Alcohol dehydrogenase mutant and application thereof in synthesis of diaryl chiral alcohols

11078465 · 2021-08-03

Assignee

Inventors

Cpc classification

International classification

Abstract

The present disclosure discloses an alcohol dehydrogenase mutant and application thereof in synthesis of diaryl chiral alcohols, and belongs to the technical field of bioengineering. The alcohol dehydrogenase mutant of the present disclosure has excellent catalytic activity and stereoselectivity, and may efficiently catalyze the preparation of a series of chiral diaryl alcohols in R- and S-configurations. By coupling alcohol dehydrogenase of the present disclosure to glucose dehydrogenase or formate dehydrogenase, the synthesis of chiral diaryl alcohol intermediates of various antihistamines may be achieved. Compared with the prior art, a method for preparing diaryl chiral alcohols through asymmetric catalytic reduction using the alcohol dehydrogenase of the present disclosure has the advantages of simple and convenient operation, high substrate concentration, complete reaction and high product purity, and has great industrial application prospects.

Claims

1. An alcohol dehydrogenase mutant, wherein the alcohol dehydrogenase mutant comprises an amino acid sequence having all of SEQ ID NO:2 except for: a substitution of valine for glutamate at position 214 of the amino acid sequence SEQ ID NO: 2; a substitution of tyrosine for glutamate at position 214 of the amino acid sequence SEQ ID NO: 2; a substitution of isoleucine for glutamate at position 214 of the amino acid sequence SEQ ID NO: 2; a substitution of glutamine for glutamate at position 214 of the amino acid sequence SEQ ID NO: 2; a substitution of serine for glutamate at position 214 of the amino acid sequence SEQ ID NO: 2; a substitution of asparagine for glutamate at position 214 of the amino acid sequence SEQ ID NO: 2; a substitution of arginine for glutamate at position 214 of the amino acid sequence SEQ ID NO: 2; a substitution of valine for glutamate at position 214 of the amino acid sequence SEQ ID NO: 2, and the substitution of alanine for serine at position 237; a substitution of tyrosine for glutamate at position 214 of the amino acid sequence SEQ ID NO: 2, and the substitution of alanine for serine at position 237; a substitution of isoleucine for glutamate at position 214 of the amino acid sequence SEQ ID NO: 2, and the substitution of alanine for serine at position 237; a substitution of glycine for glutamate at position 214 of the amino acid sequence SEQ ID NO: 2, and the substitution of cysteine for serine at position 237; a substitution of glutamine for glutamate at position 214 of the amino acid sequence SEQ ID NO: 2, and the substitution of cysteine for serine at position 237; a substitution of serine for glutamate at position 214 of the amino acid sequence SEQ ID NO: 2, and the substitution of cysteine for serine at position 237; a substitution of asparagine for glutamate at position 214 of the amino acid sequence SEQ ID NO: 2, and the substitution of cysteine for serine at position 237; and a substitution of arginine for glutamate at position 214 of the amino acid sequence SEQ ID NO: 2, and the substitution of cysteine for serine at position 237, and wherein the alcohol dehydrogenase mutant has alcohol dehydrogenase activity.

2. A method for producing chiral (4-chlorophenyl)-(pyridin-2-yl)-methanol (CPMA), which comprises: combining the alcohol dehydrogenase mutant of claim 1 at a concentration of 1 to 10 kU/L with prochiral (4-chlorophenyl)-(pyridin-2-yl)-methanone (CPMK) at a concentration of 10 to 500 mM, and NADP+at a concentration of 0.1 to 1.0 mM; adding a coenzyme circulation system comprising glucose dehydrogenase at a concentration of 1 to 10 kU/L, D-glucose at a concentration of 20 to 1000 mM, and a phosphate buffer; incubating the coenzyme circulation system with the alcohol dehydrogenase mutant, CPMK, and NADP+at 30 to 35° C. and a pH of 6 to 8 for 1 to 24 hours to produce CPMA; and extracting the CPMA by adding an organic solvent after an asymmetric reduction reaction; wherein the coenzyme circulation system further comprises: (i) phosphite and phosphite dehydrogenase (FTDH), (ii) formic acid and formate dehydrogenase (FDH), (iii) lactic acid and lactate dehydrogenase (LDH), or (iv) glycerol and glycerol dehydrogenase.

Description

BRIEF DESCRIPTION OF FIGURES

(1) FIG. 1 is whole-plasmid PCR nucleic acid electrophoretograms of alcohol dehydrogenase mutants M1 to M8.

(2) FIG. 2 is whole-plasmid PCR nucleic acid electrophoretograms of alcohol dehydrogenase mutants M9 to M16.

(3) FIG. 3 is SDS-PAGE analysis of alcohol dehydrogenase mutants M1 to M8, respectively.

(4) FIG. 4 is SDS-PAGE analysis of alcohol dehydrogenase mutants M9 to M16, respectively.

(5) FIG. 5 is a chiral liquid chromatogram of product produced from CPMK reduction catalyzed by an alcohol dehydrogenase mutant M10.

(6) FIG. 6 is a chiral liquid chromatogram of product produced from p-nitrobenzophenone reduction catalyzed by an alcohol dehydrogenase mutant M10.

(7) FIG. 7 is a chiral liquid chromatogram of product produced from acetophenone reduction catalyzed by an alcohol dehydrogenase mutant M12.

(8) FIG. 8 is a chiral liquid chromatogram of product produced from 4′-Chloroacetophenon reduction catalyzed by an alcohol dehydrogenase mutant M11.

(9) FIG. 9 is a chiral liquid chromatogram of product produced from 4-Chlorophenacyl Chloride reduction catalyzed by an alcohol dehydrogenase mutant M14.

DETAILED DESCRIPTION

(10) The present disclosure will be described in detail below by means of specific embodiments, but this does not limit the present disclosure to the scope of the described embodiments. The experimental methods without indicated specific experimental conditions in the following embodiments may be selected according to conventional methods and conditions, or according to the specification.

Example 1: Method for Measuring Activity of Alcohol Dehydrogenase and Optical Purity of Product

(11) Adopting a total reaction system of 200 μL, including: 1.0 mM NADPH, 1.0 mM substrate CPMK and sodium phosphate buffer (PBS, 100 mM, pH 7.0), fully and evenly mixing, maintaining at 30° C. for 2 min, adding an appropriate amount of enzyme solution, and detecting the change in light absorption at 340 nm.

(12) The enzyme activity was calculated by the following formula:
Enzyme activity (U)=EW×V×10.sup.3/(6220×I);

(13) in the formula, EW is the change in absorbance at 340 nm in 1 min; V is the volume of a reaction solution in mL; 6220 is the molar extinction coefficient of NADPH in L/mol.Math.cm); and 1 is the optical path distance in cm. One activity unit (U) corresponds to the amount of enzyme required to catalyze the oxidation of 1 μmol NADPH per minute under the above conditions.

(14) Method for determining optical purity ee:

(15) ee = AS - AR AS + AR × 100 % ;

(16) As: molar concentration of (S)-CPMA obtained by liquid chromatography; and A.sub.R: molar concentration of (R)-CPMA obtained by liquid chromatography.

Example 2: Construction of Alcohol Dehydrogenase Mutant Gene and Recombinant Expression Transformant

(17) A whole plasmid PCR method was used for site-directed mutagenesis on amino acid residues at positions 214 and 237 to construct an iterative combination mutant. The primer design was as Table 1 (all described in the 5′-3′ direction, and the underline represents the mutation site):

(18) TABLE-US-00001 TABLE 1 Site-directed mutagenesis primer design table Primer Sequence E214A-F AGAAACTAAATGCAACTTGTG (SEQ ID No. 3) E214A-R TCACAAGTTGCATTTAGTTTC (SEQ ID No. 4) E214T-F AGAAACTAAATACCACTTGTG (SEQ ID No. 5) E214T-R TCACAAGTGGAATTTAGTTTC (SEQ ID No. 6) E214R-F AGAAACTAAATGCAACTTGTG (SEQ ID No. 7) E214R-R TCACAAGTTGCATTTAGTTTC (SEQ ID No. 8) E214N-F AGAAACTAAATAATACTTGTG (SEQ ID No. 9) E214N-R TCACAAGTATTATTTAGTTTC (SEQ ID No. 10) E214D-F AGAAACTAAATGATACTTGTG (SEQ ID No. 11) E214D-R TCACAAGTATCATTTAGTTTC (SEQ ID No. 12) E214C-F AGAAACTAAATTGTACTTGTG (SEQ ID No. 13) E214C-R TCACAAGTACAATTTAGTTTC (SEQ ID No. 14) E214E-F AGAAACTAAATGAAACTTGTG (SEQ ID No. 15) E214E-R TCACAAGTTTCATTTAGTTTC (SEQ ID No. 16) E214Q-F AGAAACTAAATCAGACTTGTG (SEQ ID No. 17) E214Q-R TCACAAGTCTGATTTAGTTTC (SEQ ID No. 18) E214G-F AGAAACTAAATGGTACTTGTG (SEQ ID No. 19) E214G-R TCACAAGTCCAATTTAGTTTC (SEQ ID No. 20) E214H-F AGAAACTAAATCATACTTGTG (SEQ ID No. 21) E214H-R TCACAAGTATGATTTAGTTTC (SEQ ID No. 22) E214I-F AGAAACTAAATATTACTTGTG (SEQ ID No. 23) E214I-R TCACAAGTAATATTTAGTTTC (SEQ ID No. 24) E214L-F AGAAACTAAATCTGACTTGTG (SEQ ID No. 25) E214L-R TCACAAGTCAGATTTAGTTTC (SEQ ID No. 26) E214K-F AGAAACTAAATAAAACTTGTG (SEQ ID No. 27) E214K-R TCACAAGTTTTATTTAGTTTC (SEQ ID No. 28) E214M-F AGAAACTAAATATGACTTGTG (SEQ ID No. 29) E214M-R TCACAAGTCATATTTAGTTTC (SEQ ID No. 30) E214F-F AGAAACTAAATTTTACTTGTG (SEQ ID No. 31) E214F-R TCACAAGTAAAATTTAGTTTC (SEQ ID No. 32) E214P-F AGAAACTAAATCCGACTTGTG (SEQ ID No. 33) E214P-R TCACAAGTCGGATTTAGTTTC (SEQ ID No. 34) E214W-F AGAAACTAAATTGGACTTGTG (SEQ ID No. 35) E214W-R TCACAAGTCCTATTTAGTTTC (SEQ ID No. 36) E214Y-F AGAAACTAAATTATACTTGTG (SEQ ID No. 37) E214Y-R TCACAAGTATAATTTAGTTTC (SEQ ID No. 38) E214V-F AGAAACTAAATGTTACTTGTG (SEQ ID No. 39) E214V-R TCACAAGTAACATTTAGTTTC (SEQ ID No. 40) S237A-F ACTCACTTCGCACAATTCATT (SEQ ID No. 41) S237A-R AATGAATTGTGCGAAGTGAGT (SEQ ID No. 42) S237C-F ACTCACTTCTGTCAATTCATT (SEQ ID No. 43) S237C-R AATGAATTGACAGAAGTGAGT (SEQ ID No. 44)

(19) A PCR reaction system was: a PCR reaction system (50 μL) including KOD enzyme (2.5 U/mL) 1.0 μL, template (5-50 ng) 1.0 μL, dNTP 4.0 μL, 10× reaction buffer 5.0 μL, forward primer 1.0 μL, reverse primer 1.0 μL, and the rest of ddH2O to make the reaction system 50 μL in total.

(20) A PCR amplification procedure was: (1) denaturation at 94° C. for 3 min, (2) denaturation at 94° C. for 30 sec, (3) annealing at 54° C. for 30 sec, (4) extension at 72° C. for 150 sec, repeating steps (2) to (4) for 10-15 cycles, finally extension at 72° C. for 10 min, and storing a PCR amplification product at 4° C.

(21) After PCR, Dpnl restriction enzyme was added into a reaction mixture and incubated at 37° C. for 1 h, 10 μL digested PCR reaction solution was transferred into 50 μL E. coli BL21 (DE3) competent cells through CaCl.sub.2 thermal transformation, and the cells were used to uniformly coat an LB agar plate containing 50 μg/mL kanamycin sulfate for inversion culture at 37° C. for 12 h.

Example 3: Expression and Purification of Alcohol Dehydrogenase and Mutant Thereof

(22) Recombinant Escherichia coli carrying a stereoselective improvement mutant was inoculated into an LB medium containing kanamycin sulfate (50 μg/mL) at a transfer amount of 2% for shake cultivation at 37° C. and 200 rpm, 0.2 mM isopropyl-β-D-thiogalactofuranoside (IPTG) was added for induction at 25° C. when the absorbance OD.sub.600 of the medium reached 0.8, after 8 hours of induction, a strain for efficient expression of a recombinant alcohol dehydrogenase mutant was obtained through 10 minutes of centrifugation at 8000 rpm, and the collected cells was suspended in a potassium phosphate buffer (100 mM, pH 6.0) for ultrasonication.

(23) A column used for purification was a nickel affinity column HisTrap FF crude, and purification was achieved through affinity chromatography using a histidine tag on recombinant protein. The nickel column was equilibrated with a solution A first, a crude enzyme solution was loaded, a penetrating peak was further eluted off using the solution A, and after equilibrium, a solution B (20 mM sodium phosphate, 500 mM NaCl, and 1000 mM imidazole, pH 7.4) was used for gradient elution to elute off the recombinant protein bound to the nickel column, so as to obtain the recombinant alcohol dehydrogenase mutant. The purified protein was subjected to activity measurement (CPMK as substrate, and NADPH as coenzyme) and SDS-PAGE analysis. After purification of the nickel column, a single band was displayed at around 45 kDa, and the amount of impure protein was small, indicating that the column purification effect was good. The purified alcohol dehydrogenase protein was then replaced into a Tris-HCl (100 mM, pH 7.0) buffer using a Hi Trap Desalting column (GE Healthcare).

Example 4: Kinetic and Stereoselective Analysis of Alcohol Dehydrogenase Mutant

(24) The activity of KpADH at different substrate concentrations and coenzyme concentrations was determined, and a double reciprocal curve was made based on the reciprocal of activity and substrate concentration to calculate kinetic parameters.

(25) Two mutants of S237A and S237C valuable for modification of asymmetric synthesis R- and S- are obtained by random mutation screening, and the two sites are used as templates for random mutation. The characterization results of the mutant strains are shown in Table 2: the mutant E214V/S237A asymmetrically reduces a substrate to obtain (R)-CPMA, and the e.e. value reaches 98.5%; the mutant E214G/S237C asymmetrically reduces a substrate to obtain (S)-CPMA, which achieves stereoselective inversion, and the e.e. value is 75.5%. The stereoselectivity of other mutants does not improve much compared with WT. It can be known by combining the data in Tables 2 and 3 that the 214 site of alcohol dehydrogenase is a site that is important for determining selectivity improvement and inversion.

(26) TABLE-US-00002 TABLE 2 Kinetic parameters and stereoselectivity of alcohol dehydrogenase random mutants K.sub.m V.sub.max K.sub.cat K.sub.cat/K.sub.m Enzyme [mM] [uM/min .Math. mg] [s.sup.−1] [mM.sup.−1 .Math. s.sup.−1] e.e. WT 0.76 ± 0.19 21.29 ± 2.14  14.19 ± 1.16  18.68 ± 0.62 81.7 (R) S237C 1.01 ± 0.10 20.91 ± 1.82  13.94 ± 0.99   13.8 ± 0.25   27 (R) S237A 0.58 ± 0.03 36.52 ± 3.02  24.35 ± 1.26  41.98 ± 2.36 96.1 (R) F320W/S237A 1.66 ± 0.02 16.6 ± 0.37 11.07 ± 0.25   6.66 ± 0.42 76.3 (R) F320V/S237A 1.15 ± 0.05  8.9 ± 0.78  5.9 ± 0.09  5.15 ± 0.69 84.4 (R) E214G/S237C 0.31 ± 0.02 9.54 ± 0.16 6.30 ± 0.11 22.10 ± 1.37 75.5 (S) H249Y/S237C 0.98 ± 0.02 16.5 ± 0.56 11.0 ± 0.83 11.22 ± 0.98 69.5 (R) L60F/S237C 1.12 ± 0.02 12.6 ± 0.49 8.40 ± 0.23  7.50 ± 0.69 79.6 (R) A269C/S237C 1.56 ± 0.02 22.6 ± 0.59 15.4 ± 0.86  9.90 ± 0.36 66.9 (R) N220G/S237C 0.72 ± 0.02 20.6 ± 0.44 13.73 ± 0.16  19.07 ± 1.06 33.9 (R) E214V/S237A 0.32 ± 0.03 12.69 ± 0.40  8.46 ± 0.27 26.54 ± 1.66 98.5 (R)

(27) The E214 site adopts a site-directed mutagenesis strategy to replace glutamic acid with other 19 amino acids. The characterization results of the constructed new mutants are shown in Table 3 below, the K.sub.m of KpADH is 0.76 mM.sup.−1, the configuration of a reduction product is R configuration, the ee value is 81.7%, and the K.sub.m of only E214G, E214V and E214l in the mutants is significantly reduced, to 0.25 mM, 0.42 mM and 0.41 mM, respectively. The stereoselectivity of the mutants E214Y, E214V, E214l and E214F in asymmetric synthesis of (R)-CPMA is significantly improved, to 93.8%, 95.3%, 93.0% and 91.9%, respectively; the mutants E214G, E214Q, E214S, E214N and E214R show significantly reduced stereoselectivity, among which the asymmetric reduction of E214G produces (S)-CPMA, the e.e. value is 25.6 (S), and the other four mutant strains still synthesize (R)-CPMA, which are 58.5%, 14.2%, 58.1% and 42.5%, respectively.

(28) TABLE-US-00003 TABLE 3 Kinetic parameters and stereoselectivity of a single- site mutant of alcohol dehydrogenase mutant E214 K.sub.m V.sub.max K.sub.cat K.sub.cat/K.sub.m Enzyme [mM] uM/min .Math. mg [s.sup.−1] [mM.sup.−1 .Math. s.sup.−1] ee % WT 0.76 ± 0.19 21.29 ± 2.14 14.19 ± 1.16 18.68 ± 0.62 81.7 (R) E214Y 0.69 ± 0.07 17.69 ± 0.81 11.79 ± 0.44 17.09 ± 0.94 93.8 (R) E214W 1.19 ± 0.19 14.34 ± 1.65  9.56 ± 0.90  8.03 ± 1.21 82.5 (R) E214V 0.42 ± 0.08 13.36 ± 0.89  8.91 ± 0.48 21.21 ± 0.72 95.3 (R) E214T 0.75 ± 0.13 30.62 ± 2.05 20.41 ± 1.11 27.22 ± 0.41 72.8 (R) E214S 0.54 ± 0.07 17.79 ± 0.88 11.86 ± 0.48 21.96 ± 0.68 14.2 (R) E214R 0.98 ± 0.08 23.77 ± 0.90 15.85 ± 0.49 16.17 ± 2.17 42.5 (R) E214P 0.88 ± 0.15 19.02 ± 1.34 12.68 ± 0.72 14.41 ± 1.12 68.2 (R) E214N 0.42 ± 0.06 34.35 ± 2.05 22.90 ± 1.12 54.52 ± 2.17 58.1 (R) E214M 0.73 ± 0.08 38.80 ± 1.84 25.87 ± 1.00 35.43 ± 1.12 83.8 (R) E214L 0.52 ± 0.07 16.74 ± 0.88 11.16 ± 0.48 21.46 ± 0.75 78.1 (R) E214K 0.79 ± 0.19 23.22 ± 2.21 15.48 ± 1.20 19.59 ± 1.24 62.6 (R) E214I 0.41 ± 0.04 13.15 ± 0.43  8.77 ± 0.23 21.38 ± 0.47 93.0 (R) E214F 0.51 ± 0.06 23.38 ± 0.93 15.59 ± 0.51 30.56 ± 0.81 91.9 (R) E214D 0.55 ± 0.06 15.89 ± 0.75 10.59 ± 0.41 19.26 ± 0.61 63.8 (R) E214C 0.77 ± 0.11 18.37 ± 1.17 12.25 ± 0.64 15.90 ± 0.68 78.9 (R) E214A 0.81 ± 0.13 13.37 ± 0.88  8.91 ± 0.48 11.00 ± 0.48 76.3 (R) E214Q  1.3 ± 0.20  24.4 ± 0.20 16.26 ± 1.33 12.61 ± 0.93 58.5 (R) E214G 0.25 ± 0.15  8.26 ± 0.15  5.5 ± 0.10 22.10 ± 1.34 25.6 (S) E214H 0.75 ± 0.52  12.6 ± 1.56  8.4 ± 2.22  11.2 ± 1.58 77.5 (R)

(29) In order to improve the R- and S-stereoselectivity of the enzyme, E214V, E214Y and E214I are used as templates to replace serine at site 237 with glycine, and E214G, E214Q, E214S, E214N and E214R are used as templates to replace serine at site 237 with cysteine. The characterization results of the constructed new mutants are shown in Table 4 below: Kcat/Km of mutant enzymes E214V/S237A, E214Y/S237A and E2141/S237A is slightly higher than WT, but the stereoselectivity in asymmetric synthesis of (R)-CPMA is significantly improved, to 98.5%, 99.1% and 98.3%, respectively; the products synthesized by E214G/S237C, E214Q/S237C, E214S/S237C, E214N/S237C and E214R/S237C are all (S)-CPMA, among which E214G/S237C has the highest selectivity, reaching 75.5% (S), and the catalytic efficiency Kcat/Km is slightly improved compared with WT. The above combined mutants have high guiding value for studying modification of asymmetric synthesis of R- and S- by the enzyme.

(30) TABLE-US-00004 TABLE 4 Kinetic parameters and stereoselectivity of alcohol dehydrogenase combined mutants K.sub.m V.sub.max K.sub.cat K.sub.cat/K.sub.m Enzyme [mM] [uM/min .Math. mg] [s.sup.−1] [mM.sup.−1 .Math. s.sup.−1] e.e. WT 0.76 ± 0.19 21.29 ± 2.14 14.19 ± 1.16  18.68 ± 0.62 81.7 (R) E214V/S237A 0.32 ± 0.03 12.69 ± 0.40 8.46 ± 0.27 26.54 ± 1.66 98.5 (R) E214Y/S237A 0.62 ± 0.02 23.70 ± 0.37 15.80 ± 0.25  25.49 ± 0.42 99.1 (R) E214I/S237A 0.47 ± 0.05 18.09 ± 0.78 12.06 ± 0.52  25.78 ± 1.65 98.3 (R) E214G/S237C 0.31 ± 0.02  9.54 ± 0.16 6.30 ± 0.11 22.10 ± 1.37 75.5 (S) E214Q/S237C 0.55 ± 0.02 10.59 ± 0.16 7.06 ± 0.63 12.84 ± 1.44 44.6 (S) E214S/S237C 0.40 ± 0.02  12.5 ± 0.16 8.33 ± 0.17  20.8 ± 1.97 52.0 (S) E214N/S237C 0.22 ± 0.02  8.80 ± 0.20 5.87 ± 0.13 26.78 ± 1.84 43.6 (S) E214R/S237C 0.88 ± 0.02  15.6 ± 0.16 10.4 ± 0.11  11.8 ± 1.37 48.3 (S)

Example 5: Substrate Specificity Analysis of Alcohol Dehydrogenase Mutant

(31) The reduction on prochiral carbonyl compounds by the alcohol dehydrogenase mutants obtained in Example 3 was studied. The pro-chiral carbonyl compounds include (4-chlorophenyl)-(pyridin-2-yl)-methanone (CPMK), phenyl-(pyridin-2-yl)-methanone, (4-chlorophenyl)-(phenyl)-methanone, (4-bromophenyl)(phenyl)methanone, (4-fluorophenyl)(phenyl)methanone, (4-methoxyphenyl)-(phenyl)-methanone, (4-nitrophenyl)(phenyl)methanone, 1-(pyridin-2-yl)ethanone, acetophenone, 4′-Chloroacetophenone, 4-chlorophenacyl chloride, ethyl 2-oxo-4-phenylbutanoate (OPBE), ethyl 4-chloro-3-oxobutanoate, and methyl 2-oxo-2-phenylacetate.

(32) As can be seen from Table 5, the alcohol dehydrogenase exhibited high activity toward ester substrates, such as ethyl 2-oxo-4-phenylbutanoate, ethyl 4-chloro-3-oxobutanoate and methyl 2-oxo-2-phenylacetate. WT exhibited the highest activity of 41.84 U/mg toward ethyl 4-chloro-3-oxobutanoate, which suggested that the substituted chlorine atom is critical for the activity increasing of enzyme. E2141/S237A exhibited the highest activity of 30.09 U/mg toward 4-chlorophenacyl chloride while the lowest activity toward acetophenone and 1-(pyridin-2-yl)ethanone.

(33) TABLE-US-00005 TABLE 5 Substrate specificity (specific activity, U/mg) of alcohol dehydrogenase mutants E214V/ E214I/ E214Y/ E214G/ E214Q/ E214S/ E214R/ E214N/ WT S237A S237A S237A S237C S237C S237C S237C S237C embedded image 0.99 0.16 0.09 0.26 0.15 0.22 0.19 0.26 0.84 embedded image 1.34 0.12 0.08 0.25 0.07 0.12 0.09 0.18 0.52 embedded image 4.15 2.37 1.42 2.25 0.12 0.09 0.25 0.36 0.32 embedded image 4.07 2.86 2.94 4.06 3.10 5.65 5.69 4.21 7.50 embedded image 12.09 9.21 12.38 14.48 4.84 3.65 2.55 1.96 7.48 embedded image 20.67 27.07 30.09 25.70 9.81 10.25 5.96 6.69 10.02 embedded image 27.02 24.47 21.73 22.02 10.26 9.89 15.58 22.48 17.10 embedded image 39.77 27.64 30.28 22.61 21.25 22.65 30.69 30.69 13.21 embedded image 41.84 8.03 5.58 7.74 1.55 2.65 1.59 1.88 5.80

(34) It can be seen from Table 6 that mutants E214G/S237C, E214Q/S237C, E214S/S237C, E214N/S237C and E214R/S237C all exhibited high stereoselecticity toward the acetophenone to obtain R configuration products and the mutant E214G/S237C displayed the highest ee value of 99.5%. Substrate 4-chloroacetophenone was reduced by E214I/S237A with 99.4% ee (R), while substrate 4-chlorobenzoyl chloride was reduced by E214S/S237C with the highest ee value of 99.6%. (4-bromophenyl)-(phenyl)-methanone and p-nitrobenzophenone were reduced by E214N/S237A with 98.5% ee (S) and 99.2% ee (S), respectively. Substrate p-nitrobenzophenone was reduced by E214N/S237C with 99.1% ee (S). All the products above were recrystallized from ethyl acetate and gave more than 99.9% optical purity.

(35) TABLE-US-00006 TABLE 6 Stereoselectivity of alcohol dehydrogenase mutants on different substrates E214/ E214I/ E214Y/ E214G/ E214Q/ E214S/ E214R/ E214N/ WT S237A S237A S237A S237C S237C S237C S237C S237C 0embedded image 88.6 (R) 17.1 (R)  9.69 (R) 32.1 (R) 99.5 (R) 96.5 (R) 98.9 (R) 98.3 (R) 99.0 (R) embedded image 92.9 (R) 97.8 (R) 99.4 (R) 97.9 (R) 93.8 (R) 93.5 (R) 95.6 (R) 97.2 (R) 97.4 (R) embedded image 95.2 (R) 75.2 (R) 76.4 (R) 61.6 (R) 96.2 (R) 97.6 (R) 99.6 (R) 92.9 (R) 93.6 (R) embedded image 27.5 (R) 36.6 (R) 36.8 (R) 18.2 (R) 51.9 (R) 56.6 (R) 52.6 (R) 50.1 (R) 51.5 (R) embedded image 83.7 (R) 98.7 (R) 98.4 (R) 99.1 (R) 43.2 (S) 44.6 (S) 52.0 (S) 48.3 (S) 57.1 (S) embedded image 52.4 (S) 54.2 (S) 52.6 (S) 89.3 (S) 86.2 (R) 88.6 (R) 88.1 (R) 49.8 (R) 57.1 (R) embedded image 70.5 (S) 88.1 (S) 93.4 (S) 98.5 (S) 91.4 (R) 92.6 (R) 90.6 (R) 89.9 (R) 91.9 (R) embedded image 37.6 (R) 85.3 (S) 86.5 (S) 99.2 (S) 93.3 (R) 93.3 (R) 91.9 (R) 88.0 (R) 90.7 (R) embedded image 27.3 (R) 81.8 (S) 81.8 (S) 79.3 (S) 93.8 (S) 90.6 (R) 92.3 (R) 91.9 (R) 99.1 (S)

Example 6:Preparation of (R)-CPMA Through Asymmetric Reduction of CPMK by Alcohol Dehydrogenase Mutants

(36) A 20 mL biocatalytic system is established: 100 mM of potassium phosphate buffer (pH 7.0) is used, the mutant E214Y/S237A obtained in Example 2 and wild KpADH 10 g/L are added, and 100 mM, 200 mM and 500 mM of CPMK are added (substrates are added in batches). The other 8 reactions are established in the same manner as follows: mutant E214G/S237C was applied as biocatalyst while acetophenone was used as the substrate; mutant E214l/S237A was applied as biocatalyst while (4-chlorophenyl)-(phenyl)-methanone was used as the substrate; mutant E214G/S237C was applied as biocatalyst while 4-chlorobenzoyl chloride was used as the substrate; mutant E214Y/S237A was applied as biocatalyst while (4-bromophenyl)-(phenyl)-methanone was used as the substrate; mutant E214N/S237C was applied as biocatalyst while (4-methoxyphenyl)-(phenyl)-methanone was used as the substrate; All the reactions are carried out at 30° C. and 200 rpm for 12 h with a constant pH of 7.5. The conversion results are shown in Tables 7 to 11. WT KpADH displayed 82% ee in the asymmetric synthesis of (R)-CPMA while E214Y/S237A exhibited increased ee of 99.1%. The pure (R)-CPMA were recrystallized from ethyl acetate at 4° C. and gave 99.9% optical purity. In the asymmetric reduction catalyzed by E2141/S237A, E214G/S237C and E214S/S237C, the optical purity of corresponding products were all reached 99.9% after recrystallization. By contrast, only 20 mM p-nitrobenzophenone could be afforded in the asymmetric reduction catalyzed by E214Y/S237A due to the poor solubility of substrate and low tolerance of the enzyme. Besides, the conversion cannot reach 100% with 24 h in the asymmetric reduction of (4-bromophenyl)-(phenyl)-methanone and p-nitrobenzophenone due to the low enzyme activity.

(37) TABLE-US-00007 TABLE 7 Asymmetric reduction of CPMK catalyzed by wild-type alcohol dehydrogenase KpADH Conversion rate (%) Reaction time (h) 100 mM 200 mM 500 mM 1 50.5 35.6 22.5 2 65.5 46.9 30 3 79.5 62.0 55.6 4 88.8 75.5 66.5 6 98.5 95.6 80.2 8 >99.9 98.8 93.2 12 >99.9 99.4 95.6 24 >99.9 99.7 99.2

(38) TABLE-US-00008 TABLE 8 Asymmetric reduction of CPMK catalyzed by alcohol dehydrogenase mutant E214Y/S237A Conversion rate (%) Reaction time (h) 100 mM 200 mM 500 mM 1 66 45.5 25.5 2 80 65.5 33.5 3 89.5 75.9 45.8 4 94 88.8 59.9 6 96.6 95.6 77.9 8 99.5 99.1 90.2 12 >99.9 99.7 95.7 24 >99.9 >99.9 99.5

(39) TABLE-US-00009 TABLE 9 Asymmetric reduction of acetophenone catalyzed by alcohol dehydrogenase mutant E214G/S237C Conversion rate (%) Reaction time (h) 100 mM 200 mM 500 mM 1 42 35 20.9 2 53 49 34.5 3 65 60 49.6 4 77 72 62.6 6 95 85.9 77.9 8 99.0 93.6 88.6 12 >99.9 99.2 92.9 24 >99.9 99.7 99.2

(40) TABLE-US-00010 TABLE 10 Asymmetric reduction of 4-chlorobenzoyl chloride catalyzed by alcohol dehydrogenase mutant E214S/S237C Conversion rate (%) Reaction time (h) 100 mM 200 mM 500 mM 1 66 55 35.6 2 79 69 49.6 3 90 76 66.4 4 98 85.9 79.3 6 99.2 96.4 89.0 8 99.8 99.1 95.6 12 >99.9 99.8 96.9 24 >99.9 >99.9 98.9

(41) TABLE-US-00011 TABLE 11 Asymmetric reduction of 4-chloroacetophenone catalyzed by alcohol dehydrogenase mutant E214I/S237A Conversion rate (%) Reaction time (h) 100 mM 200 mM 500 mM 1 59 40 28.5 2 72 52.4 38.9 3 89 69.5 50.0 4 85 76.9 64.2 6 97.6 88.6 80.9 8 99.8 95.6 90.2 12 >99.9 99.2 94.9 24 >99.9 99.7 99.2

(42) TABLE-US-00012 TABLE 12 Asymmetric reduction of 4-nitroacetophenone catalyzed by alcohol dehydrogenase mutant E214Y/S237A Conversion rate (%) Reaction time (h) 10 mM 20 mM 50 mM 1 32 22 10.5 2 48 35.5 22.5 3 60 55.8 35.9 4 85 69.5 49.5 6 95 90.4 60.9 8 99.8 95.6 82.6 12 >99.9 99.2 85.5 24 >99.9 99.5 86.5

(43) The alcohol dehydrogenase mutants of the present invention not only have very good performance in high-efficiency, high-stereoselectivity asymmetric reduction of CPMK, but also have higher catalytic efficiency and high stereoselectivity on other aryl ketone substrates.