METHOD FOR DIAGNOSING PANCREATIC CANCER USING METHIONYL-TRNA SYNTHETASE, AND PANCREATIC CANCER DIAGNOSTIC KIT USING SAME

20210231669 · 2021-07-29

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention relates to a method for diagnosing pancreatic cancer using methionyl-tRNA synthetase (MRS). When used as a pancreatic cancer marker, MRS has a significantly higher level of diagnostic accuracy than conventional pancreatic cancer markers such as CEA; thus, analyzing the expression status of methionyl-tRNA synthetase (MRS) in pancreatic cells has the effect of clearly determining the presence or absence of pancreatic cancer, and said effect is likewise exhibited even in the cells that have been determined to be atypical cells by a general staining technique, and thus can be very useful in the diagnosis of pancreatic cancer.

    Claims

    1. A method for diagnosis of pancreatic cancer, the method comprising: (a) measuring the expression level of methionyl-tRNA synthetase (MRS) protein in a pancreatic sample collected from a latent patient; and (b) comparing the expression level of the methionyl-tRNA synthetase protein measured in step (a) with that of a negative control, and determining the latent patient to be a pancreatic cancer patient when the expression level of the methionyl-tRNA synthetase protein is increased compared with that of the negative control.

    2. The method of claim 1, further comprising detecting a cytokeratin 19 (CK19) protein.

    3. The method of claim 1, wherein the sample is pancreatic cells.

    4. The method of claim 3, wherein the pancreatic cells are isolated by fine needle aspiration.

    5. The method of claim 1, wherein the method further comprises the following steps before, simultaneously with, or after the measuring of the expression level of the MRS protein: (i) staining the pancreatic cells collected from the latent patient with: at least one nuclei-staining solution selected from the group consisting of 4′,6-diamidino-2-phenylindole (DAPI), methylene blue, acetocarmine, toluidine blue, hematoxylin, and Hoechst; and at least one cytoplasm-staining solution selected from the group consisting of eosin, crystal violet, and Orange G; and (ii) identifying the pancreatic cells as malignant tumor cells, atypical cells, or normal cells, through the staining of the pancreatic cells.

    6. The method of claim 5, wherein in step (ii), on the basis of results of the staining in step (i): the pancreatic cells are identified as malignant tumor cells when the pancreatic cells show two or more types of morphological abnormality selected from the group consisting of: a three-dimensional smear of cells; a high nuclear to cytoplasmic ratio (N/C ratio); an appearance of chromatin clumping; a rough-shaped nuclear membrane; an appearance of nucleoli, and an appearance of mitosis; the pancreatic cells are identified as normal cells when the pancreatic cells are smeared in one layer; the nuclear to cytoplasmic ratio (N/C ratio) is small; and the nuclear membrane has a smooth shape; and the pancreatic cells are identified as atypical cells when the pancreatic cells have neither a cell change leading to malignant tumor cells, nor can be determined to be normal.

    7. The method of claim 2, wherein the method comprises determining the pancreatic cells as pancreatic cancer cells when the CK19 protein is expressed and the expression level of the MRS protein is increased compared with that of the negative control.

    8. The method of claim 1, wherein the expression level of the protein is measured using any one of western blotting, enzyme-linked immunosorbent assay (ELISA), radioimmunoassay, radioimmunodiffusion, Ouchterlony immunodiffusion, rocket immunoelectrophoresis, immunostaining, immunoprecipitation assay, complement fixation assay, fluorescence activated cell sorter (FACS) assay, surface plasmon resonance (SPR) assay, or protein chip assay.

    9. A composition for diagnosis of pancreatic cancer, the composition comprising an agent for measuring the expression level of a methionyl-tRNA synthetase (MRS) protein.

    10. The composition of claim 9, further comprising an agent for measuring the expression level of a cytokeratin 19 (CK19) protein.

    11. The composition of claim 9, wherein the methionyl-tRNA synthetase protein comprises an amino acid sequence defined by SEQ ID NO: 1.

    12. The composition of claim 9-er-10, wherein the agent is an antibody or aptamer specifically binding to the protein.

    13. The composition of claim 12, wherein the antibody is an antibody or a functional fragment thereof which specifically binds to an epitope region comprising an amino acid sequence defined by SEQ ID NO: 2 in the MRS.

    14. The composition of claim 13, wherein the antibody comprises, a light chain variable region (VL) comprising an amino acid sequence defined by SEQ ID NO: 28 and a heavy chain variable region (VH) comprising an amino acid sequence defined by SEQ ID NO: 30, or a light chain variable region (VL) comprising an amino acid sequence defined by SEQ ID NO: 32 and a heavy chain variable region (VH) comprising an amino acid sequence defined by SEQ ID NO: 34.

    15. The composition of claim 10, wherein the agent is a primer or probe specifically binding to mRNA encoding the protein.

    16. A kit for diagnosis of pancreatic cancer, the kit comprising the composition of claim 10.

    17. A method for improving sensitivity and specificity in a cytodiagnosis or biopsy of pancreatic cancer, the method comprising: (a) measuring the expression level of methionyl-tRNA synthetase (MRS) protein in a pancreatic sample collected from a latent patient; and (b) determining the latent patient to be a pancreatic cancer patient when the expression level of the methionyl-tRNA synthetase protein is increased in step (a).

    18. The method of claim 17, wherein the method has a sensitivity of 80% or higher.

    19. The method of claim 17, wherein step (a) further comprises measuring the expression level of cytokeratin 19 (CK19) protein.

    20. The method of claim 19, wherein the method has a sensitivity of 80% or higher and a specificity of 80% or higher.

    21. (canceled)

    22. (canceled)

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0176] FIG. 1 shows western blot results comparing the MRS-binding strength and specificity of anti-MRS antibodies (1E8 and 8A12) of the present invention with a known commercially accessible MRS antibody (Ab50793) by using cell lysates of H460 cells treated with si-MRS.

    [0177] FIG. 2 shows western blot results comparing the MRS-binding strength and specificity of anti-MRS antibodies (1E8 and 8A12) of the present invention with a known commercially accessible MRS antibody (Ab137105) by using the cell lysates of PANC-1 cell line (pancreatic cancer cell line) and SCK cell line (non-pancreatic cancer cell line).

    [0178] FIG. 3 shows a graph depicting the results of ELISA conducted to investigate the cross-reactivity of the 1E8 antibody with other aminoacyl-tRNA synthetase (ARS) and AIMP proteins.

    [0179] FIG. 4 shows a graph depicting the results of ELISA conducted to investigate the cross-reactivity of the 8A12 antibody with other aminoacyl-tRNA synthetase (ARS) and AIMP proteins.

    [0180] FIG. 5 shows the results of surface plasmon resonance (SPR) tests conducted to investigate antibody affinity of the 1E8 antibody to MRS+AIMP3 protein.

    [0181] FIG. 6 shows the surface plasmon resonance (SPR) test results verifying that the 1E8 antibody had no response to AIMP3.

    [0182] FIG. 7 shows the results of surface plasmon resonance (SPR) tests conducted to investigate antibody affinity of the 8A12 antibody to MRS+AIMP3 protein.

    [0183] FIG. 8 shows the surface plasmon resonance (SPR) test results verifying that the 8A12 antibody had no response to AIMP3.

    [0184] FIG. 9 compares the immunofluorescence staining results using the anti-MRS antibodies (1E8 and 8A12) of the present invention and the commercially accessible MRS antibody (Ab137105) on the PANC-1 cell line (pancreatic cancer cell line) and the SCK cell line (non-pancreatic cancer line).

    [0185] FIG. 10 shows the results of immunofluorescence staining of the 1E8 and 8A12 antibodies of the present invention conducted by manufacture Thinprep slides similar to clinical conditions of the PANC-1 cell line through the Thinprep device (Hologic. Inc) used in patient sample processing in clinical sites.

    [0186] FIG. 11 shows the H&E staining results, observation results of MRS expression or non-expression, and observation results of CEA expression or non-expression in the pancreatic cells isolated from normal patients (each number represents a patient code number).

    [0187] FIG. 12 shows the H&E staining results, observation results of MRS expression or non-expression, and observation results of CEA expression or non-expression in the pancreatic cells isolated from pancreatic cancer patients (each number represents a patient code number).

    [0188] FIG. 13 shows the observation results of MRS expression or non-expression and the observation results of CEA expression or non-expression in the pancreatic cytodiagnosis samples of patients that was identified as atypical cells as a result of H&E staining and afterward was definitively diagnosed with pancreatic cancer (each number represents a patient code number).

    [0189] FIG. 14 shows the results of observing the expression level of MRS in normal acinar cells in the normal pancreatic tissue.

    [0190] FIG. 15 shows the results of double detection of MRS and CK19 proteins in pancreatic cancer cells (PANC-1 cell line), depicting that the staining intensity was shown for each marker.

    [0191] FIG. 16 shows the results of double detection of MRS and CK19 proteins in non-pancreatic cancer cells (CT26 cell line), depicting that each marker was not detected.

    [0192] FIG. 17 shows staining images by conventional pathologic cytology (pap staining) and the results of double staining of the present invention, in the cell sample containing a plurality of pancreatic acinar cells.

    [0193] FIG. 18 shows the results of the double staining of the present invention in the pancreatic cell sample of a patient classified as atypical cells by conventional pathologic cytology (pap staining) and thus undiagnosable but finally diagnosed with pancreatic cancer.

    [0194] FIG. 19 shows the results of the double staining of the present invention in the pancreatic cell sample of a patient undiagnosed due to being suspicious of pancreatic cancer (malignancy) by conventional pathologic cytology (pap staining) but finally diagnosed with pancreatic cancer.

    [0195] FIG. 20 shows the results of the double staining of the present invention in the pancreatic cell sample of a patient diagnosed with pancreatic cancer by conventional pathologic cytology and finally diagnosed with pancreatic cancer.

    [0196] FIG. 21 shows the results of MRS detection of the present invention and additional CK19 detection in the tissue (in which pancreatic cancer cells co-exist with normal cells) determined to be a pancreatic cancer tissue by conventional pathologic histology (H&E staining).

    [0197] FIG. 22 shows the results of MRS detection of the present invention and additional CK19 detection in the tissue determined to be normal pancreatic tissue by conventional pathologic histology (H&E staining) (arrows indicating pancreatic duct regions stained with CK19).

    MODE FOR CARRYING OUT THE INVENTION

    [0198] Hereinafter, the present invention will be described in detail.

    [0199] However, the following examples are merely for illustrating the present invention, and are not intended to limit the scope of the present invention.

    EXAMPLE 1

    Construction of useful Antibody for Present Inventive Method for Examination of Pancreatic Cancer (Obtaining Antibody having High Specificity to MRS)

    [0200] It has been known that in vivo, methionyl-tRNA synthetase (MRS) is present in a state of binding with aminoacyl-tRNA synthetase complex-interacting multifunctional protein 3 (AIMP3) and such binding is broken by UV irradiation or the like. Therefore, for substantially accurate detection of MRS, only MRS needs to be specifically detected even in situations where MRS binds with AIMP3. However, current AIMP types and ARS types have many similarities in terms of protein structures, and thus commercial antibodies have a problem of showing cross-reactivity with other AIMP and ARS types. For diagnostic accuracy in the pancreatic cancer examination method of the present invention, the present inventors produced high-sensitivity MRS antibody having no cross-activity with the other proteins as below.

    [0201] 1-1. MRS-AIMP3 Protein Production

    [0202] MRS-AIMP3 co-purified protein was expressed and purified from E. coli, and specific experiment methods are as follows. BL21DE3 strain was transformed so as to express MRS (SEQ ID: 1) and AIMP3 (SEQ ID NO: 40, NCBI ref.NM_004280.4), and cultured in LB medium, and then single colony was cultured to reach an OD600 value of 0.6-0.8 in 5 ml of LB liquid medium containing ampicillin. After 1 mM IPTG was added, the cells were incubated at 37° C. for 3 h, and then only the cells were obtained by centrifugation for 10 minutes. SDS-PAGE was performed with the cell solution to check for the expression of the proteins using Coomassie staining. Thereafter, the cell solution having IPTG-induced overexpression was collected and centrifuged to obtain cells. The cells were loosened with 1 ml of DPBS, followed by cell lysis using an ultrasonicator, and then the lysed cells were centrifuged to separate MRS-AIMP3 co-purified protein.

    [0203] 1-2. Mouse Immunization through Injection of MRS-AIMP3 Protein

    [0204] To obtain immunized mice necessary for the preparation of hybridoma cells, the MRS-AIMP3 co-purified protein obtained in Example 1-1 was primarily injected into the abdominal cavity of four 8- to 10-week old mice. The 10-week old BALB/c mice weighing 25-30 g were purchased from Orient Bio Co. (Sungnam, KyungKi-Do, Republic of Korea). The animals were sufficiently acclimated under predetermined conditions (temperature: 20±2° C., humidity: 40-60%, light cycle: 12-h light/dark cycle), and then used in the present study. Animal experiments were conducted according to the guidelines of the Institutional Animal Care and Use Committee of Seoul National University. Two weeks later, the same dose of MRS-AIMP3 co-purified protein was secondarily injected into the abdominal cavity of the mice to enhance the immunity of the mice after the primary immunization. One week later, the MRS-AIMP3 co-purified protein was booster-injected into the tail vein of the mice three days before cell fusion. After the immunized mice were anesthetized with ether, blood was drawn from the heart using a heparinized syringe. Thereafter, the blood was allowed to stand overnight at 4° C., and then centrifuged to separate serum. The separated serum was appropriately divided and stored at −80° C.

    [0205] 1-3. Preparation of Hybridoma Cells

    [0206] First, myeloma cells were prepared for cell fusion. The myeloma cells were cultured to a cell density of 2.5 to 5×10.sup.4 cell/ml. The myeloma cells were prepared by a ⅓ dilution 24 hours before cell fusion. The mice immunized in Example 1-2 were anesthetized with ether, and then spleens were harvested, followed by isolation of B cells. The spleens were washed with SF-DMEM2 (DMEM+2×AA), followed by cell elution. The cell suspension was collected, placed in a tube, and allowed to stand to settle heavy masses. The supernatant was transferred to a new tube, and then centrifuged at 1500 rpm for 5 m. The centrifuged splenocytes were collected by removing the supernatant, and the tube was tapped and then filled with SF-DMEM2. The B cells and the myeloma cells were separately centrifuged and washed, and then washing was repeated once more. The supernatant of the washed myeloma cells was removed, and the tube was tapped and then filled with SF-DMEM2. In addition, the supernatant of the washed B cells was removed, and the tube was tapped, and treated with 1 ml of lysis buffer (LB) to lyse red blood cells (RBCs), and then filled with SF-DMEM2. Then, the B cells and the myeloma cells were separately centrifuged, and the supernatants of the centrifuged splenocytes and myeloma cells were removed, and then the tubes were tapped and filled with 10 ml of SF-DMEM2. The B cells and myeloma cells were diluted 100-fold in e-tubes, respectively, and counted to determine concentrations thereof [B cell concentrations (1×10.sup.8, 8×10.sup.7, 5×10.sup.7), myeloma cell concentrations (1×10.sup.7, 8×10.sup.6, 5×10.sup.6)]. The B cells and the myeloma cells were determined at a ratio of 10:1. The B cells and the myeloma cells with the determined concentrations were placed together in a tube and centrifuged. The supernatant of the centrifuged cells was removed, and then the tube was put upside down on an alcohol pad and semi-dried for 30 s to 1 min, and tapped. PEG (2 ml) was slowly added for 1 min to the tube while pipetting, and the tube was shaken with the addition of SF-DMEM2, followed by centrifugation. After the centrifugation, the supernatant was removed and, without tapping, HT medium [1 ml of HT50×(HT(sigma) 1 vial+SF-DMEM1 10 ml), 10 ml of FBS, 30 ml of SF-DMEM1(DMEM+1×AA)] was added dropwise with gradually increasing speed, to reach 50 ml. This suspension was again incubated in a 5% CO.sub.2 incubator at 37° C. for 3 h.

    [0207] 1-4. Selection of Hybridoma Cells Producing MRS-Specific Monoclonal Antibodies

    [0208] To select cells specifically recognizing MRS but not AIMP3 in the fusion cell groups prepared in Example 1-3 above and investigate the production or non-production of an antibody, the following test was conducted.

    [0209] First, the medium was exchanged 8-9 days after cell fusion, and incubated in cDMEM2 until the cells were well grown in 96 wells and 24 wells. After medium exchange, the supernatants in wells in which the color has changed were collected and filled with cDMEM2 on day 5-7, and then an ELISA test was performed for the binding of an antibody produced from each fusion cell with MRS and AIMP3. After the ELISA test, wells were selected, and the cells in the selected well were transferred in 24 wells, followed by incubation. After the incubation in 24 wells, an ELISA test was again performed. Specifically, the concentration of fusion cells in 24 wells was checked, and the fusion cells were diluted in 15 ml of the culture so as to reach 0.5 cells/well in the 96-well plate. The fusion cell dilution was dispensed at 150 μl per well. The wells containing one cell were checked by microscopy. The supernatant in the wells containing cells that grew to some extent was collected, and primary screening was conducted by investigating the binding of the antibody, produced from respective fusion cells, with MRS and AIMP3 through ELISA and western blotting. The fusion cells selected on the basis of the primary screening were transferred and incubated in 24 wells, followed by centrifugation, and thereafter, the supernatant was collected, and secondary screening was conducted by ELISA and western blotting. The absorbance (OD value) of the fusion cells grown in the 24 wells was checked by ELISA to select only fusion cells having an absorbance exceeding 1.0. The selected cells were transferred and incubated in 25T/C culture flask and centrifuged, and then the supernatant was collected, and tertiary screening was conducted by ELISA and western blotting. The fusion cells selected on the basis of the tertiary screening were again transferred and incubated in 75T/C culture flask, and then the absorbance was checked by ELISA to select cells well recognizing MRS but not AIMP3, thereby finally securing “1E8” and “8A12” clones.

    [0210] 1-5. Culture of Hybridoma Cells Producing MRS-Specific Monoclonal Antibodies and Purification of Antibodies

    [0211] Monoclonal antibodies to MRS can be obtained from the final fusion cells (hybridoma cells “1E8” and “8A12”) selected in Example 1-4 by the following two methods.

    [0212] 1) Female mice aged 7-8 weeks were injected with 500 μl of pristane through the abdominal cavity. The fusion cells cultured in the 75T/C culture flask were collected and centrifuged, followed by supernatant removal, and then the cells were placed in a phosphate buffer and pipetted. After 7-10 days of pristane administration, the fusion cells selected in Example 1-4 were injected in an amount of 8×10.sup.5 to 4×10.sup.7 cells into the abdominal cavity of the mice. When the abdominal cavity of the mice was full of ascites 12 weeks later, the ascites were extracted using an 18G-syringe needle. The ascites were kept at 4° C. overnight and then centrifuged the next day, thereby removing a mass material containing a yellow layer of fat and separating only the supernatant. The separated supernatant was dispensed and stored at −20° C.

    [0213] For the purification of antibodies from the ascites, a column was packed with an appropriate amount of protein A, which has been stored in a stock solution (20% ethanol), and 20% ethanol was allowed to flow through the column, and then the column was washed with a 5-bed volume of a binding buffer (20 mM sodium phosphate, pH 7.0). The ascites were diluted with an appropriate amount of a phosphate buffer, and was then loaded on the protein A column. After binding was conducted using a 3-bed volume of a binding buffer (20 mM sodium phosphate, pH 7.0), 5 ml of fractions were eluted with a 3-bed volume of an elution buffer (0.1 M glycine buffer, pH 3.0-2.5). Each fraction was neutralized with 35 μl of a neutralization buffer (1M Tris-HCl, pH 9.0). The fractions were checked for purity through SDS-PAGE, and desalted with Ammersharm GE column.

    [0214] 2) The hybridoma cells obtained in Example 1-4 were acclimated in serum-free medium (Thermo) supplemented with GlutaMAX (Gibco) (final 5 mM) and lx cholesterol lipid concentrate (Gibco) (8A12 antibody-producing hybridoma cells are also named 34-8F2). Thereafter, the cells were cultured in a maximum culture volume of 860 ml using Cellstack-5 (Corning, Corning, NY). GlutaMAX (Gibco) (final 5 mM) and 1× cholesterol lipid concentrate (Gibco) were added to the serum-less medium (Thermo), and the cells were inoculated at an initial cell concentration of 1.4-2.0×10.sup.5 cells/ml. After 4-5 days of the inoculation, the cells were removed by centrifugation at 2000 rpm for 10 m and the culture supernatant was recovered. The pH of the supernatant was checked, and then the pH was adjusted to 7.6 using the prepared 20X binding solution (1M potassium phosphate dibasic, pH 9.0). Thereafter, the supernatant was filtered using a 0.22-μm filter to obtain a neutralized antibody culture solution.

    [0215] The obtained antibody culture solution was purified through a protein A column. After 10 column volumes of distilled water were allowed to flow through the protein A column, an equal amount of 1X binding solution (50 mM potassium phosphate dibasic, pH 9.0) was allowed to flow therethrough. Thereafter, the obtained antibody culture solution was allowed to flow therethrough to bind antibodies to protein A, followed by washing with 1X binding solution (50 mM potassium phosphate dibasic, pH 9.0). To elute the antibodies bound to protein A, 2 column volumes of an elution solution (0.2 M citric acid, pH 3.0) were allowed to flow therethrough, thereby obtaining an eluate. After the eluate was neutralized with 1 M Tris, the concentration of antibodies was determined by measurement of the absorbance at 280 nm.

    [0216] Thereafter, the GE PD-10 column was equilibrated with 25 ml of physiological saline and then centrifuged (1,000 g, 2 min). Thereafter, 2.5 ml of the antibody eluate obtained from the protein A column was added to the GE PD-10 column, followed by centrifugation (1000 g, 2 min), thereby collecting an antibody solution exchanged with physiological saline. The antibody concentration was determined by measurement of the absorbance at 280 nm, and then the antibody solution was dispensed and stored at −80° C.

    [0217] 1-6. Antibody Sequencing and Cloning

    [0218] The 1E8 and 8A12 clone-expression antibodies were cloned and sequenced by YBIO Inc. and Abclon Inc. (Korea), respectively. Briefly, RNA was first extracted from 1E8 or 8A12 hybridoma cells to synthesize cDNA. Then, PCR was performed using primers specific to VL, CL, VH, and CH1. PCR products with expected sizes were purified on agarose gel, the sequences thereof were identified through sequencing, and CDR regions were identified through Kabat numbering. The sequencing results of the antigen-binding region of 1E8 antibody are shown in Table 1, and the sequencing results of the antigen-binding region of 8A12 antibody are shown in Table 2. The Fab molecules were synthesized from the identified sequences, and were verified to show high binding ability to MRS through ELISA.

    [0219] It was also verified that the above identified sequences are consistent with the protein sequencing results (mass spectrometry results) of the antibodies, which were obtained through ascites purification after the hybridoma cells were injected into the abdominal cavity of the mice in Example 1-5.

    [0220] The obtained 1E8 Fab or 8A12 Fab sequences were cloned into the mouse IgG heavy chain sequence vector (pFUSE-mIgG2a-Fc, InvivoGen) and mouse light chain (pFUSE2-CLIg-mK, InvivoGen) sequence vector. Then, the vectors were co-transformed into freestyle 293F cells using PEI (Polysciences, 23966-2), so that antibody heavy and light chains were co-expressed together in the cells. The transformed 293F cells were cultured under conditions of 37° C. and 8% CO.sub.2 for 7 days. Then, the cells were obtained and centrifuged, and the supernatant was obtained. The pH of the supernatant was checked, and then the pH of the supernatant was adjusted to 7.6 using the prepared 20X binding solution (1M potassium phosphate dibasic, pH 9.0). Thereafter, the supernatant was filtered using a 0.22-um filter to obtain a neutralized antibody culture solution. An antibody was obtained from the antibody culture solution by the method described in 2) of Example 1-5. It was confirmed that the whole 1E8 IgG antibody thus obtained is composed of a light chain comprising an amino acid sequence of SEQ ID NO: 36 and a heavy chain comprising an amino acid sequence of SEQ ID NO: 37. It was also confirmed that the whole 8A12 IgG antibody thus obtained is composed of a light chain comprising an amino acid sequence of SEQ ID NO: 38 and a heavy chain comprising an amino acid sequence of SEQ ID NO: 39.

    TABLE-US-00001 TABLE 1 Amino acid sequence DNA sequence VH FR1 DVKLQESGPGLVNPSQSLSLT Gatgtgaagcttcaggagtcgg CTVTGYSIT gacctggcctggtgaatccttc (SEQ ID NO: 41) tcagtctctgtccctcacctgc actgtcactggctattcaatca cc (SEQ ID NO: 42) CDR- SDYAWN Agtgattatgcctggaac H1 (SEQ ID NO: 10) (SEQ ID NO: 11) FR2 WIRQFPGNKLEWMG Tggatccggcagtttccaggaa (SEQ ID NO: 43) acaaactggagtggatgggc (SEQ ID NO: 44) CDR- YISYSGRTSYKSSLKS Tacataagctacagtggtcgca H2 (SEQ ID NO: 12) ctagctacaaatcatctctcaa aagt (SEQ ID NO: 13) FR3 RISITRDTSKNQFFLELNSVT Cgaatctctatcactcgagaca TEDTATYYCAR catccaagaaccagttcttcct (SEQ ID NO: 45) ggagttgaattctgtgactact gaggacacagccacatattact gtgcaaga (SEQ ID NO: 46) CDR- DYGNFVGYFDV Gactatggtaacttcgtaggtt H3 (SEQ ID NO: 14) acttcgatgtc (SEQ ID NO: 15) FR4 WGAGTTVTVSS Tggggcgcagggaccacggtca (SEQ ID NO: 47) ccgtctcctca (SEQ ID NO: 48) VL FR1 DIVMTQSPSSLAVSVGEKVTM Gacattgtgatgacccagtctc SC catcctccctagctgtgtcagt (SEQ ID NO: 49) tggagagaaggttactatgagc tgc (SEQ ID NO: 50) CDR- KSSQSLLYSSNQKNYLA Aagtccagtcagagccttttat L1 (SEQ ID NO: 4) atagtagcaatcaaaagaacta cttggcc (SEQ ID NO: 5) FR2 WYQQKPGQSPKLLIY Tggtaccagcagaaaccagggc (SEQ ID NO: 51) agtctcctaaactgctgattta c (SEQ ID NO: 52) CDR- WASTRES Tgggcatccactagggaatct L2 (SEQ ID NO: 6) (SEQ ID NO: 7) FR3 GVPDRFTGSGSGTEFTLTISS Ggggtccctgatcgcttcacag VKAEDLAVYYC gcagtggatctgggacagaatt (SEQ ID NO: 53) cactctcaccatcagcagtgtg aaggctgaagacctggcagttt attactgt (SEQ ID NO: 54) CDR- QQYYSYPT Cagcaatattatagctatccga L3 (SEQ ID NO: 8) cg (SEQ ID NO: 9) FR4 FGGGTKLEIK ttcggtggaggcaccaagctgg (SEQ ID NO: 55) aaatcaaa (SEQ ID NO: 56)

    TABLE-US-00002 TABLE 2 Amino acid sequence DNA sequence VH FR1 DVKLQESGPGLVKPSQSLSLT Gatgtgaagcttcaggagtcgg CTVTGYSIT gacctggcctggtgaaaccttc (SEQ ID NO: 57) tcagtctctgtccctcacctgc actgtcactggctattcaatca cc (SEQ ID NO: 58) CDR- SEYAWT Agtgagtatgcctggacc H1 (SEQ ID NO: 22) (SEQ ID NO: 23) FR2 WIRQFPGNKLEWMG Tggatccggcagtttccaggaa (SEQ ID NO: 59) acaaactggaatggatgggc (SEQ ID NO: 60) CDR- YINYNGNTNLNPSLKS Tacataaactacaatggcaaca H2 (SEQ ID NO: 24) ctaacttaaatccatctctcaa aagt (SEQ ID NO: 25) FR3 RISIIRDTSKNQFFLQLNSVT Cgaatctctatcattcgagaca TEDTATYYCAR catccaagaaccagttcttcct (SEQ ID NO: 61) gcagttgaattctgtgacaact gaggacacagccacatattact gtgcaaga (SEQ ID NO: 62) CDR- SLWPRGWFAY Tcactttggcccaggggctggt H3 (SEQ ID NO: 26) ttgcttac (SEQ ID NO: 27) FR4 WGQGTLVTVSA Tggggccaagggactctggtca (SEQ ID NO: 63) ctgtctctgca (SEQ ID NO: 64) VL FR1 DIQMTQSPSSMYASLGERVTI gacattCtgatgacccagtctc TC catcttccatgtatgcatctct (SEQ ID NO: 65) aggagagagagtcactatcact tgc (SEQ ID NO: 66) CDR- KASQDINSYLS Aaggcgagtcaggacattaata L1 (SEQ ID NO: 16) gctatttaagc (SEQ ID NO: 17) FR2 WFQQKPGKSPKTLMY Tggttccagcagaaaccaggga (SEQ ID NO: 67) aatctcctaagaccctgatgta t (SEQ ID NO: 68) CDR- RANRLVD Cgtgcaaacagattggtagat L2 (SEQ ID NO: 18) (SEQ ID NO: 19) FR3 GVPSRFSGSGSGQDYSLTISS Ggggtcccatcaaggttcagtg LEYEDMGIYYC gcagtggatctggccaagatta (SEQ ID NO: 69) ttctctcaccatcagcagcctg gaatatgaagatatgggaattt attattgt (SEQ ID NO: 70) CDR- LQYDEFPRT Ctacagtatgatgagtttcctc L3 (SEQ ID NO: 20) ggacg (SEQ ID NO: 21) FR4 FGGGTKLEIK Ttcggtggaggcaccaagctgg (SEQ ID NO: 71) aaatcaaa (SEQ ID NO: 72)

    [0221] 1-7. Verification on Comparison of Binding Specificity of Antibody to MRS—Western Blotting

    [0222] To investigate the MRS binding ability of the 1E8 and 8A12 antibodies obtained in the above example, the following western blot test was conducted. H460 cells were incubated in DMEM (HyClone, GE Life Sciences) containing 10% fetal bovine serum (FBS, HyClone, GE Life Sciences) and 1% penicillin (HyClone, GE Life Sciences). All the cells were incubated under conditions of 5% CO.sub.2 and 37° C. The incubated H460 cells were treated with si-MRS for 72 h. Then, the H460 cells were obtained and lysed, and then the H460 cell lysate was subjected to western blotting. The test was repeated twice. The 1E8 or 8A12 antibody as a primary antibody was diluted to 1:5000 (0.2 μg/ml) before use and, for comparison of binding ability, a currently commercially available MRS antibody (Abcam, Ab50793) was used by the same method, and tubulin was used as a control.

    [0223] As a result of the test, as shown in FIG. 1, the conventional commercially available MRS antibody never detected MRS in the si-MRS treatment group and showed significantly low detection ability (binding ability with MRS) compared with the 8A12 and 1E8 antibodies of the present invention even in the si-MRS non-treatment group. On the contrary, the 8A12 and 1E8 antibodies of the present invention showed significantly excellent MRS-specific binding ability and sensitivity compared with the conventional commercially available MRS, and especially the 8A12 antibody showed very excellent binding ability and sensitivity.

    [0224] In addition, the MRS-binding ability of the 8A12 and 1E8 antibodies was further investigated using the PANC-1 pancreatic cancer cell line and SCK cell line (non-pancreatic cancer cell line). A commercially available MRS antibody (Abcam, Ab137105) was used as a control (antibodies were diluted to 1:1000 before use, 0.137flg/m1), and western blotting was carried out in the same manner as described above except for the si-MRS treatment procedure.

    [0225] As a result of the test, as shown in FIG. 2, the 8A12 and 1E8 antibodies of the present invention made an MRS-specific detection, but in the same conditions, the conventional commercially available antibody Ab137105 showed many non-specific bands, indicating very low selective detectability. Under the present test conditions, MRS was little detected in the SCK cell line (non-pancreatic cancer cell line).

    [0226] 1-8. Verification on Cross-Reactivity with other Proteins—ELISA

    [0227] To investigate whether the 8A12 antibody obtained in the above example had cross-reactivity with other aminoacyl-tRNA synthetase (ARS) proteins, the following test was conducted.

    [0228] On 96-well plates (Corning 3690 flat bottom, 96-well half-area plates), MRS proteins (His-MRS and MRS full) and other ARS proteins (DX2 tag free, 34S-DX2, 34S-AIMP2, His-CRS, His-AIMP1, His-GRS, His-WRS, and His-KRS) were each coated at a concentration of 1 μg/ml. The 1E8 or 8A12 antibody was added at a concentration of 500 ng/ml to the 96-well plates coated with the respective ARS proteins, followed by incubation for 1 hour. Thereafter, HRP-conjugated anti-mouse IgG secondary antibody was added, followed by incubation for 1 h, and then the absorbance at 450 nm was measured by ELISA. As a substrate, 3,3′,5,5′-tetramethylbenzidine (TMB) was used.

    [0229] As a result, as shown in FIG. 3, the 1E8 antibody bound to and reacted with only MRS, but did not react with other ARS and AIMP proteins. As a result, as shown in FIG. 4, the 8A12 antibody bound to and reacted with only MRS, but did not react with other ARS and AIMP proteins. The results verified that the 1E8 and 8A12 antibodies had no cross-activity with other ARS and AIMP proteins, and specifically detected only MRS.

    [0230] 1-9. Verification on Antibody Affinity using Surface Plasmon Resonance

    [0231] To investigate MRS-specific affinity of the 1E8 and 8A12 antibodies, a surface plasmon resonance (SPR) test was conducted using MRS-AIMP3 co-purified protein (hereinafter, MRS+AIMP3 protein) and AIMP3 protein. MRS+AIMP3 or AIMP3 protein was coated on a CM5 chip, and different concentrations of the 1E8 or 8A12 antibody were allowed to flow down, thereby measuring the degree of binding response with the protein. An analyte sample or buffer was injected at a flow rate of 30 μl/min for 8 minutes, and washed for 20 minutes.

    [0232] As a result, as shown in FIGS. 5 and 6, the 1E8 antibody bound to the MRS+AIMP3 protein but did not bind to the AIMP3 protein. It could also be verified that the 1E8 antibody had a KD value of 5.42 nM to MRS.

    [0233] As shown in FIGS. 7 and 8, it could be verified that the 8A12 antibody bound to the MRS+AIMP3 protein but did not bind to the AIMP3 protein. It could also be verified that the 8A12 antibody had a KD value of 1.56 nM to MRS.

    [0234] 1-10. Verification on Binding Site of MRS Antibodies

    [0235] To investigate the binding site (epitope, main binding site) of the 1E8 or 8A12 antibody, the following test was conducted.

    [0236] First, several MRS fragments with different lengths and loci in the MRS whole protein were constructed in consideration of GST, catalytic domain, and tRNA binding domain sites, and the MRS whole protein or each MRS fragment was cloned into the pcDNA3 vector (EV). The loci of the respective MRS fragments were selected at loci containing several small-unit domains, including the fragment of aa 1-266, the fragment of aa 267-597, the fragment of aa 1-598, the fragment of aa 598-900, the fragment of aa 660-860, the fragment of aa 660-900, the fragment of aa 730-900, and the like, in the whole amino acid sequence of MRS of SEQ ID NO: 1. In the fragments, the Myc protein was conjugated to the N-terminus of each peptide, and the Myc protein was used as a control. Then, 2 μg of the cloned vector DNA was transfected into H460 cells by using Turbofect (Thermo) according to the instruction of the manufacturer. After 24 h, the cells were harvested and western blotting was carried out. For the primary antibody, 1E8 and 8A12 antibodies were diluted at 1:5000 (0.2 μg/mL) before use.

    [0237] Through the test, the epitope of the 1E8 and 8A12 antibodies was shown to be present in at least a region of aa 598-900 in the MRS protein of SEQ ID NO: 1.

    [0238] Therefore, several small-unit domains, including the fragment of aa 811-840, the fragment of aa 821-850, the fragment of aa 831-860, the fragment of aa 841-870, the fragment of aa 846-875, the fragment of aa 851-880, the fragment of aa 856-885, the fragment of aa 861-890, the fragment of aa 866-895, and the fragment of aa 871-900, were constructed, and each peptide was coated at 300 ng/well on 96 well ELISA plates and ELISA was carried out according to the common protocol. The 1E8 or 8A12 antibody as a primary antibody was diluted to 10 nM (lx PBST-Tween 0.05%), and HRP-conjugated Goat anti-mouse IgG (Thermo) as a secondary antibody was diluted at 1:10000 (1xPBST-Tween0.05%). The absorbance was measured at 450 nm.

    [0239] The test results verified that the 1E8 and 8A12 antibodies specifically recognized, as an epitope, the region of aa 861-900 (AQKADKNEVA AEVAKLLDLK KQLAVAEGKP PEAPKGKKKK, SEQ ID NO: 2) in the MRS protein. These test results indicate that other binding molecules (other antibodies and functional fragments thereof) recognizing the region of aa 861-900 as an epitope would also have excellent MRS-specific binding ability and MRS-identifying ability.

    [0240] Hereinafter, an example employing antibodies with excellent MRS detection ability constructed above will be described for the novel pancreatic cancer examination method invented by the present inventors.

    [0241] 1-11. Pancreatic Cancer Cell Staining using Anti-MRS Antibody of Present Invention and Comparison of Effect with Commercially Available Antibody

    [0242] As for the PANC-1 pancreatic cancer cell line and the SCK cell line (non-pancreatic cancer cell line), MRS fluorescence staining was carried out using 1E8 or 8A12 antibody. A commercially available MRS antibody (Abcam, Ab137105) was used as a control. Specifically, staining was carried out as follows. Each type of target cells prepared on slides was treated with PBS containing 0.2% Tween 20 to improve cell permeability thereof, and then blocked with 2% goat serum for 1 h. The slides were incubated with 1 μg/ml of the antibody (1E8 or 8A12 antibody, produced by Oncotag) of the present invention as a primary antibody or Ab137105 antibody (Abcam) at 37° C. for 1 h, and washed three times with 0.05% TBST (500 μl). Thereafter, the Alexa-488-conjugated secondary antibody (purchased from Molecular Probes, Cat. No. A11001) as the fluorescent substance-conjugated secondary antibody was diluted to 1:100, and the slides were incubated with the secondary antibody at room temperature in the dark place, and washed three times with 0.05% TBST (500 pl). The tissue on the slides was treated with 20 μl of DAPI-added mounting solution (ProLong Gold antifade regent with DAPI/ Molecular Probes, Cat. No. P36931), and then the slides were covered with coverslips, followed by observation using a confocal laser microscope and a fluorescence microscope.

    [0243] As shown in FIG. 9. the commercially available Ab137105 antibody, which has been identified to have poor MRS specificity in Example 1-7, non-specifically stained the PANC-1 pancreatic cancer cells and the SCK cells (non-pancreatic cancer cells), but the 1E8 and 8A12 antibodies of the present invention specifically stained only MRS.

    [0244] In addition, the staining effects of the 1E8 and 8A12 antibodies of the present invention were investigated by utilizing the Thinprep device (Hologic. Inc) used in patient sample processing in clinical sites to manufacture Thinprep slides similar to clinical conditions of the PANC-1 cell line (see Example 2 below).

    [0245] As a result, as shown in FIG. 10, the 1E8 and 8A12 antibodies of the present invention could be used together with a sample providing method (Thinprep slides or the like) that has been often used in the clinical sites.

    EXAMPLE 2

    Establishment and Effect Verification of Pancreatic Cancer Cell-Specific MRS Expression Detecting Method (Staining Method) in Cytodiagnosis

    [0246] Methods

    [0247] 1) Pancreatic cells as a specimen were obtained by endoscopic ultrasound fine needle aspiration (EUS-FNA). First, a linear array echoendoscope EUS (product name: GF-UCT140 or GF-UCT180, Olympus, Japan) was guided to the stomach or duodenum, and an ultrasound device mounted on the front end of the EUS was used to identify pancreatic masses through ultrasound imaging. The pancreatic cells were collected by allowing a needle for fine needle aspiration (product name: 22G Echo-ultra™, Cook Medical, Cork, Ireland) to enter the ultrasound-guided masses.

    [0248] Thereafter, the collected pancreatic cells were provided, as Cellient paraffin sections, on slides by a common method using the Cellient Automated Cell Block System (Hologic) (Antonio Ieni et al., Cell-block procedure in endoscopic ultrasound-guided-fine-needle-aspiration of gastrointestinal solid neoplastic lesions, World J Gastrointest Endosc 2015 August 25; 7(11): 1014-1022). Alternatively, the pancreatic cancer cells may be smeared or provided through direct smearing on ThinPrep slides by a common method using ThinPrep (Hologic.Inc) (de Luna R et al., Comparison of ThinPrep and conventional preparations in pancreatic fine-needle aspiration biopsy. Diagnostic Cytopathology, 2004 Feb;30(2):71-6). The cell samples each were subjected to the following examination method, and the results thereof were compared.

    [0249] 2) Pathological findings by a conventional cytological examination may be made by the staining results using H&E staining that has frequently been used up to now. The H&E staining was carried out using hematoxylin and eosin according to a common protocol (see protocol details in Example 3 below). Alternatively, the pathological findings may be made by the staining results through Pap staining. The Pap staining was carried out using hematoxylin, OG-6(Orange G-6), and eosin azure according to a common protocol (see protocol details in Example 3 below). The paraffin section samples were treated with staining substances after paraffin removal and hydration were carried out through common methods.

    [0250] The cells were determined to be benign (normal) cells when: the cells were smeared in one layer on the slides; the nuclear to cytoplasmic ratio (N/C ratio) is small; and the nuclear membrane has a smooth shape. The cells were determined to be malignant cells when: the cells were three-dimensionally smeared; the nucleus/cytoplasm ratio was high; chromatin clumping appeared; the nuclear membrane had a rough shape; and nucleoli and mitosis appeared. The cells were identified as atypical cells when the cell change did not reach malignant cells but could not be diagnosed with benign.

    [0251] 3) The final clinical diagnosis results were made by doctors through a comprehensive final determination on the basis of the measurement results by imaging examinations (abdominal ultrasound, abdominal computed tomography, abdominal magnetic resonance imaging, endoscopic retrograde cholangiogram, and positron emission tomography) and pathological examinations (cytodiagnosis and biopsy).

    [0252] 4) The present inventors developed the immunohistochemistry (especially, immunofluorescence staining) for measuring the expression level of MRS in pancreatic cells and normal pancreatic cells (including benign pancreatitis cells but not cancer cells) as follows. Specifically, the paraffin sections were treated as follows.

    [0253] {circle around (1)} Paraffin removal: dissolve paraffin in oven at 60° C.

    [0254] {circle around (2)} Hydration: wash with xylene for 5 min three times, wash with 100% ethanol two times, wash with 95% ethanol for 2 min, wash with 90% ethanol for 2 min, wash with 70% ethanol for 2 min, wash with D.W for 2 min, and wash with PBS for 5 min

    [0255] {circle around (3)} Treatment for permeability increase: treat with 0.2% Triton X-100 for 30 min, and wash with PBS for 5min

    [0256] {circle around (4)} Pretreatment: block with 2% goat serum for 1 h

    [0257] {circle around (5)} Primary antibody treatment: dilute anti-MRS antibody (the 8A12 antibody of the present invention being representatively used, Oncotag) to 1 : 300, incubated with the diluted antibody at 4° C., and wash with PBS for 5 min three times

    [0258] {circle around (6)} Color development: The Alexa-488-conjugated secondary antibody (purchased from Molecular Probes, Cat. No. A11001) as a secondary antibody to which a fluorescent substance is conjugated to 1:200 - 1:300, incubate with the secondary antibody at room temperature in the dark for 1 h, and wash with PBS for 5 min three times

    [0259] {circle around (7)} Treat the tissue on the slides with 20 pl of DAPI-added mounting solution (ProLong Gold antifade regent with DAPI/Molecular Probes, Cat. No. P36931), and cover the slides with coverslips.

    [0260] The Thinprep slides were treated by a method comprising steps {circle around (3)} to {circle around (7)}, without paraffin removal, and reference samples prepared by the method were observed by a confocal laser microscope and a fluorescence microscope.

    [0261] The MRS staining intensity was determined in the reference samples on the basis of the positive cell sample (PANC-1, see FIG. 15) and the negative cell sample (CT-26, see FIG. 16), and the cells showing a 2-fold or more increase compared with the negative cell control were determined to be pancreatic cancer cells. The diagnostic accuracy (sensitivity and specificity) was checked by comparing these results with the pathological findings and final clinical diagnosis results of the specimen.

    [0262] Results

    [0263] Specific test results are shown in Tables 3, 4, and 5 below. As a result of applying the pancreatic cancer discrimination method through MRS staining of the present invention to 14 benign pancreatic cell samples and 94 pancreatic cancer (malignancy) cell samples, the conventional pathologic cytology results using H&E staining showed a sensitivity of about 75.5%, whereas the MRS staining of the present invention showed a sensitivity of 92.6%. In particular, even cell samples that have been classified as atypia through a conventional cytopathological examination could be discriminated for pancreatic cancer or non-pancreatic cancer, and thus the negative predictive value (NPV) through the conventional pathologic cytology is 36%, whereas the negative predictive value through MRS staining was significantly high. These results indicate that the staining method using MRS as a marker in pancreatic cancer in the present invention shows high discrimination ability (diagnostic ability) even at the cellular level, and as shown in Example 3 to be described later, the MRS used as a marker of the present invention was clearly distinguished from conventional commercially available pancreatic cancer markers (known pancreatic cancer markers, such as CEA) of which effectiveness had been difficult to exhibit in the diagnosis at the cellular level (that is, cytodiagnosis).

    TABLE-US-00003 TABLE 3 Comparative details: Comparison between conventional pathologic cytology results and MRS immunostaining results according to present invention, on the basis of final clinicopathological diagnosis results Conventional Final clinicopath- MRS immunostaining pathologic cytology ological diagnosis Positive Negative Malignancy (n = 43) Malignancy (n = 43) 42 1 Benign (n = 0) 0 0 Suspicious of Malignancy (n = 28) 26 2 malignancy (n = 29) Benign (n = 1) 1 0 Atypical (n = 21) Malignancy (n = 18) 17 1 Benign (n = 3) 2 1 Negative for Malignancy (n = 5) 2 3 malignancy (n = 15) Benign (n = 10) 2 8

    TABLE-US-00004 TABLE 4 Comparative summarization: Comparison of conventional pathologic cytology results compared with final clinicopathological diagnosis results (the determinations of positive for malignancy and suspicious malignancy being classified as final positive and the determinations of atypia and negative for malignancy being classified as final negative in conventional pathologic cytology results on Table 3 above) Final clinicopath- ological diagnosis Malignancy Benign Conventional Positive 71 1 pathologic cytology Negative 23 13 Sensitivity: 75.5% Specificity: 92.9% Accuracy = 77.9% PPV: 98.6% NPV: 36.1% PPV: positive predictive value, NPV: negative predictive value

    TABLE-US-00005 TABLE 5 Comparative summarization: Comparison of MRS immunostaining results according to present invention compared with final clinicopathological diagnosis results Final clinicopath- ological diagnosis Malignancy Benign MRS Positive 87 5 immunostaining Negative 7 9 Sensitivity: 92.6% Specificity: 64.3% Accuracy = 88.1% PPV: 94.6% NPV: 56.3% PPV: positive predictive value, NPV: negative predictive value

    EXAMPLE 3

    Comparison of Pancreatic Cancer Discrimination Ability at the Cellular Level between Commercially Available Pancreatic Cancer Marker CEA and Present Inventive MRS

    [0264] Methods

    [0265] 1) Patient Groups and Obtaining Pancreatic Cell Samples for Cytodiagnosis

    [0266] The present study was performed using 26 cases of pancreatic cell samples collected and obtained from 26 patients with suspected pancreatic cancer through cell aspiration (fine needle aspiration) under endoscopic ultrasound, and approved by the Research Ethics Committee of the Gangnam Severance Hospital. The pancreatic cell samples were obtained from the patients by the same method as in Example 2 through endoscopic ultrasound fine needle aspiration (EUS-FNA). Thereafter, the collected pancreatic cells were prepared in a state of Cellient paraffin sections or Thinprep by a common method using the Cellient Automated Cell Block System (Hologic) (see Example 2).

    [0267] The 26 patients with suspected pancreatic cancer were finally diagnosed with pancreatic cancer (13 cases) and normal pancreas (13 cases) through follow-up observation. Among 13 patients finally diagnosed with pancreatic cancer, seven cases were classified as having pancreatic cancer cells through histological observation by pathologists, and the other six cases were classified as having atypical cells by histological observation and finally diagnosed with pancreatic cancer through follow-up observation.

    [0268] The patients provided written informed consent at the time of collection of pancreatic cells, and pancreatic cells, atypical cells, and normal cells were histologically confirmed by pathologists (see the standard for determination in Example 2). Respective types of representative diagnostic cases for normal cells, tumor cells and atypical cells among the 26 obtained samples are shown in the drawing for each test.

    [0269] 2) Conventional Cytodiagnosis Staining

    [0270] H&E staining: The paraffin section samples were subjected to paraffin removal and hydration by treatment with xylene for 5 min three times, treatment with 100% ethanol for 2 min, treatment with 95% ethanol for 2 min, treatment with 90% ethanol for 2 min, treatment with 70% ethanol for 2 min, and treatment with tap water for 10 min. The samples were incubated with hematoxyline at room temperature for 30 s, and washed with tap water for 10 min. The samples were incubated with eosin at room temperature for 1 min, and washed with tap water for 10 min. The samples were subjected to dehydration and clearing by treatment with 70% ethanol for 1 min, 90% ethanol for 1 min, 95% ethanol for 1 min, 100% ethanol for 1 min, and xylene for 5 min three times. After the mounting solution was dropped on the tissue on the slides, the slides were covered with cover slides, and then the samples were observed under an optical microscope.

    [0271] Pap staining: Papanicolaou staining was carried out using Varistain 24-4 stainer of Thermo Scientific according to the protocol embedded in the device. The protocol is shown in Table 6 below.

    TABLE-US-00006 TABLE 6 reagent program1 program2 1 water 10 m 10 m 2 Hema. 1 m 30 s 1 m 30 s 3 water 30 s 30 s 4 water 30 s 30 s 5 0.5% Hcl. 7 s 7 s 6 0.5% Amm. 5 s 5 s 7 water 30 s 30 s 8 50% alc. 30 s 30 s 9 70% alc. 30 s 30 s 10 80% alc. 30 s 30 s 11 95% alc. 30 s 30 s 12 OG 6 1 m 10 s 13 95% alc. 30 s 30 s 14 95% alc. 30 s 30 s 15 EA 50 1 m 10 s 16 95% alc. 30 s 30 s 17 95% alc. 30 s 30 s 18 95% alc. 30 s 30 s 19 99% alc. 30 s 30 s 20 99% + xyl. 20 s 20 s 21 xyl. 30 s 30 s 22 xyl. 30 s 30 s 23 xyl. 30 s 30 s 24 xyl. 30 s 30 s 25 end.

    [0272] 3) Criteria of Determination in Cytodiagnosis According to Morphological Pathology by Conventional Staining

    [0273] The most critical evidence in the morphological diagnosis of malignancies is an invasive growth into surrounding normal tissues, but unlike the biopsy facilitating to prove the relationship between cancer and surrounding tissues, the cytodiagnosis cannot prove the relationship with the surrounding tissues since individual cells were extracted and smeared. Therefore, as an alternative, the atypia of individual cells is evaluated. The atypia refers to a high nuclear to cytoplasmic ratio (N/C ratio) resulting from cell nucleus enlargement and cytoplasm reduction, chromatin partially clumping without uniform distribution in the nucleus, appearance of nucleoli in the nucleus, appearance of mitosis, or the like. The diagnosis of malignancy can be made when all of these findings of atypia are shown and the degrees thereof are severe, but cells should be classified as atypical cells when the findings of the cells are partially shown or the degrees thereof are weak. The reason is that such findings may be partially shown even in benign lesions, such as severe inflammation. On the contrary, cells not showing any of the findings can be determined to be normal cells. It should be of course assumed that the cells can be observed at the site where the cells are collected.

    [0274] 4) Comparative Staining using CEA, known Commercially Available Pancreatic Cancer Marker, and Present Inventive MRS

    [0275] Immunostaining for MRS was carried out in the same manner as described in Example 2. The immunostaining for MRS was carried out by the same procedures as in Example 2 except that Carcinoembryonic Antigen (CEA) antibody (purchased from Dako, Cat. No. M7072) was used for an optimal treatment condition.

    [0276] 5) Statistical Analysis

    [0277] The test results are expressed as mean±standard deviation on the basis of three or more independent test results. For statistical significance, the Student's t test was used to analyze data to compare the difference among multiple groups. The test results were determined statistically significant when P-value was less than 0.05.

    [0278] Results

    [0279] 3-1. Immunostaining of Normal Cells

    [0280] The immunofluorescence staining using MRS or CEA antibody was carried out on the cells that have been determined to be normal as a result of analysis of H&E staining of the cells isolated from the pancreas of normal patients or pancreatic cancer patients by EUS-FNA. The results are shown in FIG. 11.

    [0281] As shown in FIG. 11, the pancreatic cells obtained from four patients showed no findings of tumor characteristics in H&E staining and thus were determined to be normal cells, and in the pancreatic cells determined to be normal, neither MRS nor CEA was stained.

    [0282] 3-2. Immunostaining of Tumor Cells

    [0283] The immunofluorescence staining using MRS or CEA antibody was carried out on the cells that have been determined to be tumor cells as a result of analysis of H&E staining of the cells isolated from the pancreas of pancreatic cancer patients. The results are shown in FIG. 12.

    [0284] As shown in FIG. 12, the pancreatic cells obtained from four patients were determined to be tumor cells in H&E staining. MRS was strongly stained in the tumor cells of all of four pancreatic cancer patients, indicating statistically significant results compared with the normal cell MRS staining group (p=0.019). However, CEA staining was weakly observed in only two patient samples, indicating no statistical significance compared with the normal cell MRS staining group (p=0.187).

    [0285] 3-3. Immunostaining of Atypical Cells

    [0286] MRS or CEA staining was carried out on the pancreatic cells of patients, which are atypical cells that could not be clearly determined to be tumor cells by only H&E staining and have been finally determined to be tumor cells as a result of follow-up observation of the prognosis of the patients afterward. The results are shown in FIG. 13.

    [0287] As shown in FIG. 13, it is not clearly discriminated whether the pancreatic cells classified as atypical cells through H&E staining are tumor cells or normal cells. Meanwhile, all the patients included in the atypical cell group were diagnosed with pancreatic cancer afterward. MRS was strongly stained in the tumor cells of all of four pancreatic cancer patients, indicating statistically significant results compared with the normal cell MRS staining group (p=0.020). However, CEA staining was not observed in all of the four atypical pancreatic cells.

    [0288] It can be seen from the results of Example 3 that performing both H&E staining and MRS staining on pancreatic cells isolated from patients with suspected pancreatic cancer can diagnose pancreatic cancer with much higher accuracy than other tumor markers. In addition, conventional tumor markers (e.g., CEA) cannot clearly discriminate whether the pancreatic cells, which cannot be determined to be tumor cells or normal cells even through H&E staining, are tumor cells or normal cells, but MRS is a very meaningful pancreatic cancer diagnostic marker in that MRS can clearly discriminate, with significantly high accuracy, whether the atypical cells are tumor cells.

    EXAMPLE 4

    Establishment of Highly Accurate Pancreatic Cancer Discrimination Method—MRS Double Staining

    [0289] 4-1. Finding cause of False-Positive Results

    [0290] As shown in Example 3, it has been proved that MRS enables a diagnosis of pancreatic cancer with higher accuracy than conventional existing pancreatic cancer markers, such as CEA. However, the tests in the above-described examples were conducted on all the samples that have already been definitively determined, and therefore, it is necessary to investigate how accurately MRS can diagnose in a blind state after tissue was collected from patients suspected of developing pancreatic cancer. In addition, as shown in Example 2, MRS showed very excellent sensitivity in the diagnosis of pancreatic cancer, but MRS alone showed a somewhat low tendency of specificity as compared with sensitivity in the determination of pancreatic cancer. The present inventors, while testing the ability of MRS to discriminate pancreatic cancer in pancreatic samples obtained from new patients, observed that out of ten samples determined to be negative (non-pancreatic cancer) in pathologic cytology, three samples seemed to show MRS expression. That is, it was confirmed that the expression of MRS is high in some normal pancreatic cell samples, causing an error of false-positive results (a determination may be made diagnosing non-pancreatic cancer samples as a pancreatic cancer).

    [0291] As a result of checking a cause of the false-positive determination by discriminate the overall specimens into cancer tissues and normal tissues through H&E staining and then carrying out MRS staining, it was verified as shown in FIG. 4 that MRS expression was high in normal acinar cells (cells present in the pancreatic parenchyma) in the normal pancreatic tissue.

    [0292] 4-2. Establishment of Strategies for Improving MRS Diagnostic Accuracy

    [0293] As shown in the results in Example 4-1, a high level of MRS was expressed in even normal acinar cells, and thus MRS alone contributes to a false-positive rate in the determination of pancreatic cancer (i.e., the specificity of diagnosis is relatively low in the determination using MRS alone). Therefore, a strategy for reducing the false-positive rate was sought by excluding such acinar cells from the interpretation of the results.

    [0294] After various trials, the present inventors first established that pancreatic cancer (especially pancreatic ductal cancer) can be discriminated with very high accuracy at the cellular level by using, as a double marker, MRS and cytokeratin 19 (CK19) among several subsidiary marker candidates. Therefore, double staining using MRS and CK19 was invented as follows.

    [0295] 4-3. Establishment of Double Staining

    [0296] As for paraffin section samples, paraffin was melted in an oven at 60° C., and subjected to paraffin removal and hydration by washing with xylene for 5 min three times, washing with 100% ethanol two times, washing with 95% ethanol for 2 min, washing with 90% ethanol for 2 min, washing with 70% ethanol for 2 min, and washing with D.W for 2 min.

    [0297] For double staining of MSR and CK19, a specific test protocol was established such that MRS was detected in green (Alexa Fluor 488) and CK19 was detected in red (Texas Red). First, cells were treated with 0.2% Triton X-100 to increase cell permeability. An incubation was conducted with 2% goat serum, a blocking solution, for 1 h. Thereafter, the pancreatic cells (specimen) was incubated with the primary antibody, methionyl-tRNA synthetase antibody (1:200) and anti-CK19 antibody(1:100) at 4° C. overnight. Thereafter, the cells were washed three times or more by performing at least 30 times of dipping in 1X TBST (assumed as one time), and then incubated with Alexa Fluor 488- and Texas Red-conjugated secondary antibodies (1:200 to 1:300, ThermoFisher Scientific, catalog no. A-11001/SANTA CRUZ BIOTECHNOLOGY, INC., catalog no. sc-278) at room temperature in a dark place for 1 h. The cells were washed three times or more by performing at least times of dipping in 1X TBST (assumed as one time). Thereafter, the DAPI-added mounting solution (ProLong Gold antifade regent with DAPI, Molecular probes, Cat. No. P36931) was dropped onto the tissue on slides, and then the cells were covered with cover slides, and the samples were observed by a fluorescent microscope.

    [0298] The standard for pancreatic cancer discrimination is as shown in Table 7 below. The cells were determined to be pancreatic cancer cells when high levels of MRS and CK19 were detected (increasingly expressed). That is, the cells were classified as Positive for MRS (+) and CK19 (+) and classified as Negative for the others.

    TABLE-US-00007 TABLE 7 MRS CK19 Readout + + cancer + − acinar cell − + ductal cell − − fibrotic cell or others

    [0299] When the level of MRS in a specimen sample was increased by 2-fold or more as compared with the negative cell sample (CT-26), together with expression of CK19, the cells were determined to be pancreatic cancer cells. The intensity of staining was based on those of positive cell sample (PANC-1) and the negative cell sample (CT-26).

    [0300] FIG. 15 shows staining patterns (staining intensity of each marker) of MRS and CK19 which were used for the staining of pancreatic cancer cells (PANC-1 cell line) that were cultured for positive control setup, in the discrimination of pancreatic cancer through cytodiagnosis by double staining of the present invention. It was verified that both MRS and CK19 were detected with high intensity in pancreatic cancer cells (that is, the expression of each marker was significantly increased).

    [0301] FIG. 16 shows staining patterns (staining intensity of each marker) of MRS and CK19 which were used for the staining of non-pancreatic cancer cells (CT26 cell line) that were cultured for negative control setup, in the discrimination of pancreatic cancer through cytodiagnosis by double staining of the present invention. MRS and CK19 were not substantially detected in the non-pancreatic cancer cells.

    [0302] FIG. 17 shows staining intensity of each marker when the pancreatic acinar cell sample collected from a patient was stained with MRS and CK19 in order to investigate staining patterns on the acinar cells in cytodiagnosis by double staining of the present invention. In the acinar cells, only the green signal was strongly shown since the detection intensity of only MRS was high.

    EXAMPLE 5

    Evaluation on Pancreatic Cancer Discrimination Ability of Present Inventive Double Staining in Cytodiagnosis

    [0303] The discrimination of pancreatic cancer was carried out by applying double staining of the present invention to 29 new pancreatic cancer cell specimens obtained from patients different from those used in the above-described examples. These pancreatic cancer cells were collected by EUS-FNA in the same manner as described above. The double staining of the present invention was carried out while pathological diagnosis results or final clinical diagnosis results were blinded.

    [0304] 5-1. Staining Pattern in Patient Classified as Atypical Cells by Conventional Pathologic Cytology and thus Undiagnosable but Finally Diagnosed with Pancreatic Cancer

    [0305] In the cell sample that has been classified as atypical cells by conventional pathologic cytology through pap staining and diagnosed with malignancy in the final clinical diagnosis, the double staining of the present invention was applied to discriminate whether it is pancreatic cancer or not.

    [0306] As shown in FIG. 18, as a result of double staining of the present invention, both MRS (green) and CK19 (red) showed high levels of detection intensity, and thus the cell sample could be determined to be malignant tumor cells (i.e., pancreatic cancer). The atypical cells identified by conventional pathologic cytology are undiagnosable, thereby requiring re-examination. The staining method of the present invention was confirmed to reduce the risk of re-examination and to be very useful in the discrimination (determination) of atypical cells into pancreatic cancer cells or benign cells.

    [0307] 5-2. Staining Pattern in Patient Undiagnosed Due to being Suspicious of Pancreatic cancer by Conventional Pathologic cytology but finally diagnosed with pancreatic cancer

    [0308] In the cell sample that has not been diagnosed with pancreatic cancer by conventional pathologic cytology through pap staining and thus temporarily diagnosed in a state of suspicious of pancreatic cancer (malignancy) but diagnosed with malignant tumor cells in the final clinical diagnosis, the double staining of the present invention was applied to discriminate between pancreatic cancer cells and benign cells.

    [0309] As shown in FIG. 19, as a result of double staining of the present invention, both MRS (green) and CK19 (red) showed high levels of detection intensity, and thus the cell sample could be determined to be malignant tumor cells (i.e., pancreatic cancer). Therefore, the staining method of the present invention was again confirmed to reduce the risk of re-examination and to be very useful in the discrimination (determination) of pancreatic cancer in cases of undiagnosed cells.

    [0310] 5-3. Staining Pattern in the Specimen from Patient Diagnosed with Pancreatic Cancer by Conventional Pathologic Cytology and Finally Diagnosed with Pancreatic Cancer

    [0311] In the cell sample that has been identified as atypical cells as a result of analysis by conventional pathological examinations through pap staining and diagnosed with malignant tumor cells in the final clinical diagnosis, the double staining of the present invention was applied to discriminate between pancreatic cancer cells and benign cells.

    [0312] As shown in FIG. 20, both MRS (green) and CK19 (red) showed high levels of detection intensity, and thus the cell sample could be determined to be malignant tumor cells (i.e., pancreatic cancer).

    [0313] 5-4. Overall Result

    [0314] A comparison was made among the determination results obtained by carrying out the double staining of the present invention, the final clinicopathological diagnosis results, and the pathologic cytology diagnosis results, for each cell specimen, and the comparison results are shown in Table 8. As a result of double staining of the present invention, the cell specimen was classified as Positive of pancreatic cancer for MRS (+) and CK19 (+) and Negative of pancreatic cancer for the other case (i.e., either MRS or CK19 being stained, or MRS (−) and CK19 (−))

    TABLE-US-00008 TABLE 8 Comparison of examination results through present inventive MRS and CK19 double staining compared with final clinicopathological diagnosis results Final clinicopath- ological diagnosis Malignancy Benign MRS + CK19 Positive 28 0 immunostaining Negative 0 1 Sensitivity: 100% Specificity: 100% Accuracy = 100% PPV: 100% NPV: 100% PPV: positive predictive value, NPV: negative predictive value

    [0315] As shown in Table 8 above, the determination of pancreatic cancer through MRS and CK19 double staining of the present invention showed a sensitivity of 100%, a specificity of 100%, a positive predictive value (PPV) of 100%, and a negative predictive value (NPV) of 100%, indicating an improvement in diagnostic accuracy.

    [0316] As shown in Example 5, the double staining of the present invention can clearly discriminate between malignant tumor cells and non-tumor cells from the cells that have been undiagnosable and undiagnosed by a conventional method, including atypical cells, thereby significantly improving the diagnostic efficiency in cytodiagnosis.

    EXAMPLE 6

    Evaluation on Pancreatic Cancer Discrimination Ability of Present Inventive Double Staining in Surgery Biopsy

    [0317] The double staining of the present invention was applied to clinical tissues containing both pancreatic cancer and surrounding normal pancreas area. The tissues obtained by surgery were paraffin-embedded by a common method, and then sliced. The double staining and determination results according to the present invention are shown in Table 9 below. As shown in Table 9 below, the tissue samples, unlike cytodiagnosis samples, were discriminated into acinar and pancreatic duct in the pancreatic tissues and thus can be separately determined according to the region.

    TABLE-US-00009 TABLE 9 Present inventive double staining Final clinicopath- Number of MRS(+) MRS(+) MRS(−) MRS(−) ological diagnosis specimens CK19(+) CK19(−) CK19(+) CK19(−) Normal acinar cell 10 0 10 0 0 pancreas Pancreatic 0 0 10 0 ductal cell Pancreatic cancer 10 10 0 0 0

    [0318] As shown in Table 9 above, the test results verified that the accuracy in discrimination between pancreatic cancer and normal pancreas through the double staining of the present invention reached 100% (sensitivity 100%, specificity 100%). It was especially verified that the double staining of the present invention can be used to provide information about normal acinar cells, thereby significantly increasing the diagnostic accuracy.

    [0319] FIGS. 21 and 22 show respective types of representative diagnostic cases for pancreatic tissue specimens. FIG. 21 shows staining patterns of the pancreatic tissue, which was determined to be a pancreatic cancer tissue by pathological findings through H&E staining, wherein MRS was highly expressed in the pancreatic cancer tissue by staining of MRS alone; CK19 was expressed in the pancreatic cancer tissue by staining of CK19 alone; and finally, both MRS and CK19 were detected at high levels in co-staining (the double staining of the present invention).

    [0320] FIG. 22 shows staining patterns of the normal tissue, which was determined to be a normal pancreatic tissue through H&E staining, wherein both acinar cells and pancreatic ductal cells were verified to be present together. Only the acinar cells were stained by staining of MRS alone, and CK19 was highly detected and observed in red (arrows) in only the pancreatic ductal cells by staining of CK19 alone. Finally, in the co-staining (the double staining of the present invention), MRS was highly detected in the acinar cells, and CK19 were highly detected and observed in red (arrows) in pancreatic ductal cells.

    INDUSTRIAL APPLICABILITY

    [0321] As set forth above, the present invention relates to a method for diagnosis of pancreatic cancer by using methionyl-tRNA synthetase (MRS). Methionyl-tRNA synthetase (MRS) as a pancreatic cancer marker shows a much higher diagnostic accuracy than a conventional pancreatic cancer marker, such as CEA, so that a clear determination of pancreatic cancer can be made by analyzing the expression or non-expression of methionyl-tRNA synthetase (MRS) in pancreatic cells, and an equivalent effect is achieved in even the cells identified as atypical cells by ordinary staining, and thus MRS can be very helpfully used in the diagnosis of pancreatic cancer and thus has high industrial applicability in the field of in-vitro diagnostic industry.