide sequences of any of the duplexes represented by any of the Duplex ID Nos. presented herein. In some embodiments, an ANGPTL3 RNAi agent comprises the sense strand and antisense strand nucleotide sequences of any of the duplexes represented by any of the Duplex ID Nos. presented herein and a targeting group and/or linking group wherein the targeting group and/or linking group is covalently linked (i.e., conjugated) to the sense strand or the antisense strand. In some embodiments, an ANGPTL3 RNAi agent includes the sense strand and antisense strand modified nucleotide sequences of any of the Duplex ID Nos. presented herein. In some embodiments, an ANGPTL3 RNAi agent comprises the sense strand and antisense strand modified nucleotide sequences of any of the Duplex ID Nos. presented herein and a targeting group and/or linking group, wherein the targeting group and/or linking group is covalently linked to the sense strand or the antisense strand.
[0196] In some embodiments, an ANGPTL3 RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequences of any of the antisense strand/sense strand duplexes of Table 2 or Table 5, and further comprises a targeting group. In some embodiments, an ANGPTL3 RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequences of any of the antisense strand/sense strand duplexes of Table 2 or Table 5, and further comprises an asialoglycoprotein receptor ligand targeting group.
[0197] In some embodiments, an ANGPTL3 RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequences of any of the antisense strand/sense strand duplexes of Table 2 or Table 5, and further comprises a targeting group selected from the group consisting of (NAG13), (NAG13)s, (NAG18), (NAG18)s, (NAG24), (NAG24)s, (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG30), (NAG30)s, (NAG31), (NAG31)s, (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s, each as defined in Table 6. In some embodiments, the targeting group is (NAG25) or (NAG25)s as defined in Table 6. In other embodiments, the targeting group is (NAG37) or (NAG37)s as defined in Table 6.
[0198] In some embodiments, an ANGPTL3 RNAi agent comprises an antisense strand and a sense strand having the modified nucleotide sequence of any of the antisense strand and/or sense strand nucleotide sequences in Table 3 or Table 4.
[0199] In some embodiments, an ANGPTL3 RNAi agent comprises an antisense strand and a sense strand having a modified nucleotide sequence of any of the antisense strand and/or sense strand nucleotide sequences of any of the duplexes Table 5, and further comprises an asialoglycoprotein receptor ligand targeting group.
[0200] In some embodiments, an ANGPTL3 RNAi agent comprises, consists of, or consists essentially of any of the duplexes of Table 5.
TABLE-US-00020 TABLE 5 ANGPTL3 RNAi Agents Duplexes with Corresponding Sense and Antisense Strand ID Numbers Antisense Sense Duplex ID Strand ID Strand ID AD05306 AM06999-AS AM06998-SS AD05307 AM07001-AS AM07000-SS AD05308 AM07003-AS AM07002-SS AD05309 AM07005-AS AM07004-SS AD05310 AM07007-AS AM07006-SS AD05311 AM07009-AS AM07008-SS AD05312 AM07011-AS AM07010-SS AD05342 AM07061-AS AM06992-SS AD05343 AM07062-AS AM06994-SS AD05344 AM07063-AS AM06996-SS AD05410 AM07148-AS AM07147-SS AD05411 AM07149-AS AM07147-SS AD05412 AM07148-AS AM07150-SS AD05413 AM07148-AS AM07151-SS AD05414 AM07148-AS AM07152-SS AD05415 AM07148-AS AM07153-SS AD05416 AM07155-AS AM07154-SS AD05417 AM07157-AS AM07156-SS AD05418 AM07159-AS AM07158-SS AD05419 AM07161-AS AM07160-SS AD05420 AM07163-AS AM07162-SS AD05421 AM07164-AS AM07162-SS AD05422 AM07163-AS AM07165-SS AD05423 AM07163-AS AM07166-SS AD05424 AM07163-AS AM07167-SS AD05425 AM07163-AS AM07168-SS AD05487 AM07233-AS AM07232-SS AD05488 AM07235-AS AM07234-SS AD05489 AM07237-AS AM07236-SS AD05490 AM07239-AS AM07238-SS AD05491 AM07241-AS AM07240-SS AD05492 AM07243-AS AM07242-SS AD05493 AM07245-AS AM07244-SS AD05494 AM07003-AS AM07246-SS AD05495 AM07163-AS AM07247-SS AD05572 AM07003-AS AM07345-SS AD05573 AM07003-AS AM07346-SS AD05574 AM07347-AS AM07002-SS AD05575 AM07348-AS AM07002-SS AD05576 AM07349-AS AM07002-SS AD05577 AM07350-AS AM07002-SS AD05578 AM07351-AS AM07002-SS AD05579 AM07352-AS AM07002-SS AD05580 AM07347-AS AM07353-SS AD05581 AM07348-AS AM07353-SS AD05582 AM07350-AS AM07353-SS AD05583 AM07351-AS AM07353-SS AD05584 AM07347-AS AM07354-SS AD05585 AM07356-AS AM07355-SS AD05586 AM07357-AS AM07160-SS AD05587 AM07357-AS AM07358-SS AD05588 AM07159-AS AM07359-SS AD05652 AM07454-AS AM07453-SS AD05653 AM07235-AS AM07455-SS AD05654 AM07456-AS AM07234-SS AD05655 AM07457-AS AM07234-SS AD05656 AM07458-AS AM07234-SS AD05657 AM07235-AS AM07459-SS AD05658 AM07461-AS AM07460-SS AD05659 AM07463-AS AM07462-SS AD05660 AM07465-AS AM07464-SS AD05661 AM07467-AS AM07466-SS AD05662 AM07469-AS AM07468-SS AD05693 AM07159-AS AM07502-SS AD05694 AM07159-AS AM07503-SS AD05695 AM07159-AS AM07504-SS AD05696 AM07505-AS AM07158-SS AD05697 AM07506-AS AM07158-SS AD05698 AM07507-AS AM07158-SS AD05699 AM07508-AS AM07158-SS AD05743 AM07235-AS AM07579-SS AD05744 AM07235-AS AM07580-SS AD05745 AM07581-AS AM07234-SS AD05746 AM07581-AS AM07582-SS AD05747 AM07583-AS AM07582-SS AD05748 AM07581-AS AM07584-SS AD05749 AM07581-AS AM07585-SS AD05750 AM07581-AS AM07586-SS AD05751 AM07581-AS AM07580-SS AD05752 AM07588-AS AM07587-SS AD05753 AM07589-AS AM07234-SS AD05756 AM07593-AS AM07234-SS AD05774 AM07235-AS AM07607-SS AD05775 AM07235-AS AM07608-SS AD05776 AM07235-AS AM07609-SS AD05777 AM07235-AS AM07610-SS AD05790 AM07623-AS AM07234-SS AD05791 AM07624-AS AM07234-SS AD05792 AM07235-AS AM07625-SS AD05793 AM07235-AS AM07626-SS AD05794 AM07235-AS AM07627-SS AD05795 AM07235-AS AM07628-SS AD05796 AM07235-AS AM07629-SS AD05797 AM07235-AS AM07630-SS AD05798 AM07235-AS AM07631-SS AD05799 AM07235-AS AM07632-SS AD05800 AM07235-AS AM07633-SS AD05801 AM07634-AS AM07158-SS AD05802 AM07634-AS AM07635-SS AD05803 AM07634-AS AM07636-SS AD05804 AM07634-AS AM07637-SS AD05805 AM07634-AS AM07638-SS AD05806 AM07634-AS AM07639-SS AD05807 AM07634-AS AM07640-SS AD05808 AM07634-AS AM07641-SS AD05809 AM07159-AS AM07642-SS AD05826 AM07660-AS AM07659-SS AD05827 AM07662-AS AM07661-SS AD05828 AM07664-AS AM07663-SS AD05840 AM07681-AS AM07680-SS AD05841 AM07683-AS AM07682-SS AD05842 AM07685-AS AM07684-SS AD05843 AM07687-AS AM07686-SS AD05991 AM07683-AS AM07910-SS AD05992 AM07911-AS AM07682-SS AD05993 AM07683-AS AM07912-SS
[0201] In some embodiments, an ANGPTL3 RNAi agent is prepared or provided as a salt, mixed salt, or a free-acid. The RNAi agents described herein, upon delivery to a cell expressing an ANGPTL3 gene, inhibit or knockdown expression of one or more ANGPTL3 genes in vivo and/or in vitro.
[0202] Targeting Groups, Linking Groups, and Delivery Vehicles
[0203] In some embodiments, an ANGPTL3 RNAi agent is conjugated to one or more non-nucleotide groups including, but not limited to, a targeting group, a linking group, a delivery polymer, or a delivery vehicle. The non-nucleotide group can enhance targeting, delivery or attachment of the RNAi agent. Examples of targeting groups and linking groups are provided in Table 6. The non-nucleotide group can be covalently linked to the 3′ and/or 5′ end of either the sense strand and/or the antisense strand. In some embodiments, an ANGPTL3 RNAi agent contains a non-nucleotide group linked to the 3′ and/or 5′ end of the sense strand. In some embodiments, a non-nucleotide group is linked to the 5′ end of an ANGPTL3 RNAi agent sense strand. A non-nucleotide group may be linked directly or indirectly to the RNAi agent via a linker/linking group. In some embodiments, a non-nucleotide group is linked to the RNAi agent via a labile, cleavable, or reversible bond or linker.
[0204] In some embodiments, a non-nucleotide group enhances the pharmacokinetic or biodistribution properties of an RNAi agent or conjugate to which it is attached to improve cell- or tissue-specific distribution and cell-specific uptake of the RNAi agent or conjugate. In some embodiments, a non-nucleotide group enhances endocytosis of the RNAi agent.
[0205] Targeting groups or targeting moieties enhance the pharmacokinetic or biodistribution properties of a conjugate or RNAi agent to which they are attached to improve cell-specific (including, in some cases, organ specific) distribution and cell-specific (or organ specific) uptake of the conjugate or RNAi agent. A targeting group can be monovalent, divalent, trivalent, tetravalent, or have higher valency for the target to which it is directed. Representative targeting groups include, without limitation, compounds with affinity to cell surface molecules, cell receptor ligands, haptens, antibodies, monoclonal antibodies, antibody fragments, and antibody mimics with affinity to cell surface molecules. In some embodiments, a targeting group is linked to an RNAi agent using a linker, such as a PEG linker or one, two, or three abasic and/or ribitol (abasic ribose) residues, which can in some instances serve as linkers. In some embodiments, a targeting group comprises a galactose-derivative cluster.
[0206] The ANGPTL3 RNAi agents described herein can be synthesized having a reactive group, such as an amino group (also referred to herein as an amine), at the 5′-terminus and/or the 3′-terminus. The reactive group can be used subsequently to attach a targeting moiety using methods typical in the art.
[0207] In some embodiments, a targeting group comprises an asialoglycoprotein receptor ligand. As used herein, an asialoglycoprotein receptor ligand is a ligand that contains a compound having affinity for the asialoglycoprotein receptor. As noted herein, the asialoglycoprotein receptor is highly expressed on hepatocytes. In some embodiments, an asialoglycoprotein receptor ligand includes or consists of one or more galactose derivatives. As used herein, the term galactose derivative includes both galactose and derivatives of galactose having affinity for the asialoglycoprotein receptor that is equal to or greater than that of galactose. Galactose derivatives include, but are not limited to: galactose, galactosamine, N-formylgalactosamine, N-acetyl-galactosamine, N-propionyl-galactosamine, N-n-butanoyl-galactosamine, and N-iso-butanoylgalactos-amine (see for example: S.T. Iobst and K. Drickamer, J. B. C., 1996, 271, 6686). Galactose derivatives, and clusters of galactose derivatives, that are useful for in vivo targeting of oligonucleotides and other molecules to the liver are known in the art (see, for example, Baenziger and Fiete, 1980, Cell, 22, 611-620; Connolly et al., 1982, J. Biol. Chem., 257, 939-945).
[0208] Galactose derivatives have been used to target molecules to hepatocytes in vivo through their binding to the asialoglycoprotein receptor expressed on the surface of hepatocytes. Binding of asialoglycoprotein receptor ligands to the asialoglycoprotein receptor(s) facilitates cell-specific targeting to hepatocytes and endocytosis of the molecule into hepatocytes. Asialoglycoprotein receptor ligands can be monomeric (e.g., having a single galactose derivative) or multimeric (e.g., having multiple galactose derivatives). The galactose derivative or galactose derivative cluster can be attached to the 3′ or 5′ end of the sense or antisense strand of the RNAi agent using methods known in the art. The preparation of targeting groups, such as galactose derivative clusters, is described in, for example, International Patent Application Publication No. WO 2018/044350 to Arrowhead Pharmaceuticals, Inc., and International Patent Application Publication No. WO 2017/156012 to Arrowhead Pharmaceuticals, Inc., the contents of both of which are incorporated by reference herein in their entirety.
[0209] As used herein, a galactose derivative cluster comprises a molecule having two to four terminal galactose derivatives. A terminal galactose derivative is attached to a molecule through its C-1 carbon. In some embodiments, the galactose derivative cluster is a galactose derivative trimer (also referred to as tri-antennary galactose derivative or tri-valent galactose derivative). In some embodiments, the galactose derivative cluster comprises N-acetyl-galactosamines. In some embodiments, the galactose derivative cluster comprises three N-acetyl-galactosamines. In some embodiments, the galactose derivative cluster is a galactose derivative tetramer (also referred to as tetra-antennary galactose derivative or tetra-valent galactose derivative). In some embodiments, the galactose derivative cluster comprises four N-acetyl-galactosamines.
[0210] As used herein, a galactose derivative trimer contains three galactose derivatives, each linked to a central branch point. As used herein, a galactose derivative tetramer contains four galactose derivatives, each linked to a central branch point. The galactose derivatives can be attached to the central branch point through the C-1 carbons of the saccharides. In some embodiments, the galactose derivatives are linked to the branch point via linkers or spacers. In some embodiments, the linker or spacer is a flexible hydrophilic spacer, such as a PEG group (see, for example, U.S. Pat. No. 5,885,968; Biessen et al. J. Med. Chem. 1995 Vol. 39 p. 1538-1546). In some embodiments, the PEG spacer is a PEG3 spacer. The branch point can be any small molecule which permits attachment of three galactose derivatives and further permits attachment of the branch point to the RNAi agent. An example of branch point group is a di-lysine or di-glutamate. Attachment of the branch point to the RNAi agent can occur through a linker or spacer. In some embodiments, the linker or spacer comprises a flexible hydrophilic spacer, such as, but not limited to, a PEG spacer. In some embodiments, the linker comprises a rigid linker, such as a cyclic group. In some embodiments, a galactose derivative comprises or consists of N-acetyl-galactosamine. In some embodiments, the galactose derivative cluster is comprised of a galactose derivative tetramer, which can be, for example, an N-acetyl-galactosamine tetramer.
[0211] Embodiments of the present disclosure include pharmaceutical compositions for delivering an ANGPTL3 RNAi agent to a liver cell in vivo. Such pharmaceutical compositions can include, for example, an ANGPTL3 RNAi agent conjugated to a galactose derivative cluster. In some embodiments, the galactose derivative cluster is comprised of a galactose derivative trimer, which can be, for example, an N-acetyl-galactosamine trimer, or galactose derivative tetramer, which can be, for example, an N-acetyl-galactosamine tetramer.
[0212] Targeting groups include, but are not limited to, (PAZ), (NAG13), (NAG13)s, (NAG18), (NAG18)s, (NAG24), (NAG24)s, (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27) (NAG27)s, (NAG28), (NAG28)s, (NAG29) (NAG29)s, (NAG30) (NAG30)s, (NAG31), (NAG31)s, (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s, (NAG39), and (NAG39)s as defined in Table 6. Other targeting groups, including galactose cluster targeting ligands, are known in the art.
[0213] In some embodiments, a linking group is conjugated to the RNAi agent. The linking group facilitates covalent linkage of the agent to a targeting group, delivery polymer, or delivery vehicle. The linking group can be linked to the 3′ and/or the 5′ end of the RNAi agent sense strand or antisense strand. In some embodiments, the linking group is linked to the RNAi agent sense strand. In some embodiments, the linking group is conjugated to the 5′ or 3′ end of an RNAi agent sense strand. In some embodiments, a linking group is conjugated to the 5′ end of an RNAi agent sense strand. Examples of linking groups, can include, but are not limited to: reactive groups such a primary amines and alkynes, alkyl groups, abasic nucleotides, ribitol (abasic ribose), and/or PEG groups.
[0214] A linker or linking group is a connection between two atoms that links one chemical group (such as an RNAi agent) or segment of interest to another chemical group (such as a targeting group or delivery polymer) or segment of interest via one or more covalent bonds. A labile linkage contains a labile bond. A linkage can optionally include a spacer that increases the distance between the two joined atoms. A spacer can further add flexibility and/or length to the linkage. Spacers include, but are not be limited to, alkyl groups, alkenyl groups, alkynyl groups, aryl groups, aralkyl groups, aralkenyl groups, and aralkynyl groups; each of which can contain one or more heteroatoms, heterocycles, amino acids, nucleotides, and saccharides. Spacer groups are well known in the art and the preceding list is not meant to limit the scope of the description.
[0215] In some embodiments, when two or more RNAi agents are included in a single composition, each of the RNAi agents may be linked to the same targeting group or two a different targeting groups (i.e., targeting groups having different chemical structure). In some embodiments, targeting groups are linked to the ANGPTL3 RNAi agents disclosed herein without the use of an additional linker. In some embodiments, the targeting group itself is designed having a linker or other site to facilitate conjugation readily present. In some embodiments, when two or more ANGPTL3 RNAi agents are included in a single, each of the RNAi agents may utilize the same linker or different linkers (i.e., linkers having different chemical structures).
[0216] Any of the ANGPTL3 RNAi agent nucleotide sequences listed in Tables 2, 3, or 4, whether modified or unmodified, can contain 3′ and/or 5′ targeting group(s) or linking group(s). Any of the ANGPTL3 RNAi agent sequences listed in Table 3 or 4, or are otherwise described herein, which contain a 3′ or 5′ targeting group or linking group, can alternatively contain no 3′ or 5′ targeting group or linking group, or can contain a different 3′ or 5′ targeting group or linking group including, but not limited to, those depicted in Table 6. Any of the ANGPTL3 RNAi agent duplexes listed in Table 5, whether modified or unmodified, can further comprise a targeting group or linking group, including, but not limited to, those depicted in Table 6, and the targeting group or linking group can be attached to the 3′ or 5′ terminus of either the sense strand or the antisense strand of the ANGPTL3 RNAi agent duplex.
[0217] Examples of targeting groups and linking groups are provided in Table 6. Table 4 provides several embodiments of ANGPTL3 RNAi agent sense strands having a targeting group or linking group linked to the 5′ or 3′ end.
TABLE-US-00021 TABLE 6 Structures Representing Various Modified Nucleotides, Targeting Groups, and Linking Groups
[0218] In each of the above structures in Table 6, NAG comprises an N-acetyl-galactosamine or another galactose derivative, as would be understood by a person of ordinary skill in the art to be attached in view of the structures above and description provided herein. For example, in some embodiments, NAG in the structures provided in Table 6 is represented by the following structure:
##STR00061##
[0219] Each (NAGx) may be attached to an ANGPTL3 RNAi agent via a phosphate group (as in (NAG25), (NAG30), and (NAG31)), or a phosphorothioate group, (as is (NAG25)s, (NAG29)s, (NAG30)s, (NAG31)s, or (NAG37)s), or another linking group.
##STR00062##
[0220] Other linking groups known in the art may be used.
[0221] In some embodiments, a delivery vehicle can be used to deliver an RNAi agent to a cell or tissue. A delivery vehicle is a compound that improves delivery of the RNAi agent to a cell or tissue. A delivery vehicle can include, or consist of, but is not limited to: a polymer, such as an amphipathic polymer, a membrane active polymer, a peptide, a melittin peptide, a melittin-like peptide (MLP), a lipid, a reversibly modified polymer or peptide, or a reversibly modified membrane active polyamine.
[0222] In some embodiments, the RNAi agents can be combined with lipids, nanoparticles, polymers, liposomes, micelles, DPCs or other delivery systems available in the art. The RNAi agents can also be chemically conjugated to targeting groups, lipids (including, but not limited to cholesterol and cholesteryl derivatives), nanoparticles, polymers, liposomes, micelles, DPCs (see, for example WO 2000/053722, WO 2008/0022309, WO 2011/104169, and WO 2012/083185, WO 2013/032829, WO 2013/158141, each of which is incorporated herein by reference), or other delivery systems available in the art.
Pharmaceutical Compositions and Formulations
[0223] The ANGPTL3 RNAi agents disclosed herein can be prepared as pharmaceutical compositions or formulations (also referred to herein as “medicaments”). In some embodiments, pharmaceutical compositions include at least one ANGPTL3 RNAi agent. These pharmaceutical compositions are particularly useful in the inhibition of the expression of the target mRNA in a target cell, a group of cells, a tissue, or an organism. The pharmaceutical compositions can be used to treat a subject having a disease, disorder, or condition that would benefit from reduction in the level of the target mRNA, or inhibition in expression of the target gene. The pharmaceutical compositions can be used to treat a subject at risk of developing a disease, disorder, or condition that would benefit from reduction of the level of the target mRNA or an inhibition in expression the target gene. In one embodiment, the method includes administering an ANGPTL3 RNAi agent linked to a targeting ligand as described herein, to a subject to be treated. In some embodiments, one or more pharmaceutically acceptable excipients (including vehicles, carriers, diluents, and/or delivery polymers) are added to the pharmaceutical compositions that include an ANGPTL3 RNAi agent, thereby forming a pharmaceutical formulation or medicament suitable for in vivo delivery to a subject, including a human.
[0224] The pharmaceutical compositions that include an ANGPTL3 RNAi agent and methods disclosed herein decrease the level of the target mRNA in a cell, group of cells, group of cells, tissue, organ, or subject, including by administering to the subject a therapeutically effective amount of a herein described ANGPTL3 RNAi agent, thereby inhibiting the expression of ANGPTL3 mRNA in the subject. In some embodiments, the subject has been previously identified or diagnosed as having a pathogenic upregulation of the target gene in the targeted cell or tissue. In some embodiments, the subject has been previously identified or diagnosed as having elevated triglyceride (TG) and/or elevated cholesterol levels or some other dyslipidemia. In some embodiments, the subject has been previously diagnosed with having one or more cardiometabolic diseases such as hypertriglyceridemia, obesity, hyperlipidemia, abnormal lipid and/or cholesterol metabolism, atherosclerosis, atherosclerosis, type II diabetes mellitus, cardiovascular disease, coronary artery disease, non-alcoholic steatohepatitis, non-alcoholic fatty liver disease, homozygous and heterozygous familial hypercholesterolemia, statin resistant hypercholesterolemia and other metabolic-related disorders and diseases. In some embodiments, the subject has been suffering from symptoms associated with one or more cardiometabolic diseases that is associated with or caused by elevated or increased TG levels, elevated or increased cholesterol levels, or hepatic steatosis.
[0225] In some embodiments, the described pharmaceutical compositions including an ANGPTL3 RNAi agent are used for treating or managing clinical presentations associated with elevated TG levels, elevated cholesterol levels, hepatic steatosis, and/or over-expression of ANGPTL3 mRNA in a subject. In some embodiments, a therapeutically (including prophylactically) effective amount of one or more of pharmaceutical compositions is administered to a subject in need of such treatment. In some embodiments, administration of any of the disclosed ANGPTL3 RNAi agents can be used to decrease the number, severity, and/or frequency of symptoms of a disease in a subject.
[0226] The described pharmaceutical compositions that include an ANGPTL3 RNAi agent can be used to treat at least one symptom in a subject having a disease or disorder that would benefit from reduction or inhibition in expression of ANGPTL3 mRNA. In some embodiments, the subject is administered a therapeutically effective amount of one or more pharmaceutical compositions that include an ANGPTL3 RNAi agent thereby treating the symptom. In other embodiments, the subject is administered a prophylactically effective amount of one or more ANGPTL3 RNAi agents, thereby preventing or inhibiting the at least one symptom.
[0227] The route of administration is the path by which an ANGPTL3 RNAi agent is brought into contact with the body. In general, methods of administering drugs and oligonucleotides and nucleic acids for treatment of a mammal are well known in the art and can be applied to administration of the compositions described herein. The ANGPTL3 RNAi agents disclosed herein can be administered via any suitable route in a preparation appropriately tailored to the particular route. Thus, herein described pharmaceutical compositions can be administered by injection, for example, intravenously, intramuscularly, intracutaneously, subcutaneously, intraarticularly, or intraperitoneally. In some embodiments, the herein described pharmaceutical compositions are administered via subcutaneous injection.
[0228] The pharmaceutical compositions including an ANGPTL3 RNAi agent described herein can be delivered to a cell, group of cells, tissue, or subject using oligonucleotide delivery technologies known in the art. In general, any suitable method recognized in the art for delivering a nucleic acid molecule (in vitro or in vivo) can be adapted for use with the compositions described herein. For example, delivery can be by local administration, (e.g., direct injection, implantation, or topical administering), systemic administration, or subcutaneous, intravenous, intraperitoneal, or parenteral routes, including intracranial (e.g., intraventricular, intraparenchymal and intrathecal), intramuscular, transdermal, airway (aerosol), nasal, oral, rectal, or topical (including buccal and sublingual) administration. In certain embodiments, the compositions are administered by subcutaneous or intravenous infusion or injection.
[0229] In some embodiments, the pharmaceutical compositions described herein comprise one or more pharmaceutically acceptable excipients. The pharmaceutical compositions described herein are formulated for administration to a subject.
[0230] As used herein, a pharmaceutical composition or medicament includes a pharmacologically effective amount of at least one of the described therapeutic compounds and one or more pharmaceutically acceptable excipients. Pharmaceutically acceptable excipients (excipients) are substances other than the Active Pharmaceutical Ingredient (API, therapeutic product, e.g., ANGPTL3 RNAi agent) that are intentionally included in the drug delivery system. Excipients do not exert or are not intended to exert a therapeutic effect at the intended dosage. Excipients can act to a) aid in processing of the drug delivery system during manufacture, b) protect, support or enhance stability, bioavailability or patient acceptability of the API, c) assist in product identification, and/or d) enhance any other attribute of the overall safety, effectiveness, of delivery of the API during storage or use. A pharmaceutically acceptable excipient may or may not be an inert substance.
[0231] Excipients include, but are not limited to: absorption enhancers, anti-adherents, anti-foaming agents, anti-oxidants, binders, buffering agents, carriers, coating agents, colors, delivery enhancers, delivery polymers, detergents, dextran, dextrose, diluents, disintegrants, emulsifiers, extenders, fillers, flavors, glidants, humectants, lubricants, oils, polymers, preservatives, saline, salts, solvents, sugars, surfactants, suspending agents, sustained release matrices, sweeteners, thickening agents, tonicity agents, vehicles, water-repelling agents, and wetting agents.
[0232] Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water-soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor® ELTM (BASF, Parsippany, N.J.) or phosphate buffered saline (PBS). Suitable carriers should be stable under the conditions of manufacture and storage and should be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol), and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, and sodium chloride in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin.
[0233] Sterile injectable solutions can be prepared by incorporating the active compound in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filter sterilization. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle, which contains a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, methods of preparation include vacuum drying and freeze-drying which yields a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
[0234] Formulations suitable for intra-articular administration can be in the form of a sterile aqueous preparation of the drug that can be in microcrystalline form, for example, in the form of an aqueous microcrystalline suspension. Liposomal formulations or biodegradable polymer systems can also be used to present the drug for both intra-articular and ophthalmic administration.
[0235] The active compounds can be prepared with carriers that will protect the compound against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Methods for preparation of such formulations will be apparent to those skilled in the art. Liposomal suspensions can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in U.S. Pat. No. 4,522,811.
[0236] The ANGPTL3 RNAi agents can be formulated in compositions in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form refers to physically discrete units suited as unitary dosages for the subject to be treated; each unit containing a predetermined quantity of active compound calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier. The specification for the dosage unit forms of the disclosure are dictated by and directly dependent on the unique characteristics of the active compound and the therapeutic effect to be achieved, and the limitations inherent in the art of compounding such an active compound for the treatment of individuals.
[0237] A pharmaceutical composition can contain other additional components commonly found in pharmaceutical compositions. Such additional components include, but are not limited to: anti-pruritics, astringents, local anesthetics, analgesics, antihistamines, or anti-inflammatory agents (e.g., acetaminophen, NSAIDs, diphenhydramine, etc.). It is also envisioned that cells, tissues, or isolated organs that express or comprise the herein defined RNAi agents may be used as “pharmaceutical compositions.” As used herein, “pharmacologically effective amount,” “therapeutically effective amount,” or simply “effective amount” refers to that amount of an RNAi agent to produce a pharmacological, therapeutic, or preventive result.
[0238] In some embodiments, the methods disclosed herein further comprise the step of administering a second therapeutic or treatment in addition to administering an RNAi agent disclosed herein. In some embodiments, the second therapeutic is another ANGPTL3 RNAi agent (e.g., an ANGPTL3 RNAi agent that targets a different sequence within the ANGPTL3 target). In other embodiments, the second therapeutic can be a small molecule drug, an antibody, an antibody fragment, or an aptamer.
[0239] Generally, an effective amount of an active compound will be in the range of from about 0.1 to about 100 mg/kg of body weight/day, e.g., from about 1.0 to about 50 mg/kg of body weight/day. In some embodiments, an effective amount of an active compound will be in the range of from about 0.25 to about 5 mg/kg of body weight per dose. In some embodiments, an effective amount of an active ingredient will be in the range of from about 0.5 to about 4 mg/kg of body weight per dose. The amount administered will also likely depend on such variables as the overall health status of the patient, the relative biological efficacy of the compound delivered, the formulation of the drug, the presence and types of excipients in the formulation, and the route of administration. Also, it is to be understood that the initial dosage administered can be increased beyond the above upper level to rapidly achieve the desired blood-level or tissue level, or the initial dosage can be smaller than the optimum.
[0240] For treatment of disease or for formation of a medicament or composition for treatment of a disease, the pharmaceutical compositions described herein including an ANGPTL3 RNAi agent can be combined with an excipient or with a second therapeutic agent or treatment including, but not limited to: a second or other RNAi agent, a small molecule drug, an antibody, an antibody fragment, peptide and/or an aptamer.
[0241] The described ANGPTL3 RNAi agents, when added to pharmaceutically acceptable excipients or adjuvants, can be packaged into kits, containers, packs, or dispensers. The pharmaceutical compositions described herein may be packaged in pre-filled syringes or vials.
[0242] Methods of Treatment and Inhibition of Expression
[0243] The ANGPTL3 RNAi agents disclosed herein can be used to treat a subject (e.g., a human or other mammal) having a disease or disorder that would benefit from administration of the RNAi agent. In some embodiments, the RNAi agents disclosed herein can be used to treat a subject (e.g., a human) that would benefit from reduction and/or inhibition in expression of ANGPTL3 mRNA and/or ANGPTL3 protein levels, for example, a subject that has been diagnosed with hypertriglyceridemia, obesity, hyperlipidemia, abnormal lipid and/or cholesterol metabolism, atherosclerosis, type II diabetes mellitus, cardiovascular disease, coronary artery disease, non-alcoholic steatohepatitis, non-alcoholic fatty liver disease, homozygous and heterozygous familial hypercholesterolemia, statin resistant hypercholesterolemia and other metabolic-related disorders and diseases.
[0244] In some embodiments, the subject is administered a therapeutically effective amount of any one or more ANGPTL3 RNAi agents. Treatment of a subject can include therapeutic and/or prophylactic treatment. The subject is administered a therapeutically effective amount of any one or more ANGPTL3 RNAi agents described herein. The subject can be a human, patient, or human patient. The subject may be an adult, adolescent, child, or infant. Administration of a pharmaceutical composition described herein can be to a human being or animal.
[0245] The ANGPTL3 RNAi agents described herein can be used to treat at least one symptom in a subject having an ANGPTL3-related disease or disorder, or having a disease or disorder that is mediated at least in part by ANGPTL3 gene expression. In some embodiments, the ANGPTL3 RNAi agents are used to treat or manage a clinical presentation of a subject with an ANGPTL3-related disease or disorder. The subject is administered a therapeutically effective amount of one or more of the ANGPTL3 RNAi agents or ANGPTL3 RNAi agent-containing compositions described herein. In some embodiments, the methods disclosed herein comprise administering a composition comprising an ANGPTL3 RNAi agent described herein to a subject to be treated. In some embodiments, the subject is administered a prophylactically effective amount of any one or more of the described ANGPTL3 RNAi agents, thereby treating the subject by preventing or inhibiting the at least one symptom.
[0246] In certain embodiments, the present disclosure provides methods for treatment of diseases, disorders, conditions, or pathological states mediated at least in part by ANGPTL3 gene expression, in a patient in need thereof, wherein the methods include administering to the patient any of the ANGPTL3 RNAi agents described herein.
[0247] In some embodiments, the gene expression level and/or mRNA level of an ANGPTL3 gene in a subject to whom a described ANGPTL3 RNAi agent is administered is reduced by at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 95%, 96%, 97%, 98%, 99%, or greater than 99% relative to the subject prior to being administered the ANGPTL3 RNAi agent or to a subject not receiving the ANGPTL3 RNAi agent. The gene expression level and/or mRNA level in the subject may be reduced in a cell, group of cells, and/or tissue of the subject.
[0248] In some embodiments, the ANGPTL3 protein level in a subject to whom a described ANGPTL3 RNAi agent has been administered is reduced by at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or greater than 99% relative to the subject prior to being administered the ANGPTL3 RNAi agent or to a subject not receiving the ANGPTL3 RNAi agent. The protein level in the subject may be reduced in a cell, group of cells, tissue, blood, and/or other fluid of the subject.
[0249] In some embodiments, the triglyceride (TG) levels in a subject to whom a described ANGPTL3 RNAi agent has been administered is reduced by at least about 10%, 20%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or greater than 99% relative to the subject prior to being administered the ANGPTL3 RNAi agent or to a subject not receiving the ANGPTL3 RNAi agent. The TG level in the subject may be reduced in a cell, group of cells, tissue, blood, and/or other fluid of the subject.
[0250] In some embodiments, the total cholesterol levels in a subject to whom a described ANGPTL3 RNAi agent has been administered is reduced by at least about 10%, 20%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or greater than 99% relative to the subject prior to being administered the ANGPTL3 RNAi agent or to a subject not receiving the ANGPTL3 RNAi agent. In some embodiments, the low-density lipoprotein (LDL) cholesterol levels in a subject to whom a described ANGPTL3 RNAi agent has been administered is reduced by at least about 10%, 20%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or greater than 99% relative to the subject prior to being administered the ANGPTL3 RNAi agent or to a subject not receiving the ANGPTL3 RNAi agent. The total cholesterol levels and/or LDL cholesterol levels in the subject may be reduced in a cell, group of cells, tissue, blood, and/or other fluid of the subject.
[0251] A reduction in ANGPTL3 mRNA levels, ANGPTL3 protein levels, TG levels, cholesterol levels, and LDL cholesterol levels can be assessed by any methods known in the art. As used herein, a reduction or decrease in ANGPTL3 mRNA level and/or protein level are collectively referred to herein as a reduction or decrease in ANGPTL3 or inhibiting or reducing the expression of ANGPTL3. The Examples set forth herein illustrate known methods for assessing inhibition of ANGPTL3 gene expression.
[0252] Cells, Tissues, Organs, and Non-Human Organisms
[0253] Cells, tissues, organs, and non-human organisms that include at least one of the ANGPTL3 RNAi agents described herein are contemplated. The cell, tissue, organ, or non-human organism is made by delivering the RNAi agent to the cell, tissue, organ or non-human organism.
[0254] The above provided embodiments and items are now illustrated with the following, non-limiting examples.
EXAMPLES
Example 1. Synthesis of ANGPTL3 RNAi Agents
[0255] ANGPTL3 RNAi agent duplexes shown in Table 5, above, were synthesized in accordance with the following general procedures:
[0256] A. Synthesis. The sense and antisense strands of the RNAi agents were synthesized according to phosphoramidite technology on solid phase used in oligonucleotide synthesis. Depending on the scale, either a MerMade96E® (Bioautomation), a MerMade12® (Bioautomation), or an OP Pilot 100 (GE Healthcare) was used. Syntheses were performed on a solid support made of controlled pore glass (CPG, 500 Å or 600 Å, obtained from Prime Synthesis, Aston, Pa., USA) All RNA and 2′-modified RNA phosphoramidites were purchased from Thermo Fisher Scientific (Milwaukee, Wis., USA) or Hongene Biotech (Shanghai, PRC). The 2′-O-methyl phosphoramidites included the following: (5′-O-dimethoxytrityl-N.sup.6-(benzoyl)-2′-O-methyl-adenosine-3′-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite, 5′-O-dimethoxy-trityl-N.sup.4-(acetyl)-2′-O-methyl-cytidine-3′-O-(2-cyanoethyl-N,N-diisopropyl-amino) phosphoramidite, (5′-O-dimethoxytrityl-N.sup.2-(isobutyryl)-2′-O-methyl-guanosine-3′-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite, and 5′-O-dimethoxytrityl-2′-O-methyl-uridine-3′-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite. The 2′-deoxy-2′-fluoro-phosphoramidites carried the same protecting groups as the 2′-O-methyl amidites. 5′-(4,4′-Dimethoxytrityl)-2′,3′-seco-uridine, 2′-benzoyl-3′-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite was also purchased from Thermo Fisher Scientific or Hongene Biotech. 5′-dimethoxytrityl-2′-O-methyl-inosine-3′-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidites were purchased from Glen Research (Virginia) or Hongene Biotech. The abasic (3′-O-dimethoxytrityl-2′-deoxyribose-5′-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidites were purchased from ChemGenes (Wilmington, Mass., USA) or SAFC (St Louis, Mo., USA) The 5′-O-dimethoxytrityl-N.sup.2,N.sup.6-(phenoxyacetate)-2′-O-methyl-diaminopurine-3′-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite was obtained from ChemGenes or Hongene Biotech.
[0257] Targeting ligand containing phosphoramidites were dissolved in anhydrous dichloromethane or anhydrous acetonitrile (50 mM), while all other amidites were dissolved in anhydrous acetonitrile (50 mM), or anhydrous dimethylformamide and molecular sieves (3 Å) were added. 5-Benzylthio-1H-tetrazole (BTT, 250 mM in acetonitrile) or 5-Ethylthio-1H-tetrazole (ETT, 250 mM in acetonitrile) was used as activator solution. Coupling times were 12 min (RNA), 15 min (targeting ligand), 90 sec (2′OMe), and 60 sec (2′F). In order to introduce phosphorothioate linkages, a 100 mM solution of 3-phenyl 1,2,4-dithiazoline-5-one (POS, obtained from PolyOrg, Inc., Leominster, Mass., USA) in anhydrous Acetonitrile was employed. Unless specifically identified as a “naked” RNAi agent having no targeting ligand present, each of the ANGPTL3 RNAi agent duplexes synthesized and tested in the following Examples utilized N-acetyl-galactosamine as “NAG” in the targeting ligand chemical structures represented in Table 6.
[0258] B. Cleavage and deprotection of support bound oligomer. After finalization of the solid phase synthesis, the dried solid support was treated with a 1:1 volume solution of 40 wt. % methylamine in water and 28% ammonium hydroxide solution (Aldrich) for 1.5 hours at 30° C. The solution was evaporated and the solid residue was reconstituted in water (see below).
[0259] C. Purification. Crude oligomers were purified by anionic exchange HPLC using a TSKgel SuperQ-5PW 13 μm column and Shimadzu LC-8 system. Buffer A was 20 mM Tris, 5 mM EDTA, pH 9.0 and contained 20% Acetonitrile and buffer B was the same as buffer A with the addition of 1.5 M sodium chloride. UV traces at 260 nm were recorded. Appropriate fractions were pooled then run on size exclusion HPLC using a GE Healthcare XK 26/40 column packed with Sephadex G-25 fine with a running buffer of filtered. DI water or 100 mM ammonium bicarbonate, pH 6.7 and 20% Acetonitrile.
[0260] D. Annealing. Complementary strands were mixed by combining equimolar RNA solutions (sense and antisense) in 1× Phosphate-Buffered Saline (Corning, Cellgro) to form the RNAi agents. Some RNAi agents were lyophilized and stored at −15 to −25° C. Duplex concentration was determined by measuring the solution absorbance on a UV-Vis spectrometer in 1× Phosphate-Buffered Saline. The solution absorbance at 260 nm was then multiplied by a conversion factor and the dilution factor to determine the duplex concentration. The conversion factor used was either 0.037 mg/(mL.Math.cm) or was calculated from an experimentally determined extinction coefficient.
Example 2. In Vivo Testing of ANGPTL3 RNAi Agents in Mice
[0261] To assess the in vivo activity of ANGPTL3 RNAi agents that are designed to target different positions on the ANGPTL3 gene, six- to eight-week-old female C57bl/6 mice were used. Pre-dose serum samples were taken at day −1 after a four hour fast. At day 1, each mouse was given a single subcutaneous administration of 200 μl containing either 3 mg/kg (mpk) of an ANGPTL3 RNAi agent in D5W (dextrose in 5% water), or control (D5W) with no RNAi agent, according to the dosing groups recited in Table 7.
TABLE-US-00022 TABLE 7 Dosing Groups of Example 2 Group RNAi Agent and Dose Dosing Regimen 1 D5W (no RNAi agent) Single injection on day 1 2 3.0 mg/kg AD05342 Single injection on day 1 3 3.0 mg/kg AD05343 Single injection on day 1 4 3.0 mg/kg AD05344 Single injection on day 1 5 3.0 mg/kg AD05306 Single injection on day 1 6 3.0 mg/kg AD05307 Single injection on day 1 7 3.0 mg/kg AD05308 Single injection on day 1 8 3.0 mg/kg AD05309 Single injection on day 1 9 3.0 mg/kg AD05310 Single injection on day 1 10 3.0 mg/kg AD05311 Single injection on day 1 11 3.0 mg/kg AD05312 Single injection on day 1
[0262] Each of the RNAi agents included a modified sequence and an N-acetyl-galactosamine-containing targeting ligand conjugated to the 5′ terminal end of the sense strand. (See Tables 3, 4, and 5 for modified sequences and targeting ligand structures). The injections were performed between the skin and muscle (i.e. subcutaneous injections) into the loose skin over the neck and shoulder area. Three (3) mice in each group were tested (n=3). Serum was collected on days 8, 13, 22, 29, and day 36 (for Groups 1 and 5-11 only). Mice were fasted for four hours prior to each collection. ANGPTL3 protein levels in serum were measured by ELISA assay (R&D Systems), according to the manufacturer's recommendations. Triglycerides, high-density lipoprotein (HDL), and total cholesterol in serum were measured on a Cobas® Integra 400 (Roche Diagnostics), according to the manufacturer's recommendations.
[0263] The ANGPTL3 protein levels, triglyceride levels, HDL levels, and total cholesterol levels for each animal were normalized. For normalization, the level of ANGPTL3 protein, triglyceride, HDL, and total cholesterol, respectively, for each animal at a time point, was divided by the pre-treatment level of expression in that animal (in this case at day −1) to determine the ratio of expression “normalized to pre-treatment.” Expression at a specific time point was then normalized to the D5W control group by dividing the “normalized to pre-treatment” ratio for an individual animal by the mean “normalized to pretreatment” ratio of all mice in the D5W control group. This resulted in expression for each time point normalized to that in the control group.
[0264] Data from the study set forth in this Example are shown in the following Tables 8 through 11:
TABLE-US-00023 TABLE 8 Average ANGPTL3 Protein Normalized to Pre-Treatment and Control from Example 2 Day 8 Day 13 Day 22 Day 29 Day 36 Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Group ID ANGPTL3 (+/−) ANGPTL3 (+/−) ANGPTL3 ( (+/−) ANGPTL3 ( (+/−) ANGPTL3 ( (+/−) Group 1 (D5W) 1.000 0.338 1.000 0.234 1.000 0.341 1.000 0.217 1.000 0.226 Group 2 (3.0 0.640 0.072 0.720 0.122 0.811 0.041 0.907 0.020 mg/kg AD05342) Group 3 (3.0 0.939 0.238 1.024 0.371 1.146 0.116 0.914 0.120 mg/kg AD05343) Group 4 (3.0 0.521 0.040 0.584 0.164 0.731 0.150 0.829 0.139 mg/kg AD05344) Group 5 (3.0 0.113 0.019 0.135 0.045 0.154 0.022 0.240 0.054 0.292 0.079 mg/kg AD05306) Group 6 (3.0 0.117 0.072 0.120 0.069 0.134 0.054 0.206 0.119 0.216 0.086 mg/kg AD05307) Group 7 (3.0 0.106 0.030 0.076 0.043 0.084 0.048 0.088 0.030 0.167 0.075 mg/kg AD05308) Group 8 (3.0 0.197 0.055 0.240 0.028 0.206 0.066 0.274 0.112 0.321 0.092 mg/kg AD05309) Group 9 (3.0 0.196 0.058 0.331 0.118 0.343 0.171 0.589 0.289 0.637 0.273 mg/kg AD05310) Group 10 (3.0 0.143 0.025 0.206 0.055 0.183 0.019 0.288 0.050 0.389 0.020 mg/kg AD05311) Group 11 (3.0 0.162 0.073 0.216 0.069 0.229 0.077 0.326 0.079 0.386 0.072 mg/kg AD05312)
TABLE-US-00024 TABLE 9 Average Triglycerides Normalized to Pre-Treatment and Control from Example 2 Day 8 Day 13 Day 22 Day 29 Day 36 Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Group ID TG (+/−) TG (+/−) TG (+/−) TG (+/−) TG (+/−) Group 1 (D5W) 1.000 0.047 1.000 0.016 1.000 0.068 1.000 0.144 1.000 0.206 Group 2 (3.0 0.726 0.028 0.870 0.101 0.832 0.119 0.771 0.159 N/A N/A mg/kg AD05342) Group 3 (3.0 0.636 0.186 0.878 0.301 0.591 0.228 0.810 0.146 N/A N/A mg/kg AD05343) Group 4 (3.0 0.709 0.131 0.821 0.094 0.617 0.160 0.783 0.105 N/A N/A mg/kg AD05344) Group 5 (3.0 0.571 0.083 0.752 0.088 0.712 0.167 0.742 0.019 0.768 0.143 mg/kg AD05306) Group 6 (3.0 0.504 0.084 0.655 0.047 0.459 0.050 0.629 0.122 0.602 0.076 mg/kg AD05307) Group 7 (3.0 0.375 0.026 0.554 0.040 0.399 0.028 0.473 0.099 0.430 0.045 mg/kg AD05308) Group 8 (3.0 0.390 0.060 0.604 0.092 0.406 0.047 0.587 0.129 0.581 0.161 mg/kg AD05309) Group 9 (3.0 0.494 0.142 0.538 0.051 0.443 0.076 0.482 0.029 0.535 0.090 mg/kg AD05310) Group 10 (3.0 0.402 0.077 0.640 0.095 0.518 0.052 0.614 0.136 0.567 0.092 mg/kg AD05311) Group 11 (3.0 0.379 0.117 0.539 0.119 0.417 0.044 0.558 0.087 0.483 0.081 mg/kg AD05312)
TABLE-US-00025 TABLE 10 Average Total Cholesterol Normalized to Pre-Treatment and Control from Example 2 Day 8 Day 13 Day 22 Day 29 Day 36 Avg Total Std Dev Avg Total Std Dev Avg Total Std Dev Avg Total Std Dev Avg Total Std Dev Group ID Chol (+/−) Chol (+/−) Chol (+/−) Chol (+/−) Chol (+/−) Group 1 (D5W) 1.000 0.067 1.000 0.067 1.000 0.132 1.000 0.047 1.000 0.019 Group 2 (3.0 1.051 0.105 1.111 0.052 0.988 0.117 0.974 0.169 N/A N/A mg/kg AD05342) Group 3 (3.0 1.234 0.104 1.290 0.107 1.222 0.043 1.105 0.106 N/A N/A mg/kg AD05343) Group 4 (3.0 1.062 0.162 1.033 0.115 1.101 0.035 1.017 0.050 N/A N/A mg/kg AD05344) Group 5 (3.0 0.686 0.124 0.733 0..089 0.800 0.081 0.810 0.076 0.938 0.078 mg/kg AD05306) Group 6 (3.0 0.649 0.160 0.570 0.057 0.628 0.015 0.753 0.099 0.755 0.134 mg/kg AD05307) Group 7 (3.0 0.671 0.037 0.645 0.129 0.621 0.160 0.669 0.088 0.905 0.171 mg/kg AD05308) Group 8 (3.0 0.677 0.093 0.817 0.054 0.703 0.011 0.842 0.052 0.951 0.153 mg/kg AD05309) Group 9 (3.0 0.844 0.149 0.913 0.135 0.911 0.162 0.932 0.102 1.114 0.183 mg/kg AD05310) Group 10 (3.0 0.659 0.068 0.757 0.124 0.666 0.063 0.778 0.093 0.998 0.160 mg/kg AD05311) Group 11 (3.0 0.730 0.150 0.826 0.153 0.704 0.062 0.876 0.080 0.978 0.068 mg/kg AD05312)
TABLE-US-00026 TABLE 11 Average HDL Normalized to Pre-Treatment and Control from Example 2 Day 8 Day 13 Day 22 Day 29 Day 36 Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Group ID HDL (+/−) HDL (+/−) HDL (+/−) HDL (+/−) HDL (+/−) Group 1 (D5W) 1.000 0.069 1.000 0.068 1.000 0.143 1.000 0.056 1.000 0.007 Group 2 (3.0 1.063 0.088 1.085 0.045 0.974 0.111 1.004 0.199 N/A N/A mg/kg AD05342) Group 3 (3.0 1.253 0.116 1.250 0.108 1.202 0.039 1.069 0.103 N/A N/A mg/kg AD05343) Group 4 (3.0 1.089 0.141 1.023 0.127 1.101 0.064 1.023 0.032 N/A N/A mg/kg AD05344) Group 5 (3.0 0.654 0.119 0.643 0.063 0.721 0.059 0.756 0.052 0.856 0.091 mg/kg AD05306) Group 6 (3.0 0.633 0.151 0.524 0.048 0.588 0.023 0.724 0.082 0.702 0.128 mg/kg AD05307) Group 7 (3.0 0.634 0.035 0.583 0.138 0.572 0.161 0.606 0.086 0.854 0.177 mg/kg AD05308) Group 8 (3.0 0.665 0.094 0.791 0.059 0.688 0.021 0.826 0.007 0.901 0.115 mg/kg AD05309) Group 9 (3.0 0.792 0.131 0.867 0.122 0.867 0.161 0.914 0.098 1.045 0.158 mg/kg AD05310) Group 10 (3.0 0.648 0.063 0.708 0.120 0.621 0.065 0.755 0.086 0.953 0.178 mg/kg AD05311) Group 11 (3.0 0.671 0.158 0.761 0.159 0.652 0.059 0.849 0.089 0.958 0.048 mg/kg AD05312)
[0265] The ANGPTL3 RNAi agents AD05342 and AD05343 (Groups 2 and 3) included nucleotide sequences that were designed to inhibit expression of an ANGPTL3 gene at position 743 of the gene; ANGPTL3 RNAi agent AD05344 (Group 4) included nucleotide sequences designed to inhibit expression of an ANGPTL3 gene at position 744 of the gene; ANGPTL3 RNAi agents AD05306 and AD05307 (Groups 5 and 6) included nucleotide sequences designed to inhibit expression of an ANGPTL3 gene at position 921 of the gene; ANGPTL3 RNAi agents AD05308 and AD05309 (Groups 7 and 8) included nucleotide sequences designed to inhibit expression of an ANGPTL3 gene at position 922 of the gene; ANGPTL3 RNAi agents AD05310 and AD05311 (Groups 9 and 10) included nucleotide sequences designed to inhibit expression of an ANGPTL3 gene at position 1302 of the gene; and ANGPTL3 RNAi agents AD05312 (Group 11) included nucleotide sequences designed to inhibit expression of an ANGPTL3 gene at position 1304 of the gene. (See SEQ ID NO:1 for the ANGPTL3 gene sequence referenced).
[0266] As shown in Table 8, above, each of the RNAi agents in at least Groups 5, 6, 7, 8, 9, 10, and 11 showed ANGPTL3 inhibition. For example, on day 29, Group 7 (ANGPTL3 RNAi agent AD05308), which included nucleotide sequences designed to target position 922 of the ANGPTL3 gene, showed an approximately 91% percent reduction (0.088) in ANGPTL3 protein compared to control. Similarly, both Group 5 (ANGPTL3 RNAi agent AD05306) and Group 6 (ANGPTL3 RNAi agent AD05307), which were designed to target position 921 of the ANGPTL3 gene, showed greater than 75% reduction in ANGPTL3 protein at day 29 (i.e., 0.240 and 0.206).
Example 3. In Vivo Testing of ANGPTL3 RNAi Agents in Mice
[0267] To assess the in vivo activity of ANGPTL3 RNAi agents that are designed to target positions 921 and 922 on the ANGPTL3 gene, six- to eight-week-old female C57bl/6 mice were used. Pre-dose serum samples were taken at day −1 after a four hour fast. At day 1, each mouse was given a single subcutaneous administration of 200 μl containing either 1 mg/kg (mpk) of an ANGPTL3 RNAi agent in D5W (dextrose in 5% water), or control (D5W) with no RNAi agent, according to the dosing groups recited in Table 12.
TABLE-US-00027 TABLE 12 Dosing Groups of Example 3 Group RNAi Agent and Dose Dosing Regimen 1 D5W (no RNAi agent) Single injection on day 1 2 1.0 mg/kg AD05307 Single injection on day 1 3 1.0 mg/kg AD05410 Single injection on day 1 4 1.0 mg/kg AD05411 Single injection on day 1 5 1.0 mg/kg AD05412 Single injection on day 1 6 1.0 mg/kg AD05413 Single injection on day 1 7 1.0 mg/kg AD05414 Single injection on day 1 8 1.0 mg/kg AD05415 Single injection on day 1 9 1.0 mg/kg AD05416 Single injection on day 1 10 1.0 mg/kg AD05417 Single injection on day 1 11 1.0 mg/kg AD05418 Single injection on day 1 12 1.0 mg/kg AD05308 Single injection on day 1 13 1.0 mg/kg AD05419 Single injection on day 1 14 1.0 mg/kg AD05420 Single injection on day 1 15 1.0 mg/kg AD05421 Single injection on day 1 16 1.0 mg/kg AD05422 Single injection on day 1 17 1.0 mg/kg AD05423 Single injection on day 1 18 1.0 mg/kg AD05424 Single injection on day 1 19 1.0 mg/kg AD05425 Single injection on day 1
[0268] Each of the RNAi agents included a modified sequence and an N-acetyl-galactosamine-containing targeting ligand conjugated to the 5′ terminal end of the sense strand. (See Tables 3, 4, and 5 for modified sequences and targeting ligand structures). The injections were performed between the skin and muscle (i.e. subcutaneous injections) into the loose skin over the neck and shoulder area. Three (3) mice in each group were tested (n=3). Serum was collected on days 9, 15, 22, and 29. Mice were fasted for four hours prior to each collection. ANGPTL3 protein levels in serum were measured by ELISA assay (R&D Systems), according to the manufacturer's recommendations. Triglycerides, high-density lipoprotein (HDL), and total cholesterol in serum were measured on a Cobas® Integra 400 (Roche Diagnostics), according to the manufacturer's recommendations.
[0269] The ANGPTL3 protein levels, triglyceride levels, HDL levels, and total cholesterol levels for each animal were normalized. For normalization, the level of ANGPTL3 protein, triglyceride, HDL, and total cholesterol, respectively, for each animal at a time point, was divided by the pre-treatment level of expression in that animal (in this case at day −1) to determine the ratio of expression “normalized to pre-treatment.” Expression at a specific time point was then normalized to the D5W control group by dividing the “normalized to pre-treatment” ratio for an individual animal by the mean “normalized to pretreatment” ratio of all mice in the D5W control group. This resulted in expression for each time point normalized to that in the control group.
[0270] Data from the study set forth in this Example are shown in the following Tables 13 through 16:
TABLE-US-00028 TABLE 13 Average ANGPTL3 Protein Normalized to Pre-Treatment and Control from Example 3 Day 8 Day 15 Day 22 Day 29 Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Group ID ANGPTL3 (+/−) ANGPTL3 (+/−) ANGPTL3 (+/−) ANGPTL3 (+/−) Group 1 (D5W) 1.000 0.294 1.000 0.154 1.000 0.167 1.000 0.191 Group 2 (1.0 0.323 0.117 0.311 0.098 0.346 0.142 0.486 0.096 mg/kg AD05307) Group 3 (1.0 0.376 0.042 0.406 0.140 0.515 0.089 0.571 0.085 mg/kg AD05410) Group 4 (1.0 0.750 0.066 0.822 0.176 0.670 0.091 0.821 0.206 mg/kg AD05411) Group 5 (1.0 0.289 0.066 0.348 0.073 0.387 0.075 0.564 0.111 mg/kg AD05412) Group 6 (1.0 0.274 0.054 0.348 0.025 0.373 0.051 0.500 0.102 mg/kg AD05413) Group 7 (1.0 0.559 0.292 0.608 0.209 0.753 0.275 0.706 0.171 mg/kg AD05414) Group 8 (1.0 0.291 0.079 0.340 0.065 0.415 0.015 0.498 0.100 mg/kg AD05415) Group 9 (1.0 0.325 0.141 0.382 0.146 0.417 0.189 0.607 0.128 mg/kg AD05416) Group 10 (1.0 0.352 0.103 0.287 0.057 0.371 0.053 0.416 0.111 mg/kg AD05417) Group 11 (1.0 0.236 0.049 0.290 0.084 0.394 0.058 0.517 0.113 mg/kg AD05418) Group 12 (1.0 0.196 0.008 0.202 0.040 0.209 0.027 0.309 0.026 mg/kg AD05308) Group 13 (1.0 0.268 0.020 0.305 0.101 0.404 0.037 0.361 0.024 mg/kg AD05419) Group 14 (1.0 0.391 0.106 0.548 0.233 0.564 0.240 0.572 0.167 mg/kg AD05420) Group 15 (1.0 0.308 0.089 0.407 0.115 0.383 0.058 0.570 0.117 mg/kg AD05421) Group 16 (1.0 0.463 0.130 0.758 0.205 0.717 0.144 0.921 0.184 mg/kg AD05422) Group 17 (1.0 0.302 0.055 0.353 0.079 0.331 0.067 0.454 0.137 mg/kg AD05423) Group 18 (1.0 0.260 0.031 0.308 0.077 0.310 0.053 0.375 0.006 mg/kg AD05424) Group 19 (1.0 0.319 0.056 0.383 0.071 0.423 0.108 0.518 0.190 mg/kg AD05425)
TABLE-US-00029 TABLE 14 Average Triglycerides Normalized to Pre-Treatment and Control from Example 3 Day 8 Day 15 Day 22 Day 29 Std Std Std Std Avg Dev Avg Dev Avg Dev Avg Dev Group ID TG (+/−) TG (+/−) TG (+/−) TG (+/−) Group 1 (D5W) 1.000 0.117 1.000 0.122 1.000 0.184 1.000 0.186 Group 2 (1.0 0.786 0.027 0.692 0.041 0.903 0.153 0.852 0.054 mg/kg AD05307) Group 3 (1.0 0.873 0.152 1.005 0.133 1.259 0.288 1.046 0.167 mg/kg AD05410) Group 4 (1.0 1.302 0.214 1.311 0.181 1.687 0.390 1.498 0.174 mg/kg AD05411) Group 5 (1.0 0.642 0.019 0.617 0.052 1.139 0.601 0.780 0.216 mg/kg AD05412) Group 6 (1.0 0.720 0.028 0.728 0.097 0.889 0.058 0.925 0.087 mg/kg AD05413) Group 7 (1.0 0.765 0.160 0.660 0.169 0.905 0.281 0.626 0.096 mg/kg AD05414) Group 8 (1.0 0.675 0.173 0.780 0.204 0.877 0.196 0.647 0.048 mg/kg AD05415) Group 9 (1.0 0.785 0.136 0.821 0.100 0.944 0.104 0.787 0.116 mg/kg AD05416) Group 10 (1.0 0.898 0.054 0.906 0.194 1.121 0.227 0.898 0.259 mg/kg AD05417) Group 11 (1.0 0.718 0.035 0.791 0.124 0.855 0.090 0.881 0.123 mg/kg AD05418) Group 12 (1.0 0.952 0.319 0.749 0.262 0.854 0.239 1.009 0.136 mg/kg AD05308) Group 13 (1.0 0.652 0.024 0.786 0.074 0.794 0.092 0.901 0.045 mg/kg AD05419) Group 14 (1.0 0.644 0.234 0.861 0.244 0.978 0.313 0.836 0.260 mg/kg AD05420) Group 15 (1.0 0.597 0.253 0.586 0.085 0.796 0.048 0.700 0.088 mg/kg AD05421) Group 16 (1.0 0.698 0.137 0.594 0.066 0.972 0.129 0.837 0.073 mg/kg AD05422) Group 17 (1.0 0.811 0.140 0.593 0.076 1.157 0.429 0.848 0.031 mg/kg AD05423) Group 18 (1.0 0.847 0.219 0.667 0.173 1.171 0.297 0.898 0.264 mg/kg AD05424) Group 19 (1.0 0.710 0.063 0.517 0.018 0.721 0.149 0.682 0.077 mg/kg AD05425)
TABLE-US-00030 TABLE 15 Average Total Cholesterol Normalized to Pre-Treatment and Control from Example 3 Day 8 Day 15 Day 22 Day 29 Avg Std Avg Std Avg Std Avg Std Total Dev Total Dev Total Dev Total Dev Group ID Chol (+/−) Chol (+/−) Chol (+/−) Chol (+/−) Group 1 (D5W) 1.000 0.060 1.000 0.047 1.000 0.079 1.000 0.115 Group 2 (1.0 0.940 0.181 0.840 0.031 0.948 0.086 1.088 0.051 mg/kg AD05307) Group 3 (1.0 0.929 0.071 0.881 0.087 1.022 0.124 0.945 0.134 mg/kg AD05410) Group 4 (1.0 1.043 0.013 0.905 0.060 1.017 0.056 1.071 0.060 mg/kg AD05411) Group 5 (1.0 0.886 0.117 0.857 0.022 0.972 0.104 1.063 0.155 mg/kg AD05412) Group 6 (1.0 0.940 0.095 0.893 0.027 0.982 0.106 0.854 0.065 mg/kg AD05413) Group 7 (1.0 1.076 0.197 0.919 0.103 1.064 0.093 0.969 0.088 mg/kg AD05414) Group 8 (1.0 0.897 0.063 0.817 0.059 0.927 0.026 0.986 0.109 mg/kg AD05415) Group 9 (1.0 0.893 0.104 0.841 0.080 0.950 0.118 0.925 0.116 mg/kg AD05416) Group 10 (1.0 1.045 0.074 0.838 0.093 1.054 0.082 1.045 0.076 mg/kg AD05417) Group 11 (1.0 0.783 0.032 0.842 0.096 0.916 0.049 0.953 0.090 mg/kg AD05418) Group 12 (1.0 0.872 0.071 0.768 0.034 1.048 0.424 0.978 0.088 mg/kg AD05308) Group 13 (1.0 0.876 0.016 0.848 0.060 1.106 0.102 0.985 0.051 mg/kg AD05419) Group 14 (1.0 1.036 0.183 0.950 0.188 1.014 0.122 1.033 0.125 mg/kg AD05420) Group 15 (1.0 0.893 0.059 0.914 0.045 1.011 0.019 1.049 0.020 mg/kg AD05421) Group 16 (1.0 1.034 0.143 1.042 0.096 0.982 0.063 1.130 0.153 mg/kg AD05422) Group 17 (1.0 1.004 0.055 0.997 0.129 0.973 0.076 0.947 0.087 mg/kg AD05423) Group 18 (1.0 0.762 0.048 0.776 0.118 0.824 0.080 0.847 0.111 mg/kg AD05424) Group 19 (1.0 1.032 0.127 0.835 0.061 0.954 0.138 1.045 0.161 mg/kg AD05425)
TABLE-US-00031 TABLE 16 Average HDL Normalized to Pre-Treatment and Control from Example 3 Day 8 Day 15 Day 22 Day 29 Std Std Std Std Avg Dev Avg Dev Avg Dev Avg Dev Group ID HDL (+/−) HDL (+/−) HDL (+/−) HDL (+/−) Group 1 (D5W) 1.000 0.060 1.000 0.043 1.000 0.067 1.000 0.120 Group 2 (1.0 0.916 0.181 0.856 0.009 0.913 0.083 1.053 0.026 mg/kg AD05307) Group 3 (1.0 0.904 0.062 0.878 0.065 1.003 0.121 0.916 0.103 mg/kg AD05410) Group 4 (1.0 1.025 0.011 0.910 0.059 0.997 0.065 1.007 0.025 mg/kg AD05411) Group 5 (1.0 0.869 0.190 0.875 0.065 0.954 0.128 1.044 0.159 mg/kg AD05412) Group 6 (1.0 0.935 0.072 0.916 0.023 0.964 0.091 0.867 0.066 mg/kg AD05413) Group 7 (1.0 1.059 0.163 0.960 0.095 1.079 0.086 0.993 0.083 mg/kg AD05414) Group 8 (1.0 0.889 0.048 0.832 0.047 0.942 0.053 1.013 0.071 mg/kg AD05415) Group 9 (1.0 0.848 0.112 0.838 0.077 0.921 0.112 0.928 0.098 mg/kg AD05416) Group 10 (1.0 0.986 0.074 0.820 0.076 0.996 0.095 1.026 0.089 mg/kg AD05417) Group 11 (1.0 0.766 0.049 0.823 0.094 0.910 0.064 0.916 0.098 mg/kg AD05418) Group 12 (1.0 0.838 0.053 0.754 0.019 0.739 0.052 0.953 0.090 mg/kg AD05308) Group 13 (1.0 0.865 0.022 0.851 0.072 1.093 0.097 0.991 0.061 mg/kg AD05419) Group 14 (1.0 1.021 0.155 0.967 0.164 1.020 0.111 1.039 0.123 mg/kg AD05420) Group 15 (1.0 0.865 0.052 0.920 0.068 0.972 0.037 1.043 0.054 mg/kg AD05421) Group 16 (1.0 0.987 0.115 1.032 0.080 0.953 0.052 1.101 0.124 mg/kg AD05422) Group 17 (1.0 0.968 0.069 0.999 0.126 0.972 0.056 0.945 0.072 mg/kg AD05423) Group 18 (1.0 0.760 0.077 0.790 0.099 0.831 0.105 0.854 0.101 mg/kg AD05424) Group 19 (1.0 0.985 0.115 0.840 0.080 0.929 0.145 1.022 0.150 mg/kg AD05425)
[0271] While having different sequences and modification patterns, the ANGPTL3 RNAi agents in Groups 2 through 11 included nucleotide sequences that were each designed to inhibit expression of an ANGPTL3 gene at position 921 of the gene; and the ANGPTL3 RNAi agents in Groups 12 through 19 included nucleotide sequences that were each designed to inhibit expression of an ANGPTL3 gene at position 922 of the gene. (See SEQ ID NO:1 for the ANGPTL3 gene sequence referenced). As shown in Table 12 above, each of the RNAi agents achieved inhibition of ANGPTL3 as compared to control. For example, Group 12 (ANGPTL3 RNAi agent AD05308) achieved nearly an 80% reduction in ANGPTL3 protein levels compared in control (0.209) on day 22.
Example 4. In Vivo Testing of ANGPTL3 RNAi Agents in Mice
[0272] To assess the in vivo activity of ANGPTL3 RNAi agents that are designed to target additional positions on the ANGPTL3 gene, six- to eight-week-old female C57bl/6 mice were used. Pre-dose serum samples were taken at day −1 after a four hour fast. At day 1, each mouse was given a single subcutaneous administration of 200 μl containing either 1 mg/kg (mpk) or 0.5 mg/kg (mpk) of an ANGPTL3 RNAi agent in D5W (dextrose in 5% water), or control (D5W) with no RNAi agent, according to the dosing groups recited in Table 17.
TABLE-US-00032 TABLE 17 Dosing Groups of Example 4 Group RNAi Agent and Dose Dosing Regimen 1 D5W (no RNAi agent) Single injection on day 1 2 1.0 mg/kg AD05487 Single injection on day 1 3 1.0 mg/kg AD05488 Single injection on day 1 4 1.0 mg/kg AD05489 Single injection on day 1 5 1.0 mg/kg AD05490 Single injection on day 1 6 1.0 mg/kg AD05491 Single injection on day 1 7 1.0 mg/kg AD05492 Single injection on day 1 8 1.0 mg/kg AD05493 Single injection on day 1 9 1.0 mg/kg AD05494 Single injection on day 1 10 1.0 mg/kg AD05495 Single injection on day 1 11 1.0 mg/kg AD05308 Single injection on day 1 12 0.5 mg/kg AD05308 Single injection on day 1 13 1.0 mg/kg AD05418 Single injection on day 1
[0273] Each of the RNAi agents included a modified sequence and an N-acetyl-galactosamine-containing targeting ligand conjugated to the 5′ terminal end of the sense strand. (See Tables 3, 4, and 5 for modified sequences and targeting ligand structures). The injections were performed between the skin and muscle (i.e. subcutaneous injections) into the loose skin over the neck and shoulder area. Three (3) mice in each group were tested (n=3). Serum was collected on days 8, 15, 22, 29, and day 43 (Groups 1-3, 9, and 11-13 only). Mice were fasted for four hours prior to each collection. ANGPTL3 protein levels in serum were measured by ELISA assay (R&D Systems), according to the manufacturer's recommendations. Triglycerides, high-density lipoprotein (HDL), and total cholesterol in serum were measured on a Cobas® Integra 400 (Roche Diagnostics), according to the manufacturer's recommendations.
[0274] The ANGPTL3 protein levels, triglyceride levels, HDL levels, and total cholesterol levels for each animal were normalized. For normalization, the level of ANGPTL3 protein, triglyceride, HDL, and total cholesterol, respectively, for each animal at a time point, was divided by the pre-treatment level of expression in that animal (in this case at day −1) to determine the ratio of expression “normalized to pre-treatment.” Expression at a specific time point was then normalized to the D5W control group by dividing the “normalized to pre-treatment” ratio for an individual animal by the mean “normalized to pretreatment” ratio of all mice in the D5W control group. This resulted in expression for each time point normalized to that in the control group.
[0275] Data from the study set forth in this Example are shown in the following Tables 18 through 22:
TABLE-US-00033 TABLE 18 Average ANGPTL3 Protein Normalized to Pre-Treatment and Control from Example 4 Day 8 Day 15 Day 22 Day 29 Day 43 Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Group ID ANGPTL3 (+/−) ANGPTL3 (+/−) ANGPTL3 (+/−) ANGPTL3 (+/−) ANGPTL3 (+/−) Group 1 (D5W) 1.000 0.355 1.000 0.428 1.000 0.431 1.000 0.443 1.000 0.256 Group 2 (1.0 0.173 0.022 0.170 0.056 0.138 0.030 0.226 0.034 0.477 0.052 mg/kg AD05487) Group 3 (1.0 0.090 0.011 0.070 0.023 0.092 0.011 0.124 0.024 0.254 0.074 mg/kg AD05488) Group 4 (1.0 0.875 0.229 0.933 0.181 0.911 0.288 1.009 0.331 mg/kg AD05489) Group 5 (1.0 0.821 0.064 0.826 0.091 0.773 0.216 0.837 0.173 mg/kg AD05490) Group 6 (1.0 0.822 0.030 0.739 0.180 0.851 0.128 1.034 0.212 mg/kg AD05491) Group 7 (1.0 0.498 0.016 0.575 0.018 0.561 0.025 0.716 0.031 mg/kg AD05492) Group 8 (1.0 0.667 0.078 0.774 0.084 0.765 0.129 0.802 0.250 mg/kg AD05493) Group 9 (1.0 0.174 0.023 0.192 0.027 0.238 0.044 0.230 0.053 0.467 0.056 mg/kg AD05494) Group 10 (1.0 0.448 0.263 0.680 0.526 0.721 0.609 0.745 0.319 mg/kg AD05495) Group 11 (1.0 0.299 0.103 0.298 0.116 0.252 0.100 0.322 0.097 0.643 0.277 mg/kg AD05308) Group 12 (0.5 0.340 0.038 0.310 0.030 0.319 0.021 0.345 0.040 0.582 0.020 mg/kg AD05308) Group 13 (1.0 0.258 0.033 0.270 0.027 0.387 0.064 0.407 0.010 0.847 0.054 mg/kg AD05418)
TABLE-US-00034 TABLE 19 Average Triglycerides Normalized to Pre-Treatment and Control from Example 4 Day 8 Day 15 Day 22 Day 29 Day 43 Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Group ID TG (+/−) TG (+/−) TG (+/−) TG (+/−) TG (+/−) Group 1 (D5W) 1.000 0.085 1.000 0.013 1.000 0.291 1.000 0.131 1.000 0.193 Group 2 (1.0 0.776 0.051 0.912 0.117 0.761 0.070 0.556 0.228 0.757 0.119 mg/kg AD05487) Group 3 (1.0 0.624 0.040 0.795 0.106 0.837 0.047 0.721 0.077 0.901 0.316 mg/kg AD05488) Group 4 (1.0 0.877 0.065 1.424 0.231 1.189 0.155 1.216 0.030 mg/kg AD05489) Group 5 (1.0 0.930 0.196 1.341 0.359 1.385 0.215 0.820 0.424 mg/kg AD05490) Group 6 (1.0 1.240 0.334 1.896 0.376 1.590 0.311 1.238 0.071 mg/kg AD05491) Group 7 (1.0 0.775 0.086 0.991 0.154 1.085 0.128 1.188 0.129 mg/kg AD05492) Group 8 (1.0 1.255 0.320 1.459 0.436 1.326 0.494 1.190 0.281 mg/kg AD05493) Group 9 (1.0 0.667 0.054 1.118 0.249 1.341 0.198 0.909 0.183 0.995 0.256 mg/kg AD05494) Group 10 (1.0 0.864 0.061 1.343 0.211 1.294 0.097 1.116 0.444 mg/kg AD05495) Group 11 (1.0 0.749 0.074 1.164 0.037 1.152 0.121 1.021 0.057 0.994 0.072 mg/kg AD05308) Group 12 (0.5 1.330 0.203 1.598 0.419 1.732 0.342 1.446 0.515 1.547 0.174 mg/kg AD05308) Group 13 (1.0 0.858 0.068 1.065 0.029 1.079 0.072 0.980 0.037 0.892 0.136 mg/kg AD05418)
TABLE-US-00035 TABLE 20 Average Total Cholesterol Normalized to Pre-Treatment and Control from Example 4 Day 8 Day 15 Day 22 Day 29 Day 43 Avg Total Std Dev Avg Total Std Dev Avg Total Std Dev Avg Total Std Dev Avg Total Std Dev Group ID Chol (+/−) Chol (+/−) Chol (+/−) Chol (+/−) Chol (+/−) Group 1 (D5W) 1.000 0.110 1.000 0.159 1.000 0.074 1.000 0.153 1.000 0.122 Group 2 (1.0 0.728 0.055 0.944 0.110 0.697 0.050 0.560 0.305 0.923 0.086 mg/kg AD05487) Group 3 (1.0 0.827 0.096 0.667 0.086 0.759 0.057 0.683 0.077 0.837 0.072 mg/kg AD05488) Group 4 (1.0 1.139 0.062 1.058 0.110 1.040 0.175 1.068 0.153 mg/kg AD05489) Group 5 (1.0 0.986 0.043 1.064 0.025 1.021 0.140 0.779 0.427 mg/kg AD05490) Group 6 (1.0 1.047 0.069 1.029 0.072 0.934 0.048 0.960 0.072 mg/kg AD05491) Group 7 (1.0 0.957 0.048 0.883 0.059 0.907 0.059 1.001 0.040 mg/kg AD05492) Group 8 (1.0 1.060 0.006 0.879 0.066 0.952 0.068 1.011 0.110 mg/kg AD05493) Group 9 (1.0 0.823 0.045 0.829 0.075 0.980 0.054 0.793 0.100 0.947 0.051 mg/kg AD05494) Group 10 (1.0 0.930 0.128 0.919 0.082 1.025 0.167 0.758 0.240 mg/kg AD05495) Group 11 (1.0 0.868 0.018 0.793 0.026 0.770 0.081 0.819 0.073 1.073 0.149 mg/kg AD05308) Group 12 (0.5 0.992 0.061 0.838 0.028 1.000 0.046 0.958 0.059 1.157 0.088 mg/kg AD05308) Group 13 (1.0 0.818 0.071 0.761 0.087 0.915 0.105 0.853 0.039 1.002 0.076 mg/kg AD05418)
TABLE-US-00036 TABLE 21 Average HDL Normalized to Pre-Treatment and Control from Example 4 Day 8 Day 15 Day 22 Day 29 Day 43 Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Group ID HDL (+/−) HDL (+/−) HDL (+/−) HDL (+/−) HDL (+/−) Group 1 (D5W) 1.000 0.090 1.000 0.158 1.000 0.087 1.000 0.158 1.000 0.141 Group 2 (1.0 0.716 0.074 0.918 0.120 0.658 0.050 0.745 0.065 0.934 0.094 mg/kg AD05487) Group 3 (1.0 0.839 0.094 0.644 0.061 0.727 0.035 0.771 0.104 0.833 0.079 mg/kg AD05488) Group 4 (1.0 1.203 0.071 1.068 0.116 1.056 0.195 1.111 0.177 mg/kg AD05489) Group 5 (1.0 1.022 0.020 1.043 0.027 0.981 0.109 1.021 0.153 mg/kg AD05490) Group 6 (1.0 1.071 0.052 1.015 0.065 0.905 0.058 0.979 0.093 mg/kg AD05491) Group 7 (1.0 1.003 0.076 0.920 0.088 0.920 0.092 1.047 0.055 mg/kg AD05492) Group 8 (1.0 1.096 0.006 0.882 0.053 0.966 0.061 1.046 0.110 mg/kg AD05493) Group 9 (1.0 0.874 0.059 0.782 0.065 0.911 0.045 0.802 0.083 0.978 0.073 mg/kg AD05494) Group 10 (1.0 0.931 0.124 0.863 0.096 0.953 0.157 0.978 0.091 mg/kg AD05495) Group 11 (1.0 0.904 0.026 0.801 0.039 0.728 0.078 0.824 0.082 1.096 0.196 mg/kg AD05308) Group 12 (0.5 1.007 0.085 0.770 0.021 0.921 0.037 0.934 0.064 1.101 0.106 mg/kg AD05308) Group 13 (1.0 0.828 0.103 0.730 0.115 0.846 0.104 0.845 0.050 1.018 0.082 mg/kg AD05418)
TABLE-US-00037 TABLE 22 Average LDL Normalized to Pre-Treatment and Control from Example 4 Day 8 Day 15 Day 22 Day 29 Day 43 Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Group ID LDL (+/−) LDL (+/−) LDL (+/−) LDL (+/−) LDL (+/−) Group 1 (D5W) 1.000 0.166 1.000 0.257 1.000 0.244 1.000 0.122 1.000 0.247 Group 2 (1.0 0.916 0.207 1.125 0.079 0.845 0.020 0.744 0.095 0.989 0.031 mg/kg AD05487) Group 3 (1.0 0.936 0.201 0.714 0.189 0.811 0.105 0.801 0.084 0.902 0.189 mg/kg AD05488) Group 4 (1.0 1.197 0.191 0.874 0.068 0.985 0.226 0.943 0.132 0.000 0.000 mg/kg AD05489) Group 5 (1.0 0.937 0.059 1.045 0.183 1.116 0.235 1.135 0.138 0.000 0.000 mg/kg AD05490) Group 6 (1.0 0.966 0.199 0.867 0.147 0.912 0.202 0.839 0.197 0.000 0.000 mg/kg AD05491) Group 7 (1.0 0.857 0.135 0.777 0.118 0.747 0.116 0.851 0.157 0.000 0.000 mg/kg AD05492) Group 8 (1.0 0.946 0.014 0.776 0.112 0.782 0.053 0.927 0.329 0.000 0.000 mg/kg AD05493) Group 9 (1.0 0.846 0.030 1.129 0.203 1.086 0.054 0.922 0.132 0.845 0.081 mg/kg AD05494) Group 10 (1.0 1.192 0.150 1.084 0.087 1.232 0.263 0.898 0.114 0.000 0.000 mg/kg AD05495) Group 11 (1.0 0.842 0.103 0.688 0.072 0.829 0.144 0.897 0.143 1.033 0.164 mg/kg AD05308) Group 12 (0.5 0.965 0.172 0.830 0.055 1.209 0.146 1.251 0.139 1.375 0.102 mg/kg AD05308) Group 13 (1.0 1.044 0.035 0.841 0.033 1.142 0.231 0.966 0.080 0.921 0.135 mg/kg AD05418)
[0276] The ANGPTL3 RNAi agents AD05487 and AD05488 (Groups 2 and 3) included nucleotide sequences that were designed to inhibit expression of an ANGPTL3 gene at position 304 of the gene; ANGPTL3 RNAi agent AD05489 and AD05490 (Groups 4 and 5) included nucleotide sequences designed to inhibit expression of an ANGPTL3 gene at position 172 of the gene; ANGPTL3 RNAi agents AD05491 and AD05492 (Groups 6 and 7) included nucleotide sequences designed to inhibit expression of an ANGPTL3 gene at position 1008 of the gene; ANGPTL3 RNAi agent AD0593 (Group 8) included nucleotide sequences designed to inhibit expression of an ANGPTL3 gene at position 1009 of the gene; ANGPTL3 RNAi agents AD05494, AD05495, and AD05308 (Groups 9, 10, 11, and 12) included nucleotide sequences designed to inhibit expression of an ANGPTL3 gene at position 1302 of the gene; and ANGPTL3 RNAi agents AD05418 (Group 13) included nucleotide sequences designed to inhibit expression of an ANGPTL3 gene at position 921 of the gene. (See SEQ ID NO:1 for the ANGPTL3 gene sequence referenced).
[0277] As shown in Table 18 above, while most of the RNAi agents achieved a reduction in ANGPTL3 protein levels at nearly every time point measured, the ANGPTL3 RNAi agents in Group 2 (AD05487) and Group 3 (AD05488), which each included nucleotide sequences designed to inhibit ANGPTL3 gene expression at position 304 of the gene, outperformed the other Groups in this study. For example, at days 15 and 22, ANGPTL3 RNAi agent AD05488 (Group 3) achieved greater than 90% knockdown of ANGPTL3 protein (i.e., 0.070 on day 15 and 0.092 on day 22). Similarly, ANGPTL3 RNAi agent AD05487 (Group 2) achieved nearly 75% knockdown on days 15 and 22 (i.e., 0.170 on day 15 and 0.138 on day 22). Moreover, the same trends were seen across the additional measured parameters including TG, total cholesterol, and LDL, as both Group 2 (AD05487) and Group 3 (AD05488) generally outperformed the other RNAi agents tested (see Tables 19-22). For example, For Groups 2 and 3, on day 29, triglyceride levels were reduced by at least 28% (i.e., 0.556 or 0.721), total cholesterol was reduced by at least 31% (i.e., 0.560 or 0.683), and LDL levels were reduced by nearly 20% (0.744 or 0.801).
Example 5. In Vivo Testing of ANGPTL3 RNAi Agents in Cynomolgus Monkeys
[0278] ANGPTL3 RNAi agents were evaluated in cynomolgus monkeys. On day 1, cynomolgus macaque (Macaca fascicularis) primates (also referred to herein as “cynos”) were administered a single subcutaneous injection of 0.3 mL/kg (approximately 2-3 mL volume, depending on animal mass) containing 3.0 mg/kg of ANGPTL3 RNAi agent AD05308 or AD05418, formulated in saline. Each of the ANGPTL3 RNAi agents contained modified nucleotides and included N-acetyl-galactosamine targeting ligands conjugated to the 5′-terminal end of the sense strand, as shown in Tables 3, 4, and 5.
[0279] Two (2) cynos in each group were tested (n=2). Blood samples were drawn and serum samples were analyzed on days −37 (pre-dose), −15 (pre-dose), and −1 (pre-dose), 8, 16, 23, 30, and 37. Cynos were fasted overnight prior to each collection. ANGPTL3 protein levels in serum were measured by ELISA assay (R&D Systems), according to the manufacturer's recommendations. The ANGPTL3 protein levels were normalized. For normalization, the level of ANGPTL3 protein for each animal at a time point, was divided by the average pre-treatment level of expression in that animal (in this case at days −37, −15, and −1) to determine the ratio of expression “normalized to pre-treatment.”
[0280] Data from the study set forth in this Example are shown in the following Tables 23 and 24:
TABLE-US-00038 TABLE 23 Average ANGPTL3 Protein Normalized to Pre-Treatment from Example 5 By Group Day 8 Day 16 Day 23 Day 30 Day 37 Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Group ID ANGPTL3 (+/−) ANGPTL3 (+/−) ANGPTL3 (+/−) ANGPTL3 (+/−) ANGPTL3 (+/−) Group 1 (3.0 0.416 0.183 0.447 0.034 0.649 0.260 0.647 0.106 0.565 0.204 mg/kg AD05308) Group 2 (3.0 0.544 0.058 0.334 0.035 0.300 0.057 0.389 0.110 0.270 0.082 mg/kg AD05418)
TABLE-US-00039 TABLE 24 Average ANGPTL3 Protein Normalized to Pre-Treatment from Example 5 By Individual Animal Day 8 Day 16 Day 23 Day 30 Day 37 Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Group ID ANGPTL3 (+/−) ANGPTL3 (+/−) ANGPTL3 (+/−) ANGPTL3 (+/−) ANGPTL3 (+/−) AD05308 (3.0 0.545 0.021 0.423 0.011 0.832 0.014 0.722 0.025 0.709 0.020 mg/kg) (Cyno A) AD05308 (3.0 0.287 0.004 0.471 0.010 0.465 0.017 0.572 0.025 0.421 0.002 mg/kg) (Cyno B) AD05418 (3.0 0.585 0.006 0.358 0.008 0.260 0.012 0.311 0.010 0.212 0.001 mg/kg) (Cyno A) AD05418 (3.0 0.503 0.013 0.309 0.008 0.340 0.021 0.467 0.022 0.328 0.010 mg/kg) (Cyno B)
[0281] Each of the cynomolgus monkeys dosed with either AD05308 or AD05418 showed a reduction in ANGPTL3 protein compared to pre-treatment measurements across all measured time points. For example, for individual animals, on Day 16, the cynos dosed with AD05418 showed a reduction of either approximately 64% (0.358 normalized protein level) or 69% (0.309 normalized protein level) in ANGPTL3 protein. Further, even on day 37, the cynos of Group 2 (AD05418) showed an average reduction of approximately 73% (0.270) in ANGPTL protein levels.
Example 6. In Vivo Testing of ANGPTL3 RNAi Agents in Mice
[0282] To assess the in vivo activity of additional ANGPTL3 RNAi agents that are designed to target position 304 on the ANGPTL3 gene, six- to eight-week-old female C57bl/6 mice were used. Pre-dose serum samples were taken at day −1 after a four hour fast. At day 1, each mouse was given a single subcutaneous administration of 200 μl containing 0.5 mg/kg (mpk) of an ANGPTL3 RNAi agent in D5W (dextrose in 5% water), or control (D5W) with no RNAi agent, according to the dosing groups recited in Table 25.
TABLE-US-00040 TABLE 25 Dosing Groups of Example 6 Group RNAi Agent and Dose Dosing Regimen 1 D5W (no RNAi agent) Single injection on day 1 2 0.5 mg/kg AD05488 Single injection on day 1 3 0.5 mg/kg AD05652 Single injection on day 1 4 0.5 mg/kg AD05653 Single injection on day 1 5 0.5 mg/kg AD05654 Single injection on day 1 6 0.5 mg/kg AD05655 Single injection on day 1 7 0.5 mg/kg AD05656 Single injection on day 1 8 0.5 mg/kg AD05657 Single injection on day 1 9 0.5 mg/kg AD05658 Single injection on day 1 10 0.5 mg/kg AD05660 Single injection on day 1 11 0.5 mg/kg AD05661 Single injection on day 1 12 0.5 mg/kg AD05662 Single injection on day 1
[0283] Each of the RNAi agents included a modified sequence and an N-acetyl-galactosamine-containing targeting ligand conjugated to the 5′ terminal end of the sense strand. (See Tables 3, 4, and 5 for modified sequences and targeting ligand structures). The injections were performed between the skin and muscle (i.e. subcutaneous injections) into the loose skin over the neck and shoulder area. Three (3) mice in each group were tested (n=3). Serum was collected on days 8, 15, 22, 30, and on day 43 for certain groups (i.e., Groups 1, 2, 5, and 10 only). Mice were fasted for four hours prior to each collection. ANGPTL3 protein levels in serum were measured by ELISA assay (R&D Systems), according to the manufacturer's recommendations. Triglycerides, total cholesterol, high-density lipoprotein (HDL), and low-density lipoprotein (LDL) in serum were measured on a Cobas® Integra 400 (Roche Diagnostics), according to the manufacturer's recommendations.
[0284] The ANGPTL3 protein levels, triglyceride levels, total cholesterol levels, HDL levels, and LDL levels for each animal were normalized. For normalization, the level of ANGPTL3 protein, triglyceride, HDL, and total cholesterol, respectively, for each animal at a time point, was divided by the pre-treatment level of expression in that animal (in this case at day −1) to determine the ratio of expression “normalized to pre-treatment.” Expression at a specific time point was then normalized to the D5W control group by dividing the “normalized to pre-treatment” ratio for an individual animal by the mean “normalized to pretreatment” ratio of all mice in the D5W control group. This resulted in expression for each time point normalized to that in the control group.
[0285] Data from the study set forth in this Example are shown in the following Tables:
TABLE-US-00041 TABLE 26 Average ANGPTL3 Protein Normalized to Pre-Treatment and Control from Example 6 Day 8 Day 15 Day 22 Day 30 Day 43 Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Group ID ANGPTL3 (+/−) ANGPTL3 (+/−) ANGPTL3 (+/−) ANGPTL3 (+/−) ANGPTL3 (+/−) Group 1 (D5W) 1.000 0.117 1.000 0.134 1.000 0.136 1.000 0.013 1.000 0.100 Group 2 (0.5 0.221 0.031 0.272 0.046 0.254 0.022 0.381 0.043 0.475 0.054 mg/kg AD05488) Group 3 (0.5 0.394 0.130 0.346 0.089 0.333 0.102 0.478 0.047 mg/kg AD05652) Group 4 (0.5 0.388 0.056 0.416 0.087 0.378 0.055 0.548 0.055 mg/kg AD05653) Group 5 (0.5 0.261 0.061 0.305 0.014 0.308 0.048 0.340 0.012 0.413 0.051 mg/kg AD05654) Group 6 (0.5 0.301 0.037 0.338 0.027 0.304 0.017 0.403 0.052 mg/kg AD05655) Group 7 (0.5 0.402 0.138 0.347 0.074 0.328 0.039 0.445 0.078 mg/kg AD05656) Group 8 (0.5 0.341 0.137 0.385 0.052 0.371 0.011 0.425 0.121 mg/kg AD05657) Group 9 (0.5 0.427 0.077 0.484 0.093 0.492 0.032 0.477 0.045 mg/kg AD05658) Group 10 (0.5 0.342 0.042 0.372 0.047 0.368 0.085 0.404 0.032 0.485 0.081 mg/kg AD05660) Group 11 (0.5 0.436 0.120 0.322 0.057 0.372 0.028 0.430 0.037 mg/kg AD05661) Group 12 (0.5 0.602 0.106 0.609 0.189 0.688 0.294 0.736 0.128 mg/kg AD05662)
TABLE-US-00042 TABLE 27 Average Triglycerides Normalized to Pre-Treatment and Control from Example 6 Day 8 Day 15 Day 22 Day 30 Day 43 Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Group ID TG (+/−) TG (+/−) TG (+/−) TG (+/−) TG (+/−) Group 1 (D5W) 1.000 0.181 1.000 0.078 1.000 0.171 1.000 0.203 1.000 0.065 Group 2 (0.5 mg/kg AD05488) 0.568 0.095 0.637 0.035 0.484 0.052 0.652 0.086 0.689 0.089 Group 3 (0.5 mg/kg AD05652) 0.653 0.102 0.636 0.058 0.582 0.120 0.858 0.182 Group 4 (0.5 mg/kg AD05653) 0.628 0.205 0.528 0.123 0.469 0.111 0.737 0.036 Group 5 (0.5 mg/kg AD05654) 0.522 0.054 0.624 0.110 0.536 0.047 0.652 0.060 1.001 0.175 Group 6 (0.5 mg/kg AD05655) 0.512 0.142 0.672 0.162 0.491 0.095 0.785 0.132 Group 7 (0.5 mg/kg AD05656) 0.633 0.109 0.631 0.044 0.442 0.021 0.657 0.031 Group 8 (0.5 mg/kg AD05657) 0.579 0.075 0.589 0.024 0.416 0.061 0.670 0.214 Group 9 (0.5 mg/kg AD05658) 0.529 0.037 0.555 0.074 0.490 0.087 0.720 0.108 Group 10 (0.5 mg/kg AD05660) 0.567 0.032 0.713 0.083 0.480 0.153 0.644 0.074 1.040 0.228 Group 11 (0.5 mg/kg AD05661) 0.574 0.139 0.697 0.208 0.480 0.112 0.596 0.151 Group 12 (0.5 mg/kg AD05662) 0.563 0.091 0.755 0.086 0.592 0.078 0.644 0.062
TABLE-US-00043 TABLE 28 Average Total Cholesterol Normalized to Pre-Treatment and Control from Example 6 Day 8 Day 15 Day 22 Day 30 Day 43 Avg Total Std Dev Avg Total Std Dev Avg Total Std Dev Avg Total Std Dev Avg Total Std Dev Group ID Chol (+/−) Chol (+/−) Chol (+/−) Chol (+/−) Chol (+/−) Group 1 (D5W) 1.000 0.062 1.000 0.077 1.000 0.081 1.000 0.041 1.000 0.113 Group 2 (0.5 mg/kg AD05488) 0.782 0.086 0.768 0.011 0.801 0.070 0.961 0.114 1.037 0.123 Group 3 (0.5 mg/kg AD05652) 0.829 0.094 0.815 0.078 0.724 0.069 0.835 0.069 Group 4 (0.5 mg/kg AD05653) 0.907 0.129 0.891 0.120 0.781 0.067 1.024 0.106 Group 5 (0.5 mg/kg AD05654) 0.752 0.083 0.741 0.035 0.741 0.081 0.788 0.087 0.764 0.076 Group 6 (0.5 mg/kg AD05655) 0.751 0.043 0.815 0.089 0.708 0.048 0.845 0.126 Group 7 (0.5 mg/kg AD05656) 0.779 0.078 0.696 0.068 0.717 0.097 0.842 0.038 Group 8 (0.5 mg/kg AD05657) 0.772 0.032 0.736 0.053 0.690 0.021 0.797 0.059 Group 9 (0.5 mg/kg AD05658) 0.760 0.068 0.784 0.075 0.778 0.037 0.784 0.062 Group 10 (0.5 mg/kg AD05660) 0.774 0.060 0.824 0.106 0.898 0.108 0.820 0.019 0.928 0.121 Group 11 (0.5 mg/kg AD05661) 0.719 0.076 0.755 0.013 0.784 0.076 0.758 0.061 Group 12 (0.5 mg/kg AD05662) 0.744 0.024 0.918 0.063 0.864 0.039 0.905 0.046
TABLE-US-00044 TABLE 29 Average HDL Normalized to Pre-Treatment and Control from Example 6 Day 8 Day 15 Day 22 Day 30 Day 43 Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Group ID HDL (+/−) HDL (+/−) HDL (+/−) HDL (+/−) HDL (+/−) Group 1 (D5W) 1.000 0.072 1.000 0.069 1.000 0.083 1.000 0.040 1.000 0.098 Group 2 (0.5 mg/kg AD05488) 0.783 0.069 0.763 0.020 0.793 0.076 0.956 0.122 1.088 0.131 Group 3 (0.5 mg/kg AD05652) 0.811 0.106 0.778 0.087 0.690 0.098 0.806 0.054 Group 4 (0.5 mg/kg AD05653) 0.915 0.154 0.898 0.155 0.773 0.087 1.027 0.113 Group 5 (0.5 mg/kg AD05654) 0.708 0.120 0.725 0.040 0.717 0.105 0.776 0.097 0.731 0.056 Group 6 (0.5 mg/kg AD05655) 0.752 0.045 0.825 0.098 0.708 0.063 0.835 0.119 Group 7 (0.5 mg/kg AD05656) 0.747 0.078 0.682 0.081 0.726 0.087 0.833 0.050 Group 8 (0.5 mg/kg AD05657) 0.757 0.034 0.716 0.054 0.695 0.013 0.801 0.065 Group 9 (0.5 mg/kg AD05658) 0.778 0.084 0.787 0.075 0.807 0.062 0.793 0.069 Group 10 (0.5 mg/kg AD05660) 0.768 0.056 0.807 0.108 0.912 0.101 0.800 0.008 0.899 0.129 Group 11 (0.5 mg/kg AD05661) 0.739 0.082 0.752 0.014 0.796 0.086 0.782 0.034 Group 12 (0.5 mg/kg AD05662) 0.740 0.020 0.919 0.096 0.887 0.086 0.955 0.045
TABLE-US-00045 TABLE 30 Average LDL Normalized to Pre-Treatment and Control from Example 6 Day 8 Day 15 Day 22 Day 30 Day 43 Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Group ID LDL (+/−) LDL (+/−) LDL (+/−) LDL (+/−) LDL (+/−) Group 1 (D5W) 1.000 0.138 1.000 0.136 1.000 0.177 1.000 0.097 1.000 0.120 Group 2 (0.5 mg/kg AD05488) 0.805 0.162 0.880 0.075 0.991 0.139 1.093 0.171 0.970 0.114 Group 3 (0.5 mg/kg AD05652) 0.867 0.093 1.015 0.060 0.878 0.102 0.904 0.175 Group 4 (0.5 mg/kg AD05653) 1.043 0.198 1.134 0.219 1.034 0.229 1.259 0.233 Group 5 (0.5 mg/kg AD05654) 1.087 0.094 0.845 0.033 0.893 0.070 1.006 0.136 0.840 0.112 Group 6 (0.5 mg/kg AD05655) 0.877 0.048 0.911 0.081 0.752 0.111 0.976 0.194 Group 7 (0.5 mg/kg AD05656) 0.818 0.120 0.837 0.052 0.782 0.216 0.963 0.117 Group 8 (0.5 mg/kg AD05657) 0.888 0.051 0.853 0.049 0.791 0.073 0.903 0.136 Group 9 (0.5 mg/kg AD05658) 0.715 0.065 0.818 0.070 0.741 0.041 0.764 0.076 Group 10 (0.5 mg/kg AD05660) 0.795 0.078 0.909 0.094 1.041 0.040 0.998 0.187 0.941 0.078 Group 11 (0.5 mg/kg AD05661) 0.687 0.048 0.855 0.051 0.877 0.079 0.798 0.102 Group 12 (0.5 mg/kg AD05662) 0.723 0.037 0.908 0.068 0.865 0.125 0.832 0.106
[0286] Each of the ANGPTL3 RNAi agents tested (i.e., AD05488, AD05652, AD05653, AD05654, AD05655, AD05656, AD05657, AD05658, AD05660, AD05661, and AD05662) each included nucleotide sequences designed to target the ANGPTL3 gene at position 304 (see, e.g., SEQ ID NO:1). As shown above, each of the RNAi agents showed a substantial reduction in ANGPTL3 protein levels through at least day 22. Reductions in TG levels and total cholesterol were also observed.
Example 7. In Vivo Testing of ANGPTL3 RNAi Agents in Mice
[0287] To further assess the in vivo activity of additional ANGPTL3 RNAi agents that are designed to target position 304 on the ANGPTL3 gene, six- to eight-week-old female C57bl/6 mice were used. Pre-dose serum samples were taken at day −1 after a four hour fast. At day 1, each mouse was given a single subcutaneous administration of 200 μl containing 0.5 mg/kg (mpk) of an ANGPTL3 RNAi agent in D5W (dextrose in 5% water), or control (D5W) with no RNAi agent, according to the dosing groups recited in Table 31.
TABLE-US-00046 TABLE 31 Dosing Groups of Example 7 Group RNAi Agent and Dose Dosing Regimen 1 D5W (no RNAi agent) Single injection on day 1 2 0.5 mg/kg AD05488 Single injection on day 1 3 0.5 mg/kg AD05774 Single injection on day 1 4 0.5 mg/kg AD05775 Single injection on day 1 5 0.5 mg/kg AD05776 Single injection on day 1 6 0.5 mg/kg AD05777 Single injection on day 1 7 0.5 mg/kg AD05308 Single injection on day 1 8 0.5 mg/kg AD05418 Single injection on day 1
[0288] Each of the RNAi agents included a modified sequence and an N-acetyl-galactosamine-containing targeting ligand conjugated to the 5′ terminal end of the sense strand. (See Tables 3, 4, and 5 for modified sequences and targeting ligand structures). The injections were performed between the skin and muscle (i.e. subcutaneous injections) into the loose skin over the neck and shoulder area. Three (3) mice in each group were tested (n=3). Serum was collected on days 8, 15, 22, and 29. Mice were fasted for four hours prior to each collection. ANGPTL3 protein levels in serum were measured by ELISA assay (R&D Systems), according to the manufacturer's recommendations. Triglycerides, total cholesterol, high-density lipoprotein (HDL), and low-density lipoprotein (LDL) in serum were measured on a Cobas® Integra 400 (Roche Diagnostics), according to the manufacturer's recommendations.
[0289] The ANGPTL3 protein levels, triglyceride levels, total cholesterol levels, HDL levels, and LDL levels for each animal were normalized. For normalization, the level of ANGPTL3 protein, triglyceride, HDL, and total cholesterol, respectively, for each animal at a time point, was divided by the pre-treatment level of expression in that animal (in this case at day −1) to determine the ratio of expression “normalized to pre-treatment.” Expression at a specific time point was then normalized to the D5W control group by dividing the “normalized to pre-treatment” ratio for an individual animal by the mean “normalized to pretreatment” ratio of all mice in the D5W control group. This resulted in expression for each time point normalized to that in the control group.
[0290] Data from the study set forth in this Example are shown in the following Tables 32-36:
TABLE-US-00047 TABLE 32 Average ANGPTL3 Protein Normalized to Pre-Treatment and Control from Example 7 Day 8 Day 15 Day 22 Day 29 Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Group ID ANGPTL3 (+/−) ANGPTL3 (+/−) ANGPTL3 (+/−) ANGPTL3 (+/−) Group 1 (D5W) 1.000 0.139 1.000 0.060 1.000 0.414 1.000 0.227 Group 2 (0.5 mg/kg AD05488) 0.339 0.014 0.379 0.098 0.346 0.031 0.469 0.058 Group 3 (0.5 mg/kg AD05652) 0.343 0.075 0.302 0.062 0.287 0.018 0.425 0.060 Group 4 (0.5 mg/kg AD05653) 0.247 0.033 0.232 0.038 0.218 0.008 0.300 0.061 Group 5 (0.5 mg/kg AD05654) 0.327 0.121 0.297 0.099 0.300 0.096 0.378 0.043 Group 6 (0.5 mg/kg AD05655) 0.297 0.056 0.246 0.035 0.257 0.068 0.345 0.035 Group 7 (0.5 mg/kg AD05656) 0.447 0.101 0.388 0.139 0.440 0.092 0.523 0.171 Group 8 (0.5 mg/kg AD05657) 0.534 0.117 0.565 0.077 0.639 0.042 0.758 0.119
TABLE-US-00048 TABLE 33 Average Triglycerides Normalized to Pre-Treatment and Control from Example 7 Day 8 Day 15 Day 22 Day 29 Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Group ID TG (+/−) TG (+/−) TG (+/−) TG (+/−) Group 1 (D5W) 1.000 0.074 1.000 0.116 1.000 0.151 1.000 0.089 Group 2 (0.5 mg/kg AD05488) 0.856 0.223 0.947 0.279 0.922 0.116 0.877 0.400 Group 3 (0.5 mg/kg AD05652) 0.867 0.165 0.641 0.037 0.832 0.177 0.723 0.027 Group 4 (0.5 mg/kg AD05653) 0.837 0.109 0.610 0.107 0.819 0.063 0.885 0.140 Group 5 (0.5 mg/kg AD05654) 0.738 0.130 0717 0.120 0.601 0.105 0.718 0.180 Group 6 (0.5 mg/kg AD05655) 0.755 0.099 0.702 0.001 0.700 0.120 0.648 0.093 Group 7 (0.5 mg/kg AD05656) 0.836 0.343 0.755 0.152 0.839 0.199 0.705 0.219 Group 8 (0.5 mg/kg AD05657) 0.830 0.316 0.655 0.049 0.815 0.184 0.586 0.243
TABLE-US-00049 TABLE 34 Average Total Cholesterol Normalized to Pre-Treatment and Control from Example 7 Day 8 Day 15 Day 22 Day 29 Avg Total Std Dev Avg Total Std Dev Avg Total Std Dev Avg Total Std Dev Group ID Chol (+/−) Chol (+/−) Chol (+/−) Chol (+/−) Group 1 (D5W) 1.000 0.058 1.000 0.162 1.000 0.094 1.000 0.032 Group 2 (0.5 mg/kg AD05488) 0.802 0.033 0.810 0.012 0.810 0.043 0.906 0.064 Group 3 (0.5 mg/kg AD05652) 1.001 0.047 0.923 0.070 0.932 0.064 1.231 0.041 Group 4 (0.5 mg/kg AD05653) 0.794 0.041 0.777 0.049 0.812 0.037 1.108 0.216 Group 5 (0.5 mg/kg AD05654) 0.762 0.073 0.745 0.087 0.784 0.075 1.011 0.120 Group 6 (0.5 mg/kg AD05655) 0.797 0.078 0.800 0.019 0.794 0.122 0.995 0.127 Group 7 (0.5 mg/kg AD05656) 0.756 0.037 0.814 0.098 0.896 0.116 0.927 0.096 Group 8 (0.5 mg/kg AD05657) 0.950 0.082 0.878 0.044 0.926 0.012 1.023 0.056
TABLE-US-00050 TABLE 35 Average HDL Normalized to Pre-Treatment and Control from Example 7 Day 8 Day 15 Day 22 Day 29 Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Group ID HDL (+/−) HDL (+/−) HDL (+/−) HDL (+/−) Group 1 (D5W) 1.000 0.055 1.000 0.152 1.000 0.088 1.000 0.029 Group 2 (0.5 mg/kg AD05488) 0.783 0.020 0.793 0.009 0.780 0.030 0.886 0.070 Group 3 (0.5 mg/kg AD05652) 0.982 0.038 0.930 0.013 0.901 0.085 1.263 0.021 Group 4 (0.5 mg/kg AD05653) 0.754 0.028 0.757 0.038 0.736 0.017 1.069 0.193 Group 5 (0.5 mg/kg AD05654) 0.760 0.059 0.743 0.062 0.773 0.055 1.022 0.093 Group 6 (0.5 mg/kg AD05655) 0.784 0.085 0.768 0.003 0.801 0.113 1.008 0.117 Group 7 (0.5 mg/kg AD05656) 0.750 0.033 0.791 0.079 0.846 0.115 0.905 0.107 Group 8 (0.5 mg/kg AD05657) 0.907 0.087 0.857 0.035 0.910 0.014 1.048 0.050
TABLE-US-00051 TABLE 36 Average LDL Normalized to Pre-Treatment and Control from Example 7 Day 8 Day 15 Day 22 Day 29 Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Group ID LDL (+/−) LDL (+/−) LDL (+/−) LDL (+/−) Group 1 (D5W) 1.000 0.119 1.000 0.088 1.000 0.110 1.000 0.151 Group 2 (0.5 mg/kg AD05488) 0.953 0.186 0.825 0.074 0.860 0.187 1.055 0.095 Group 3 (0.5 mg/kg AD05652) 1.188 0.200 1.101 0.197 1.055 0.043 1.474 0.267 Group 4 (0.5 mg/kg AD05653) 0.975 0.188 0.918 0.135 1.095 0.180 1.534 0.417 Group 5 (0.5 mg/kg AD05654) 0.849 0.143 0.764 0.223 0.861 0.158 1.207 0.269 Group 6 (0.5 mg/kg AD05655) 0.886 0.116 0.869 0.165 0.966 0.383 1.224 0.407 Group 7 (0.5 mg/kg AD05656) 0.710 0.077 0.801 0.105 0.933 0.123 1.047 0.146 Group 8 (0.5 mg/kg AD05657) 1.160 0.143 0.928 0.128 0.950 0.085 1.131 0.150
Example 8. In Vivo Testing of ANGPTL3 RNAi Agents in Cynomolgus Monkeys
[0291] Additional ANGPTL3 RNAi agents were evaluated in cynomolgus monkeys. On day 1, cynomolgus macaque (Macaca fascicularis) primates (also referred to herein as “cynos”) were administered a single subcutaneous injection of 0.3 mL/kg (approximately 1-2 mL volume, depending on animal mass) containing 3.0 mg/kg of one of ANGPTL3 RNAi agent AD05577, AD05307, AD05488, AD05654, or AD05659, each formulated in saline. Each of the ANGPTL3 RNAi agents contained modified nucleotides and included N-acetyl-galactosamine targeting ligands conjugated to the 5′-terminal end of the sense strand, as shown in Tables 3, 4, and 5.
[0292] Two (2) cynos in each group were tested (n=2). Blood samples were drawn and serum samples were analyzed on days −8 (pre-dose), 1 (pre-dose), 8, 15, 22, 29, and 36. Cynos were fasted overnight prior to each collection. ANGPTL3 protein levels in serum were measured by ELISA assay (R&D Systems), according to the manufacturer's recommendations. Triglycerides, total cholesterol, high-density lipoprotein (HDL), and low-density lipoprotein (LDL) in serum were measured on a Cobas® Integra 400 (Roche Diagnostics), according to the manufacturer's recommendations.
[0293] The ANGPTL3 protein levels, triglyceride levels, total cholesterol levels, HDL levels, and LDL levels for each animal were normalized. For normalization, the level of ANGPTL3 protein, triglyceride, HDL, and total cholesterol, respectively, for each animal at a time point, was divided by the average pre-treatment level of expression in that animal (in this case at days −8, and 1 (pre-dose)) to determine the ratio of expression “normalized to pre-treatment.”
[0294] Data from the study set forth in this Example are shown in the following Tables 37-41:
TABLE-US-00052 TABLE 37 Average ANGPTL3 Protein Normalized to Pre-Treatment from Example 8 Day 8 Day 15 Day 22 Day 29 Day 36 Std Std Std Std Std Avg Dev Avg Dev Avg Dev Avg Dev Avg Dev Group ID ANGPTL3 (+/−) ANGPTL3 (+/−) ANGPTL3 (+/−) ANGPTL3 (+/−) ANGPTL3 (+/−) Group 1 (3.0 0.503 0.015 0.544 0.037 0.754 0.147 0.586 0.026 0.479 0.054 mg/kg AD05577) Group 2 (3.0 0.486 0.116 0.402 0.134 0.726 0.306 0.518 0.210 0.392 0.159 mg/kg AD05307) Group 3 (3.0 0.423 0.071 0.334 0.067 0.343 0.110 0.276 0.069 0.229 0.123 mg/kg AD05488) Group 4 (3.0 0.366 0.048 0.262 0.055 0.394 0.082 0.202 0.062 0.203 0.024 mg/kg AD05654) Group 5 (3.0 0.406 0.040 0.434 0.095 0.610 0.033 0.522 0.014 0.349 0.030 mg/kg AD05659)
TABLE-US-00053 TABLE 38 Average Triglycerides Normalized to Pre-Treatment from Example 8 Day 8 Day 15 Day 22 Day 29 Day 36 Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Group ID TG (+/−) TG (+/−) TG (+/−) TG (+/−) TG (+/−) Group 1 (3.0 1.159 0.247 0.977 0.076 0.855 0.034 0.886 0.010 0.748 0.014 mg/kg AD05577) Group 2 (3.0 1.157 0.127 1.058 0.389 0.895 0.118 0.969 0.264 0.806 0.008 mg/kg AD05307) Group 3 (3.0 0.727 0.158 0.586 0.175 0.399 0.075 0.534 0.157 0.364 0.079 mg/kg AD05488) Group 4 (3.0 0.949 0.282 0.645 0.293 0.534 0.292 0.542 0.281 0.429 0.231 mg/kg AD05654) Group 5 (3.0 0.893 0.225 0.670 0.194 0.707 0.092 0.600 0.044 0.635 0.094 mg/kg AD05659)
TABLE-US-00054 TABLE 39 Average Total Cholesterol Normalized to Pre-Treatment from Example 8 Day 8 Day 15 Day 22 Day 29 Day 36 Avg Total Std Dev Avg Total Std Dev Avg Total Std Dev Avg Total Std Dev Avg Total Std Dev Group ID Chol (+/−) Chol (+/−) Chol (+/−) Chol (+/−) Chol (+/−) Group 1 (3.0 mg/kg 0.885 0.110 0.931 0.123 0.844 0.181 0.839 0.188 0.936 0.195 AD05577) Group 2 (3.0 mg/kg 0.994 0.017 1.006 0.017 0.905 0.021 0.954 0.074 0.909 0.038 AD05307) Group 3 (3.0 mg/kg 0.840 0.020 0.779 0.067 0.743 0.033 0.674 0.004 0.722 0.021 AD05488) Group 4 (3.0 mg/kg 0.912 0.007 0.933 0.004 0.794 0.071 0.806 0.011 0.832 0.042 AD05654) Group 5 (3.0 mg/kg 0.928 0.053 0.841 0.004 0.748 0.020 0.796 0.048 0.797 0.028 AD05659)
TABLE-US-00055 TABLE 40 Average HDL Normalized to Pre-Treatment from Example 8 Day 8 Day 15 Day 22 Day 29 Day 36 Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Group ID HDL (+/−) HDL (+/−) HDL (+/−) HDL (+/−) HDL (+/−) Group 1 (3.0 0.855 0.101 0.788 0.096 0.818 0.192 0.857 0.124 0.852 0.119 mg/kg AD05577) Group 2 (3.0 1.007 0.039 0.946 0.088 0.879 0.022 0.998 0.063 0.863 0.070 mg/kg AD05307) Group 3 (3.0 0.832 0.006 0.695 0.075 0.688 0.097 0.657 0.032 0.622 0.099 mg/kg AD05488) Group 4 (3.0 0.865 0.018 0.804 0.017 0.698 0.056 0.760 0.014 0.682 0.015 mg/kg AD05654) Group 5 (3.0 0.910 0.008 0.865 0.084 0.765 0.073 0.857 0.129 0.761 0.104 mg/kg AD05659)
TABLE-US-00056 TABLE 41 Average LDL Normalized to Pre-Treatment from Example 8 Day 8 Day 15 Day 22 Day 29 Day 36 Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Group ID LDL (+/−) LDL (+/−) LDL (+/−) LDL (+/−) LDL (+/−) Group 1 0.951 0.136 1.091 0.150 0.860 0.220 0.991 0.288 0.925 0.258 (3.0 mg/kg AD05577) Group 2 1.008 0.093 1.102 0.012 0.971 0.113 1.106 0.103 0.894 0.021 (3.0 mg/kg AD05307) Group 3 0.934 0.051 0.926 0.020 0.891 0.092 0.872 0.085 0.805 0.081 (3.0 mg/kg AD05488) Group 4 1.015 0.014 1.134 0.026 0.957 0.097 1.022 0.035 0.962 0.068 (3.0 mg/kg AD05654) Group 5 1.188 0.065 1.085 0.099 0.928 0.045 1.105 0.208 0.952 0.024 (3.0 mg/kg AD05659)
[0295] Each of the cynomolgus monkeys dosed with any of AD05577, AD05307, AD05488, AD05654, or AD05659 showed a reduction in ANGPTL3 protein compared to pre-treatment measurements across all measured time points.
Example 9. In Vivo Testing of ANGPTL3 RNAi Agents in Cynomolgus Monkeys
[0296] Additional ANGPTL3 RNAi agents were evaluated in cynomolgus monkeys. On day 1, cynomolgus macaque (Macaca fascicularis) primates (also referred to herein as “cynos”) were administered a single subcutaneous injection of 0.3 mL/kg (approximately 2-3 mL volume, depending on animal mass) containing 2.0 mg/kg of an ANGPTL3 RNAi agent, which included either AD05488, AD05743, AD05775, or AD05841, each formulated in saline. Each of the ANGPTL3 RNAi agents contained modified nucleotides and included N-acetyl-galactosamine targeting ligands conjugated to the 5′-terminal end of the sense strand, as shown in Tables 3, 4, and 5. ANGPTL3 RNAi agents AD05488, AD05743, and AD05775 included nucleotide sequences designed to target position 304 of the ANGPTL3 gene. ANGPTL3 RNAi agent AD05841 included nucleotide sequences designed to target position 1035 of the ANGPTL3 gene.
[0297] Three (3) cynos in each group were tested (n=3). Blood samples were drawn and serum samples were analyzed on days −14 (predose), −7 (predose), 1 (pre-dose), 8, 15, 22, 29, and 35. Cynos were fasted overnight prior to each collection. ANGPTL3 protein levels in serum were measured by ELISA assay (R&D Systems), according to the manufacturer's recommendations. Triglycerides, total cholesterol, high-density lipoprotein (HDL), and low-density lipoprotein (LDL) in serum were measured on a Cobas® Integra 400 (Roche Diagnostics), according to the manufacturer's recommendations.
[0298] The ANGPTL3 protein levels, triglyceride levels, total cholesterol levels, HDL levels, and LDL levels for each animal were normalized. For normalization, the level of ANGPTL3 protein, triglyceride, HDL, and total cholesterol, respectively, for each animal at a time point, was divided by the average pre-treatment level of expression in that animal (in this case at days −14, −7, and 1) to determine the ratio of expression “normalized to pre-treatment.”
[0299] Data from the study set forth in this Example are shown in the following Tables 42-45:
TABLE-US-00057 TABLE 42 Average ANGPTL3 Protein Normalized to Pre-Treatment from Example 9 Day 8 Day 15 Day 22 Day 29 Day 35 Avg Std Dev Avg Std Dev Avg Std Avg Std Avg Std Dev Group ID ANGPTL3 (+/−) ANGPTL3 (+/−) ANGPTL3 Dev ANGPTL3 Dev ANGPTL3 (+/−) Group 1 0.232 0.083 0.240 0.114 0.239 0.087 0.258 0.090 0.332 0.133 (2.0 mg/kg AD05488) Group 2 0.349 0.029 0.316 0.070 0.322 0.075 0.381 0.068 0.346 0.066 (2.0 mg/kg AD05743) Group 3 0.463 0.089 0.352 0.053 0.330 0.053 0.365 0.106 0.379 0.111 (2.0 mg/kg AD05775) Group 4 0.672 0.188 0.646 0.213 0.489 0.196 0.582 0.187 0.460 0.154 (2.0 mg/kg AD05841)
TABLE-US-00058 TABLE 43 Average Triglycerides Normalized to Pre-Treatment from Example 9 Day 8 Day 15 Day 22 Day 29 Day 35 Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Group ID TG (+/−) TG (+/−) TG (+/−) TG (+/−) TG (+/−) Group 1 0.413 0.081 0.403 0.131 0.288 0.184 0.344 0.254 0.350 0.083 (2.0 mg/kg AD05488) Group 2 0.646 0.134 0.708 0.373 0.458 0.163 0.479 0.063 0.521 0.101 (2.0 mg/kg AD05743) Group 3 0.466 0.209 0.427 0.065 0.552 0.254 0.391 0.056 0.431 0.150 (2.0 mg/kg AD05775) Group 4 0.600 0.160 0.506 0.083 0.579 0.073 0.687 0.182 0.600 0.107 (2.0 mg/kg AD05841)
TABLE-US-00059 TABLE 44 Average Total Cholesterol Normalized to Pre-Treatment from Example 8 Day 8 Day 15 Day 22 Day 29 Day 35 Avg Total Std Dev Avg Total Std Dev Avg Total Std Dev Avg Total Std Dev Avg Total Std Dev Group ID Chol (+/−) Chol (+/−) Chol (+/−) Chol (+/−) Chol (+/−) Group 1 0.823 0.065 0.744 0.014 0.709 0.037 0.687 0.029 0.659 0.041 (2.0 mg/kg AD05488) Group 2 0.925 0.050 0.758 0.042 0.768 0.041 0.807 0.093 0.752 0.055 (2.0 mg/kg AD05743) Group 3 0.965 0.067 0.811 0.058 0.811 0.075 0.813 0.015 0.770 0.022 (2.0 mg/kg AD05775) Group 4 0.863 0.209 0.844 0.178 0.820 0.141 0.819 0.265 0.798 0.069 (2.0 mg/kg AD05841)
TABLE-US-00060 TABLE 45 Average HDL Normalized to Pre-Treatment from Example 9 Day 8 Day 15 Day 22 Day 29 Day 35 Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Group ID HDL (+/−) HDL (+/−) HDL (+/−) HDL (+/−) HDL (+/−) Group 1 0.985 0.354 0.911 0.261 0.849 0.353 0.856 0.333 0.810 0.296 (2.0 mg/kg AD05488) Group 2 0.849 0.048 0.797 0.058 0.666 0.155 0.757 0.138 0.677 0.135 (2.0 mg/kg AD05743) Group 3 0.904 0.078 0.871 0.161 0.737 0.085 0.781 0.055 0.723 0.042 (2.0 mg/kg AD05775) Group 4 0.842 0.268 0.919 0.186 0.876 0.204 0.896 0.247 0.919 0.102 (2.0 mg/kg AD05841)
TABLE-US-00061 TABLE 46 Average LDL Normalized to Pre-Treatment from Example 9 Day 8 Day 15 Day 22 Day 29 Day 35 Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Group ID LDL (+/−) LDL (+/−) LDL (+/−) LDL (+/−) LDL (+/−) Group 1 0.971 0.291 0.913 0.193 0.949 0.216 0.853 0.145 0.845 0.108 (2.0 mg/kg AD05488) Group 2 1.055 0.061 0.825 0.054 0.986 0.013 0.941 0.124 0.911 0.069 (2.0 mg/kg AD05743) Group 3 1.134 0.156 0.909 0.111 1.089 0.180 1.034 0.184 1.008 0.143 (2.0 mg/kg AD05775) Group 4 0.918 0.135 0.953 0.193 0.980 0.069 0.894 0.270 1.002 0.048 (2.0 mg/kg AD05841)
[0300] Each of the cynomolgus monkeys dosed with any of AD05488, AD05743, AD05775, and AD05841, each at 2.0 mg/kg dosage levels, showed a reduction in ANGPTL3 protein compared to pre-treatment measurements across each of the measured time points.
Example 10. Additional In Vivo Testing of ANGPTL3 RNAi Agents in Mice
[0301] To assess the in vivo activity of further ANGPTL3 RNAi agents that are designed to target position 304 on the ANGPTL3 gene, six- to eight-week-old female C57bl/6 mice were used. Pre-dose serum samples were taken at day −1 after a four hour fast. At day 1, each mouse was given a single subcutaneous administration of 200 μl containing 0.5 mg/kg (mpk) of an ANGPTL3 RNAi agent in D5W (dextrose in 5% water), or control (D5W) with no RNAi agent, according to the dosing groups recited in Table 47.
TABLE-US-00062 TABLE 47 Dosing Groups of Example 10 Group RNAi Agent and Dose Dosing Regimen 1 D5W (no RNAi agent) Single injection on day 1 2 0.5 mg/kg AD05488 Single injection on day 1 3 0.5 mg/kg AD05790 Single injection on day 1 4 0.5 mg/kg AD05791 Single injection on day 1 5 0.5 mg/kg AD05792 Single injection on day 1 6 0.5 mg/kg AD05793 Single injection on day 1 7 0.5 mg/kg AD05794 Single injection on day 1 8 0.5 mg/kg AD05795 Single injection on day 1 9 0.5 mg/kg AD05796 Single injection on day 1 10 0.5 mg/kg AD05797 Single injection on day 1 11 0.5 mg/kg AD05798 Single injection on day 1 12 0.5 mg/kg AD05799 Single injection on day 1 13 0.5 mg/kg AD05800 Single injection on day 1
[0302] Each of the RNAi agents included a modified sequence and an N-acetyl-galactosamine-containing targeting ligand conjugated to the 5′ terminal end of the sense strand. (See Tables 3, 4, and 5 for modified sequences and targeting ligand structures). As noted above, each of the ANGPTL3 RNAi agents dosed in this study included nucleotide sequences designed to target the ANGPTL3 gene at position 304. The injections were performed between the skin and muscle (i.e. subcutaneous injections) into the loose skin over the neck and shoulder area. Three (3) mice in each group were tested (n=3). Serum was collected on days 8, 15, 22, 29, and for some groups on day 36 (i.e., Groups 1, 2, and 9-13 only). Mice were fasted for four hours prior to each collection. ANGPTL3 protein levels in serum were measured by ELISA assay (R&D Systems), according to the manufacturer's recommendations. Triglycerides, total cholesterol, high-density lipoprotein (HDL), and low-density lipoprotein (LDL) in serum were measured on a Cobas® Integra 400 (Roche Diagnostics), according to the manufacturer's recommendations.
[0303] The ANGPTL3 protein levels, triglyceride levels, total cholesterol levels, HDL levels, and LDL levels for each animal were normalized. For normalization, the level of ANGPTL3 protein, triglyceride, HDL, and total cholesterol, respectively, for each animal at a time point, was divided by the pre-treatment level of expression in that animal (in this case at day −1) to determine the ratio of expression “normalized to pre-treatment.” Expression at a specific time point was then normalized to the D5W control group by dividing the “normalized to pre-treatment” ratio for an individual animal by the mean “normalized to pretreatment” ratio of all mice in the D5W control group. This resulted in expression for each time point normalized to that in the control group.
[0304] Data from the study set forth in this Example are shown in the following Tables 48-52:
TABLE-US-00063 TABLE 48 Average ANGPTL3 Protein Normalized to Pre-Treatment and Control from Example 10 Day 8 Day 15 Day 22 Day 29 Day 36 Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Group ID ANGPTL3 (+/−) ANGPTL3 (+/−) ANGPTL3 (+/−) ANGPTL3 (+/−) ANGPTL3 (+/−) Group 1 1.000 0.128 1.000 0.246 1.000 0.116 1.000 0.202 1.000 0.218 (D5W) Group 2 0.179 0.019 0.197 0.010 0.196 0.014 0.258 0.042 0.297 0.039 (0.5 mg/kg AD05488) Group 3 0.207 0.076 0.144 0.025 0.208 0.017 0.308 0.036 (0.5 mg/kg AD05790) Group 4 0.145 0.040 0.170 0.016 0.214 0.076 0.246 0.045 (0.5 mg/kg AD05791) Group 5 0.195 0.049 0.192 0.097 0.171 0.046 0.309 0.184 (0.5 mg/kg AD05792) Group 6 0.205 0.038 0.156 0.048 0.162 0.011 0.287 0.016 (0.5 mg/kg AD05793) Group 7 0.223 0.014 0.217 0.031 0.224 0.048 0.285 0.044 (0.5 mg/kg AD05794) Group 8 0.246 0.076 0.343 0.021 0.288 0.042 0.453 0.134 (0.5 mg/kg AD05795) Group 9 0.183 0.058 0.213 0.062 0.223 0.047 0.241 0.040 0.315 0.098 (0.5 mg/kg AD05796) Group 10 0.250 0.098 0.201 0.051 0.238 0.097 0.269 0.027 0.371 0.042 (0.5 mg/kg AD05797) Group 11 0.175 0.018 0.167 0.015 0.228 0.044 0.233 0.069 0.242 0.033 (0.5 mg/kg AD05798) Group 12 0.167 0.047 0.150 0.026 0.227 0.032 0.221 0.024 0.231 0.015 (0.5 mg/kg AD05799) Group 13 0.194 0.013 0.196 0.050 0.214 0.029 0.227 0.053 0.235 0.005 (0.5 mg/kg AD05800)
TABLE-US-00064 TABLE 49 Average Triglycerides Normalized to Pre-Treatment and Control from Example 10 Day 8 Day 15 Day 22 Day 29 Day 36 Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Group ID TG (+/−) TG (+/−) TG (+/−) TG (+/−) TG (+/−) Group 1 1.000 0.097 1.000 0.099 1.000 0.185 1.000 0.135 1.000 0.174 (D5W) Group 2 0.646 0.083 0.669 0.209 0.723 0.227 0.739 0.136 0.843 0.239 (0.5 mg/kg AD05488) Group 3 0.832 0.086 0.784 0.172 0.974 0.242 0.718 0.085 (0.5 mg/kg AD05790) Group 4 1.125 0.266 0.930 0.141 1.631 0.218 0.854 0.179 (0.5 mg/kg AD05791) Group 5 0.888 0.196 0.796 0.144 1.094 0.217 0.794 0.026 (0.5 mg/kg AD05792) Group 6 1.143 0.137 0.972 0.116 0.998 0.280 1.028 0.408 (0.5 mg/kg AD05793) Group 7 0.560 0.083 0.545 0.145 0.713 0.097 0.730 0.175 (0.5 mg/kg AD05794) Group 8 0.739 0.072 0.753 0.078 1.034 0.121 0.842 0.065 (0.5 mg/kg AD05795) Group 9 0.602 0.075 0.586 0.142 0.832 0.132 0.702 0.085 0.958 0.076 (0.5 mg/kg AD05796) Group 10 0.851 0.159 0.651 0.075 0.969 0.065 0.713 0.030 0.929 0.186 (0.5 mg/kg AD05797) Group 11 0.869 0.166 0.586 0.107 0.653 0.059 0.573 0.118 0.690 0.081 (0.5 mg/kg AD05798) Group 12 0.683 0.092 0.593 0.166 0.751 0.061 0.546 0.075 0.725 0.179 (0.5 mg/kg AD05799) Group 13 0.676 0.046 0.634 0.048 0.655 0.019 0.635 0.088 1.033 0.068 (0.5 mg/kg AD05800)
TABLE-US-00065 TABLE 50 Average Total Cholesterol Normalized to Pre-Treatment and Control from Example 10 Day 8 Day 15 Day 22 Day 29 Day 36 Avg Total Std Dev Avg Total Std Dev Avg Total Std Dev Avg Total Std Dev Avg Total Std Dev Group ID Chol (+/−) Chol (+/−) Chol (+/−) Chol (+/−) Chol (+/−) Group 1 1.000 0.060 1.000 0.018 1.000 0.104 1.000 0.038 1.000 0.056 (D5W) Group 2 0.659 0.023 0.808 0.018 0.763 0.113 0.743 0.028 0.824 0.065 (0.5 mg/kg AD05488) Group 3 0.698 0.104 0.730 0.026 0.711 0.031 0.757 0.083 (0.5 mg/kg AD05790) Group 4 0.664 0.035 0.694 0.062 0.631 0.041 0.677 0.046 (0.5 mg/kg AD05791) Group 5 0.716 0.055 0.725 0.081 0.568 0.074 0.727 0.133 (0.5 mg/kg AD05792) Group 6 0.813 0.102 0.805 0.091 0.689 0.026 0.769 0.128 (0.5 mg/kg AD05793) Group 7 0.715 0.055 0.861 0.031 0.673 0.080 0.768 0.110 (0.5 mg/kg AD05794) Group 8 0.852 0.124 0.973 0.187 0.745 0.087 0.866 0.067 (0.5 mg/kg AD05795) Group 9 0.666 0.113 0.793 0.047 0.595 0.054 0.735 0.082 0.795 0.125 (0.5 mg/kg AD05796) Group 10 0.734 0.024 0.734 0.017 0.642 0.026 0.741 0.113 0.861 0.102 (0.5 mg/kg AD05797) Group 11 0.719 0.031 0.784 0.065 0.711 0.077 0.721 0.086 0.649 0.019 (0.5 mg/kg AD05798) Group 12 0.700 0.052 0.684 0.014 0.698 0.092 0.632 0.070 0.714 0.040 (0.5 mg/kg AD05799) Group 13 0.842 0.079 0.794 0.048 0.691 0.071 0.750 0.100 0.853 0.186 (0.5 mg/kg AD05800)
TABLE-US-00066 TABLE 51 Average HDL Normalized to Pre-Treatment and Control from Example 10 Day 8 Day 15 Day 22 Day 29 Day 36 Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Group ID HDL (+/−) HDL (+/−) HDL (+/−) HDL (+/−) HDL (+/−) Group 1 1.000 0.090 1.000 0.014 1.000 0.123 1.000 0.058 1.000 0.036 (D5W) Group 2 0.648 0.029 0.807 0.041 0.733 0.096 0.746 0.012 0.816 0.038 (0.5 mg/kg AD05488) Group 3 0.674 0.110 0.705 0.040 0.649 0.030 0.748 0.095 (0.5 mg/kg AD05790) Group 4 0.632 0.029 0.674 0.063 0.563 0.036 0.679 0.041 (0.5 mg/kg AD05791) Group 5 0.676 0.055 0.683 0.086 0.509 0.061 0.712 0.135 (0.5 mg/kg AD05792) Group 6 0.721 0.082 0.724 0.079 0.600 0.015 0.696 0.088 (0.5 mg/kg AD05793) Group 7 0.652 0.041 0.823 0.047 0.611 0.059 0.736 0.090 (0.5 mg/kg AD05794) Group 8 0.757 0.117 0.905 0.189 0.644 0.074 0.817 0.085 (0.5 mg/kg AD05795) Group 9 0.610 0.107 0.760 0.062 0.535 0.075 0.696 0.080 0.734 0.117 (0.5 mg/kg AD05796) Group 10 0.676 0.020 0.688 0.005 0.564 0.037 0.701 0.092 0.790 0.089 (0.5 mg/kg AD05797) Group 11 0.709 0.030 0.808 0.068 0.719 0.094 0.759 0.117 0.653 0.024 (0.5 mg/kg AD05798) Group 12 0.666 0.085 0.674 0.039 0.695 0.083 0.667 0.088 0.707 0.033 (0.5 mg/kg AD05799) Group 13 0.806 0.060 0.796 0.065 0.706 0.075 0.772 0.088 0.801 0.158 (0.5 mg/kg AD05800)
TABLE-US-00067 TABLE 52 Average LDL Normalized to Pre-Treatment and Control from Example 10 Day 8 Day 15 Day 22 Day 29 Day 36 Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Group ID LDL (+/−) LDL (+/−) LDL (+/−) LDL (+/−) LDL (+/−) Group 1 1.000 0.123 1.000 0.172 1.000 0.146 1.000 0.180 1.000 0.202 (D5W) Group 2 0.836 0.057 0.969 0.033 0.901 0.129 0.762 0.165 0.863 0.153 (0.5 mg/kg AD05488) Group 3 0.922 0.174 0.944 0.082 0.916 0.126 0.899 0.153 (0.5 mg/kg AD05790) Group 4 0.878 0.119 0.744 0.097 0.848 0.158 0.755 0.145 (0.5 mg/kg AD05791) Group 5 0.805 0.060 0.776 0.058 0.623 0.017 0.745 0.082 (0.5 mg/kg AD05792) Group 6 0.968 0.181 0.828 0.106 0.768 0.049 0.751 0.200 (0.5 mg/kg AD05793) Group 7 0.853 0.057 0.847 0.031 0.677 0.233 0.714 0.156 (0.5 mg/kg AD05794) Group 8 1.044 0.073 0.956 0.219 0.805 0.159 0.777 0.040 (0.5 mg/kg AD05795) Group 9 0.807 0.143 0.760 0.056 0.606 0.087 0.697 0.055 0.784 0.150 (0.5 mg/kg AD05796) Group 10 0.786 0.102 0.749 0.013 0.688 0.024 0.689 0.155 0.879 0.225 (0.5 mg/kg AD05797) Group 11 0.879 0.159 0.896 0.203 0.648 0.039 0.738 0.055 0.762 0.065 (0.5 mg/kg AD05798) Group 12 0.853 0.104 0.837 0.196 0.678 0.176 0.652 0.138 0.873 0.157 (0.5 mg/kg AD05799) Group 13 0.951 0.268 0.885 0.041 0.682 0.130 0.826 0.244 1.107 0.298 (0.5 mg/kg AD05800)
[0305] As indicated in Table 48 above, each of the ANGPTL3 RNAi agents tested showed a significant reduction in ANGPTL3 protein across all time points, and similar trends are seen with respect to reductions in TG levels, total cholesterol levels, and LDL levels.
Example 11. In Vivo Testing of ANGPTL3 RNAi Agents in Mice
[0306] To assess the dose response of ANGPTL3 RNAi agent AD05488, six- to eight-week-old female C57bl/6 mice were used. Pre-dose serum samples were taken at day −1 after a four hour fast. At day 1, each mouse was given a single subcutaneous administration of 200 μl containing the respective mg/kg dose of an ANGPTL3 RNAi agent in D5W (dextrose in 5% water), or control (D5W) with no RNAi agent, according to the dosing groups recited in Table 53:
TABLE-US-00068 TABLE 53 Dosing Groups of Example 11 Group RNAi Agent and Dose Dosing Regimen 1 D5W (no RNAi agent) Single injection on day 1 2 0.05 mg/kg AD05488 Single injection on day 1 3 0.1 mg/kg AD05488 Single injection on day 1 4 0.5 mg/kg AD05488 Single injection on day 1 5 1.0 mg/kg AD05488 Single injection on day 1 6 2.5 mg/kg AD05488 Single injection on day 1 7 5.0 mg/kg AD05488 Single injection on day 1
[0307] The RNAi agent tested (AD05488) included a modified sequence and an N-acetyl-galactosamine-containing targeting ligand conjugated to the 5′ terminal end of the sense strand. (See Tables 3, 4, and 5 for modified sequences and targeting ligand structures). The injections were performed between the skin and muscle (i.e. subcutaneous injections) into the loose skin over the neck and shoulder area. Four (4) mice in each group were tested (n=4). Serum was collected on days 8, 15, 22, and 29. Mice were fasted for four hours prior to each collection. ANGPTL3 protein levels in serum were measured by ELISA assay (R&D Systems), according to the manufacturer's recommendations. Triglycerides, total cholesterol, high-density lipoprotein (HDL), and low-density lipoprotein (LDL) in serum were measured on a Cobas® Integra 400 (Roche Diagnostics), according to the manufacturer's recommendations.
[0308] The ANGPTL3 protein levels, triglyceride levels, total cholesterol levels, HDL levels, and LDL levels for each animal were normalized. For normalization, the level of ANGPTL3 protein, triglyceride, HDL, and total cholesterol, respectively, for each animal at a time point, was divided by the pre-treatment level of expression in that animal (in this case at day −1) to determine the ratio of expression “normalized to pre-treatment.” Expression at a specific time point was then normalized to the D5W control group by dividing the “normalized to pre-treatment” ratio for an individual animal by the mean “normalized to pretreatment” ratio of all mice in the D5W control group. This resulted in expression for each time point normalized to that in the control group.
[0309] Data from the study set forth in this Example are shown in the following Tables 54-58:
TABLE-US-00069 TABLE 54 Average ANGPTL3 Protein Normalized to Pre-Treatment and Control from Example 11 Day 8 Day 15 Day 22 Day 29 Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Group ID ANGPTL3 (+/−) ANGPTL3 (+/−) ANGPTL3 (+/−) ANGPTL3 (+/−) Group 1 1.000 0.291 1.000 0.170 1.000 0.224 1.000 0.293 (D5W) Group 2 0.788 0.110 0.929 0.203 1.106 0.117 0.990 0.175 (0.05 mg/kg AD05488) Group 3 0.511 0.109 0.757 0.092 0.720 0.069 0.734 0.058 (0.1 mg/kg AD05488) Group 4 0.207 0.039 0.261 0.050 0.310 0.080 0.349 0.090 (0.5 mg/kg AD05488) Group 5 0.116 0.038 0.141 0.027 0.171 0.066 0.199 0.054 (1.0 mg/kg AD05488) Group 6 0.064 0.010 0.047 0.012 0.056 0.009 0.063 0.002 (2.5 mg/kg AD05488) Group 7 0.018 0.005 0.019 0.004 0.029 0.010 0.031 0.003 (5.0 mg/kg AD05488)
TABLE-US-00070 TABLE 55 Average Triglycerides Normalized to Pre-Treatment and Control from Example 11 Day 8 Day 15 Day 22 Day 29 Std Std Std Std Avg Dev Avg Dev Avg Dev Avg Dev Group ID (+/−) (+/−) TG (+/−) TG (+/−) TG (+/−) Group 1 1.000 0.181 1.000 0.120 1.000 0.135 1.000 0.221 (D5W) Group 2 1.296 0.168 1.274 0.180 1.202 0.016 1.999 0.356 (0.05 mg/kg AD05488) Group 3 1.116 0.193 1.141 0.256 1.234 0.184 1.798 0.555 (0.1 mg/kg AD05488) Group 4 1.028 0.266 1.027 0.283 0.864 0.208 1.855 0.364 (0.5 mg/kg AD05488) Group 5 0.860 0.186 0.755 0.228 0.720 0.140 1.254 0.195 (1.0 mg/kg AD05488) Group 6 0.623 0.197 0.556 0.139 0.447 0.075 0.772 0.269 (2.5 mg/kg AD05488) Group 7 0.923 0.150 0.892 0.105 0.781 0.107 1.128 0.299 (5.0 mg/kg AD05488)
TABLE-US-00071 TABLE 56 Average Total Cholesterol Normalized to Pre-Treatment and Control from Example 11 Day 8 Day 15 Day 22 Day 29 Avg Std Avg Std Avg Std Avg Std Total Dev Total Dev Total Dev Total Dev Group ID Chol (+/−) Chol (+/−) Chol (+/−) Chol (+/−) Group 1 1.000 0.061 1.000 0.058 1.000 0.124 1.000 0.069 (D5W) Group 2 0.856 0.030 1.090 0.092 0.946 0.081 0.915 0.059 (0.05 mg/kg AD05488) Group 3 0.820 0.095 0.974 0.097 0.785 0.078 0.945 0.074 (0.1 mg/kg AD05488) Group 4 0.740 0.061 0.918 0.081 0.897 0.102 0.883 0.071 (0.5 mg/kg AD05488) Group 5 0.610 0.072 0.816 0.074 0.857 0.099 0.920 0.063 (1.0 mg/kg AD05488) Group 6 0.647 0.076 0.832 0.119 0.772 0.174 0.694 0.117 (2.5 mg/kg AD05488) Group 7 0.583 0.086 0.787 0.030 0.790 0.136 0.783 0.176 (5.0 mg/kg AD05488)
TABLE-US-00072 TABLE 57 Average HDL Normalized to Pre-Treatment and Control from Example 11 Day 8 Day15 Day 22 Day 29 Std Std Std Std Avg Dev Avg Dev Avg Dev Avg Dev Group ID HDL (+/−) (+/−) HDL (+/−) (+/−) HDL (+/−) Group 1 1.000 0.054 1.000 0.049 1.000 0.101 1.000 0.070 (D5W) Group 2 0.851 0.030 1.052 0.104 0.982 0.083 0.894 0.071 (0.05 mg/kg AD05488) Group 3 0.807 0.101 0.950 0.077 0.806 0.064 0.910 0.063 (0.1 mg/kg AD05488) Group 4 0.727 0.066 0.876 0.087 0.906 0.091 0.897 0.084 (0.5 mg/kg AD05488) Group 5 0.575 0.079 0.785 0.077 0.839 0.113 0.888 0.043 (1.0 mg/kg AD05488) Group 6 0.618 0.069 0.787 0.109 0.782 0.181 0.701 0.116 (2.5 mg/kg AD05488) Group 7 0.534 0.082 0.717 0.018 0.760 0.140 0.759 0.156 (5.0 mg/kg AD05488)
TABLE-US-00073 TABLE 58 Average LDL Normalized to Pre-Treatment and Control from Example 11 Day 8 Day 15 Day 22 Day 29 Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Group ID LDL (+/−) LDL (+/−) LDL (+/−) LDL (+/−) Group 1 (D5W) 1.000 0.130 1.000 0.174 1.000 0.216 1.000 0.118 Group 2 (0.05 mg/kg AD05488) 0.798 0.036 1.147 0.107 0.772 0.097 0.822 0.076 Group 3 (0.1 mg/kg AD05488) 0.878 0.160 1.153 0.172 0.732 0.183 0.845 0.202 Group 4 (0.5 mg/kg AD05488) 0.816 0.138 1.137 0.217 0.866 0.011 0.896 0.099 Group 5 (1.0 mg/kg AD05488) 0.760 0.094 1.145 0.101 0.993 0.194 1.123 0.270 Group 6 (2.5 mg/kg AD05488) 0.805 0.101 1.185 0.191 0.915 0.209 0.814 0.049 Group 7 (5.0 mg/kg AD05488) 0.802 0.148 1.170 0.129 0.909 0.076 0.932 0.171
[0310] Additionally, ANGPTL3 mRNA levels were also assessed. All of the mice from each respective group were sacrificed on day 29 after serum collection, livers were harvested, and approximately 100 mg liver samples were collected and snap-frozen in liquid nitrogen for RNA isolation. Levels of ANGPTL3 mRNA in the mice livers were then measured by RT-qPCR, the results of which are set forth in the following Table 59:
TABLE-US-00074 TABLE 59 Average ANGPTL3 mRNA Level at Day 29, Normalized to Control from Example 11 Day 29 Avg Relative Low High ANGPTL3 Variance Variance Group ID mRNA (Error) (Error) Group 1 (D5W) 1.000 0.075 0.081 Group 2 (0.05 mg/kg AD05488) 0.798 0.126 0.149 Group 3 (0.1 mg/kg AD05488) 0.563 0.054 0.059 Group 4 (0.5 mg/kg AD05488) 0.277 0.074 0.100 Group 5 (1.0 mg/kg AD05488) 0.123 0.035 0.049 Group 6 (2.5 mg/kg AD05488) 0.036 0.007 0.009 Group 7 (5.0 mg/kg AD05488) 0.038 0.011 0.016
[0311] As shown in, among other things, Tables 54 and 59, the administration of ANGPTL3 RNAi agent AD05488 showed a reduction in both ANGPTL3 protein and ANGPTL3 mRNA.
Example 12. In Vivo Testing of ANGPTL3 RNAi Agents in LDL Receptor (LDLR) Knockout Mice
[0312] To evaluate the effect of RNAi agent administration in a disease model, mice having a genetic mutation for the LDL receptor (referred to herein as LDLR KO mice) were commercially obtained (The Jackson Laboratory). The LDLR KO mice are homozygous for the Ldlr.sup.tm1Her mutation, and have elevated serum cholesterol levels, particularly when placed on a high fat diet. For three weeks prior to the onset of the study, thirty-nine (39) LDLR KO mice were placed on a high fat diet (Teklad Custom Diets TD.88137). An additional eight (8) LDLR KO mice were placed on a normal chow diet over the same three-week period. Pre-dose serum samples were taken on day −15 and day −1 after a four hour fast. At day 1, each mouse was given a single subcutaneous administration of 200 μl/30 g animal body weight containing the respective mg/kg dose of an ANGPTL3 RNAi agent in D5W (dextrose in 5% water), control (D5W) with no RNAi agent, or a control RNAi agent that included a nucleotide sequence designed to target the Hepatitis B Virus (HBV) genome. A second injection of the same formulation was administered to the animals on day 29. The dosing regimen for the study is recited in the following Table 60:
TABLE-US-00075 TABLE 60 Dosing Groups of Example 12 Number RNAi of LDL Agent and KO Mice Group Dose Diet Dosing Regimen (n =) 1 D5W High Fat Injection on day 1, 13 (no RNAi (“Western”) remaining animals agent) Diet received a second injection on day 29 2 3.0 mg/kg High Fat Injection on day 1, 13 AD05488 (“Western”) remaining animals Diet received a second injection on day 29 3 3.0 mg/kg of a High Fat Injection on day 1, 13 control RNAi (“Western”) remaining animals agent directed Diet received a second to HBV injection on day 29 4 D5W Normal Injection on day 1 and 4 (no RNAi Chow-Fed a second single agent) Diet injection on day 29 5 3.0 mg/kg Normal Injection on day 1, and 4 AD05488 Chow-Fed a second injection on Diet day 29
[0313] Each mouse remained on its respective diet through the duration of study. The RNAi agent tested (AD05488) included a modified sequence and an N-acetyl-galactosamine-containing targeting ligand conjugated to the 5′ terminal end of the sense strand. (See Tables 3, 4, and 5 for modified sequences and targeting ligand structures). The injections were performed between the skin and muscle (i.e. subcutaneous injections) into the loose skin over the neck and shoulder area. Serum was collected on days 8, 15, 22, 29 (pre-second dose), 36, 43, 50, and 57. LDLR KO mice were fasted for four hours prior to each collection. On day 15, four (4) LDLR KO mice from Groups 1, 2, and 3 (i.e., the groups being administered the high fat “Western” diet) were sacrificed after serum collection, and on day 29, an additional four (4) LDLR KO mice from Groups 1, 2, and 3 were sacrificed after serum collection, for the purpose of performing mRNA assessments.
[0314] ANGPTL3 protein levels in serum were measured by ELISA assay (R&D Systems), according to the manufacturer's recommendations. Triglycerides, total cholesterol, high-density lipoprotein (HDL), and low-density lipoprotein (LDL) in serum were measured on a Cobas® Integra 400 (Roche Diagnostics), according to the manufacturer's recommendations.
[0315] The ANGPTL3 protein levels, triglyceride levels, total cholesterol levels, HDL levels, and LDL levels for each animal were normalized. For normalization, respective levels of ANGPTL3 protein, TG, total cholesterol, HDL, or LDL for each animal at a time point was divided by the average pre-treatment level of expression in that animal (in this case the average of day −15 and day −1) to determine the ratio of expression “normalized to pre-treatment.”
[0316] Expression at a specific time point was then normalized to the D5W control group that was administered the same diet (i.e., either the high fat “Western” diet or the normal chow-fed diet) by dividing the “normalized to pre-treatment” ratio for an individual animal by the mean “normalized to pretreatment” ratio of all mice in the D5W control group on the respective same diet, resulting in expression for each time point normalized to that in the control group.
[0317] Data from the study set forth in this Example are shown in the following Tables 61-65:
TABLE-US-00076 TABLE 61 Average ANGPTL3 Protein Normalized to Pre-Treatment and Control (Diet Matched) from Example 12 Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Group ID ANGPTL3 (+/−) ANGPTL3 (+/−) ANGPTL3 (+/−) ANGPTL3 (+/−) Day 8 Day 15 Day 22 Day 29 Group 1 (D5W) (High Fat Diet) 1.000 0.130 1.000 0.125 1.000 0.190 1.000 0.127 Group 2 (3.0 mg/kg AD05488) 0.013 0.008 0.009 0.007 0.011 0.006 0.011 0.005 (High Fat Diet) Group 3 (3.0 mg/kg HBV 0.958 0.093 1.116 0.126 0.925 0.218 0.962 0.268 Control RNAi agent) (High Fat Diet) Group 4 (D5W) (Normal Diet) 1.000 0.094 1.000 0.061 1.000 0.140 1.000 0.277 Group 5 (3.0 mg/kg AD05488) 0.042 0.013 0.037 0.013 0.043 0.017 0.060 0.026 (Normal Diet) Day 36 Day 43 Day 50 Day 57 Group 1 (D5W) (High Fat Diet) 1.000 0.182 1.000 0.266 1.000 0.174 1.000 0.237 Group 2 (3.0 mg/kg AD05488) 0.005 0.001 0.005 0.002 0.005 0.003 0.007 0.004 (High Fat Diet) Group 3 (3.0 mg/kg HBV 1.356 0.438 1.371 0.381 1.230 0.331 1.006 0.373 Control RNAi agent) (High Fat Diet) Group 4 (D5W) (Normal Diet) 1.000 0.183 1.000 0.114 1.000 0.047 1.000 0.149 Group 5 (3.0 mg/kg AD05488) 0.024 0.010 0.024 0.008 0.032 0.008 0.037 0.016 (Normal Diet)
TABLE-US-00077 TABLE 62 Average Triglycerides Normalized to Pre-Treatment and Control (Diet Matched) from Example 12 Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Group ID TG (+/−) TG (+/−) TG (+/−) TG (+/−) Day 8 Day 15 Day 22 Day 29 Group 1 (D5W) (High Fat Diet) 1.000 0.272 1.000 0.381 1.000 0.276 1.000 0.265 Group 2 (3.0 mg/kg AD05488) 0.121 0.022 0.086 0.027 0.094 0.032 0.096 0.027 (High Fat Diet) Group 3 (3.0 mg/kg HBV 0.923 0.345 0.864 0.321 0.735 0.210 0.775 0.174 Control RNAi agent) (High Fat Diet) Group 4 (D5W) (Normal Diet) 1.000 0.172 1.000 0.092 1.000 0.099 1.000 0.138 Group 5 (3.0 mg/kg AD05488) 0.472 0.039 0.503 0.018 0.473 0.086 0.480 0.052 (Normal Diet) Day 36 Day 43 Day 50 Day 57 Group 1 (D5W) (High Fat Diet) 1.000 0.331 1.000 0.363 1.000 0.377 1.000 0.476 Group 2 (3.0 mg/kg AD05488) 0.104 0.031 0.084 0.025 0.091 0.027 0.079 0.025 (High Fat Diet) Group 3 (3.0 mg/kg HBV 0.746 0.171 0.520 0.097 0.683 0.104 0.713 0.154 Control RNAi agent) (High Fat Diet) Group 4 (D5W) (Normal Diet) 1.000 0.096 1.000 0.241 1.000 0.043 1.000 0.289 Group 5 (3.0 mg/kg AD05488) 0.548 0.051 0.348 0.053 0.625 0.061 0.438 0.087 (Normal Diet)
TABLE-US-00078 TABLE 63 Average Total Cholesterol Normalized to Pre-Treatment and Control (Diet Matched) from Example 12 Avg Total Std Dev Avg Total Std Dev Avg Total Std Dev Avg Total Std Dev Group ID Chol (+/−) Chol (+/−) Chol (+/−) Chol (+/−) Day 8 Day 15 Day 22 Day 29 Group 1 (D5W) (High Fat Diet) 1.000 0.101 1.000 0.142 1.000 0.187 1.000 0.161 Group 2 (3.0 mg/kg AD05488) 0.524 0.045 0.438 0.034 0.410 0.037 0.410 0.058 (High Fat Diet) Group 3 (3.0 mg/kg HBV 0.942 0.125 0.969 0.188 0.980 0.177 1.017 0.198 Control RNAi agent) (High Fat Diet) Group 4 (D5W) (Normal Diet) 1.000 0.072 1.000 0.052 1.000 0.102 1.000 0.088 Group 5 (3.0 mg/kg AD05488) 0.645 0.100 0.683 0.100 0.691 0.122 0.636 0.083 (Normal Diet) Day 36 Day 43 Day 50 Day 57 Group 1 (D5W) (High Fat Diet) 1.000 0.100 1.000 0.158 1.000 0.176 1.000 0.213 Group 2 (3.0 mg/kg AD05488) 0.438 0.042 0.363 0.043 0.374 0.055 0.341 0.058 (High Fat Diet) Group 3 (3.0 mg/kg HBV 1.029 0.143 0.847 0.105 0.932 0.129 0.860 0.124 Control RNAi agent) (High Fat Diet) Group 4 (D5W) (Normal Diet) 1.000 0.150 1.000 0.180 1.000 0.115 1.000 0.088 Group 5 (3.0 mg/kg AD05488) 0.758 0.114 0.657 0.161 0.824 0.135 0.684 0.096 (Normal Diet)
TABLE-US-00079 TABLE 64 Average HDL Normalized to Pre-Treatment and Control (Diet Matched) from Example 12 Day 8 Day 15 Day 22 Day 29 Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Group ID HDL (+/−) HDL (+/−) HDL (+/−) HDL (+/−) Group 1 (D5W) (High Fat Diet) 1.000 0.061 1.000 0.083 1.000 0.083 1.000 0.072 Group 2 (3.0 mg/kg AD05488) 0.693 0.042 0.735 0.066 0.716 0.062 0.711 0.078 (High Fat Diet) Group 3 (3.0 mg/kg HBV 0.869 0.177 0.870 0.136 0.908 0.122 0.919 0.155 Control RNAi agent) (High Fat Diet) Group 4 (D5W) (Normal Diet) 1.000 0.016 1.000 0.024 1.00 0.053 1.000 0.068 Group 5 (3.0 mg/kg AD05488) 0.645 0.069 0.745 0.088 0.766 0.087 0.737 0.088 (Normal Diet)
TABLE-US-00080 TABLE 65 Average LDL Normalized to Pre-Treatment and Control (Diet Matched) from Example 12 Day 8 Day 15 Day 22 Day 29 Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Group ID LDL (+/−) LDL (+/−) LDL (+/−) LDL (+/−) Group 1 (D5W) (High Fat Diet) 1.000 0.105 1.000 0.133 1.000 0.195 1.000 0.192 Group 2 (3.0 mg/kg AD05488) 0.547 0.060 0.476 0.041 0.429 0.054 0.419 0.075 (High Fat Diet) Group 3 (3.0 mg/kg HBV 0.959 0.150 1.000 0.207 1.004 0.197 1.063 0.230 Control RNAi agent) (High Fat Diet) Group 4 (D5W) (Normal Diet) 1.000 0.134 1.000 0.088 1.000 0.160 1.000 0.160 Group 5 (3.0 mg/kg AD05488) 0.558 0.116 0.606 0.107 0.662 0.147 0.563 0.091 (Normal Diet)
[0318] As shown in Tables 61-65, the groups dosed with 3.0 mg/kg of ANGPTL3 RNAi agent AD05488 (i.e., Groups 2 and 5) showed significant reductions in ANGPTL3 protein levels, TG levels, and total cholesterol in this model. The LDLR KO mice on a high fat “Western” diet showed particularly reduced levels, with an approximately 99% reduction in ANGPTL3 protein levels at day 57 (0.007) compared to control from the administration of two 3 mg/kg dose of ANGPTL3 RNAi agent AD05488. It is also noted that Group 3, which included an RNAi agent control that included nucleotide sequences designed to target an HBV mRNA, performed as expected and showed essentially no inhibition of ANGPTL3.
[0319] Additionally, ANGPTL3 mRNA levels were also assessed. On day 15, four (4) mice were sacrificed from each of Groups 1, 2, and 3. On day 29, an additional four (4) mice were sacrificed from each of Groups 1, 2, and 3. On day 57, all remaining animals from all Groups were sacrificed. At sacrifice, livers were harvested, and approximately 100 mg liver samples from the median lobes were collected and snap-frozen in liquid nitrogen for RNA isolation. Levels of ANGPTL3 mRNA in the mice livers were then measured by RT-qPCR, and normalized to the mRNA levels of the mice in Group 1 (high fat “Western” diet; D5W administration; day 15 sacrifice), the results of which are set forth in the following Table 66:
TABLE-US-00081 TABLE 66 Average ANGPTL3 mRNA Level at Day 29, Normalized to Control from Example 12 Number of Ang Relative Low High Day of Animals ANGPTL3 Variance Variance Group ID Sacrifice (n =) mRNA (Error) (Error) Group 1 (D5W, high 15 4 1.000 0.213 0.271 fat diet) (day 15 sacrifice) Group 1 (D5W, high 29 4 1.133 0.074 0.079 fat diet) (day 29 sacrifice) Group 1 (D5W, high 57 5 0.949 0.106 0.119 fat diet) (day 57 sacrifice) Group 2 (3.0 mg/kg 15 4 0.019 0.006 0.009 AD05488, high fat diet) (day 15 sacrifice) Group 2 (3.0 mg/kg 29 4 0.032 0.007 0.009 AD05488, high fat diet) (day 29 sacrifice) Group 2B (3.0 mg/kg 57 5 0.024 0.005 0.006 AD05488, high fat diet) (day 57 sacrifice) Group 3 (3.0 mg/kg 15 4 1.044 0.138 0.159 HBV control RNAi agent, high fat diet) (day 15 sacrifice) Group 3 (3.0 mg/kg 29 4 1.095 0.206 0.254 HBV control RNAi agent, high fat diet) (day 29 sacrifice) Group 3 (3.0 mg/kg 57 5 0.994 0.134 0.155 HBV control RNAi agent, high fat diet) (day 57 sacrifice) Group 4 (D5W, 57 4 1.397 0.055 0.057 normal chow) Group 5 (3.0 mg/kg 57 4 0.060 0.009 0.010 AD05488, normal chow)
[0320] The administration of ANGPTL3 RNAi agent AD05488 showed a significant reduction in ANGPTL3 mRNA levels in both the animals on the high fat “Western” diet and the animals on the normal chow-fed diet.
Example 13. In Vivo Testing of ANGPTL3 RNAi Agents in High Fructose Corn Syrup (HFCS) Diet-Fed Rhesus Monkeys
[0321] ANGPTL3 RNAi agent AD05488 was further evaluated in high-fructose corn syrup (HFCS) diet-fed Rhesus monkeys. Rhesus monkeys were placed on an HFCS diet 37 days prior to dosing. These animals were known to develop increased plasma triglycerides greater than 180 mg/dL on the HFCS diet. On day 1 and again on day 29, four (4) Rhesus monkeys were administered a subcutaneous injection containing 4.0 mg/kg of ANGPTL3 RNAi agent AD05488 formulated in saline (n=4). Two additional Rhesus monkeys were administered normal saline control. ANGPTL3 RNAi agent AD05488 contained modified nucleotides and included N-acetyl-galactosamine targeting ligands conjugated to the 5′-terminal end of the sense strand, as shown in Tables 3, 4, and 5.
[0322] Fasted blood samples were drawn for analysis, and serum samples were analyzed on days −8 (predose), 8, 15, 21, 29, and 36. ANGPTL3 expression levels, triglycerides, total cholesterol, high-density lipoprotein (HDL), and low-density lipoprotein (LDL) in serum were measured on a Cobas® Integra 400 (Roche Diagnostics), according to the manufacturer's recommendations.
[0323] The ANGPTL3 protein levels, triglyceride levels, total cholesterol levels, HDL levels, and LDL levels for each animal were normalized. For normalization, the level of ANGPTL3 protein, triglyceride, HDL, and total cholesterol, respectively, for each animal at a time point, was divided by the pre-treatment level of expression in that animal (in this case at day −8) to determine the ratio of expression “normalized to pre-treatment.”
[0324] Data from the study set forth in this Example are shown in the following Tables 67-71:
TABLE-US-00082 TABLE 67 Average ANGPTL3 Protein Normalized to Pre-Treatment from Example 13 (Fasted) Day 8 Day 15 Day 21 Day 29 Day 36 Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Group ID ANGPTL3 (+/−) ANGPTL3 (+/−) ANGPTL3 (+/−) ANGPTL3 (+/−) ANGPTL3 (+/−) Group 1 (saline 1.087 0.419 1.282 0.436 1.214 0.334 1.363 0.230 1.134 0.248 control) Group 2 (4.0 0.229 0.082 0.154 0.090 0.116 0.080 0.114 0.047 0.064 0.044 mg/kg AD05488)
TABLE-US-00083 TABLE 68 Average Triglycerides Normalized to Pre-Treatment from Example 13 (Fasted) Day 8 Day 15 Day 21 Day 29 Day 36 Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Group ID TG (+/−) TG (+/−) TG (+/−) TG (+/−) TG (+/−) Group 1 (saline 0.743 0.055 0.717 0.054 1.017 0.155 0.758 0.263 0.659 0.111 control) Group 2 (4.0 0.351 0.241 0.244 0.094 0.233 0.089 0.302 0.192 0.177 0.076 mg/kg AD05488)
TABLE-US-00084 TABLE 69 Average Cholesterol Normalized to Pre-Treatment from Example 13 (Fasted) Day 8 Day 15 Day 21 Day 29 Day 36 Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Group ID Chol (+/−) Chol (+/−) Chol (+/−) Chol (+/−) Chol (+/−) Group 1 (saline 0.972 0.050 0.944 0.079 0.957 0.0.18 0.882 0.021 0.894 0.038 control) Group 2 (4.0 0.734 0.200 0.641 0.174 0.579 0.107 0.549 0.090 0.459 0.086 mg/kg AD05488)
TABLE-US-00085 TABLE 70 Average HDL Normalized to Pre-Treatment from Example 13 (Fasted) Day 8 Day 15 Day 21 Day 29 Day 36 Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Group ID Chol (+/−) Chol (+/−) Chol (+/−) Chol (+/−) Chol (+/−) Group 1 (saline 1.082 0.098 1.071 0.111 1.003 0.158 1.025 0.131 1.027 0.071 control) Group 2 (4.0 1.202 0.276 1.091 0.322 0.921 0.296 0.730 0.232 0.798 0.349 mg/kg AD05488)
TABLE-US-00086 TABLE 71 Average LDL Normalized to Pre-Treatment from Example 13 (Fasted) Day 8 Day 15 Day 21 Day 29 Day 36 Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Group ID Chol (+/−) Chol (+/−) Chol (+/−) Chol (+/−) Chol (+/−) Group 1 (saline 0.892 0.060 0.928 0.046 0.823 0.034 0.804 0.076 0.804 0.172 control) Group 2 (4.0 0.973 0.475 0.909 0.390 0.908 0.437 0.955 0.520 0.710 0.499 mg/kg AD05488)
[0325] The Rhesus monkeys dosed with AD05488 at 4.0 mg/kg dosage levels showed a significant reduction in ANGPTL3 protein compared to pre-treatment measurements across each of the measured time points. Further, reductions in triglyceride and total cholesterol levels were evident.
Example 14. In Vivo Testing of ANGPTL3 RNAi Agents and Statins in LDL Receptor (LDLR) Knockout Mice
[0326] To evaluate the effect of co-administration of RNAi agents and statins in a disease model, LDLR KO mice were commercially obtained (The Jackson Laboratory). For three weeks prior to the onset of the study, forty-one (41) male 7 to 8 week old LDLR KO mice were placed on a high fat (“western”) diet (Teklad Custom Diets TD.88137), and remained on that diet throughout the duration of the study. Pre-dose serum samples were taken on study Day 1 after a four hour fast. The dosing regimen for the study is recited in the following Table 72:
TABLE-US-00087 TABLE 72 Dosing Groups of Example 14 LDL KO Atorvastatin Dose and RNAi Agent and Dose Mice Group Dosing Regimen Dosing Regimen (n =) 1 Vehicle oral gavage D5W (no RNAi agent) 7 administered daily starting Injection on Day 23 on Day 1 2 N/A Single 2.5 mg/kg AD05488 7 Injection on Day 23 3 10 mg/kg atorvastatin oral Single 2.5 mg/kg AD05488 8 gavage administered daily Injection on Day 23 starting on Day 1 4 20 mg/kg* atorvastatin oral Single 2.5 mg/kg AD05488 6 gavage administered daily Injection on Day 23 starting on Day 1 5 10 mg/kg atorvastatin oral N/A 7 gavage administered daily starting on Day 1 6 20 mg/kg* atorvastatin oral N/A 6 havage administered daily starting on Day 1 *Mice were treated at 40 mg/kg for the first 11 days, then switched to 20 mg/kg thereafter.
[0327] The vehicle used for the oral gavage in the study was a 1:1 mixture of Ora-Plus®:Ora-Sweet® solution, which were acquired commercially. For the preparation of the atorvastatin oral gavage administrations, the respective desired dose of atorvastatin was first dissolved in sterile water (0.3 mL water per 1 mL of desired formulation) and vortexed until smooth, followed by the addition of a mixture of 1:1 Ora-Plus®:Ora-Sweet® solution (0.7 mL vehicle per 1 mL of desired formulation) and vortexed. On day 1 and for each day thereafter an oral gavage dose was administered for each of the Groups except for Group 2. On Day 23, Groups 1, 2, 3, and 4 received a single subcutaneous administration of 2.5 mg/kg dose (31.25 μg/mL solution) of an ANGPTL3 RNAi agent in D5W (dextrose in 5% water), or vehicle control (D5W) with no RNAi agent.
[0328] The RNAi agent tested (AD05488) included a modified sequence and an N-acetyl-galactosamine-containing targeting ligand conjugated to the 5′ terminal end of the sense strand. (See Tables 3, 4, and 5 for modified sequences and targeting ligand structures). The injections were performed between the skin and muscle (i.e. subcutaneous injections) into the loose skin over the neck and shoulder area. Serum was collected on days 8, 15, 22 (pre-RNAi agent injection), 29, 36, 43, and 50. LDLR KO mice were fasted for four hours prior to each collection.
[0329] ANGPTL3 protein levels in serum were measured by ELISA assay (R&D Systems), according to the manufacturer's recommendations. Among other biomarkers, triglycerides, total cholesterol, and low-density lipoprotein (LDL) in serum were measured on a Cobas® Integra 400 (Roche Diagnostics), according to the manufacturer's recommendations.
[0330] The ANGPTL3 protein levels, triglyceride levels, total cholesterol levels, HDL levels, and LDL levels for each animal were normalized. For normalization, respective levels of ANGPTL3 protein, TG, total cholesterol, or LDL for each animal at a time point was divided by the pre-treatment level of expression in that animal (in this case pre-dose levels on Day 1) to determine the ratio of expression “normalized to pre-treatment.” Data from the study set forth in this Example are shown in the following Tables 73-76:
TABLE-US-00088 TABLE 73 Average ANGPTL3 Protein Normalized to Pre-Treatment from Example 14 Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Group ID ANGPTL3 (+/−) ANGPTL3 (+/−) ANGPTL3 (+/−) ANGPTL3 (+/−) Day 8 Day 15 Day 22 Day 29 Group 1 (Daily Vehicle Gavage; 1.511 0.236 1.787 0.263 1.680 0.273 1.650 0.237 D5W injection) Group 2 (No gavage; 2.5 mg/kg 1.419 0.224 1.584 0.214 1.658 0.295 0.023 0.008 AD05488) Group 3 (10 mg/kg daily oral 1.597 0.344 1.765 0.363 1.681 0.419 0.015 0.005 gavage atorvastatin; 2.5 mg/kg AD05488 on day 23) Group 4 (20 mg/kg* daily oral 1.683 0.216 1.999 0.282 1.675 0.376 0.022 0.042 gavage atorvastatin; 2.5 mg/kg AD05488 on day 23) Group 5 (10 mg/kg daily oral 1.577 0.295 1.839 0.319 1.693 0.270 1.764 0.283 gavage atorvastatin; no injection) Group 6 (20 mg/kg* daily oral 1.553 0.673 1.924 0.836 1.871 0.604 1.767 0.770 gavage atorvastatin; no injection) Day 36 Day 43 Day 50 Group 1 (Daily Vehicle Gavage; 1.604 0.307 1.784 0.460 1.622 0.387 D5W injection) Group 2 (No gavage; 2.5 mg/kg 0.012 0.004 0.020 0.014 0.026 0.005 AD05488) Group 3 (10 mg/kg daily oral 0.005 0.001 0.007 0.003 0.010 0.002 gavage atorvastatin; 2.5 mg/kg AD05488 on day 23) Group 4 (20 mg/kg* daily oral 0.004 0.002 0.005 0.001 0.010 0.004 gavage atorvastatin; 2.5 mg/kg AD05488 on day 23) Group 5 (10 mg/kg daily oral 1.851 0.384 1.758 0.441 1.878 0.342 gavage atorvastatin; no injection) Group 6 (20 mg/kg* daily oral 1.981 0.775 1.935 0.619 1.847 0.610 gavage atorvastatin; no injection)
TABLE-US-00089 TABLE 74 Average Triglycerides Normalized to Pre-Treatment from Example 14 Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Group ID TG (+/−) TG (+/−) TG (+/−) TG (+/−) Day 8 Day 15 Day 22 Day 29 Group 1 (Daily Vehicle Gavage; 0.711 0.151 0.826 0.193 1.009 0.304 0.753 0.219 D5W injection) Group 2 (No gavage; 2.5 mg/kg 0.988 0.253 1.247 0.330 1.524 0.189 0.166 0.023 AD05488 on day 23) Group 3 (10 mg/kg daily oral 0.613 0.338 0.436 0.213 0.614 0.162 0.072 0.020 gavage atorvastatin; 2.5 mg/kg AD05488 on day 23) Group 4 (20 mg/kg* daily oral 0.567 0.233 0.526 0.280 0.748 0.208 0.071 0.021 gavage atorvastatin; 2.5 mg/kg AD05488 on day 23) Group 5 (10 mg/kg daily oral 0.667 0.353 0.601 0.319 1.086 0.546 0.803 0.297 gavage atorvastatin; no injection) Group 6 (20 mg/kg* daily oral 0.477 0.328 0.362 0.200 0.505 0.248 0.552 0.250 gavage atorvastatin; no injection) Day 36 Day 43 Day 50 Group 1 (Daily Vehicle Gavage; 1.060 0.388 0.986 0.251 0.948 0.239 D5W injection) Group 2 (No gavage; 2.5 mg/kg 0.125 0.037 0.139 0.034 0.153 0.012 AD05488) Group 3 (10 mg/kg daily oral 0.058 0.013 0.076 0.019 0.065 0.016 gavage atorvastatin; 2.5 mg/kg AD05488 on day 23) Group 4 (20 mg/kg* daily oral 0.058 0.011 0.089 0.024 0.082 0.016 gavage atorvastatin; 2.5 mg/kg AD05488 on day 23) Group 5 (10 mg/kg daily oral 0.958 0.558 0.862 0.338 0.977 0.634 gavage atorvastatin; no injection) Group 6 (20 mg/kg* daily oral 0.598 0.260 0.603 0.194 0.677 0.219 gavage atorvastatin; no injection)
TABLE-US-00090 TABLE 75 Average Total Cholesterol Normalized to Pre-Treatment from Example 14 Avg Total Std Dev Avg Total Std Dev Avg Total Std Dev Avg Total Std Dev Group ID Chol (+/−) Chol (+/−) Chol (+/−) Chol (+/−) Day 8 Day 15 Day 22 Day 29 Group 1 (Daily Vehicle 0.996 0.107 1.009 0.192 1.142 0.183 1.087 0.187 Gavage; D5W injection) Group 2 (No gavage; 2.5 0.962 0.109 1.122 0.133 1.261 0.160 0.645 0.092 mg/kg AD05488) Group 3 (10 mg/kg daily oral 0.763 0.204 0.620 0.166 0.758 0.108 0.444 0.074 gavage atorvastatin; 2.5 mg/kg AD05488 on day 23) Group 4 (20 mg/kg* daily oral 0.682 0.171 0.622 0.200 0.857 0.326 0.448 0.141 gavage atorvastatin; 2.5 mg/kg AD05488 on day 23) Group 5 (10 mg/kg daily oral 0.821 0.244 0.774 0.257 0.980 0.359 0.943 0.318 gavage atorvastatin; no injection) Group 6 (20 mg/kg* daily oral 0.586 0.248 0.620 0.190 0.767 0.220 0.761 0.157 gavage atorvastatin; no injection) Day 36 Day 43 Day 50 Group 1 (Daily Vehicle 1.201 0.223 1.237 0.230 1.125 0.309 Gavage; D5W injection) Group 2 (No gavage; 2.5 0.518 0.085 0.512 0.082 0.515 0.073 mg/kg AD05488) Group 3 (10 mg/kg daily oral 0.362 0.070 0.331 0.054 0.322 0.048 gavage atorvastatin; 2.5 mg/kg AD05488 on day 23) Group 4 (20 mg/kg* daily oral 0.295 0.045 0.293 0.036 0.310 0.043 gavage atorvastatin; 2.5 mg/kg AD05488 on day 23) Group 5 (10 mg/kg daily oral 1.105 0.365 0.998 0.276 0.987 0.376 gavage atorvastatin; no injection) Group 6 (20 mg/kg* daily oral 0.825 0.082 0.767 0.148 0.807 0.114 gavage atorvastatin; no injection)
TABLE-US-00091 TABLE 76 Average LDL Normalized to Pre-Treatment from Example 14 Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Group ID LDL (+/−) LDL (+/−) LDL (+/−) LDL (+/−) Day 8 Day 15 Day 22 Day 29 Group 1 (Daily Vehicle Gavage; 0.951 0.138 0.969 0.238 1.044 0.222 1.093 0.243 D5W injection) Group 2 (No gavage; 2.5 mg/kg 0.893 0.107 1.051 0.126 1.113 0.178 0.653 0.119 AD05488) Group 3 (10 mg/kg daily oral 0.692 0.170 0.537 0.154 0.659 0.112 0.422 0.097 gavage atorvastatin; 2.5 mg/kg AD05488 on day 23) Group 4 (20 mg/kg* daily oral 0.572 0.193 0.515 0.222 0.755 0.388 0.434 0.166 gavage atorvastatin; 2.5 mg/kg AD05488 on day 23) Group 5 (10 mg/kg daily oral 0.778 0.255 0.695 0.266 0.861 0.365 0.881 0.362 gavage atorvastatin; no injection) Group 6 (20 mg/kg* daily oral 0.490 0.254 0.556 0.195 0.687 0.209 0.700 0.171 gavage atorvastatin; no injection) Day 36 Day 43 Day 50 Group 1 (Daily Vehicle Gavage; 1.130 0.237 1.242 0.286 1.050 0.348 D5W injection) Group 2 (No gavage; 2.5 mg/kg 0.492 0.103 0.443 0.166 0.480 0.086 AD05488) Group 3 (10 mg/kg daily oral 0.312 0.083 0.264 0.055 0.256 0.050 gavage atorvastatin; 2.5 mg/kg AD05488 on day 23) Group 4 (20 mg/kg* daily oral 0.240 0.060 0.217 0.038 0.242 0.029 gavage atorvastatin; 2.5 mg/kg AD05488 on day 23) Group 5 (10 mg/kg daily oral 0.996 0.357 0.929 0.303 0.872 0.356 gavage atorvastatin; no injection) Group 6 (20 mg/kg* daily oral 0.716 0.071 0.689 0.153 0.687 0.100 gavage atorvastatin; no injection)
[0331] Mice administered with daily atorvastatin showed approximately 40-60% reduction in triglycerides, approximately 23-40% reduction in total cholesterol, and approximately 30-45% reduction in LDL, respectively. Mice treated with higher doses of atorvastatin typically gave deeper reductions.
[0332] Administration with ANGPTL3 RNAi agent AD05488 with the co-administration of atorvastatin (i.e., Groups 3 and 4) showed additive effects on lipid parameters. For example, for Groups that involved co-administration of atorvastatin and RNAi agent, total reductions in triglycerides, total cholesterol, and LDL, were ˜95%, ˜70%, and −80%, respectively. Overall lipid parameters profile with the co-administration of atorvastatin was slightly better than administration of ANGPTL3 RNAi agent AD05488 alone. Further, Groups with ANGPTL3 RNAi agent AD05488 showed a clear reduction in ANGPTL3 protein levels, while no reduction in ANGPTL3 protein was seen in groups that did not involve the administration of an ANGPTL3 RNAi agent.
OTHER EMBODIMENTS
[0333] It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.