CXCR3 AS EPIGENETIC MARKER FOR THE IDENTIFICATION OF INFLAMMATORY IMMUNE CELLS, IN PARTICULAR CD8+ MEMORY T CELLS
20210230698 · 2021-07-29
Inventors
Cpc classification
C12Q1/6883
CHEMISTRY; METALLURGY
C12Q1/6883
CHEMISTRY; METALLURGY
International classification
Abstract
The present invention relates to a method, in particular an in vitro method, for specifically identifying the C-X-C motif chemokine receptor 3 (CXCR3) subpopulation of immune cells in a sample from a mammal comprising immune cells, in particular at least one of CD8+ effector and memory T cells, T helper (Th)1 cells and natural killer T (NKT) cells, comprising analyzing epigenetic modifications/properties of (including the methylation status) of at least one CpG position in the mammalian gene region for CXCR3 according to SEQ ID No. 1, wherein a demethylation or lack of methylation of said of at least one CpG position in said gene region is indicative for said CXCR3 specific subpopulation of immune cells in said sample, when compared to other immune cells, in particular for at least one of CD8+ effector and memory T cells, T helper (Th)1 cells and natural killer T (NKT) cells. The analyses according to the invention can identify the above cells on an epigenetic level and distinguish them from all other cells in complex samples, such as, for example, other blood or immune cells. The present invention furthermore provides an improved method for quantifying the above cells, in particular in complex samples. The method can be performed without a step of purifying and/or enriching cells, preferably in whole blood and/or non-trypsinized tissue.
Claims
1. A method for identifying a C-X-C motif chemokine receptor 3 (CXCR3) specific subpopulation of immune cells in a sample from a mammal comprising immune cells, the method comprising analyzing the methylation status of at least one cytosine-phosphate-guanine (CpG) position in a gene region for the mammalian CXCR3 according to SEQ ID NO: 1, wherein a demethylation or lack of methylation of said at least one CpG position in said gene region is indicative for said C-X-C motif CXCR3 specific subpopulation of immune cells in said sample, when compared to other immune cells.
2. The method according to claim 1, wherein said C-X-C motif CXCR3 specific subpopulation of immune cells comprises at least one of: CD8+ effector and memory T cells; and/or T helper (Th)1 cells and natural killer T (NKT) cells, and is compared to immune cells other than a CD8+ memory or effector T cells, T helper (Th)1 cells and/or natural killer T (NKT) cells.
3. The method according to claim 1, wherein said method comprises the steps of pre-sorting said sample based on CD4+Th1 cells, and subsequent specific identification of T helper (Th)1 cells based on said analyzing of the methylation status.
4. The method according to claim 1, wherein said at least one CpG position is selected from CpG positions 34, 71, 77, 102, 130, 150, 163, 170, 184, 224, 227, 235, 278, 299, 305, 337, 379, 390, 407, 419, and 429 in amplicon 3188 according to SEQ ID NO: 1.
5. The method according to claim 1, wherein said method comprises identifying CD8+ effector and memory T cells, if a demethylation of more than 95% is found for the at least one CpG position as analyzed.
6. The method according to claim 1, wherein said analysis of the bisulfite convertibility comprises a method selected from a methylation specific enzymatic digest, bisulfite sequencing, an analysis selected from promoter methylation, CpG island methylation, MSP, HeavyMethyl, MethyLight, Ms-SNuPE, and other methods relying on a detection of amplified DNA.
7. The method according to claim 1, further comprising a quantification of the relative amount of CD8+ memory or effector T cells, T helper (Th)1 cells and/or natural killer T (NKT) cells based on comparing relative amounts of methylation frequency in the region as analyzed with relative amounts of methylation frequency in a control gene.
8. The method according to claim 1, wherein said sample is selected from a mammalian body fluid, including a human blood sample, or a tissue, organ or cell type blood sample, a sample of blood lymphocytes or a fraction thereof.
9. The method according to claim 1, wherein said method is performed without a step of purifying and/or enriching said cells to be identified using whole blood and/or non-trypsinized tissue.
10. The method according to claim 1, further comprising the step of concluding on the immune status of said mammal based on said immune cells as identified.
11. A method for monitoring the level of the subpopulation of CXCR3 specific immune cells, in particular CD8+ effector and memory T cells, T helper (Th)1 cells and natural killer T (NKT) cells, preferably CD8+ effector and memory T cells, in a mammal, comprising performing the method according to claim 7, and furthermore comparing said relative amount of said cells as identified to a sample taken earlier or in parallel from the same mammal, and/or to a control sample.
12. The method according to claim 1, further comprising measuring and/or monitoring the amount of said subpopulation of CXCR3 specific immune cells, in particular said CD8+ effector and memory T cells, T helper (Th)1 cells and natural killer T (NKT) cells, preferably CD8+ effector and memory T cells, in response to chemical and/or biological substances that are provided to said mammal.
13. The method according to claim 1, wherein said mammal suffers from or is likely to suffer from autoimmune diseases, transplant rejections, infection diseases, cancer, and/or allergy.
14. A kit for identifying, quantifying, and/or monitoring the C-X-C motif chemokine receptor 3 (CXCR3) specific subpopulation of immune cells comprising CD8+ effector and memory T cells, T helper (Th)1 cells and natural killer T (NKT) cells, and/or CD4+Th1 cells, or CD8+ effector and memory T cells, in a mammal based on the analysis of the bisulfite accessibility of CpG positions in the gene region of CXCR3, the kit comprising components for performing a method according to claim 1 wherein the kit comprises a) a bisulfite reagent, and b) materials for the analysis of the methylation status of CpG positions selected from the CpG positions in the region according to SEQ ID NO: 1.
15. An oligomer according to any of SEQ ID NOs: 4 to 9, or the amplicon according to SEQ ID NOs: 1, 2, or 3.
16. Use of the kit according to claim 14 for identifying, quantifying, and/or monitoring the C-X-C motif chemokine receptor 3 (CXCR3) specific subpopulation of immune cells comprising CD8+ effector and memory T cells, T helper (Th)1 cells and natural killer T (NKT) cells, and/or CD4+Th1 cells, or CD8+ effector and memory T cells, in a mammal.
17. Use of the oligomer or the amplicon according to claim 15 for identifying, quantifying, and/or monitoring the C-X-C motif chemokine receptor 3 (CXCR3) specific subpopulation of immune cells comprising CD8+ effector and memory T cells, T helper (Th)1 cells and natural killer T (NKT) cells, and/or CD4+Th1 cells, or CD8+ effector and memory T cells, in a mammal.
18. The kit according to claim 14, wherein the materials for the analysis of the methylation status of CpG positions comprise an oligomer selected from the sequences according to SEQ ID NOs: 4 to 9.
19. The method according to claim 7, wherein the control gene comprises glyceraldehyde 3-phosphate dehydrogenase (GAPDH).
Description
[0044] The invention will now be further described in the following examples and with reference to the accompanying figures and the sequence listing, without being limited thereto. For the purposes of the present invention, all references as cited herein are incorporated by reference in their entireties.
[0045]
[0046]
[0047]
[0048] SEQ ID No. 1 shows the sequence of the amplicon No. 3188 according to the present invention (see
[0049] SEQ ID Nos. 2 and 3 show the sequences of the CpG converted and TpG converted sequences of amplicon 3188, respectively.
[0050] SEQ ID Nos. 4 to 9 show the sequences of specific oligomers (primers and probes) according to the present invention.
EXAMPLES
Example 1
[0051] In order to identify CD8+ memory and effector T cells, T helper (Th)1 cells and natural killer T cells (NKT), qPCR was performed on bisulphite converted samples stemming from the human genomic region according to the sequence SEQ ID No. 1, in particular the region of AMP 3188. For the actual epigenetic profiling of the amplicon region in blood cell subtypes, the immune cell populations as analyzed were as shown in
[0052] The bisulfite-converted target-regions of preferred qPCR-assay-system as developed were (see also
TABLE-US-00001 CpG Template Variant (methylated, i.e. non- converted CGs)(SEQ ID NO: 2): GGTGTAGTTTTTAGAGTTGGGAGGGTGGTTTTTCGGGAGATTTGGTGGTG TTGGGGTTGTTAGTGAGTTTCGGGAGCGAGGATATTGGGGAGAGTTAGAG TCGGTAGAGGGAGGGAGGAGTTTGGAATGCGGGGAAGTTAGATTGTGGGC GAAAGGGGAGTTCGGATTTCGGTTTTATAAGTTCGAGTAGGAGGTTTTTG AGGTTTTAGATTAGGATGAATTTCGGCGGGAAGACGATGGTTGTTTTTGG AGTTTTTTTTGGTTGGGGTAGTTTAGGCGTAAGAGTAGTATTTATATTCG TTTTCGGAATTTGATTTTTATAAAGGTATAGAGTAGCGGGTTGAGGTAGT AGTGTATGTAGTTTAGGTTTGAGGTGATCGATTTGGTTACGTTTATTTTG TTTTTTCGGTTATAGTTGCGGGTTAAAGCGTTTAGGTTTATGAGGATGTT TATTAGTATTATTAGGTGATAGGGGGTTTAG TpG Template Variant (un-methylated, i.e. con- verted CGs)(SEQ ID NO: 3): GGTGTAGTTTTTAGAGTTGGGAGGGTGGTTTTTTGGGAGATTTGGTGGTG TTGGGGTTGTTAGTGAGTTTTGGGAGTGAGGATATTGGGGAGAGTTAGAG TTGGTAGAGGGAGGGAGGAGTTTGGAATGTGGGGAAGTTAGATTGTGGGT GAAAGGGGAGTTTGGATTTTGGTTTTATAAGTTTGAGTAGGAGGTTTTTG AGGTTTTAGATTAGGATGAATTTTGGTGGGAAGATGATGGTTGTTTTTGG AGTTTTTTTTGGTTGGGGTAGTTTAGGTGTAAGAGTAGTATTTATATTTG TTTTTGGAATTTGATTTTTATAAAGGTATAGAGTAGTGGGTTGAGGTAGT AGTGTATGTAGTTTAGGTTTGAGGTGATTGATTTGGTTATGTTTATTTTG TTTTTTTGGTTATAGTTGTGGGTTAAAGTGTTTAGGTTTATGAGGATGTT TATTAGTATTATTAGGTGATAGGGGGTTTAG
[0053] Preferred assay conditions were as follows:
[0054] TpG System:
[0055] Primer: 1.5 μM final Concentration
[0056] Probe: 0.125 μM final Concentration
[0057] Working Solution Probe (20×): 2.5 μM
[0058] Working Solution Primer Mix (20×): 30 μM
[0059] Working Solution λ-DNA (10×): 50 ng/μ1
[0060] Additive (e.g. Mg.sup.2+): -μM Final Concentration
[0061] Roche Master-Mix: 1×
[0062] Reaction Volume: 10 μl
[0063] Thermo Profile:
[0064] Pre-Incubation: 95° C. for 35 min.
[0065] Annealing/Elongation: 61° C. for 15 sec.
[0066] Denaturation: 95° C. for 1 min.
[0067] No of Cycles: 50
[0068] CpG System:
[0069] Primer: 1.5 μM Final Concentration
[0070] Probe: 0.125 μM Final Concentration
[0071] Working Solution Probe (20×): 2.5 μM
[0072] Working Solution Primer Mix (20×): 30 μM
[0073] Working Solution λ-DNA (10×): 50 ng/μ1
[0074] Additive (e.g. Mg.sup.2+): -μM Final Concentration
[0075] Roche Master-Mix: 1×
[0076] Reaction Volume: 10 μl
[0077] Thermo Profile:
[0078] Pre-Incubation: 95° C. for 35 min.
[0079] Annealing/Elongation: 61° C. for 15 sec.
[0080] Denaturation: 95° C. for 1 min.
[0081] No of Cycles: 50
[0082] The preferred primer and probe sequences were:
TABLE-US-00002 TpG- Sequence 5′ .fwdarw. 3′ + optional System modifications Primer_FW GGGTGAAAGGGGAGTTTG (SEQ ID NO: 4) Primer_Rv CAAAAACAAATATAAATACTACTCTTACAC (SEQ ID NO: 5) Probe FAM -TGAATTTTGGTGGGAAGATGATGGTTG - BHQ1 (SEQ ID NO: 6) CpG- Sequence 5′ .fwdarw. 3′ + optional System modifications Primer_FW GCGAAAGGGGAGTTCG (SEQ ID NO: 7) Primer Rv CGAAAACGAATATAAATACTACTCTTACGC (SEQ ID NO: 8) Probe FAM - ATTTCGGCGGGAAGACGATGGTTG - BHQ1 (SEQ ID NO: 9) FAM - fluorescein BHQ1 - non-fluorescent Black Hole Quencher ®-1 (Sigma Aldrich)
[0083] Results:
[0084] Following the successful application of the assay as above, the following demethylation levels were found in amplicon 3188 for the cell types of interest:
TABLE-US-00003 % demethylation CXCR3 (amplicon 3188) Total CD8+ T cells 43.2 Naïve CD8+ T cells 2.4 Effector CD8+ T cells 100.7 Effector memory CD8+ T cells 110.5 Central memory CD8+ T cells 91.2 Total CD4+ T cells 23.8 Naïve CD4+ T cells 0.9 Effector CD4+ T cells (TH1) 79.9 Effector CD4+ T cells (TH2) 7.2 Memory CD4+ T cells 29.7 NK Cells 1.5 NKT cells 82.1 Granulocytes 1.5 Monocytes 0.2 B-cells 1.7 p-dendritic cells 3.6 m-dendritic cells 4.4