COMPOSITIONS FOR THE TREATMENT OF SKIN CONDITIONS
20210228650 · 2021-07-29
Inventors
Cpc classification
A61K2035/11
HUMAN NECESSITIES
A61K47/10
HUMAN NECESSITIES
International classification
Abstract
Described herein are methods and compositions for the treatment of skin conditions associated with dysbiosis. Skin conditions associated with dysbiosis for treatment using compositions and methods described herein include atopic dermatitis, eczema, dermatitis, psoriasis, rosacea, and acne. Compositions include single or more than one strain of healthy donor derived bacteria for administration to provide therapy for skin conditions associated with dysregulated microbiota. Such compositions include gram negative and/or gram positive bacteria.
Claims
1. A method for reduction of psoriasis, comprising: topically administering a pharmaceutical composition comprising at least one strain of Roseomonas mucosa to a subject in need thereof, wherein the at least one strain of Roseomonas mucosa is viable and present in an amount sufficient for reduction of psoriasis in the subject.
2. The method of claim 1, wherein the pharmaceutical composition further comprises a pharmaceutically acceptable carrier.
3. The method of claim 1, wherein the at least one strain of Roseomonas mucosa is present in an amount of from 10.sup.2 to 10.sup.12 colony forming units.
4. The method of claim 1, wherein the at least one strain of Roseomonas mucosa is present in an amount sufficient for a reduction in Staphylococcus aureus in the subject.
5. The method of claim 1, wherein the pharmaceutical composition is administered to the subject at least two times per week.
6. The method of claim 1, wherein the pharmaceutical composition is administered to the subject once a day.
7. The method of claim 1, wherein the subject is an adult.
8. The method of claim 1, wherein the subject is a child.
9. The method of claim 1, wherein the subject is an infant.
10. The method of claim 1, wherein the at least one strain of Roseomonas mucosa comprises a nucleic acid sequence of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3.
11. A method for reduction of rosacea, comprising: topically administering a pharmaceutical composition comprising at least one strain of Roseomonas mucosa to a subject in need thereof, wherein the at least one strain of Roseomonas mucosa is viable and present in an amount sufficient for reduction of rosacea in the subject.
12. The method of claim 11, wherein the pharmaceutical composition further comprises a pharmaceutically acceptable carrier.
13. The method of claim 11, wherein the at least one strain of Roseomonas mucosa is present in an amount of from 10.sup.2 to 10.sup.12 colony forming units.
14. The method of claim 11, wherein the at least one strain of Roseomonas mucosa is present in an amount sufficient for a reduction in Staphylococcus aureus in the subject.
15. The method of claim 11, wherein the pharmaceutical composition is administered to the subject at least two times per week.
16. The method of claim 11, wherein the pharmaceutical composition is administered to the subject once a day.
17. The method of claim 11, wherein the subject is an adult.
18. The method of claim 11, wherein the subject is a child.
19. The method of claim 11, wherein the subject is an infant.
20. The method of claim 11, wherein the at least one strain of Roseomonas mucosa comprises a nucleic acid sequence of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0016]
[0017]
DETAILED DESCRIPTION
[0018] Provided herein are compositions and methods for treatment of a condition associated with skin dysbiosis by administering bacteria from a subject who does not have the condition associated with skin dysbiosis. The compositions and methods may further include an additional therapeutic agent for treatment of the condition associated with skin dysbiosis, where the presence of the bacteria enhances the therapeutic effect of the additional therapeutic agent. Described herein are (1) microorganisms for treatment of skin conditions associated with dysbiosis; (2) combination therapies; (3) therapeutic applications; (4) dosage forms; and (5) administration schedules.
[0019] Throughout this disclosure, various embodiments are presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of any embodiments. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range to the tenth of the unit of the lower limit unless the context clearly dictates otherwise. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual values within that range, for example, 1.1, 2, 2.3, 5, and 5.9. This applies regardless of the breadth of the range. The upper and lower limits of these intervening ranges may independently be included in the smaller ranges, and are also encompassed within the invention, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included, unless the context clearly dictates otherwise.
[0020] The terminology used herein is for the purpose of describing particular instances only and is not intended to be limiting of any embodiment. As used herein, the singular forms “a,” “an” and “the” are intended to include the plural forms as well, unless the context clearly indicates otherwise. As used herein, the term “and/or” includes any and all combinations of one or more of the associated listed items.
[0021] Unless specifically stated or obvious from context, as used herein, the term “about” in reference to a number or range of numbers is understood to mean the stated number and numbers+/−10% thereof, or 10% below the lower listed limit and 10% above the higher listed limit for the values listed for a range.
Microorganisms for Treatment of Skin Conditions Associated with Dysbiosis
[0022] Provided herein are compositions for use in treatment of a skin condition associated with dysbiosis. Such compositions may include isolated and/or purified bacteria and combinations of bacteria from intact human skin, or propagated from such bacteria. These bacteria can function as a healthy microbiota or promote growth of resident microbiome when administered to a subject with a skin condition associated with dysbiosis. The compositions provided may treat, alleviate, delay, or reduce the likelihood of the symptoms of the condition associated with dysbiosis. Exemplary skin conditions associated with dysbiosis for treatment using compositions described herein include, without limitation, eczema, allergic eczema, flexural eczema, infantile eczema, nummular eczema, discoid lupus, prurigo Besnier, psoriasis, vitiligo, dermatitis, atopic dermatitis, perioral dermatitis, neurodermatitis, seborrheic dermatitis, rosacea, and acne.
[0023] Provided herein are compositions comprising bacteria isolated from a donor subject that does not have a skin condition associated with dysbiosis, e.g., atopic dermatitis. A subject that does not have skin condition associated with dysbiosis is a subject without any observed pathological skin condition. Moreover, the donor subject may not have any pathological condition, for example, a pathological condition of the skin and/or any internal organ. The donor subject can be immunocompetent. The bacteria may be isolated from the skin of the donor subject directly, or propagated in vitro using techniques for culturing bacteria.
[0024] Provided herein are genera, species, strains, and combinations of strains or species, originally found within the human skin microbiota of a donor subject without a skin disease associated with dysbiosis. Such species/strains may be selected for their ability to significantly reduce the rate of skin pathogen replication. These species/strains provide a safe and effective means for modulating growth, replication, and disease severity of bacterial pathogens. Moreover, the compositions provided herein exclude pathogenic bacteria. As such, bacteria described herein for use in compositions may be non-pathogenic when administered to the skin of the subject, for example, an immunocompetent subject. Where the bacteria do not cause infection when administered to intact human skin, no pathogenesis is expected to be observed following treatment. Bacteria obtained from a donor subject may be isolated from the skin of various parts of the donor subject's body, for example, the forearm, antecubital fossa, and neck.
[0025] Compositions described herein, when administered to a subject having a skin condition associated with dysbiosis, reduce the growth rate of a specific pathogen present in the subject, for example, S. aureus. Bacteria with the capacity to durably reduce S. aureus in the skin can be identified using a methodology for estimating an Ecological Control Factor (ECF) for constituents within the human microbiota. The ECF can be determined by assessing the antagonistic activity of a given commensal strain or combination of strains towards a given pathogen using an in vitro assay, resulting in observed levels of ecological control at various concentrations of the added commensal strains. The ECF for a commensal strain or combination of strains is similar to the minimal inhibitory concentration (MIC) assessment that is employed in the assessment of antibiotics. The ECF can be used to assess and rank the relative potencies of commensal strains and combinations of strains by the ability to antagonize skin pathogens. The ECF of a commensal strain or combination of 20 strains can be calculated by assessing the concentration of that composition that can mediate a given percentage of inhibition (e.g., at least 10%, at least 20%, at least 50%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 100%) of a target pathogen in an in vitro assay.
[0026] Bacteria compositions provided herein may stimulate human keratinocytes. Such stimulation may occur in vivo and/or in vitro. Bacteria can stimulate keratinocytes by increasing the transcription of the mRNA of immune mediators or molecules involved in epithelial barrier function including, for example, increasing production of an mRNA-encoding IL-1β, an mRNA-encoding defensin beta 4, an mRNA-encoding Cyp27b1, an mRNA-encoding a vitamin D receptor, an mRNA-encoding occludin, an mRNA-encoding claudin 1, and/or an mRNA-encoding filaggrin. Bacterial compositions described herein may induce cytokine expression from human cells. Exemplary impacted human cells include, without limitation, the cells of the skin, such as fibroblasts and keratinocytes. Exemplary induced cytokines include, without limitation, an interleukin (IL), such as IL-6 and IL-1β.
[0027] In some embodiments, bacteria from only a single genus are included in a composition for treatment of a skin condition associated with dysbiosis. In alternative embodiments, combinations of genera are included in a composition for treatment of a skin condition associated with dysbiosis. In further embodiments, the composition comprises bacteria that are viable. Compositions described herein may include, for example, 1, 2, 3, 4, or 5 genera of bacteria.
[0028] Bacteria described herein for treatment of a skin condition associated with dysbiosis may be gram-positive bacteria or gram-negative bacteria. Exemplary gram-positive bacteria include a Staphylococcus species including, without limitation, Staphylococcus epidermis, Staphylococcus cohnii, and Staphylococcus hominis. Exemplary gram-negative bacteria include, without limitation, Proteobacteria, Acetobacteraceae, Spirochaetaceae, Enterobacteriales, Fusobacterium polymorphum, and Selenomonadales. Exemplary genera of gram-negative bacteria additionally include Pseudomonas, Pantoea, Moraxella, Roseomonas, Vitreoscilla, and Methylobacteria spp. The gram-negative bacteria may be diplococci, coccobacilli, cocci, or bacilli. Additional bacteria for treatment of a skin condition associated with dysbiosis include, without limitation, Lactobacillus casei var. rhamnosus, Bifidobacterium animalis subsp. lactis. Bifidobacterium longum, Lactobacillus plantarum, and Lactobacillus johnsonii.
[0029] In some embodiments, a composition provided herein comprises a viable species of Roseomonas. In some embodiments, a composition provided herein comprises a viable species of Pseudomonas. In some embodiments, a composition provided herein comprises a viable species of Roseomonas and viable species of Pseudomonas.
[0030] Compositions described herein may include one or more of a species of the Roseomonas genus for treatment of a skin condition associated with dysbiosis. Exemplary species of the Roseomonas genus include, without limitation, Roseomonas aerilata, Roseomonas aerophila, Roseomonas aestuarii, Roseomonas alkaliterrae, Roseomonas aquatic, Roseomonas cervicalis, Roseomonas fauriae, Roseomonas frigidaquae, Roseomonas gilardii, Roseomonas lacus, Roseomonas ludipueritiae, Roseomonas mucosa, Roseomonas pecuniae, Roseomonas rhizosphaerae, Roseomonas riguiloci, Roseomonas rosea, Roseomonas soli, Roseomonas stagni, Roseomonas terrae, and Roseomonas vinacea. In some instances, the Roseomonas mucosa is, or is derived from, ATCC BAA-692 strain. The bacteria may be viable. The bacteria may be isolated and/or purified. The bacteria may be isolated from a subject not having the skin condition associated with the dysbiosis which is sought to be treated.
[0031] Compositions described herein may include one or more of a species of the Pseudomonas genus for treatment of a skin condition associated with dysbiosis. Exemplary species of the Pseudomonas genus include, without limitation, Pseudomonas aeruginosa, Pseudomonas luteola, and Pseudomonas oryzihabitans. The bacteria may be viable. The bacteria may be isolated and/or purified. The bacteria may be isolated from a subject not having the skin condition associated with dysbiosis which is sought to be treated.
[0032] Compositions described herein may include one or more of a species of the Pantoea genus for treatment of a skin condition associated with dysbiosis. Exemplary species of the Pantoea genus include, without limitation, Pantoea septica. The bacteria may be viable. The bacteria may be isolated and/or purified. The bacteria may be isolated from a subject not having the skin condition associated with dysbiosis which is sought to be treated.
[0033] Compositions described herein may include one or more of a species of the Moraxella genus for treatment of a skin condition associated with dysbiosis. Exemplary species of the Moraxella genus include, without limitation, Moraxella osloensis. The bacteria may be viable. The bacteria may be isolated and/or purified. The bacteria may be isolated from a subject not having the skin condition associated with dysbiosis which is sought to be treated.
[0034] Compositions described herein may include one or more of a species of the Vitreoscilla genus for treatment of a skin condition associated with dysbiosis. Exemplary species of the Vitreoscilla genus include, without limitation, Vitreoscilla filiformis, Vitreoscilla beggiatoides, and Vitreoscilla stercoraria. The bacteria may be viable. The bacteria may be isolated and/or purified. The bacteria may be isolated from a subject not having the skin condition associated with dysbiosis which is sought to be treated.
[0035] Bacteria of a single species or a single strain can be included in compositions disclosed herein. Combinations of species bacteria can be included in compositions for use in disclosed methods. Thus, a composition described herein can include 1, 2, 3, 4, or 5 species of bacteria. In some embodiments, a composition provided herein includes multiple viable Roseomonas mucosa strains from one or more subjects not having a skin condition associated with dysbiosis. In some embodiments, a composition provided herein includes multiple viable Pseudomonas aeruginosa strains from one or more donor subjects not having a skin condition associated with dysbiosis. In some embodiments, a composition provided herein includes a viable strain of Roseomonas mucosa and a viable strain of Pseudomonas aeruginosa one or more donor subjects not having a skin condition associated with dysbiosis. Exemplary skin conditions associated with dysbiosis include, without limitation, eczema, allergic eczema, flexural eczema, infantile eczema, nummular eczema, discoid lupus, prurigo Besnier, psoriasis, vitiligo, dermatitis, atopic dermatitis, perioral dermatitis, neurodermatitis, seborrheic dermatitis, rosacea, and acne
[0036] Compositions provided herein for treatment of a condition associated with skin dysbiosis may include one or more types of bacteria types of bacteria. A composition provided herein may comprise 1 to 15, 2 to 12, 2 to 10, or 2 to 5 different species of bacteria. A composition provided herein may comprise 1 to 15, 2 to 12, 2 to 10, or 2 to 5 different strains of bacteria. A composition provided herein may comprise 1 to 15, 2 to 12, 2 to 10, or 2 to 5 different strains of the same species of bacteria. A composition provided herein may comprise 1, 2, 3, 4, or 5 different strains of the same species of bacteria. A composition provided herein may comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more different species of bacteria. In some instance, composition provided herein comprise at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 30, at least 40, at least 50, or greater than 50 types of bacteria, as defined by genus, species, or operational taxonomic unit (OTU). Strains described herein may be gram negative or gram positive. Such strains may be derived from a donor who does not have a certain dysbiosis of the skin for which the strain is to be used to treat.
[0037] Bacteria described herein may be transformed with a heterologous nucleic acid, such as in the form of a plasmid. For example, the plasmid may comprise an expression vector encoding for protein of interest. Such a mechanism provides a means for introduction of exogenous DNA can be introduced bacterial cells with standard techniques, such as electroporation or calcium phosphate-mediated transfection.
[0038] In some embodiments, the heterologous nucleic acid is included in a plasmid. A plasmid generally contains multiple genetic elements positionally and sequentially oriented with other necessary genetic elements, such that the nucleic acid in a nucleic acid cassette can be transcribed and when necessary translated in the transfected cells. Plasmids can include nucleic acids that are derived from DNA via a plasmid vector, cosmids, or phagemids, where one or more heterologous nucleic acid can be inserted. The heterologous nucleic acid can encode a protein of interest, which can be operably-linked to a promoter for expression of the bacteria.
[0039] Plasmids generally contain one or more unique restriction sites. In addition, a plasmid can confer well-defined phenotypes on the host organism, which can be selectable or readily-detected, for example, drug resistance. Thus, the plasmid can include an expression cassette, where a polypeptide is encoded. Expression can include the efficient transcription of an inserted gene, nucleic acid sequence, or nucleic acid cassette with the plasmid.
[0040] In some embodiments, when a circular plasmid is transferred into a bacterial cell, the plasmid can be an autonomously replicating, extra-chromosomal DNA molecule, distinct from the normal bacterial genome and non-essential for bacterial cell survival under non-selective conditions. Persistent expression can refer to introduction of genes into the cell together with genetic elements which enable episomal (extra-chromosomal) replication and/or maintenance of the genetic material in the cell. Persistent expression can lead to apparently stable transformation of the cell without the integration of the novel genetic material into the chromosome of the host cell. A plasmid can also introduce genetic material into chromosomes of the targeted cell. Gene expression after stable introduction can permanently alter the characteristics of the cell and cell progeny by replication leading to stable transformation.
[0041] Methods for producing bacterial strains for incorporation in a composition described herein optionally include processing steps of organism banking, organism production, and preservation. For organism banking, strains of bacteria can be isolated directly from a specimen, for example, from human skin or a banked stock. Bacteria can be cultured on a nutrient agar or broth that supports growth to generate viable biomass. The cultured biomass can be preserved in multiple aliquots for long-term storage. Bacteria may be isolated directly from the skin of a human donor subject. Generally, the human donor subject does not have a skin condition associated with dysbiosis, e.g., atopic dermatitis, or any other skin condition. Bacteria can also be isolated from other sources including, for example, commercial sources or environmental samples.
Combination Therapies
[0042] Provided herein are combination therapies for treatment of a skin condition associated with dysbiosis. The combination therapy includes administration of a first therapeutic agent, wherein the first therapeutic agent comprises a species or strain of bacteria described herein for treatment of a skin condition associated with dysbiosis, and a second therapeutic agent for treatment of the skin condition, where the second therapeutic agent is listed in Table 1, and wherein the combination of therapeutic agents provides for an enhanced therapeutic effect than administration of either agent alone. In further instances, the first therapeutic agent is present in an amount to increase the therapeutic effect of the second therapeutic agent, or vice versa. Therapeutic agents may be, without limitation, a microorganism, small molecule, antibody, calcineurin inhibitor, immune modulator, or steroid. Examples of such agents are provided, without limitation, in Table 1. Each of the first, second, or third therapeutic agents may be administered simultaneously or sequentially. Each of the first, second, or third therapeutic agents may be administered in similar or different dosage forms (oral, rectal, or topical). Exemplary skin conditions associated with dysbiosis include, without limitation, eczema, allergic eczema, flexural eczema, infantile eczema, nummular eczema, discoid lupus, prurigo Besnier, psoriasis, vitiligo, dermatitis, atopic dermatitis, perioral dermatitis, neurodermatitis, seborrheic dermatitis, rosacea, and acne.
TABLE-US-00001 TABLE 1 Therapeutic agents Type Description Microorganism Roseomonas mucosa (optionally obtained Pseudomonas aeruginosa from or derived Pantoea septica from a donor subject Vitreoscilla filiformis not having a skin Vitreoscilla beggiatoides condition associated Vitreoscilla stercoraria with dysbiosis) Moraxella osloensis Lactobacillus casei var. rhamnosus Bifidobacterium animalis subsp. lactis. Bifidobacterium longum Lactobacillus plantarum Lactobacillus johnsonii Staphylococcus epidermis Staphylococcus cohnii Staphylococcus hominis Propionibacterium acnes Calcineurin inhibitors Cyclosporine Pimecrolimus Tacrolimus Voclosporin Antibody Omalizumab Ligelizumab Ustekinumab Lebrikizumab Tralokinumab Secukinumab Nemolizumab Dupilumab Mepolizumab Fezakinumab GBR 830 Tezepelumab Immune modulators Cyclosporine Methotrexate Azathioprine Mycophenolic acid Mycophenolate mofetil Thymic stromal lymphopoietin (TSLP) antagonists OX40 antagonists Small Molecules Fevipiprant Timapiprant Baricitinib AQX-1125 Aprimelast Serlopitant Tradipitant Asimadoline Tofacitinib Upadacitinib PF-04965842 Steroid Corticosteroids Betamethasone dipropionate Betamethasone valerate Desonide Desoximetasone Diflorasone diacetate Fluocinonide Flurandrenolide Fluticasone propionate Fluocinolone acetonide Hydrocortisone Amcinonide Halcinonide Triamcinolone Triamcinolone Acetonide Mometasone Alclometasone
[0043] Provided herein are compositions and methods for a combination therapy for treatment of a skin condition associated with dysbiosis, comprising a first agent that is a gram positive bacterial strain and a second agent that is a gram negative bacterial strain. Strains selected for such combination therapies are donor derived, where the donor does not show signs of the skin condition associated with dysbiosis. In some instances, compositions for combination therapy described herein comprise a plurality of strains for each species included in the composition. In some instances, the combination of therapeutic agents provides for a therapeutic effect that is enhanced compared to administration of any one agent in the mixture alone. In some instances, a strain of gram positive bacteria is selected based on an increase relative abundance compared the same species of bacteria in a subject suffering from a skin condition associated with dysbiosis. Exemplary gram positive bacterial species for inclusion are, without limitation, one or more species in the genus of Staphylococci, Streptococci, Enterococci, Corynebacteriae, or Propionibacterii. Exemplary Staphylococci species for combination with a gram negative species described herein include, without limitation, Staphylococcus aureus, Staphylococcus hemolyticus, Staphylococcus auricularis, Staphylococcus warneri, Staphylococcus hominis, Staphylococcus epidermidis, Staphylococcus simulans, Staphylococcus sciuri, Staphylococcus capitis, Staphylococcus saprophyticus, Staphylococcus xylosis, Staphylococcus cohnii, and Staphylococcus lentus. Exemplary Streptococci species for combination with a gram negative species described herein include, without limitation, Streptococcus bovis, Streptococcus agalactae, Streptococcus viridian, Streptococcus pneumonia, Streptococcus salivarius, and Streptococcus acidominimus. Exemplary Enterococci species combination with a gram negative species described herein include, without limitation, Enterococcus faecalis, Enterococcus Faecium, and Enterococcus gallinarium. Exemplary Corynebacteriae species for combination with a gram negative species described herein include, without limitation, Corynebacterium xerosis and Corynebacterium minutissimum. Exemplary Propionibacterium species for combination with a gram negative species described herein include, without limitation, Propionibacterium acnes. Exemplary gram positive bacteria for combination with a gram negative species described herein include, without limitation, Staphylococcus epidermidis, Staphylococcus hominis, Staphylococcus cohnii, or Propionibacterium acnes. In some instances, the Staphylococcus epidermidis is, or is derived from, ATCC 12228 strain. In some instances, the Propionibacterium acnes is, or is derived from, ATCC 6919 strain. Exemplary genera of gram-negative bacteria additionally include Pseudomonas, Pantoea, Moraxella, Roseomonas, Vitreoscilla, and Methylobacteria spp. Exemplary species of the Roseomonas genus include, without limitation, Roseomonas aerilata, Roseomonas aerophila, Roseomonas aestuarii, Roseomonas alkaliterrae, Roseomonas aquatic, Roseomonas cervicalis, Roseomonas fauriae, Roseomonas frigidaquae, Roseomonas gilardii, Roseomonas lacus, Roseomonas ludipueritiae, Roseomonas mucosa, Roseomonas pecuniae, Roseomonas rhizosphaerae, Roseomonas riguiloci, Roseomonas rosea, Roseomonas soli, Roseomonas stagni, Roseomonas terrae, and Roseomonas vinacea. Exemplary species of the Pseudomonas genus include, without limitation, Pseudomonas aeruginosa, Pseudomonas luteola, and Pseudomonas oryzihabitans. Exemplary species of the Pantoea genus include, without limitation, Pantoea septica. Exemplary species of the Moraxella genus include, without limitation, Moraxella osloensis. Exemplary species of the Vitreoscilla genus include, without limitation, Vitreoscilla filiformis, Vitreoscilla beggiatoides, and Vitreoscilla stercoraria.
Therapeutic Applications: Skin Conditions Associated with Dysbiosis
[0044] Provided herein are methods and compositions for the treatment of skin conditions associated with dysbiosis. Such conditions are often associated with a disruption in the skin barrier and inflammation in regions of the skin. Affected subjects may have a rash, itchiness, redness, swelling, vesicle formation (minute blisters), cracking, weeping, crusting, and scaling of the skin. Compositions and methods described herein for treatment of the skin condition associated with dysbiosis may experience a lessening of the rash, itchiness, redness, swelling, vesicle formation (minute blisters), cracking, weeping, crusting, or scaling of the skin associated with the skin condition. Exemplary skin conditions associated with dysbiosis include, without limitation, eczema, allergic eczema, flexural eczema, infantile eczema, nummular eczema, discoid lupus, prurigo Besnier, psoriasis, vitiligo, dermatitis, atopic dermatitis, perioral dermatitis, neurodermatitis, seborrheic dermatitis, rosacea, and acne. Treatments described herein may also provide for treatment of secondary disease conditions associated with the primary disease being treated. For example, in the case of treating atopic dermatitis, a composition described herein may also provide for treatment or prevention of asthma, allergies, and allergic rhinitis (hay fever).
Dosage Forms
[0045] Compositions and pharmaceutical compositions provided herein may be formulated for topical, oral, or rectal administration.
[0046] Creams are viscous liquids or semisolid emulsions, either oil-in-water or water-in-oil. Cream bases are water-washable, and contain an oil phase, an emulsifier, and an aqueous phase. The oil or “internal” phase generally contains of petrolatum and a fatty alcohol, such as acetyl or stearyl alcohol. The aqueous phase can exceed the oil phase in volume, and can contain a humectant. The emulsifier in a cream formulation can be a nonionic, anionic, cationic, or amphoteric surfactant.
[0047] Lotions can include preparations to be applied to the skin surface without friction. Lotions are typically liquid or semiliquid preparations in which particles are present in a water or alcohol base. Lotions can be suspensions of solids or a liquid oily emulsion of the oil-in-water type. Lotions can be used for treating large body areas, because of the ease of applying a more fluid composition. It is generally necessary that the insoluble matter in a lotion be finely divided. Lotions typically contain suspending agents to produce better dispersions as well as compounds useful for localizing and holding the active agent in contact with the skin, e.g., methylcellulose, sodium carboxymethyl-cellulose, or the like.
[0048] Solutions are homogeneous mixtures prepared by dissolving one or more chemical substances (solutes) in a liquid such that the molecules of the dissolved substance are dispersed among those of the solvent. The solution can contain other pharmaceutically or cosmetically acceptable chemicals to buffer, stabilize, or preserve the solute. Common examples of solvents used in preparing topical solutions are ethanol, water, propylene glycol or any other-acceptable vehicles. These can be applied in any manner, such as spraying them on the skin, painting them on the skin, or wetting a bandage with the solution.
[0049] Gels are semisolid, suspension-type systems. Single-phase gels contain organic macromolecules distributed substantially uniformly throughout the carrier liquid, which can be aqueous, contain an alcohol, or hydrophobic. Organic macromolecules, including gelling agents, can be crosslinked acrylic acid polymers, e.g., carboxypolyalkylenes (CARBOPOL®). Non-limiting examples of gels include hydrophilic polymers, such as polyethylene oxides, polyoxyethylene-polyoxypropylene copolymers, and polyvinylalcohol; cellulosic polymers, such as hydroxypropyl cellulose, hydroxyethyl cellulose, hydroxypropyl methylcellulose, hydroxypropyl methylcellulose phthalate, and methyl cellulose; gums, such as tragacanth and xanthan gum; sodium alginate; and gelatin. To prepare a uniform gel, dispersing agents, such as alcohol or glycerin can be added, or the gelling agent can be dispersed by trituration, mechanical mixing or stirring, or combinations thereof.
[0050] Ointments can also be used in the disclosed methods. Ointments are semisolid preparations that are typically based on petrolatum or other petroleum derivatives. The specific ointment base to be used, as will be appreciated by those skilled in the art, is one that will provide for a number of desirable characteristics, e.g., emolliency or the like. An ointment base is generally inert, stable, non-irritating, and non-sensitizing. Ointment bases may be oleaginous bases, emulsifiable bases, emulsion bases, or water-soluble bases.
[0051] Oleaginous ointment bases include, for example, vegetable oils, fats obtained from animals, and semisolid hydrocarbons obtained from petroleum. Emulsifiable ointment bases, also known as absorbent ointment bases, contain little or no water and include, for example, hydroxystearin sulfate, anhydrous lanolin, and hydrophilic petrolatum. Emulsion ointment bases are either water-in-oil (W/O) emulsions or oil-in-water (O/W) emulsions, and include, for example, acetyl alcohol, glyceryl monostearate, lanolin, and stearic acid. Water-soluble ointment bases are prepared from polyethylene glycols of varying molecular weight.
[0052] Pastes are semisolid dosage forms in which the active agent is suspended in a suitable base, and are also of use. Depending on the nature of the base, pastes are divided between fatty pastes or those made from single-phase aqueous gels. The base in a fatty paste can be petrolatum or hydrophilic petrolatum or the like. The pastes made from single-phase aqueous gels can incorporate carboxymethylcellulose or the like as a base.
[0053] A topical composition can be any form suitable for application to the body surface including, for example, as a cream, lotion, spray, solution, gel, foam, ointment, paste, plaster, paint, bioadhesive, bandage, spray, suspension, and containing liposomes, micelles, and/or microspheres. A topical composition can be used in combination with an occlusive overlayer so that moisture evaporating from the body surface can be maintained within the formulation upon application to the body surface and thereafter. A cream, lotion, gel, ointment, paste, or the like can be spread on the affected surface.
[0054] A solution can be applied in the same way, but more typically will be applied with a dropper, swab, sprayer or the like, and carefully applied to the affected areas. Compositions can be applied directly to the target location, for example in a topical preparation, such as an ointment, or as a part of a dressing or a bandage. Compositions can be formulated as a unit dosage, for administration by any device for administration to the skin. The unit dosage can be a reservoir of the active agent in a carrier, for example an adhesive carrier capable of adhering to the skin for a desired period of time, such as at least a day or more.
[0055] Pharmaceutical compositions provided herein may include a pharmaceutically-acceptable carrier, and can include additional compounds. In some embodiments, pharmaceutical compositions include additional active and/or inactive materials, which can be in prepared as single dosage unit or in a multi-dose format.
[0056] Pharmaceutical compositions described herein may include a carrier that comprises one or more of a buffering agent, a preservative, a stabilizer, a binder, a compaction agent, a lubricant, a dispersion enhancer and/or a coloring agent. Non-limiting examples of suitable buffering agents include sodium citrate, magnesium carbonate, magnesium bicarbonate, calcium carbonate, and calcium bicarbonate. Non-limiting examples of suitable preservatives include antioxidants, such as alpha tocopherol and ascorbate, parabens, chlorobutanol, and phenol. Non-limiting examples of suitable binders include sucrose, starches, pregelatinized starches, gelatin, polyvinylpyrrolidone, cellulose, methylcellulose, sodium carboxymethylcellulose, ethylcellulose, polyacrylamides, polyvinyloxoazolidone, polyvinylalcohols, C12-C18 fatty acid alcohol, polyethylene glycol, polyols, saccharides, oligosaccharides, and combinations thereof. Non-limiting examples of suitable lubricants include magnesium stearate, calcium stearate, zinc stearate, hydrogenated vegetable oils, sterotex, polyoxyethylene monostearate, talc, polyethyleneglycol, sodium benzoate, sodium lauryl sulfate, magnesium lauryl sulfate, and light mineral oil. A pH buffering agent(s) can, if employed and when dissolved in an aqueous component of the composition, provide a pH in the range of 5 to 7 (5 e.g. about pH 5.5).
[0057] Pharmaceutical compositions described herein may include a carrier that comprises other ingredients including, for example, ingredients that sustain growth of the bacteria. In some embodiments, pharmaceutical compositions can include a nutrient. In some embodiments, compositions include at least one carbohydrate or saccharide. A carbohydrate can be a monosaccharide, a disaccharide, trisaccharide, oligosaccharide, or polysaccharide. Non-limiting examples of carbohydrates include glucose, sucrose, galactose, mannose, ribose, arabinose, xylose, fructose, maltose, cellobiose, lactose, raffinose, stachyose, starch, glycogen, and cellulose. Carbohydrates can contain modified saccharide unit, including, for example, 2′-deoxyribose in which a hydroxyl group is removed, 2′-fluororibose in which a hydroxyl group is replaced with a fluorine, and or N-acetylglucosamine, a nitrogen-containing form of glucose (e.g., 2′-fluororibose, deoxyribose, and hexose). Carbohydrates can exist in many different forms, for example, conformers, cyclic forms, acyclic forms, stereoisomers, tautomers, anomers, and isomers.
[0058] Pharmaceutical compositions described herein may include a carrier that comprises one or more lipids. A lipid can include fats, oils, triglycerides, cholesterol, phospholipids, and fatty acids. Fats, oils, and fatty acids can be saturated, unsaturated (cis or trans), or partially unsaturated (cis or trans). Non-limiting examples of fatty acids include lauric acid (12:0), myristic acid (14:0), palmitic acid (16:0), palmitoleic acid (16:1), margaric acid (17:0), heptadecenoic acid (17:1), stearic acid (18:0), oleic acid (18:1), linoleic acid (18:2), linolenic acid, α-linolenic acid, and γ-linolenic acid.
[0059] Pharmaceutical compositions described herein may include a carrier that comprises at least one supplemental mineral or mineral source. Non-limiting examples of minerals include chloride, sodium, calcium, iron, chromium, copper, iodine, zinc, magnesium, manganese, molybdenum, phosphorus, potassium, and selenium. Suitable forms of any of the foregoing minerals include soluble mineral salts, slightly soluble mineral salts, insoluble mineral salts, chelated minerals, mineral complexes, non-reactive minerals, such as carbonyl minerals, and reduced minerals, and combinations thereof. In some embodiments, compositions include at least one supplemental vitamin. Supplemental vitamins can be fat-soluble or water-soluble. Non-limiting examples of vitamins include vitamin C, vitamin A, vitamin E, vitamin B12, vitamin K, riboflavin, niacin, vitamin D, vitamin B6, folic acid, pyridoxine, thiamine, pantothenic acid, and biotin. Suitable forms of any of the foregoing are salts of the vitamin, derivatives of the vitamin, compounds having the same or similar activity of the vitamin, and metabolites of the vitamin.
[0060] Various other additives can be included in the compositions. Non-limiting examples of additives include antioxidants, astringents, perfumes, preservatives, emollients, pigments, dyes, humectants, propellants, and sunscreen agents, as well as other classes of materials whose presence can be pharmaceutically or otherwise desirable. Non-limiting examples of optional additives include preservatives, such as sorbate; solvents, such as isopropanol and propylene glycol; astringents, such as menthol and ethanol; emollients, such as polyalkylene methyl glucosides; humectants, such as glycerin; emulsifiers, such as glycerol stearate, PEG-100 stearate, polyglyceryl-3 hydroxylauryl ether, and polysorbate 60; sorbitol and other polyhydroxyalcohols, such as polyethylene glycol; sunscreen agents, such as octyl methoxyl cinnamate (Parsol MCX) and butyl methoxy benzoylmethane (Parsol 1789); antioxidants, such as ascorbic acid (vitamin C), α-tocopherol (Vitamin E), β-tocopherol, γ-tocopherol, δ-tocopherol, ε-tocopherol, ζ.sub.1-tocopherol, ζ.sub.2-tocopherol, η-tocopherol, and retinol (vitamin A); essential oils, ceramides, essential fatty acids, mineral oils, vegetable oils (e.g., soya bean oil, palm oil, liquid fraction of shea butter, sunflower oil), animal oils (e.g., perhydrosqualene), synthetic oils, silicone oils or waxes (e.g., cyclomethicone and dimethicone), fluorinated oils (generally perfluoropolyethers), fatty alcohols (e.g., cetyl alcohol), and waxes (e.g., beeswax, carnauba wax, and paraffin wax); skin-feel modifiers; and thickeners and structurants, such as swelling clays and cross-linked carboxypolyalkylenes.
[0061] Other additives include materials that condition the skin. Such materials can soften the skin by retarding the decrease of water content of the skin and/or protect the skin. Conditioners and moisturizing agents include, for example, pyrrolidine carboxylic acid and amino acids; organic antimicrobial agents, such as triclosan and benzoic acid. Further additives include anti-inflammatory agents, such as acetylsalicylic acid and glycyrrhetinic acid; anti-seborrhoeic agents, such as retinoic acid; vasodilators, such as nicotinic acid; inhibitors of melanogenesis, such as kojic acid; and mixtures thereof.
[0062] In some embodiments, compositions described herein include alpha hydroxyacids, alpha ketoacids, polymeric hydroxyacids, moisturizers, collagen, marine extract, and antioxidants, such as ascorbic acid (vitamin C) and α-tocopherol (Vitamin E). Sunscreens can also be included. Additional, components, such as enzymes, herbs, plant extracts, and glandular or animal extracts can be added to the composition. The amounts of these various additives are those conventionally used in the cosmetics field, and range, for example, from about 0.01% to about 20% of the total weight of the topical formulation.
[0063] Compositions described herein can also include antimicrobial agents, to prevent spoilage upon storage, for example, to inhibit growth of microbes, such as yeasts and molds. Suitable antimicrobial agents are typically selected from the group consisting of the methyl and propyl esters of p-hydroxybenzoic acid (i.e., methyl and propyl paraben), sodium benzoate, sorbic acid, imidurea, and combinations thereof.
[0064] Compositions described herein can also contain irritation-mitigating additives to reduce or eliminate the possibility of skin irritation or skin damage resulting from the chemical entity to be administered, or other components of the composition. Suitable irritation-mitigating additives include, for example, α-tocopherol; monoamine oxidase inhibitors, particularly phenyl alcohols, such as 2-phenyl-1-ethanol; glycerin; salicylates; ascorbates; ionophores, such as monensin; amphiphilic amines; ammonium chloride; N-acetylcysteine; capsaicin; and chloroquine. The irritation-mitigating additive, if present, can be incorporated into the compositions at a concentration effective to mitigate irritation or skin damage, typically representing not more than about 20 wt %, more typically not more than about 5 wt %, of the formulation. Non-limiting examples of suitable pharmacologically-active agents that can be incorporated into the present formulations can include the following: agents that improve or eradicate pigmented or non-pigmented age spots, keratoses, and wrinkles; local anesthetics and analgesics; corticosteroids; retinoids; and hormones. Some examples of topical pharmacologically-active agents include acyclovir, amphotericins, chlorhexidine, clotrimazole, ketoconazole, econazole, miconazole, metronidazole, minocycline, phenytoin, para-amino benzoic acid esters, octyl methoxycinnamate, octyl salicylate, oxybenzone, dioxybenzone, tocopherol, tocopheryl acetate, zinc pyrithione, diphenhydramine, pramoxine, lidocaine, procaine, crotamiton, hydroquinone and its monomethyl and benzyl ethers, naproxen, ibuprofen, cromolyn, retinol, retinyl palmitate, retinyl acetate, coal tar, griseofulvin, estradiol, hydrocortisone, hydrocortisone 21-acetate, hydrocortisone 17-valerate, hydrocortisone 17-butyrate, progesterone, betamethasone valerate, betamethasone dipropionate, triamcinolone acetonide, fluocinonide, clobetasol propionate, minoxidil, dipyridamole, diphenylhydantoin, benzoyl peroxide, 5-fluorouracil, tacrolimus, and topical steroids, such as alclometasone, amcinonide, betamethasone, clobetasol, desonide, dexoximetasone, diflorasone, flucinonide, flurandrenolide, halobetasol, halcinonide, hydrocortisone, and/or triamcinolone.
[0065] Although topical formulations, such as creams and salves, are formulated for dermal delivery, the delivery systems can include time-release, delayed release, or sustained release delivery systems. Such systems can avoid repeated administrations of the compositions, increasing convenience to the subject and the physician. Non-limiting examples of release delivery systems include (a) erosional systems and (b) diffusional systems in which an active component permeates at a controlled rate from a polymer. The delivery system can include collagen, fibrin, or a membrane extract, such as a basal membrane extract, for example, in which compositions are formulated for administration to the skin. Suitable basement membrane extracts include a biologically active polymerizable extract containing in parts by weight about 60-85% laminin, 5-30% collagen IV, 1-10% nidogen, 1-10% heparan sulfate proteoglycan, and 1-5% entactin. BME can support normal growth and differentiation of various cell types including epithelial cells when cultured. Basal membrane extracts are well known in the art and are commercially available.
[0066] Compositions described herein may comprise a single (unit) dose of bacteria. Compositions described herein may comprise 10.sup.2 to 10.sup.12 colony forming units (cfu) of bacteria or a bacterial strain described herein. Compositions described herein may comprise about 10.sup.3 to 10.sup.11 cfu, 10.sup.3 to 10.sup.10 cfu, 10.sup.3 to 10.sup.9 cfu, 10.sup.3 to 10.sup.8 cfu, 10.sup.3 to 10.sup.7 cfu, 10.sup.3 to 10.sup.6 cfu, 10.sup.3 to about 10.sup.5 cfu, 10.sup.3 to 10.sup.4 cfu, 10.sup.4 to 10.sup.12 cfu, 10.sup.4 to 10.sup.11 cfu, 10.sup.4 to 10.sup.10 cfu, 10.sup.4 to 10.sup.9 cfu, 10.sup.4 to 10.sup.8 cfu, 10.sup.4 to 10.sup.7 cfu, 10.sup.4 to 10.sup.6 cfu, 10.sup.5 to 10.sup.12 cfu, 10.sup.5 to 10.sup.11 cfu, about 10.sup.5 to about 10.sup.10 cfu, 10.sup.6 to 10.sup.12 cfu, 10.sup.7 to 10.sup.12 cfu, 10.sup.8 to 10.sup.12 cfu, 10.sup.9 to 10.sup.12 cfu, 10.sup.10 to 10.sup.12 cfu, 10.sup.11 to 10.sup.12 cfu, or 10.sup.6 to 10.sup.10 cfu of bacteria or a bacterial strain described herein. In some embodiments, compositions comprise about 10.sup.3 cfu, about 10.sup.4 cfu, about 10.sup.5 cfu, about 10.sup.6 cfu, about 10.sup.7 cfu, about 10.sup.8 cfu, about 10.sup.9 cfu, about 10.sup.10 cfu, about 10.sup.11 cfu, or about 10.sup.12 cfu of bacteria or a bacterial strain described herein.
[0067] In other embodiments, a composition described herein comprises at least about 0.01% by weight, at least about 0.05% by weight, at least about 0.1% by weight, at least about 0.2% by weight, at least about 0.3% by weight, at least about 0.4% by weight, at least about 0.5% by weight, at least about 0.6% by weight, at least about 0.7% by weight, at least about 0.8% by weight, at least about 0.9% by weight, at least about 1.0% by weight, at least about 1.5% by weight, at least about 2.0% by weight, at least about 3.0% by weight, at least about 4.0% by weight, at least about 5.0% by weight, at least about 6.0% by weight, at least about 7.0% by weight, at least about 8.0% by weight, at least about 9.0% by weight, at least about 10.0% by weight, at least about 11.0% by weight, at least about 12.0% by weight, at least about 13.0% by weight, at least about 14.0% by weight, at least about 15.0% by weight, at least about 16.0% by weight, at least about 17.0% by weight, at least about 18.0% by weight, at least about 19.0% by weight, at least about 20.0% by weight, at least about 25.0% by weight, at least about 30.0% by weight, at least about 35.0% by weight, at least about 40.0% by weight, at least about 45.0% by weight, or at least about 50.0% by weight of bacteria or bacterial strain described herein. In some embodiments, compositions can include from 0.01% to 30% by weight, from about 0.01% to 20% by weight, from 0.01% to 5% by weight, from 0.1% to 30% by weight, from 0.1% to 20% by weight, from 0.1% to about 15% by weight, from 0.1% to 10% by weight, from 0.1% to 5% by weight, from 0.2% to 5% by weight, from 0.3% to 5% by weight, from 0.4% to 5% by weight, from 0.5% to 5% by weight, or from 1% to 5% by weight of bacteria or bacterial strain described herein.
Administration
[0068] Subjects having a skin condition associated with dysbiosis may be treated using compositions described herein. The subject can be a human. In some embodiments, the subject is a child. The subject can be 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 year(s) of age. In some embodiments, the subject is an adolescent. The subject can be 12, 13, 14, 15, 16, 17, or 18 years of age. The subject is an infant or less than 1 year of age. In other embodiments, the subject is an adult. The subject can be about 20 years of age, about 25 years of age, about 30 years of age, about 35 years of age, about 40 years of age, about 45 years of age, about 50 years of age, about 55 years of age, about 60 years of age, about 65 years of age, about 70 years of age, about 75 years of age, about 80 years of age, or more than 80 years of age. The subject can be immunocompromised or can have an intact immune system (immunocompetent).
[0069] Compositions can be applied to the skin, such as at lesion areas and round lesion area, or at areas of intact skin (non-lesion areas) to prevent lesions for forming. Compositions can be used to reduce lesion size. Compositions can be applied at one time (daily) or at multiple times throughout the day. In some embodiments, compositions can be applied 2 times, 3 times, 4 times, or 5 times per day. In some embodiments, compositions can be applied every other day, daily over a week, every other day over a week, every week, 2 times per week, 3 times per week, 4 times per week, 5 times per week, 6 times per week, or 7 times per week. Compositions can be formulated as a unit dose for administration.
[0070] For treatment of the skin, a therapeutically-effective amount of a composition can be locally administered to the affected area. Affected areas can include, for example, the antecubital fossa, neck, and forearm. Pharmacological compositions disclosed herein facilitate the use of at least one species of bacteria for the treatment of atopic dermatitis. Such compositions can be suitable for delivery of the active ingredient to any suitable subject, such as, but not limited to, a human subject, and can be manufactured in a manner that is itself known, e.g., by means of conventional mixing, dissolving, granulating, emulsifying, encapsulating, entrapping or lyophilizing processes. Pharmacological compositions can be formulated in a conventional manner using one or more pharmacologically (physiologically or pharmaceutically) acceptable carriers, as well as optional auxiliaries that facilitate processing of the active compounds into preparations which can be used pharmaceutically, as discussed above.
[0071] Compositions and methods described herein may be used for the treatment of a skin condition associated with dysbiosis. Treatment of the skin condition associated with dysbiosis may result in reduced lesion size, reduced number of lesions, and/or a reduction in related symptoms. In addition, treatment of the skin condition associated with dysbiosis with a composition or method described herein may reduce S. aureus in the skin of a subject in need thereof. Compositions and methods described herein may provide for enhanced barrier function of the skin as measured by trans-epidermal water loss. Administrations described herein, e.g., topical, oral, or rectal, may reduce reoccurrences, so that additional incidents of the skin condition associated with dysbiosis are reduced in number, intensity, or frequency. The administration may increase the time of remission, such as the length of time between incidents. In some embodiments, an additional incident of skin condition associated with dysbiosis does not occur for 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 weeks following application. In some embodiments, an additional incident skin condition associated with dysbiosis does not occur for 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 months following the topical application. Exemplary skin conditions associated with dysbiosis include, without limitation, eczema, allergic eczema, flexural eczema, infantile eczema, nummular eczema, discoid lupus, prurigo Besnier, psoriasis, vitiligo, dermatitis, atopic dermatitis, perioral dermatitis, neurodermatitis, seborrheic dermatitis, rosacea, and acne.
[0072] Compositions and methods described herein may be used for the treatment of atopic dermatitis. Treatment of the atopic dermatitis may result in reduced lesion size, reduced number of lesions, and/or a reduction in related symptoms. In addition, treatment of atopic dermatitis with a composition or method described herein may reduce S. aureus in the skin of a subject in need thereof. Compositions and methods described herein may provide for enhanced barrier function of the skin as measured by trans-epidermal water loss. Atopic dermatitis can occur as flare-ups, and there can be periods of remission. Administrations described herein, e.g., topical, oral, or rectal, may reduce reoccurrences, so that additional incidents of atopic dermatitis are reduced in number, intensity, or frequency. The administration may increase the time of remission, such as the length of time between incidents. In some embodiments, an additional incident of atopic dermatitis does not occur for 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 weeks following application. In some embodiments, an additional incident of atopic dermatitis does not occur for 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 months following the topical application.
[0073] Methods provided herein for treatment of a skin condition associated with dysbiosis may comprise measuring the microbiota of the skin of the subject. Specifically, diagnostic assays can be performed to determine whether the bacterial flora in the skin of a subject is altered following treatment compared to an original assessment. Alteration of bacterial phyla, bacterial classes, bacterial orders, bacterial families, bacterial genera, and/or bacterial species in the skin of a subject with atopic dermatitis can be determined. In some embodiments, the amount of S. aureus modified in the skin of the subject following treatment can be determined. Such a method for identifying a microbiota in a sample can include providing a sample, such as a skin sample, and detecting at least one microbiota in the sample. In some embodiments, the method can include preparing a nucleic acid sample including a molecular indicator of identity from at least one microbiota present in the sample and detecting the molecular indicator of identity.
[0074] For example, the method can involve preparing at least one nucleic acid sample by preparing a DNA sample. The molecular indicator of identity can be a polymorphic polynucleotide, such as an rRNA gene (for example, a 16S rRNA gene). The molecular indicator of identity can be detected by determining the nucleotide sequence of the polymorphic polynucleotide, such as the 16S rRNA gene, or a portion or subsequence thereof. Additional embodiments, for detecting the molecular indicator of identity can also include PCR with selective primers, quantitative PCR with selective primers, DNA-DNA hybridization, RNA-DNA hybridization, in situ hybridization, and combinations thereof. For example, the polymorphic polynucleotide can be detected by hybridization to a specific probe. In such an example, the specific probe hybridizes to a polymorphic target nucleic acid, such as a 16S rRNA gene. Optionally, the nucleic acid can be hybridized to at least one array including a plurality of specific probes, e.g., a plurality of specific probes, each of which identifies a species of bacteria. Detecting the molecular indicator of identity can also be accomplished using protein probes (such as antibodies) that bind to polymorphic target proteins, for example, polymorphic target proteins that identify the microbiota.
[0075] The relative abundance of one or more bacteria, such as S. aureus, can be measured in a sample from a subject. Relative abundance can refer to the commonality or rarity of an organism relative to other organisms in a defined location or community. For example, the relative abundance can be determined by generally measuring the presence of a particular organism compared to the total presence of organisms in a sample.
[0076] The relative abundance of bacteria can be measured directly or indirectly. Direct measurements can include culture based methods. Indirect measurements can include comparing the prevalence of a molecular indicator of identity, such as ribosomal RNA (rRNA) gene sequences, specific for an organism or group of organisms in relation to the overall sample.
[0077] In some embodiments, the relative abundance of microbiota, such S. aureus and/or any type of bacteria, within the skin an individual subject can be calculated by measuring the ratio of one or more specific bacteria in a sample from an individual to obtain a microbiota profile of the subject. The relative abundance can be derived from the total abundance of bacteria present in a sample. The total abundance can refer to the total bacteria in a sample. A microbiota profile can refer to a representation, such as a graph, of the relative abundance of one or more microbiota in a subject or sample of skin from a subject.
Kits
[0078] Disclosed compositions can be provided as a component of a kit. The purified viable bacteria can be provided in a growth medium, lyophilized form, or as frozen cells. Thus, the kit can include a container including a therapeutically-effective amount of a purified viable bacteria and an additional therapeutic agent for treatment of a condition associated with skin dysbiosis.
[0079] In some embodiments, the kit can include the components needed to produce a pharmaceutical composition, such as one container including the bacteria and one container including a pharmaceutically-acceptable carrier for suspending the bacteria thereof. The pharmaceutically-acceptable carrier can be, for example, a buffered saline solution or a sucrose solution. In other embodiments, the kit can include a container including the bacteria, and a second container including a pharmaceutically-acceptable carrier, and a device, such as, but not limited to, a syringe, for measuring the pharmaceutically-acceptable carrier. In some with medium, lyophilized form, or as frozen cells. Thus, the kit can include a container including a therapeutically-etion of the bacteria once it is suspended in the pharmaceutically-acceptable carrier.
[0080] Optionally, such a kit includes additional components including packaging, instructions and various other reagents, such as additional buffers or other therapeutic ingredients. The kit can include a container and a label or package insert on or associated with the container. Suitable containers can include, for example, bottles, vials, tubes, etc. The containers can be formed from a variety of materials, such as glass or plastic. The container can hold a composition including bacteria effective for treating atopic dermatitis. In some embodiments, the container can have a sterile access port. For example, the container can be an intravenous solution bag or a vial having a stopper pierceable by a hypodermic injection needle.
[0081] The label or package insert indicates that the composition can be used for treating the particular condition, such as atopic dermatitis. The label or package insert typically will further include instructions for use. The package insert typically includes instructions customarily included in commercial packages of therapeutic products that contain information about the indications, usage, dosage, administration, contraindications and/or warnings concerning the use of such therapeutic products. Non-limiting examples of instructions include information on the amount of the pharmaceutically-acceptable carrier to add to the vial containing the bacteria, instructions for suspending the bacteria in the pharmaceutically-acceptable carrier, and instructions for topical application to the skin. The application can be spraying on the skin, swabbing on the skin, or introducing the suspension onto a bandage for application to the skin.
[0082] The following examples are set forth to illustrate more clearly the principle and practice of embodiments disclosed herein to those skilled in the art and are not to be construed as limiting the scope of any claimed embodiments. Unless otherwise stated, all parts and percentages are on a weight basis.
EXAMPLES
Example 1: Oral Pharmaceutical Composition for Treatment of Atopic Dermatitis
[0083] A pharmaceutical composition is designed for treatment of atopic dermatitis including a strain of Roseomonas mucosa described herein in the oral dosage form of a capsule.
Example 2: Rectal Pharmaceutical Composition for Treatment of Atopic Dermatitis
[0084] A pharmaceutical composition is designed for treatment of atopic dermatitis including a strain of Roseomonas mucosa described herein in the rectal dosage form of a suppository.
Example 3: Combination Therapies in Mouse Model for Atopic Dermatitis
[0085] MC903, a vitamin D analogue, induces an AD-like dermatitis when applied to mouse ears. For prevention studies, 1e7 CFU of gram negative bacteria is suspended in sterile PBS and dripped onto the mouse ears in 10 mcL of volume. Inoculations are initiated two days prior to MC903, and continued throughout the MC903 exposure. MC903 is placed first, the ethanol was allowed to evaporate for 2 to 5 minutes prior to placement of bacterial isolates. Ear thickness is measured on day 14. Half the mice are subject to co-inoculation of S. aureus, 1×E6 CFU of the SAAS9 strain of S. aureus which is dripped onto the ear immediately prior to inoculation with the gram negative isolate. Treatment studies are performed by exposing mice to MC903 daily for 14 days and inoculating with 1×E7 CFU total of strains provided in “Agent 1” (see Table 2) on days 13 to 15. Agents 2 and 3 are also administered on days 13 to 15. Ear thickness is measured and photos taken on day 21. Serum total IgE analysis: Serum is collected on day 14 of MC903. Serum is collected on day 14 of MC903 treatment and total IgE is determined. Bacterial strains are donor derived, where the donor subject is a human donor not having atopic dermatitis.
TABLE-US-00002 TABLE 2 Combination therapies. Route for Route for Route for Condition Agent 1 Agent 1 Agent 2 Agent 2 Agent 3 Agent 3 1 Roseomonas mucosa Topical None None 2 None Cyclosporine Topical None 3 None None Desonide Topical 4 None Cyclosporine Oral Desonide Topical 5 Roseomonas mucosa Topical Cyclosporine Oral None 6 Roseomonas mucosa Topical Cyclosporine Oral Desonide Topical 7 Roseomonas mucosa Topical None Desonide Topical 8 Pseudomonas Topical aeruginosa 9 Pseudomonas Topical Cyclosporine Oral None aeruginosa 10 Pseudomonas Topical Cyclosporine Oral Desonide Topical aeruginosa 11 Pseudomonas Topical None Desonide Topical aeruginosa 12 Roseomonas mucosa Topical None None and Pseudomonas aeruginosa 13 Roseomonas mucosa Topical Cyclosporine Oral None and Pseudomonas aeruginosa 14 Roseomonas mucosa Topical Cyclosporine Oral Desonide Topical and Pseudomonas aeruginosa 15 Roseomonas mucosa Topical None Desonide Topical and Pseudomonas aeruginosa 16 Staphylococcus Topical None None epidermis 17 Staphylococcus Topical Cyclosporine Oral None epidermis 18 Staphylococcus Topical Cyclosporine Oral Desonide Topical epidermis 19 Staphylococcus Topical None Desonide Topical epidermis 20 Staphylococcus Topical None None epidermis Roseomonas mucosa 21 Staphylococcus Topical Cyclosporine Oral None epidermis Roseomonas mucosa 22 Staphylococcus Topical Cyclosporine Oral Desonide Topical epidermis Roseomonas mucosa 23 Staphylococcus Topical None Desonide Topical epidermis Roseomonas mucosa 24 Staphylococcus hominis Topical None None 25 Staphylococcus hominis Topical Cyclosporine Oral None 26 Staphylococcus hominis Topical Cyclosporine Oral Desonide Topical 27 Staphylococcus hominis Topical None Desonide Topical 28 Staphylococcus hominis Topical None None Roseomonas mucosa 29 Staphylococcus hominis Topical Cyclosporine Oral None Roseomonas mucosa 30 Staphylococcus hominis Topical Cyclosporine Oral Desonide Topical Roseomonas mucosa 31 Staphylococcus hominis Topical None Desonide Topical Roseomonas mucosa 32 Staphylococcus cohnii Topical None None 33 Staphylococcus cohnii Topical Cyclosporine Oral None 34 Staphylococcus cohnii Topical Cyclosporine Oral Desonide Topical 35 Staphylococcus cohnii Topical None Desonide Topical 36 Staphylococcus cohnii Topical None None Roseomonas mucosa 37 Staphylococcus cohnii Topical Cyclosporine Oral None Roseomonas mucosa 38 Staphylococcus cohnii Topical Cyclosporine Oral Desonide Topical Roseomonas mucosa 39 Staphylococcus cohnii Topical None Desonide Topical Roseomonas mucosa
Example 4: Culturing Gram Negative Bacteria from Healthy Donors to Assess S. aureus Growth Inhibition
[0086] Overgrowth and infection with S. aureus is both a contributor to, and consequence of the immune imbalance and poor barrier function characteristic of atopic dermatitis. Multiple isolates of S. aureus are grown in the presence of the supernatant from cultures of healthy volunteer (HV)-derived bacteria or bacteria derived from a skin lesion of a subject having atopic dermatitis, eczema, allergic eczema, flexural eczema, infantile eczema, nummular eczema, discoid lupus, prurigo Besnier, psoriasis, vitiligo, dermatitis, atopic dermatitis, perioral dermatitis, neurodermatitis, seborrheic dermatitis, rosacea, or acne. S. aureus growth are assessed.
[0087] Co-inoculation of the cultured HV-derived bacteria or bacteria derived from a subject having a disease associated with skin dysbiosis with S. aureus are contacted to mouse ears and S. aureus yields are recorded. Lipid metabolite level for Lysophosphatidylcholine (LPC) is also assessed. HV-derived bacteria referenced in Table 3 are assessed.
TABLE-US-00003 TABLE 3 Conditions. Condition Agents 1 Saline 2 Roseomonas mucosa 3 Pseudomonas aeruginosa 4 Staphylococcus epidermis 5 Staphylococcus hominis 6 Staphylococcus cohnii 7 Propionibacterium acnes 8 Moraxella osloensis 9 Roseomonas mucosa, Pseudomonas aeruginosa 10 Roseomonas mucosa, Staphylococcus epidermis 11 Roseomonas mucosa, Staphylococcus hominis 12 Roseomonas mucosa, Staphylococcus cohnii 13 Roseomonas mucosa, Propionibacterium acnes 14 Roseomonas mucosa, Moraxella osloensis 15 Pseudomonas aeruginosa, Staphylococcus epidermis 16 Pseudomonas aeruginosa, Staphylococcus hominis 17 Pseudomonas aeruginosa, Staphylococcus cohnii 18 Pseudomonas aeruginosa, Propionibacterium acnes 19 Pseudomonas aeruginosa, Moraxella osloensis 20 Moraxella osloensis, Staphylococcus epidermis 21 Moraxella osloensis, Staphylococcus hominis 22 Moraxella osloensis, Staphylococcus cohnii 23 Moraxella osloensis, Propionibacterium acnes
Example 5: Culturing Gram Negative Bacteria from Healthy Donors to Induce Innate Immunity in Humans
[0088] To measure in vivo human cutaneous immune reactivity to bacteria described herein, human foreskin-derived primary keratinocytes (KC) are infected with isolates of live healthy volunteer-derived bacteria or bacteria derived from a skin lesion of a subject having atopic dermatitis, eczema, allergic eczema, flexural eczema, infantile eczema, nummular eczema, discoid lupus, prurigo Besnier, psoriasis, vitiligo, dermatitis, atopic dermatitis, perioral dermatitis, neurodermatitis, seborrheic dermatitis, rosacea, or acne. 20-24 hours after infection, KCs exposed to HV-bacteria are screened for a relative increase compared to those exposed to bacteria derived from the subject having the disease associated with skin dysbiosis for increase in mRNA levels for defensin β4A, CYP27b1 (a vitamin D converting enzyme), the vitamin D receptor (VDR), and the anti-microbial peptide cathelicidin. HV-derived bacteria referenced in Table 3 are assessed.
Example 6: Culturing Gram Negative Bacteria from Healthy Donors to Assess Barrier Function in Mice
[0089] The loss of barrier function in AD causes dry, itchy skin due to trans-epidermal water loss (TEWL) and cutaneous sensitization to antigens. For a subset of subjects, this barrier defect is associated with dysfunction in the tight junction protein filaggrin. Isolates of live HV-derived bacteria or bacteria derived from a skin lesion of a subject having atopic dermatitis are topically applied to healthy mouse ears, which are subsequently assessed for enhanced transcript levels of filaggrin, ear thickness change, and TWEL. HV-derived bacteria referenced in Table 3 are assessed.
Example 7: Culturing Gram Negative Bacteria from Healthy Donors to Assess Outcomes in a Mouse Model of Atopic Dermatitis
[0090] MC903, a vitamin D analogue, induces an AD-like dermatitis when applied to mouse ears. Isolates of live HV-derived bacteria or bacteria derived from a subject having atopic dermatitis are topically applied to healthy mouse ears prior to administration of MC903. Ear thickness, serum IgE induction, mRNA levels (for filaggrin, defensin β4A, CYP27b1, VDR, and cathelicidin), are compared before and after MC903 administration. HV-derived bacteria referenced in Table 3 are assessed.
Example 8: Generation and Characterization of a Pharmaceutical Formulation of R. Mucosa from Healthy Volunteers
[0091] Three isolates of R. mucosa from 3 human healthy volunteers (HVs) are grown in minimal media (R2A broth, Teknova; or Hanks Buffered Salt Solution, HBSS, Gibco) for 24-48 hours. Isolates are selected based on their ability to inhibit the growth of S. aureus, activate vitamin D pathways in human keratinocytes, and improve outcomes in mouse models of AD. The isolates are referenced as RM-A, RM-B, and RM-C. Genomic sequencing is performed on all strains to verify that no transmittable, clinically significant antibiotic resistance genes were present. The bacterial cells are washed 3 times in PBS (Gibco) and resuspended into 10%-15% sucrose in water for a concentration of 10.sup.9 CFU/ml. Serial dilutions are performed in 10%-15% sucrose to generate stocks of 10.sup.4, 10.sup.5, and 10.sup.6 CFU/ml. Aliquots of diluted bacterial samples are plated on R2A agar (Remel) and incubated at 32° C. for 48-72 hours to enumerate prelyophilization CFU concentration. Eight hundred microliters (adult) or 1.5 ml (pediatric) of bacterial solution is frozen in 1.5-ml amber glass vials (Wheaton; adult) or a 3-ml self-contained sprayer system (Discount Vials; pediatrics) prior to lyophilization (Labconco). Vials/sprayers are sealed, labeled, and stored at −70° C. until dispensed to the patients.
[0092] Genomes from the three isolates of R. mucosa have regions of sequence specific to each of the three isolates, as show in in Table 4 (bases specific to each strain are in bold and underlined).
TABLE-US-00004 TABLE 4 SEQ ID Strain Nucleic Acid NO: RM-A CGGCGGCGGACAGCCCCTCCACCCCATCCTCGCCGAG 1 CCCGATGATGCTAA RM-B CGGCGGCGGACAGCCCCTCCACTCCACCTCGCCGAGC 2 CCGATGATGCTAA RM-C CGGCGGCGGACAGCCCCTCCACCCCGTCCTCGCCGAG 3 CCCGATGATGCTAA
[0093] Primers designed to amplify the region where strain specific variation is identified. A Custom TaqMan® SNP Genotyping Assays, Non-human, SM kit and protocol is used to perform an analysis for detection of each strain. Briefly, DNA from each isolate is subjected to PCR where the primers were SEQ ID NO: 4 (CACCGGACAGCAGGCT), and SEQ ID NO: 5 (GCGGTGGCTTAGCATCATC). Amplification products are subjected to an allelic discrimination assay. In a first comparison, the following reporters are used: SEQ ID NO: 6 (CACCCCATCCTCG) and SEQ ID NO: 7 (CACCCCGTCCTCG). This is an A/G allelic discrimination assay. In a second comparison, the following reporters are used: SEQ ID NO: 8 (CCCTCCACCCCATCCT) and SEQ ID NO: 9 (CCCTCCACTCCATCCT). This is a T/C allelic discrimination assay.
Example 9: MC903-Induced Atopic Dermatitis Model in Mice
[0094] Balb/c male mice are subject to a model for induction of atopic dermatitis. MC903 is dissolved in 100% ethanol and topically applied on mouse ears (2 and 4 nmol in 25 μl per ear) for 14 days. A control group is treated with ethanol only. Gradual induction of lesions in the ear in mice is monitored by scoring for ear thickness, appearance of scars and redness. Every other day in-life observations are done from Day 5 to Day 15, and ears are collected on Day 15 for histo-pathological evaluation of the disease. The route of administration is oral gavage, twice daily. Subjects are divided as summarized below in Table 5.
TABLE-US-00005 TABLE 5 Dose Population Group (mg/kg) N 1. Control Naive (optional) 0 10 2. Vehicle 0 10 3. MC903, Dose 1 2 nmol 10 4. MC903, Dose 2 4 nmol 10 5. MC903, Dose 1 + 62.5 mg/day 10 Positive control (Clobetasol cream, 0.05%) 6. Positive control 62.5 mg/day 10 (Clobetasol cream, 0.05%)
[0095] The acclimation period before start of treatment is at least five days. Body weight is measured before start of model induction and then before each dosing. Baseline thickness of the ear is taken by digital caliper and animals are randomized into different treatment groups. From Day 5 to Day 15, assessment of ear thickness, erythema score and skin scaling score are done. On Day 15, the right ear is collected from all animals, and fixed in 10% NBF for histopathological assessment. The left ear is collected and snap frozen for future gene or cytokine analysis. Spleen and lymph nodes are also collected. Terminal serum is collected and kept for potential IgE antibody analysis. H&E staining of right ears (one slide/animal) is performed, histological evaluation of Epidermal thickness is performed using the Image-Pro system. Subjects are dosed with single and combination therapies as described in Example 3, Table 2.
Example 10: Imiquimod (IMQ)-Induced Psoriasis Model in Mice
[0096] Balb-c male mice are subject to a model for psoriasis. Animals receive 62.5 mg of 5% IMQ cream topically on the back skin (alternatively this is performed using ears) once daily from Day 1 to Day 11. IMQ causes gradual induction of psoriasis-like lesions in the skin in mice as evidenced by increase in thickness, appearance of scars and redness. Daily in-life observations are done from Day 2 to Day 12, and back skin is collected on Day 12 for possible histopathological evaluation of the disease. Dosing regimen is to start 3 days prior to first IMQ application on Day −3. Administration is daily by topical administration. Subjects are divided zed below in Table 6.
TABLE-US-00006 TABLE 6 Dose Population Group (mg/kg) N Test System: 1. Control Naive (optional) 0 10 2. IMQ + Vehicle 0 10 3. IMQ + TI, 1 Low dose 10 4. IMQ + TI, 2 Increased dose 10 5. IMQ + Positive control 62.5 mg/day 10 (Clobetasol cream, 0.05%)
[0097] Subjects are given an acclimation period of at least 5 days before initiation of treatment. Body weight is measured once before start of IMQ application and then before each dosing. On Day 0, baseline thickness of the back skin is taken by a digital caliper and animals are randomized into different treatment groups. From Day 2 to Day 12, daily assessment of back skin thickness, skin erythema score and skin scaling score are done. Skin samples collected from all animals at termination and analysis for IL13, TNFa, MIP-1a, G-CSF and IL-17 (5plex) using a Bio-Rad kit. Terminal Procedures: On Day 12, back skin is collected from all animals, and fixed in 10% NBF for histopathological assessment. If required, skin samples are snap frozen for cytokine analysis. Terminal blood plasma/serum is collected. H&E staining of back skin and/or ear sections is performed (one slide/animal). Epidermal thickness, Parakeratosis, Acanthosis and Inflammatory infiltrate scorings, and a Composite score are performed. Subjects are dosed with single and combination therapies as described in Example 3, Table 2.
[0098] While preferred embodiments of the present invention have been shown and described herein, it will be obvious to those skilled in the art that such embodiments are provided by way of example only. Numerous variations, changes, and substitutions will now occur to those skilled in the art without departing from the invention. It should be understood that various alternatives to the embodiments of the invention described herein may be employed in practicing the invention. It is intended that the following claims define the scope of the invention and that methods and structures within the scope of these claims and their equivalents be covered thereby.