Time lapse sequencing: a convertible-nucleoside approach to enrichment-free analysis of RNA dynamics
11098342 · 2021-08-24
Assignee
Inventors
Cpc classification
C12Q2525/101
CHEMISTRY; METALLURGY
C12Q1/6806
CHEMISTRY; METALLURGY
C12Q2525/101
CHEMISTRY; METALLURGY
C12Q1/6806
CHEMISTRY; METALLURGY
International classification
Abstract
The invention provides methods and compositions for generating mutations in new nucleic acid molecules through incorporation of a transformable nucleoside into the nucleic acid and subsequent transformation of the nucleoside through oxidative-nucleophilic-aromatic-substitution chemistry, referred to as TimeLapse chemistry. The invention further provides methods for detecting the mutations, referred to as TimeLapse-seq.
Claims
1. A method for identifying newly synthesized nucleic acid molecules comprising: a) contacting a cell with a modified base, wherein the modified base is incorporated into at least one newly generated nucleic acid molecule; b) isolating the nucleic acid molecules from the cell; c) contacting the isolated nucleic acid molecules with an oxidant and a nucleophile, wherein the nucleophile is selected from the group consisting of 2,2,2-trifluoroethylamine (TFEA), benzylamine (C.sub.6H.sub.5CH.sub.2NH.sub.2), aniline (C.sub.6H.sub.5NH.sub.2), 1,1-dimethylethylenediamine ((CH.sub.3).sub.2NCH.sub.2CH.sub.2NH.sub.2), ethanolamine (C.sub.2H.sub.7NO) and 4-(Triflouromethyl)benzylamine (CF.sub.3C.sub.6H.sub.4CH.sub.2NH.sub.2), and further wherein the modified base is converted to an analog of a different base; d) detecting the presence of the analog of a different base or a. mutation that is the result of amplification thereof; and e) identifying a nucleic acid molecule comprising the analog of a different base as being a newly generated nucleic acid molecule.
2. The method of claim 1, wherein the oxidant is selected from the group consisting of hydrogen peroxide (H.sub.2O.sub.2), sodium iodate (NaIO.sub.3), potassium permagnate (KMnO.sub.4), sodium periodate (NaIO.sub.4), and meta-Chloroperoxybenzoic acid (mCPBA).
3. The method of claim 1, wherein the oxidant is NaIO.sub.4 and the nucleophile is TFEA.
4. The method of claim 1, wherein the nucleic acid molecule is selected from the group consisting of: a ribonucleic acid molecule and a deoxyribonucleic acid molecule.
5. The method of claim 1, wherein the modified base is selected from the group consisting of 4-thiouridine (s.sup.4U), 6-thioguanine (s.sup.6G), 6-thiodeoxyguanosine (s.sup.6dG) and 4-thiothymine (s.sup.4T).
6. The method of claim 1, wherein the mutation is selected from the group consisting of: a U to C mutation and a G to A mutation.
7. The method of claim 1, wherein the modified base is selected from the group consisting of s.sup.4T and s.sup.4U and the modified base is converted into an analog of cytidine.
8. The method of claim 1, wherein the modified base is selected from the group consisting of s.sup.6G and s.sup.6dG, and wherein the modified base is converted into an analog of adenine.
9. The method of claim 1, wherein the step of detecting comprises sequencing the nucleic acid molecules.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1) For the purpose of illustrating the invention, there are depicted in the drawings certain embodiments of the invention. However, the invention is not limited to the precise arrangements and instrumentalities of the embodiments depicted in the drawings.
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
(22)
(23)
(24)
(25)
(26)
(27)
(28)
(29)
(30)
DETAILED DESCRIPTION OF THE INVENTION
(31) The invention described herein arises from the development of a nucleic acid-friendly oxidative-nucleophilic-aromatic-substitution chemistry (TimeLapse chemistry) to convert a thiol-containing nucleoside (e.g., s.sup.4U, s.sup.6G, s.sup.6dG or s.sup.4T) into an analog of a different base. Nucleic-acid friendly conditions have a near neutral pH to avoid base-catalyzed hydrolysis of the labile phosphodiester linkages, and conditions that will not destroy other functionality on the RNA such as oxidative damage to the nucleobases themselves. The substitution leads to apparent U-to-C, T-to-C, or G-to-A mutations that mark newly synthesized (nascent) nucleic acid molecules upon sequencing. The substitution leads to progressively higher levels of the mark over time, providing information about when the nucleic acid was synthesized. In various embodiments, the invention provides methods for performing TimeLapse-seq to reveal nucleotide dynamics, regulation, and turnover of nucleic acid molecules that are concealed in traditional sequencing methods.
(32) In some embodiments, the methods of the invention are useful for identifying when nucleic acid molecules were synthesized including, but not limited to, newly synthesized DNA molecules, including nuclear and mitochondrial (mtDNA) molecules, and newly synthesized RNA molecules, including mRNA, rRNA, noncodingRNA (ncRNA), large ncRNA (lncRNA), small nuclear RNA (snRNA), small cytoplasmic RNA (scRNA), small nucleolar RNA (snoRNA), small interfering RNA (siRNA) and microRNA (miRNA) molecules.
(33) In various embodiments, the nucleic acid molecule for use in the invention can be in a cell or isolated from a cell. In various embodiments, a cell can be in a cell culture, in a live tissue slice, or in a primary cell culture derived from a primary cell of a subject. In some embodiments, the nucleic acid molecule is from a normal cell or from a disease cell. In some embodiments, the nucleic acid molecule is from a cell undergoing a treatment.
(34) In one embodiment, the invention provides methods for introducing one or more mutations into newly synthesized nucleic acid molecules in a cell or a population of cells. In one embodiment, the methods comprise contacting a cell with a thiol-containing nucleoside, isolating at least one nucleic acid molecule, and converting the thiol-containing nucleoside into an analog of a different base in at least one cell in order to generate a mutation. In one embodiment, the conversion of the thiol-containing nucleoside into an analog of a different base is performed by contacting the at least one nucleic acid molecule with an oxidant and a nucleophile. The method of converting a thiol-containing nucleoside in a nucleic acid molecule into an analog of a different base by contacting the nucleic acid molecule with an oxidant and a nucleophile is referred to herein as TimeLapse chemistry.
(35) In some embodiments, the invention relates to methods of sequencing an isolated nucleic acid. The methods of sequencing an isolated nucleic acid comprising a base analog generated using TimeLapse chemistry as described herein is referred to herein as TimeLapse-seq. In the TimeLapse-seq methodology, a mutated nucleic acid molecule is generated, with at least one U-to-C, T-to-C, or G-to-A mutation. Subsequent sequencing and analysis using a mutational mapping strategy can be used to determine which nucleic acid molecules that were synthesized after the introduction of a thiol-containing nucleoside (i.e., contain at least one U-to-C, T-to-C, or G-to-A mutation due to the conversion of a thiol-containing nucleoside to an analog of a different base using TimeLapse chemistry) and those that were synthesized before the introduction of the a thiol-containing nucleoside (i.e., do not contain at least one U-to-C, T-to-C, or G-to-A mutation due to the conversion of a thiol-containing nucleoside to an analog of a different base using TimeLapse chemistry).
(36) In some embodiments, the methods of the invention are useful for identifying nucleic acid molecules that were actively transcribed during the time period that a cell is contacted with a thiol-containing nucleoside. In one embodiment, a nucleic acid molecule that is being actively transcribed is one that is upregulated or is accumulating. These nucleic acid molecules may be identified as molecules that have incorporated a thiol-containing nucleoside or have acquired a mutation due to the conversion of a thiol-containing nucleoside.
(37) In some embodiments, the methods of the invention are useful for identifying nucleic acid molecules that were not being actively transcribed during the time period that a cell is contacted with a thiol-containing nucleoside. In one embodiment, a nucleic acid molecule that is not being actively transcribed is one that is downregulated or is not accumulating. These nucleic acid molecules may be identified as molecules that did not incorporated a thiol-containing nucleoside or did not acquired a mutation due to the conversion of a thiol-containing nucleoside.
(38) In one embodiment, the methods of the invention are useful for characterizing nucleic acid dynamics, for example through characterizing newly synthesized nucleic acid molecules at one or more time points and/or under one or more treatment conditions. In one embodiment, the one or more time points may be one or more time points during the cell cycle of a population of cells, such as synchronized cell population. In one embodiment, the one or more time points may be before and after a treatment with, by way of non-limiting examples, a pharmaceutical agent, a treatment that alters the level or expression of a gene or gene product (e.g., a gene therapy, a microRNA replacement therapy, an anti-microRNA therapy, an siRNA therapy, treatment with a protein, treatment with a peptide, treatment with an antibody), or a treatment that alters a condition of a cell (e.g., alteration in temperature, oxygen level, desiccation). Such methods are useful for, by way of a non-limiting example, evaluating changes in DNA or RNA expression as a result of a treatment.
(39) In one embodiment, the methods of the invention are useful for characterizing nucleic acid dynamics associated with a cell type, with a cell stage, or with a disease or disorder. Such methods are useful for, by way of non-limiting example, evaluating DNA or RNA expression or dynamics associated with a particular cell type, cell stage, or disease or disorder.
(40) Definitions
(41) As used herein, each of the following terms has the meaning associated with it in this section.
(42) The articles “a” and “an” are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, “an element” means one element or more than one element.
(43) “Amplification” refers to any means by which a polynucleotide sequence is copied and thus expanded into a larger number of polynucleotide molecules, e.g., by reverse transcription, polymerase chain reaction, and ligase chain reaction, among other methods.
(44) “Antisense” refers to the nucleic acid sequence of the non-coding strand of a double stranded DNA molecule encoding a protein, or to a sequence which is substantially homologous to the non-coding strand. As defined herein, an antisense sequence is complementary to the sequence of a double stranded DNA molecule encoding a protein. It is not necessary that the antisense sequence be complementary solely to the coding portion of the coding strand of the DNA molecule. The antisense sequence may be complementary to regulatory sequences specified on the coding strand of a DNA molecule encoding a protein, which regulatory sequences control expression of the coding sequences.
(45) Herein, the term “barcode” refers to a sequence that can or will be used to group nucleic acid molecules. The present invention provides for attaching a barcode sequence to a nucleic acid of interest, such as a naturally occurring or a synthetically derived nucleic acids. For example, sequences that undergo randomly primed synthesis in the proximity of a particular surface can or will be physically attached to the sequence of a barcode or to the sequences of a barcode set, as defined below.
(46) The term “barcode set” refers to one or more barcodes that contain sequence features that distinguish them as distinct from other barcode sets. A barcode set can contain unrelated sequences, or sequences that are in some manner related, such as sequences in which there are errors or intentional differences introduced during their synthesis. As a non-limiting example, each barcode in a barcode set can have a sequence such as XRRXXX, in which X indicates a defined nucleotide, such as guanine (G), adenine (A), thymine (T), cytosine (C), uracil (U), and inosine (I), or other nucleotide, and R indicates any purine nucleotide. These nucleotides will be referred to by their single letter codes, G, A, T, C, U, and I, throughout.
(47) “Binding” is used herein to mean that a first moiety interacts with a second moiety.
(48) “Biological sample,” as that term is used herein, means a sample obtained from a single-cellular or multi-cellular organism that can be used to assess the level of expression of a nucleic acid according to the method of the invention. Such a sample includes, but is not limited to, a cell, a blood sample, or a tissue sample.
(49) “Complementary” as used herein refers to the broad concept of subunit sequence complementarity between two nucleic acids, e.g., two DNA molecules. When a nucleotide position in both of the molecules is occupied by nucleotides normally capable of base pairing with each other, then the nucleic acids are considered to be complementary to each other at this position. Thus, two nucleic acids are complementary to each other when a substantial number (at least 50%) of corresponding positions in each of the molecules are occupied by nucleotides which normally base pair with each other (e.g., A:T and G:C nucleotide pairs). As defined herein, an antisense sequence is complementary to the sequence of a double stranded DNA molecule encoding a protein. It is not necessary that the antisense sequence be complementary solely to the coding portion of the coding strand of the DNA molecule. The antisense sequence may be complementary to regulatory sequences specified on the coding strand of a DNA molecule encoding a protein, which regulatory sequences control expression of the coding sequences.
(50) A “coding region” of a gene consists of the nucleotide residues of the coding strand of the gene and the nucleotides of the non-coding strand of the gene which are homologous with or complementary to, respectively, the coding region of an mRNA molecule which is produced by transcription of the gene.
(51) A “coding region” of an mRNA molecule also consists of the nucleotide residues of the mRNA molecule which are matched with an anticodon region of a transfer RNA molecule during translation of the mRNA molecule or which encode a stop codon. The coding region may thus include nucleotide residues corresponding to amino acid residues which are not present in the mature protein encoded by the mRNA molecule (e.g., amino acid residues in a protein export signal sequence).
(52) The term “contig” has general meaning in the art, and refers to contiguous partial sequences that can or may be assembled into a single sequence. Assembly is typically done by aligning sequences to each other or to a reference sequence, or a combination of both.
(53) “Denaturing” or “denaturation of” a complex comprising two polynucleotides (such as a first primer extension product and a second primer extension product) refers to dissociation of two hybridized polynucleotide sequences in the complex. The dissociation may involve a portion or the whole of each polynucleotide. Thus, denaturing or denaturation of a complex comprising two polynucleotides can result in complete dissociation (thus generating two single stranded polynucleotides), or partial dissociation (thus generating a mixture of single stranded and hybridized portions in a previously double stranded region of the complex).
(54) A “disease” is a state of health of an animal wherein the animal cannot maintain homeostasis, and wherein if the disease is not ameliorated, then the animal's health continues to deteriorate. In contrast, a “disorder” in an animal is a state of health in which the animal is able to maintain homeostasis, but in which the animal's state of health is less favorable than it would be in the absence of the disorder. Left untreated, a disorder does not necessarily cause a further decrease in the animal's state of health.
(55) A “genomic DNA” is a DNA strand which has a nucleotide sequence homologous with a gene as it exists in the natural host. By way of example, a fragment of a chromosome is a genomic DNA.
(56) The term “isoform,” when applied to RNA, refers to RNA molecules that share some portion but not all of their sequence, and derive from the same gene. For RNA, the sequences can differ due to alternative promoter usage or post-transcriptional processing, such as splicing and polyadenylation. With respect to RNA, differences due to mutations are also included. When applied to DNA, isoform refers to two or more DNA regions that substantially map to the same one or more chromosome region, and that share some portion but not all of their sequence. With respect to DNA, also included are differences due to mutations. Of particular but non-exclusive interest with respect to DNA isoforms are chromosomal rearrangements.
(57) An “isolated cell” refers to a cell which has been separated from other components and/or cells which naturally accompany the isolated cell in a tissue or organism.
(58) An “isolated nucleic acid” refers to a nucleic acid (or a segment or fragment thereof) which has been separated from sequences which flank it in a naturally occurring state, e.g., a RNA fragment which has been removed from the sequences which are normally adjacent to the fragment. The term also applies to nucleic acids which have been substantially purified from other components which naturally accompany the nucleic acid, e.g., RNA or DNA or proteins, which naturally accompany it in the cell. The term therefore includes, for example, purified genomic or transcriptomic cellular content
(59) In the context of the present invention, the following abbreviations for the commonly occurring nucleic acid bases are used. “A” refers to adenosine, “C” refers to cytidine, “G” refers to guanosine, “T” refers to thymidine, and “U” refers to uridine.
(60) Sequence “mutation,” as used herein, refers to any sequence alteration in a sequence of interest in comparison to a reference sequence. A reference sequence can be a wild type sequence or a sequence to which one wishes to compare a sequence of interest. A sequence mutation includes single nucleotide changes, or alterations of more than one nucleotide in a sequence, due to mechanisms such as substitution, deletion or insertion. Single nucleotide polymorphism (SNP) is also a sequence mutation as used herein.
(61) “Newly synthesized” or “nascent” nucleic acid molecules, as used herein, refers to those nucleic acid molecules that have been synthesized after a specific event or time point, as compared to nucleic acid molecules synthesized prior to a specific event or time point. In the context of the current invention, nascent nucleic acid molecules are those molecules synthesized after addition of a thiol-containing nucleoside which incorporate at least one thiol-containing nucleoside into the nucleic acid molecule.
(62) “Nucleic acid analogs” are structurally modified, polymeric analogs of DNA and RNA made by chemical synthesis from monomeric nucleotide analog units, and possessing some of the qualities and properties associated with nucleic acids. PNA and phosphorothioate oligonucleotides are examples of two of many nucleic acid analogs known in the art. “Watson/Crick base-pairing” and “Watson/Crick complementarity” refer to the pattern of specific pairs of nucleotides, and analogs thereof, that bind together through hydrogen bonds, e.g., A pairs with T and U, and G pairs with C. The act of specific base-pairing is “hybridization” or “hybridizing.” A hybrid forms when two, or more, complementary strands of nucleic acids or nucleic acid analogs undergo base-pairing.
(63) The term “oligonucleotide” typically refers to short polynucleotides, generally no greater than about 50 nucleotides. It will be understood that when a nucleotide sequence is represented by a DNA sequence (i.e., A, T, G, C), this also includes an RNA sequence (i.e., A, U, G, C) in which “U” replaces “T.”
(64) A “polynucleotide” means a single strand or parallel and anti-parallel strands of a nucleic acid. Thus, a polynucleotide may be either a single-stranded or a double-stranded nucleic acid. The term “nucleic acid” typically refers to large polynucleotides.
(65) A “primer” is generally a nucleotide sequence (i.e., a polynucleotide), generally with a free 3′-OH group, that hybridizes with a template sequence (such as a target RNA, or a primer extension product) and is capable of promoting polymerization of a polynucleotide complementary to the template. A “primer” can be, for example, an oligonucleotide. It can also be, for example, a sequence of the template (such as a primer extension product or a fragment of the template created following RNase cleavage of a template-DNA complex) that is hybridized to a sequence in the template itself (for example, as a hairpin loop), and that is capable of promoting nucleotide polymerization.
(66) A “random primer,” as used herein, is a primer that comprises a sequence that is designed not necessarily based on a particular or specific sequence in a sample, but rather is based on a statistical expectation (or an empirical observation) that the sequence of the random primer is hybridizable (under a given set of conditions) to one or more sequences in the sample. The sequence of a random primer (or its complement) may or may not be naturally-occurring, or may or may not be present in a pool of sequences in a sample of interest. The amplification of a plurality of RNA species in a single reaction mixture would generally, but not necessarily, employ a multiplicity of random primers. As is well understood in the art, a “random primer” can also refer to a primer that is a member of a population of primers (a plurality of random primers) which collectively are designed to hybridize to a desired and/or a significant number of target sequences. A random primer may hybridize at a plurality of sites on a nucleic acid sequence. The use of random primers provides a method for generating primer extension products complementary to a target polynucleotide which does not require prior knowledge of the exact sequence of the target. Conventional notation is used herein to describe polynucleotide sequences: the left-hand end of a single-stranded polynucleotide sequence is the 5′-end; the left-hand direction of a double-stranded polynucleotide sequence is referred to as the 5′-direction. The direction of 5′ to 3′ addition of nucleotides to nascent RNA transcripts is referred to as the transcription direction. The DNA strand having the same sequence as an mRNA is referred to as the “coding strand”; sequences on the DNA strand which are located 5′ to a reference point on the DNA are referred to as “upstream sequences”; sequences on the DNA strand which are 3′ to a reference point on the DNA are referred to as “downstream sequences.”
(67) “Probe” refers to a polynucleotide that is capable of specifically hybridizing to a designated sequence of another polynucleotide. A probe specifically hybridizes to a target complementary polynucleotide, but need not reflect the exact complementary sequence of the template. In such a case, specific hybridization of the probe to the target depends on the stringency of the hybridization conditions. Probes can be labeled with, e.g., chromogenic, radioactive, or fluorescent moieties and used as detectable moieties.
(68) “Homologous,” as used herein, refers to the subunit sequence similarity between two polymeric molecules, e.g., between two nucleic acid molecules, e.g., two DNA molecules or two RNA molecules, or between two polypeptide molecules. When a subunit position in both of the two molecules is occupied by the same monomeric subunit, e.g., if a position in each of two DNA molecules is occupied by adenine, then they are completely or 100% homologous at that position. The percent homology between two sequences is a direct function of the number of matching or homologous positions, e.g., if half (e.g., five positions in a polymer ten subunits in length) of the positions in two compound sequences are homologous then the two sequences are 50% identical, if 90% of the positions, e.g., 9 of 10, are matched or homologous, the two sequences share 90% homology.
(69) In addition, when the terms “homology” or “identity” are used herein to refer to the nucleic acids and proteins, it should be construed to be applied to homology or identity at both the nucleic acid and the amino acid sequence levels.
(70) A “sequence read” corresponds to a determination of the nucleotides in a target nucleic acid molecule in the order in which they occur and can or will include only a part of the target molecule, and can or will exclude other parts of the target molecule. The sequencing read in this context does not necessarily correspond to a fixed length. Current sequencing methods can produce reads of various lengths. Some sequencing methods, including but not limited to those that use physical separation of molecules of different sizes, can or will produce sequence reads ranging from one nucleotide to more than a thousand nucleotides. Alternatively, some sequencing methods produce shorter reads consisting of 1 to 50 nucleotides, 1 to 100 nucleotides, 1 to 200 nucleotides and longer, and the possible lengths may increase as technology improves.
(71) The term “sequence” refers to the sequential order of nucleotides in a nucleic acid molecule, or, depending on context, refers to a molecule or part of a molecule in which a particular sequential order of nucleotides exists.
(72) Ranges: throughout this disclosure, various aspects of the invention can be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range and, when appropriate, partial integers of the numerical values within ranges. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 2.7, 3, 4, 5, 5.3, and 6. This applies regardless of the breadth of the range. It is understood that any and all whole or partial integers between any ranges set forth herein are included herein.
(73) Description
(74) In one embodiment, the present invention is a method of generating mutations in nucleic acid molecules. The method comprises the steps of contacting a cell with a thiol-containing nucleoside so that at least one thiol-containing nucleoside is incorporated into a nucleic acid molecule, isolating the nucleic acid molecules, treating the isolated nucleic acid molecules with an oxidant and a nucleophile to convert a thiol-containing nucleoside to a convertible nucleoside intermediate and further convert the convertible nucleoside intermediate into an analog of a different base (i.e., an analog of a base that is not the same as the base of the thiol-containing nucleoside or nucleobase).
(75) In one embodiment, the present invention is a method of identifying newly synthesized (or nascent) nucleic acid molecules by inducing at least one mutation in a nucleic acid sequence and then determining the presence and/or location of the at least one mutation. The method comprises the steps of contacting a cell with a thiol-containing nucleoside so that at least one thiol-containing nucleoside is incorporated into a nucleic acid molecule, isolating the nucleic acid molecules, treating the isolated nucleic acid molecules with an oxidant and a nucleophile to convert a thiol-containing nucleoside or nucleobase to a convertible nucleoside intermediate and further convert the convertible nucleoside intermediate into an analog of a different base (i.e., an analog of a base that is not the same as the base of the thiol-containing nucleoside or nucleobase), amplifying the nucleic acid molecule comprising an analog of a different base thereby generating a mutation in the amplification product, and determining the presence or location of a mutation in the amplification product.
(76) In some embodiments, the methods of the invention are useful for identifying nucleic acid molecules that were being actively transcribed during the time period that a cell is contacted with a thiol-containing nucleoside.
(77) In one embodiment, the methods of the invention are useful in that they capture both nucleic acid molecules comprising a thiol-containing nucleoside and nucleic acid molecules that do not comprise a thiol-containing nucleoside. This allows the method of the invention to analyze those nucleic acid molecules that were being actively transcribed and those that were not. This method provides an advantage over pull-down methods that only capture actively transcribed nucleic acid molecules (e.g., BrdU based sequencing methods.) Therefore, in some embodiments, the methods of the invention are useful for identifying nucleic acid molecules that were not being actively transcribed (i.e. were silent) during the time period that a cell is contacted with a thiol-containing nucleoside.
(78) In some embodiments, the methods of the invention are useful for revealing the dynamics of newly synthesized nucleic acid molecules. In various embodiments, the dynamics include stability, synthesis and degradation of particular newly synthesized nucleic acid molecules within a diverse and changing population of nucleic acid molecules.
(79) In some embodiments, the methods of the invention are useful for identifying nucleic acid molecules that were upregulated (i.e., increases expression) during the time period that a cell is contacted with a thiol-containing nucleoside or nucleobase.
(80) In some embodiments, the methods of the invention are useful for identifying nucleic acid molecules that were downregulated (i.e., decreased expression) during the time period that a cell is contacted with a thiol-containing nucleoside.
(81) In various embodiments, the thiol-containing nucleoside or nucleobase used in the methods of the invention is at least one selected from the group consisting of 4-thiouridine (s.sup.4U), 6-thioguanine (s.sup.6G), 6-thiodeoxyguaosine (s.sup.6dG) and 4-thiothymidine (s.sup.4T). In one embodiment, a thiol nucleobase is added, and an enzyme expressed in the cell transforms the nucleobase into a nucleotide. For example, in one embodiment, a nucleobase is 4-thiouricil which is transformed into 4-thiouridine.
(82) In one embodiment, the selection of the thiol-containing nucleoside or nucleobase is dependent on whether DNA or RNA based nucleic acid molecules are being detected. In one embodiment, the invention is a method of identifying a newly transcribed RNA molecule. Therefore, in one embodiment, the thiol-containing nucleoside or nucleobase is one of 4-thiouricil, s.sup.4U, s.sup.6G and s.sup.6dG such that one of s.sup.4U, s.sup.6G and s.sup.6dG is incorporated into newly transcribed RNA molecules.
(83) In one embodiment, the invention is a method of identifying a newly replicated DNA molecule. Therefore, in one embodiment, the thiol-containing nucleoside or nucleobase is one of s.sup.4T, s.sup.6G and s.sup.6dG such that one of s.sup.4T, s.sup.6G and s.sup.6dG is incorporated into newly replicated DNA molecules.
(84) In one embodiment, a thiol-containing nucleoside or nucleobase is converted to a convertible nucleoside intermediate and further converted into an analog of a different base (i.e., an analog of a base that is not the same as the base of the thiol-containing nucleoside or nucleobase). In one embodiment, 4-thiouricil, s.sup.4U or s.sup.4T is converted into a cytidine analog. In one embodiment, s.sup.6G or s.sup.6dG is converted into an adenine analog.
(85) In various embodiments, the mutation generated in a newly synthesized nucleic acid molecule is dependent on the thiol-containing nucleoside or nucleobase used. In one embodiment, the thiol-containing nucleoside or nucleobase is 4-thiouricil or s.sup.4U and the mutation generated by the method of the invention is a U to C mutation. In one embodiment, the thiol-containing nucleoside or nucleobase is s.sup.4T and the mutation generated by the method of the invention is a T to C mutation. In one embodiment, the thiol-containing nucleoside or nucleobase is s.sup.6G or s.sup.6dG and the mutation generated by the method of the invention is a G to A mutation.
(86) In various embodiments, the oxidant used in the methods of the invention is at least one selected from the group consisting of hydrogen peroxide (H.sub.2O.sub.2), sodium iodate (NaIO.sub.3), potassium permagnate (KMnO.sub.4), sodium periodate (NaIO.sub.4), and meta-Chloroperoxybenzoic acid (mCPBA).
(87) In various embodiments, the nucleophile used in the methods of the invention is at least one selected from the group consisting of 2,2,2-trifluoroethylamine (TFEA), benzylamine (C.sub.6H.sub.5CH.sub.2NH.sub.2), O-methylhydroxylamine hydrochloride (MeONH.sub.2), aniline (C.sub.6H.sub.5NH.sub.2), hydrazine (H.sub.2NNH.sub.2), ammonia (NH.sub.3), 1,1-dimethylethylenediamine ((CH.sub.3).sub.2NCH.sub.2CH.sub.2NH.sub.2), methylamine (CH.sub.3NH.sub.2), propargylamine (HCCCH.sub.2NH.sub.2), allylamine (H.sub.2CCHCH.sub.2NH.sub.2), 2-azidoethylamine (N.sub.3CH.sub.2CH.sub.2NH.sub.2), cysteiamine disulfide ((HSCH.sub.2CH.sub.2S).sub.2) and 4-(Trifluoromethyl)benzylamine (CF.sub.3C.sub.6H.sub.4CH.sub.2NH.sub.2).
(88) In one embodiment, the oxidant is mCPBA and the nucleophile is at least one of TFEA, benzylamine, MeONH.sub.2, aniline, ammonia, and 4-(Trifluoromethyl)benzylamine. In one embodiment, the oxidant is sodium iodate and the nucleophile is MeONH.sub.2. In one embodiment, the oxidant is sodium periodate and the nucleophile is at least one of TFEA, benzylamine, and aniline. In one embodiment, the oxidant is hydrogen peroxide and the nucleophile is TFEA.
(89) Assays
(90) In various embodiments, the methods of the invention are useful to examine nucleic acid dynamics in any cell type. In one embodiment, a cell of use in the method of the invention is any cell this is undergoing active nucleic acid synthesis. The cell may be from any organism, including but not limited to, a plant, an animal, and a microorganism including bacteria, cyanobacteria, archaea, fungi, protozoa, and algae. A bacteria may be a gram positive or a gram negative bacteria. In one embodiment, an organism is a model organism useful for research.
(91) In one embodiment, the organism is a mammal. Non-limiting examples of mammalian cell types that are appropriate for use in the methods of the invention include, but are not limited to stem and progenitor cells (e.g., embryonic stem cells, hematopoietic stem cells, mesenchymal stem cells, neural crest cells, etc.), endothelial cells, muscle cells, myocardial, smooth and skeletal muscle cells, mesenchymal cells, epithelial cells, hematopoietic cells (e.g., lymphocytes, including T-cells, such as Th1 T cells, Th2 T cells, Th0 T cells, cytotoxic T cells, B cells, pre-B cells, etc.; monocytes; dendritic cells; neutrophils; and macrophages; natural killer cells; mast cells; etc.); adipocytes, cells involved with particular organs, such as thymus, endocrine glands, pancreas, and brain (e.g., neurons, glia, astrocytes, dendrocytes, etc.).
(92) In one embodiment, the methods of the invention are useful for examining nucleic acid dynamics following infection with a virus, including nucleic acid dynamics of viral DNA or viral RNA. Therefore, in one embodiment, the cell is a cell infected with a virus.
(93) In one embodiment, the methods of the invention are useful for examining nucleic acid dynamics of endogenous nucleic acid molecules. In one embodiment, the methods of the invention are useful for examining nucleic acid dynamics of exogenous nucleic acid molecules. In various embodiments, therefore, the cell comprises an exogenous nucleic acid molecule (e.g., an expression vector for expression of an exogenous nucleic acid).
(94) In some embodiments, the methods of the invention are useful to examine nucleic acid dynamics of cells undergoing or having undergone a treatment. In various embodiments, a treatment is a therapeutic treatment or a non-therapeutic treatment. In various embodiments, a treatment is at least one of treatment with a pharmaceutical agent, a treatment that alters the level or expression of a gene or gene product (e.g., a gene therapy, a microRNA replacement therapy, an anti-microRNA therapy, an siRNA therapy, treatment with a protein, treatment with a peptide, treatment with an antibody) or a treatment that alters a condition of a cell (e.g., alteration in temperature, oxygen level, desiccation).
(95) In some embodiments, the methods of the invention are useful to examine nucleic acid dynamics in healthy, normal or control cells. In one embodiment, the methods of the invention are useful to examine nucleic acid dynamics in cells associated with a disease or disorder. In various embodiments, the disease or disorder may be hereditary or non-hereditary. In various embodiments, the disease or disorder may be a single gene disease or disorder, a complex disease or disorder (e.g., a disease such as, but not limited to, heart disease, diabetes, and obesity that does not have a single genetic cause), an epigenetic disease or disorder, an infectious disease, or any other known or unknown disease or disorder. The methods of the invention are not limited with regard to the disease or disorder that can evaluated using the method of the invention, but rather any cell associated with any disease or disorder can be evaluated using the method of the invention.
(96) Nucleic acids can be obtained using known techniques. Nucleic acid herein includes DNA molecules, including but not limited to nuclear DNA and mtDNA molecules, and RNA molecules including but not limited to mRNA, rRNA, noncodingRNA (ncRNA), large ncRNA (lncRNA), small nuclear RNA (snRNA), small cytoplasmic RNA (scRNA), small nucleolar RNA (snoRNA), small interfering RNA (siRNA) and microRNA (miRNA) molecules. The nucleic acid can be double-stranded or single-stranded (i.e., a sense or an antisense single strand) and can be complementary to a nucleic acid encoding a polypeptide. The nucleic acid can be naturally occurring nucleic acid molecules (e.g., genomic DNA molecules), synthetic nucleic acid molecules (e.g., recombinant DNA molecules), or nucleic acid molecules derived therefrom (e.g., transcripts made from recombinant DNA molecules).
(97) There are many methods known in the art for the detection of specific nucleic acid sequences and new methods are continually reported. A great many such methods involve the generation of an amplification product. Such methods include, but are not limited to polymerase chain reaction (PCR), reverse transcription, ligase chain reaction, loop mediated isothermal amplification, multiple displacement amplification, and nucleic acid sequence based amplification. In one embodiment, an amplification product is generated during sequencing, for example by a polymerase enzyme during single-molecule sequencing.
(98) In one embodiment, a process for the detection of nucleic acid takes advantage of the polymerase chain reaction (PCR). The PCR process is well known in the art (U.S. Pat. No. 4,683,195, U.S. Pat. No. 4,683,202, and U.S. Pat. No. 4,800,159). To briefly summarize PCR, nucleic acid primers, complementary to opposite strands of a nucleic acid amplification target nucleic acid sequence, are permitted to anneal to the denatured sample. A DNA polymerase (typically heat stable) extends the DNA duplex from the hybridized primer. The process is repeated to amplify the nucleic acid target. If the nucleic acid primers do not hybridize to the sample, then there is no corresponding amplified PCR product.
(99) In PCR, the nucleic acid probe can be labeled with a tag. In one embodiment, the detection of the duplex is done using at least one primer directed to the target nucleic acid. In yet another embodiment of PCR, the detection of the hybridized duplex comprises electrophoretic gel separation followed by dye-based visualization.
(100) Nucleic acid amplification procedures by PCR are well known and are described in U.S. Pat. No. 4,683,202. Briefly, the primers anneal to the target nucleic acid at sites distinct from one another and in an opposite orientation. A primer annealed to the target sequence is extended by the enzymatic action of a heat stable polymerase. The extension product is then denatured from the target sequence by heating, and the process is repeated. Successive cycling of this procedure on both strands provides exponential amplification of the region flanked by the primers.
(101) Amplification is then performed using a PCR-type technique, that is to say the PCR technique or any other related technique. Two primers, complementary to the target nucleic acid sequence are then added to the nucleic acid content along with a polymerase, and the polymerase amplifies the DNA region between the primers.
(102) Stem-loop RT-PCR is a PCR method that is useful in the methods of the invention to amplify and quantify nucleic acid molecules of interest (See Caifu et al., 2005, Nucleic Acids Research 33:e179; Mestdagh et al., 2008, Nucleic Acids Research 36:e143; Varkonyi-Gasic et al., 2011, Methods Mol Biol 744:145-57). Briefly, the method includes two steps: RT and real-time PCR. First, a stem-loop RT primer is hybridized to a miRNA molecule and then reverse transcribed with a reverse transcriptase. Then, the RT products are quantified using conventional real-time PCR.
(103) The expression “specifically hybridizing in stringent conditions” refers to a hybridizing step in the process of the invention where the oligonucleotide sequences selected as probes or primers are of adequate length and sufficiently unambiguous so as to minimize the amount of non-specific binding that may occur during the amplification. The oligonucleotide probes or primers herein described may be prepared by any suitable methods such as chemical synthesis methods.
(104) Hybridization is typically accomplished by annealing the oligonucleotide probe or primer to the template nucleic acid under conditions of stringency that prevent non-specific binding but permit binding of this template nucleic acid which has a significant level of homology with the probe or primer.
(105) Among the conditions of stringency is the melting temperature (Tm) for the amplification step using the set of primers, which is in the range of about 50° C. to about 95° C. Typical hybridization and washing stringency conditions depend in part on the size (i.e., number of nucleotides in length) of the template nucleic acid or the oligonucleotide probe, the base composition and monovalent and divalent cation concentrations (Ausubel et al., 1994, eds Current Protocols in Molecular Biology).
(106) In one embodiment, the amplifications are real-time amplifications performed using a labeled probe, capable of specifically hybridizing in stringent conditions with a segment of a nucleic acid sequence, or polymorphic nucleic acid sequence. The labeled probe is capable of emitting a detectable signal every time each amplification cycle occurs.
(107) The real-time amplification, such as real-time PCR, is well known in the art, and the various known techniques will be employed in the best way for the implementation of the present process. These techniques are performed using various categories of probes, such as hydrolysis probes, hybridization adjacent probes, or molecular beacons. The techniques employing hydrolysis probes or molecular beacons are based on the use of a fluorescence quencher/reporter system, and the hybridization adjacent probes are based on the use of fluorescence acceptor/donor molecules.
(108) Hydrolysis probes with a fluorescence quencher/reporter system are available in the market, and are for example commercialized by the Applied Biosystems group (USA). Many fluorescent dyes may be employed, such as FAM dyes (6-carboxy-fluorescein), or any other dye phosphoramidite reagents.
(109) Among the stringent conditions applied for any one of the hydrolysis-probes of the present invention is the Tm, which is in the range of about 50° C. to 95° C. In one embodiment, the Tm for a hydrolysis-probes is in the range of about 55° C. to about 80° C. In one embodiment, the Tm applied for a hydrolysis-probe is about 75° C.
(110) In one embodiment, the method includes determining the sequence of the nucleic acid molecules. Direct sequence analysis can be used to determine the sequence of the nucleic acid molecules of interest. A sample comprising nucleic acid can be used, and PCR or other appropriate methods can be used to amplify all or a fragment of the nucleic acid, and/or its flanking sequences, if desired.
(111) In one embodiment, the nucleic acid may be prepared (e.g., library preparation) for massively parallel sequencing in any manner as would be understood by those having ordinary skill in the art. Current methods for library preparation attempt to uniformly sample all sequences across every nucleic acid molecule, optimally with sufficient overlap to allow reassembly of the sequences from which they derive, or alternatively, to allow inference of the sequence by alignment with reference sequences. These methods are generally known in the art and generally relate to generating multiple copies of (amplifying) the complementary sequence of the nucleic acid sequences of interest. These standard methods have in common that the libraries of sequences that they contain correspond to the sequences of genes, or in various embodiments, from the messenger RNAs (i.e., mRNAs) transcribed from genes. In one embodiment, the libraries include RNA sequences from DNA regions that are not necessarily considered to be genes, including but not limited to microRNAs, short interfering RNAs, long non-coding RNAs, and others. Similar libraries contain sequences directly obtained from DNA, including but not limited to genomic DNA, organelle DNA, mitochondrial DNA, chloroplast DNA, pathogen DNA, commensal organism DNA, viral DNA, parasite DNA, and symbiotic organism DNA.
(112) While there are many variations of library preparation, the purpose is to construct nucleic acid fragments of a suitable size for a sequencing instrument and to modify the ends of the sample nucleic acid to work with the chemistry of a selected sequencing process. Depending on application, nucleic acid fragments may be generated having a length of about 100-1000 bases. It should be appreciated that the present invention can accommodate any nucleic acid fragment size range that can be generated by a sequencer. This can be achieved by capping the ends of the fragments with nucleic acid adapters. These adapters have multiple roles: first to allow attachment of the specimen strands to a substrate (bead or slide) and second have nucleic acid sequence that can be used to initiate the sequencing reaction (priming). In many cases, these adapters also contain unique sequences (bar-coding) that allow for identification of individual samples in a multiplexed run. The key component of this attachment process is that only one nucleic acid fragment is attached to a bead or location on a slide. This single fragment can then be amplified, such as by a PCR reaction, to generate hundreds of identical copies of itself in a clustered region (bead or slide location).
(113) One aspect of the present invention provides in part for methods to attach barcodes to nucleic acid molecules by primed synthesis in which the barcode is attached to the randomized or partially randomized primer, and the subsequent preparation of the resulting barcoded nucleic acid molecules for sequencing. The invention provides in part for grouping the nucleic acid molecules with attached barcodes and inferring or deducing the sequences of the single sample from which they derive.
(114) In one embodiment, clusters of identical nucleic acid molecules form a product that is sequenced. The sequencing can be performed using any standard sequencing method or platform, as would be understood by those having ordinary skill in the art. Representative sequencing methods that can be used in the method of the invention include, but are not limited to direct manual sequencing (Church and Gilbert, 1988, Proc Natl Acad Sci U.S.A., 81:1991-1995; Sanger et al., 1977, Proc Natl Acad Sci U.S.A., 74:5463-5467; Beavis et al. U.S. Pat. No. 5,288,644); automated fluorescent sequencing; single-stranded conformation polymorphism assays (SSCP); clamped denaturing gel electrophoresis (CDGE); denaturing gradient gel electrophoresis (DGGE) (Sheffield et al., 1981, Proc Natl Acad Sci U.S.A., 86:232-236), mobility shift analysis (Orita et al., 1989, Proc Natl Acad Sci U.S.A., 86:2766-2770; Rosenbaum and Reissner, 1987, Biophys. Chem, 265:1275; Keen et al., 1991, Trends Genet, 7:5); RNase protection assays (Myers, et al., 1985, Science, 230:1242); Luminex xMAP™ technology; HTS (Gundry and Vijg, 2011, Mutat Res, doi:10.1016/j.mrfmmm.2011.10.001); NGS (Voelkerding et al., 2009, Clinical Chemistry, 55:641-658; Su et al., 2011, Expert Rev Mol Diagn, 11:333-343; Ji and Myllykangas, 2011, Biotechnol Genet Eng Rev, 27:135-158); and/or ion semiconductor sequencing (Rusk, 2011, Nature Methods, doi:10.1038/nmeth1330; Rothberg et al., 2011, Nature, 475:348-352). Next-gen sequencing platforms including, but not limited to, Illumina HiSeq, Illumina MiSeq, Life Technologies PGM, Pacific biosciences RSII and Helicos Heliscope can be used in the method of the invention for sequencing the nucleic acid molecules. These and other methods, alone or in combination, can be used to detect and quantify at least one nucleic acid molecule of interest.
(115) The probes and primers according to the invention can be labeled directly or indirectly with a radioactive or nonradioactive compound, by methods well known to those skilled in the art, in order to obtain a detectable and/or quantifiable signal; the labeling of the primers or of the probes according to the invention is carried out with radioactive elements or with nonradioactive molecules. Among the radioactive isotopes used, mention may be made of .sup.32P, .sup.33P, .sup.35S or .sup.3H. The nonradioactive entities are selected from ligands such as biotin, avidin, streptavidin or digoxigenin, haptenes, dyes, and luminescent agents such as radioluminescent, chemoluminescent, bioluminescent, fluorescent or phosphorescent agents.
(116) In one embodiment, the sequencing is single-molecule sequencing which allows complete genomes to be sequenced on a single microarray chip in a single sequencing reaction. The principle of this technology is that large numbers of short sequences are immobilized as single strands on a surface where they can be individually visualized with a sensitive microscope and camera. Every fragment is then sequenced simultaneously with fluorescent nucleotides and a polymerase enzyme, and the sequence information from all of the molecules is recorded simultaneously within a single camera frame.
(117) The invention also provides methods which employ (usually, analyze) the products of the methods of the invention, such as preparation of libraries (including cDNA and differential expression libraries); sequencing, detection of sequence alteration(s) (e.g., genotyping or nucleic acid mutation detection); determining presence or absence of a sequence of interest; gene expression profiling; differential amplification; preparation of an immobilized nucleic acid (which can be a nucleic acid immobilized on a microarray), and characterizing (including detecting and/or quantifying) mutations in nucleic acid products generated by the methods of the invention.
(118) In one embodiment, the invention provides methods of generating mutations in newly synthesized nucleic acid molecules in a cell, said method comprising (a) contacting a cell with a thiol-containing nucleoside or nucleobase, (b) isolating nucleic acid molecules from the cell, and (c) contacting the nucleic acid molecules with an oxidant and a nucleophile.
(119) In some embodiments, the invention provides methods of analyzing newly synthesized nucleic acid molecules in a cell, said methods comprising (a) contacting a cell with a thiol-containing nucleoside or nucleobase, (b) isolating nucleic acid molecules from the cell, (c) contacting the nucleic acid molecules with an oxidant and a nucleophile, (d) sequencing the isolated nucleic acid molecules, and (e) analyzing the sequencing reads to identify those reads containing a mutation generated by conversion of a thiol-containing nucleoside or nucleobase of the invention.
(120) In one embodiment, the thiol-containing nucleoside or nucleobase is one of 4-thiouricil, s.sup.4U, s.sup.6G, s.sup.6dG and s.sup.4T.
(121) In one embodiment, the method relates to identification of newly transcribed RNA molecules. Therefore, in one embodiment, the thiol-containing nucleoside or nucleobase is one that can be incorporated into nascent transcripts in a cell. In one embodiment, the thiol-containing nucleoside is generated in the cell from a thiol-containing nucleobase. In one embodiment, the thiol-containing nucleobase is 4-thiouricil, which is converted into s.sup.4U. In one embodiment, the thiol-containing nucleoside is s.sup.4U and the mutation generated by the method of the invention is a U to C mutation in amplification products generated from nascent transcripts. In one embodiment, the thiol-containing nucleoside is one of s.sup.6G and s.sup.6dGand the mutation generated by the method of the invention is a G to A mutation in amplification products generated from nascent transcripts.
(122) In one embodiment, the method relates to identification of newly replicated DNA molecules. Therefore, in one embodiment, the thiol-containing nucleoside or nucleobase is one that can be incorporated into newly replicated DNA molecules in a cell. In one embodiment, the thiol-containing nucleoside is s.sup.4T and the mutation generated by the method of the invention is a T to C mutation in amplification products generated from newly replicated DNA. In one embodiment, the thiol-containing nucleoside is one of s.sup.6G and s.sup.6dG and the mutation generated by the method of the invention is a G to A mutation in amplification products generated from newly replicated DNA.
(123) In one embodiment, a thiol-containing nucleoside or nucleobase is provided in a concentration sufficient for at least one thiol-containing nucleoside to be incorporated into a newly synthesized nucleic acid molecule. In one embodiment, a thiol-containing nucleoside or nucleobase is provided at a concentration of at least 100 nM, at least 500 nM, at least 1 μM, at least 5 μM, at least 10 μM, at least 50 μM, at least 100 μM, at least 500 μM, at least 1 mM, at least 5 mM, at least 10 mM, at least 50 mM, at least 100 mM, at least 500 mM, at least 1M or greater than 1M.
(124) In one embodiment, a thiol-containing nucleoside or nucleobase is provided for a time period sufficient for at least one thiol-containing nucleoside or nucleobase to be incorporated into a newly synthesized nucleic acid molecule. In one embodiment, a thiol-containing nucleoside or nucleobase is provided for at least 1 minute, at least 5 minutes, at least 10 minutes, at least 20 minutes, at least 30 minutes, at least 40 minutes, at least 50 minutes, at least 60 minutes, at least 70 minutes, at least 80 minutes, at least 90 minutes, at least 100 minutes, at least 120 minutes, at least 150 minutes, at least 180 minutes, at least 210 minutes, at least 240 minutes, or greater than 240 minutes.
(125) In one embodiment, the thiol-containing nucleoside or nucleobase is provided for a time period sufficient to incorporate the thiol-containing nucleoside into at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, at least 99%, or greater than 99% of newly synthesized nucleic acid molecules and then removed from the media. In one embodiment, the thiol nucleoside is added for at least 2 hours, at least 4 hours, at least 8 hours, at least 12 hours, at least 24 hours, at least 48 hours, at least 36 hours, or greater than 36 hours.
(126) In one embodiment, a thiol-containing nucleoside or nucleobase is provided for a limited time period such that it is only incorporated into recently synthesized nucleic acid molecules. In one embodiment, a thiol-containing nucleoside or nucleobase is provided for less than 5 hours, less than 4 hours, less than 3 hours, less than 2 hours or less than 1 hour.
(127) In one embodiment, the time for which a cell is contacted with a thiol-containing nucleoside or nucleobase and the concentration of the nucleoside or nucleobase can be varied based on the experimental design (e.g., the number of newly synthesized nucleic acid molecules having an incorporated thiol-containing nucleoside or nucleobase and/or the time frame during which newly synthesized nucleic acid molecules are being evaluated.) A person of skill in the art would easily understand how to vary these parameters to achieve a desired outcome based on the disclosure herein.
(128) In various embodiments, the oxidant is at least one of hydrogen peroxide, sodium iodate, sodium periodate, and meta-Chloroperoxybenzoic acid.
(129) In various embodiments, the nucleophile is at least one of TFEA, benzylamine, MeONH.sub.2, aniline, hydrazine, ammonia, 1,1-Dimethylethylenediamine, and 4-(Trifluoromethyl)benzylamine.
(130) In various embodiments, the oxidant is meta-Chloroperoxybenzoic acid and the nucleophile is at least one of TFEA, benzylamine, MeONH.sub.2, aniline, ammonia, and 4-(Trifluoromethyl)benzylamine. In one embodiment, the oxidant is sodium iodate and the nucleophile is MeONH.sub.2. In various embodiments, the oxidant is sodium periodate and the nucleophile is one of TFEA, benzylamine, and aniline. In one embodiment, the oxidant is hydrogen peroxide and the nucleophile is TFEA.
(131) In one embodiment, the nucleic acid molecules are contacted with a solution comprising a nucleophile and an oxidant is subsequently added thereto. In one embodiment, an oxidant is added dropwise to a solution containing isolated nucleic acid molecules and a nucleophile.
(132) In one embodiment, a nucleophile is provided in a concentration sufficient for conversion of at least one thiol-containing nucleoside or nucleobase to a convertible nucleoside intermediate. In one embodiment, a nucleophile is provided at a concentration of at least 100 nM, at least 500 nM, at least 1 μM, at least 5 μM, at least 10 μM, at least 50 μM, at least 100 μM, at least 500 μM, at least 1 mM, at least 5 mM, at least 10 mM, at least 50 mM, at least 100 mM, at least 500 mM, at least 1M or greater than 1M.
(133) In one embodiment, an oxidant is provided in a concentration sufficient for conversion of at least one convertible nucleoside intermediate into an analog of a different base (i.e., a cytidine analog for s.sup.4T or s.sup.4U or an adenine analog for s.sup.6G or s.sup.6dG). In one embodiment, an oxidant having a concentration of at least 100 nM, at least 500 nM, at least 1 μM, at least 5 μM, at least 10 μM, at least 50 μM, at least 100 μM, at least 500 μM, at least 1 mM, at least 5 mM, at least 10 mM, at least 50 mM, at least 100 mM, at least 500 mM, at least 1M or greater than 1M is provided drop-wise to a solution comprising a nucleic acid molecule and a nucleophile.
(134) Methods of analyzing the sequencing reads may include the use of bioinformatics methods for filtering, aligning, and characterizing sequencing reads. Such bioinformatics methods may include, but are not limited to, filtering of sequencing reads for unique sequences, trimming of sequencing reads (e.g., to remove sequencing adaptor sequences or low quality bases), filtering of sequencing reads for reads greater than a minimum length, generation of contigs and alignment of sequencing reads to a reference genome. In some embodiments, bioinformatics methods include methods for identifying mutation sites in sequencing reads (e.g., methods to determine sites of T-to-C mutations). In some embodiments, the methods include processing an aligned BAM file in R using Rsamtools and determining the sites and numbers of mutations.
(135) In some embodiments, the methods include one or more measures to remove from the analysis those specific mutations that are determined to not be a result of the method of the invention. Exemplary mutations that are determined to not be a result of the method of the invention include, but are not limited to, mutations at positions with a base quality score of less than or equal to 55 that are less than four nucleotides from the end of the sequencing read, and sites of common SNPs or RNA modifications. Methods for identifying sites of common SNPs or RNA modifications include, but are not limited to, identifying T-to-C SNP sites or G-to-A SNP sites in control samples using bcftools, identifying locations where T-to-C or G-to-A mutations are high in non-treated controls, and identifying sites where T-to-C or G-to-A mutations are anomalously high relative to other sites within the same gene.
(136) In one embodiment, the method of the invention further includes the step of analyzing and characterizing those sequencing reads containing a mutation generated by conversion of a convertible nucleoside of the invention as being generated from a nascent mRNA transcript. In one embodiment, the step of analyzing and characterizing sequencing reads containing a mutation is performed using at least one bioinformatics method. Bioinformatics methods appropriate for use in analyzing and characterizing sequencing reads may include, but are not limited to, methods to examine the distribution of reads with T-to-C or G-to-A mutations, methods to make genome-coverage tracks, methods to normalize the data, methods for generating heatmaps, or any other tool known in the art or developed for the purpose of identifying and analyzing mutations in sequencing data.
(137) Kits
(138) The present invention also includes kits useful in the methods of the invention. Such kits comprise components useful in any of the methods described herein, including for example, at least one of a thiol-containing nucleoside or nucleobase, a reagent for performing oxidative-nucleophilic-aromatic-substitution chemistry, primers, probes, oligonucleotide arrays, restriction enzymes, antibodies, allele-specific oligonucleotides, means for amplification of a subject's nucleic acids, means for reverse transcribing a subject's RNA, means for analyzing a subject's nucleic acid sequence, and instructional materials. For example, in one embodiment, the kit comprises components useful for one or more of the generation, detection and quantification of at least one mutation in a nucleic acid molecule. In various embodiments, at least one control nucleic acid molecule is contained in the kit, such as a positive control, a negative control, or a nucleic acid molecule useful for assessing the quality of a sequencing run.
EXPERIMENTAL EXAMPLES
(139) The invention is further described in detail by reference to the following experimental examples. These examples are provided for purposes of illustration only, and are not intended to be limiting unless otherwise specified. Thus, the invention should in no way be construed as being limited to the following examples, but rather, should be construed to encompass any and all variations which become evident as a result of the teaching provided herein.
Example 1
TimeLapse-Seq Adds a Temporal Dimension to RNA Sequencing
(140) Global analyses of cellular RNAs provide a detailed portrait of the biological state of a sample. RNA sequencing (RNA-seq) offers a snapshot of cellular RNA populations, but does not provide temporal information about the sequenced RNA. Time Lapse Sequencing (TimeLapse-seq), a chemical method to encode temporal information into an RNA sequencing experiment, has been developed and is demonstrated herein. In TimeLapse-seq, a sample is treated with s.sup.4U, a metabolic label that is incorporated into new RNAs (
(141) The results presented herein provide 1) experimental Mass spectrometry data demonstrating the conversion of s.sup.4U and s.sup.4T to amine containing C-analogues, 2) an experimental restriction enzyme digestion assay demonstrating the high efficiency of this chemistry under a number of conditions (>70% conversion) and the compatibility of this chemistry with oligoribonucleotides and enzymatic manipulation, 3) exemplary targeted sequencing data showing these conditions lead to conversion only when all components are present (s.sup.4U-RNA, oxidant and nucleophile), 4) exemplary RNA-Seq data from metabolically labeled cellular RNA with and without chemical treatment demonstrating that this approach captures different RNA turnover rates for different cellular RNAs, and 5) experimental data demonstrating that this approach can reveals cryptic dynamics of the RNA pool (e.g., changes in RNA upon cellular heatshock.)
(142) Further this assay captures both “labeled” (i.e., nucleic acid molecules that incorporated a s.sup.4U or s.sup.4T) and those that are “unlabeled.” This demonstrates that only a subpopulation of RNA is labeled, and further provides an advantage over pull-down methods that only capture “labeled” nucleic acid molecules (e.g., BrdU based sequencing methods.)
(143) The materials and methods are now described
(144) Materials
(145) All commercially available materials were purchased from the indicated suppliers and used without further purification. 4-thiouridine (s.sup.4U), and Meta-chloroperoxybenzoic acid (mCPBA) were purchased from Alfa Aesar (Haverhill, Mass.). 4-thiouridine-5′-triphosphate (s.sup.4UTP) was purchased from TriLink BioTechnologies (San Diego, Calif.). 2,2,2-trifluoroethylamine (TFEA), sodium acetate, EDTA, Tris hydrochloride, acrylamide/bis-acrylamide 30% solution, and phenol: chloroform: isoamyl (25:24:1) were purchased from Sigma Aldrich (St. Louis, Mo.). Sodium periodate (NaIO.sub.4) and ammonium bicarbonate were purchased from Acros Organics (Geel, Belgium). Dithiothreitol (DTT) was purchased from Thermo Fisher Scientific (Waltham, Mass.). Phosphate buffered saline (PBS) was purchased from AmericanBio (Natick, Mass.). Dulbecco's Modified Eagle Medium (DMEM), fetal bovine serum (FBS), Trizol reagent, TURBO DNase and SuperScript III Reverse Transcriptase were purchased from Life Technologies (Carlsbad, Calif.). KAPA Taq Ready Mix was purchased from Kapa Biosystems Inc (Wilmington, Mass.). Penicillin-streptomycin (P/S) and 33mm 0.45 μm PDVF syringe filters were purchased from EMD Millipore (Billerica, Mass.). Notl HF restriction enzyme and NEBNext Ultra Directional RNA Library Prep Kit were purchased from New England Biolabs (Ipswich, Mass.). SMARTer Stranded Total RNA Kit (Pico Input) was purchased from Takara Bio USA (Mountain View, Calif.). Hypersil Gold 3 um, 160×2.1 mm column was purchased from Thermo Fisher Scientific (Waltham, Mass.).
(146) Instrumentation
(147) LC-MS measurements were carried out on an Agilent 6550A Q-TOF. Analysis of fluorescent RNAs was carried out on a GE Healthcare Typhoon FLA 9500. RNA-seq was performed on Illumina HiSeq 2500 and Illumina HiSeq 4000 instruments.
(148) LC-MS Analysis of Nucleosides
(149) To a solution of s.sup.4U (50 μM) and ammonium bicarbonate (10 mM) was added TFEA (600 mM). mCPBA (10 mM) was dissolved in ethanol and added dropwise to the reaction mixture. After 1 hour at 25° C. the reaction was analyzed by reverse-phase LC-MS with a Hypersil GOLD column (Thermo, 3 μm, 160×2.1 mm) using chromatography conditions as previously described (Duffy et al., 2015, Mol Cell, 59:858-866). Masses were collected using positive ion mode and extracted ions were identified and integrated using Agilent MassHunter software.
(150) Nuclear Magnetic Resonance Analysis of Nucleobase Chemistry
(151) 4-thiouracil (4.3 mg, 1 equiv) was dissolved in DMSO-d.sub.6, and TFEA (3.4 μl, 1.3 equiv) was added to the solution. After mixing, a solution of NaIO.sub.4 in DMSO-d.sub.6 (12.3 mg, 1.7 eq) was added to the nucleobase and amine solution, and the reaction was allowed to proceed at 45° C. for 4 hours. .sup.1H NMR spectra were processed using the MestReNova software.
(152) NotI Restriction Endonuclease Assay
(153) An RNA containing a single s.sup.4U was in-vitro transcribed (IVT) from a synthesized DNA template strand using T7 RNA polymerase and s.sup.4UTP in place of UTP for 16 hours at 37° C. The reaction mixture was treated with TURBO DNase for 1 hour at 37° C. The RNA was purified using denaturing PAGE, the resulting band was gel purified by crushing the gel slice and soaking it in extraction buffer (1 mM EDTA, 1 mM DTT, 20mM Tris, 300 mM NaOAc pH 5.2) at 4° C. for 4 hours. The supernatant was passed through a 0.45 μM syringe filter, and the RNA was ethanol precipitated and washed with 75% ethanol prior to resuspension in nuclease-free water.
(154) IVT RNAs were screened for optimal TimeLapse chemistry as follows: RNA (120 ng) was added to a mixture of amine and water. A solution of oxidant was then added drop wise and the reaction mixture was incubated at the temperature and time indicated (see
(155) After chemical treatment, IVT RNA (50 ng) was reverse transcribed with SuperScript III according to the manufactures directions. The cDNA was PCR amplified for 30 cycles with a fluorescent forward primer, then amplified an additional 2 cycles using ⅕ of the previous PCR reaction material with non-labeled primers (Table 1). The amplified PCR product was then incubated with Notl HF for 1 hour at 37° C. The fluorescent products were visualized using native PAGE followed by scanning with a Typhoon FLA imager and the proportion of cut product was determined using ImageJ.
(156) TABLE-US-00001 TABLE 1 In vitro transcription (IVT) templates and restriction enzyme (RE) assay primer sequences SEQ Identifier ID NO: Sequence IVT template 23 CTTGCGTTTCTCTCGTCCTT ctgtcttgctgttgttcGCG ACCGCcctgtGCGGTTGTGT CTTTTGTCCTGCCTATAGTG AGTCGTATTAATTTC IVT positive 24 CTTGCGTTTCTCTCGTCCTT control template ctgtcttgctgttgttcGCG GCCGCcctgtGCGGTTGTGT CTTTTGTCCTGCCTATAGTG AGTCGTATTAATTTC IVT T7 promoter 19 GAAATTAATACGACTCACTA TA RE RT and reverse 20 CTTGCGTTTCTCTCGTCCTT primer RE fluorescent 21 /5Cy5/AGGACAAAAGACAC forward primer AACCGC RE forward primer 22 AGGACAAAAGACACAACCGC Primer extension 25 /5Cy5/CTTGCGTTTCTCTC RT GTCCTT
(157) Targeted TimeLapse Sequencing
(158) Mouse embryonic fibroblast (MEF) cells were grown at 37° C. in DMEM containing 10% FBS and 1% P/S. At approximately 60% confluence, the media was replaced with media supplemented with s.sup.4U (700 μM). After two hours, the cells were rinsed with PBS, resuspended in TRIzol reagent, and stored overnight at −80° C. Following chloroform extraction, total RNA was ethanol precipitated with 1 mM DTT and washed with 75% ethanol. Total RNA was resuspended and treated with TURBO DNase, then extracted with acidic phenol:chloroform:isoamyl alcohol and ethanol precipitated and washed as described above. Isolated total RNA was added to a mixture of TFEA (600 mM), EDTA (1 mM) and sodium acetate pH 5.2 (100 mM) in water. A solution of NaIO.sub.4 (10 mM) was then added drop wise and the reaction mixture was incubated for 1 hour at 45° C. Potassium chloride (300 mM) and sodium acetate pH 5.2 (300 mM) were added and the reaction mixture was allowed to stand on ice for 10 minutes prior to centrifugation (>10000 rpm, 30 minutes, 4° C.) to precipitate remaining periodate. The RNA in the supernatant was then ethanol precipitated and washed three times with 75% ethanol prior to resuspension in nuclease-free water. The chemically treated RNAs were then reverse transcribed using a mixture of mouse Actb and Gapdh-specific mRNA RT primers (Table 2). The resulting cDNA was then amplified with Phusion polymerase using corresponding forward PCR primers to produce PCR amplicons approximately 150 nucleotides (nt) in length. An Illumina sequencing library was constructed using the NEBNext Ultra Directional RNA Library Prep kit. Paired-end 75bp sequencing was performed on an Illumina HiSeq 2500 instrument. Sequencing reads were trimmed to remove adaptor sequences and aligned to the mouse genome using Bowtie2. Aligned reads were parsed to identify mutations at each nucleotide position in the Actb and Gapdh mRNAs using analyses adapted from (Siegfried et al., 2014, Nat Methods, 11:959-965). Raw mutation probabilities were determined by dividing the number of recorded mutation events by the number of reads at that position. Mutation probabilities were normalized to appropriate control samples and filtered by read depth (only positions with depth >3,000 were included in analyses). Analyses and figure plot generation were performed in R using the tidyverse, corrplot, and multiplot packages (Siegfried et al., (2014) Nat Methods, 11:959-965; Wei et al., (2017), Visualization of a Correlation Matrix, Version 0.84). The enrichment in mutation rates was tested for significance using a two-sided Wilcoxon test. Targeted sequencing was performed in duplicate using biologically distinct samples.
(159) TABLE-US-00002 TABLE 2 Targeted TimeLapse-seq primer sequences SEQ Identifier ID NO: Sequence mActB1 Forward 1 CTACACGACGCTCTTCCGATCTNNNNN Sequence ACTGAGCTGCGTTTTACACCC mActB2 Forward 2 CTACACGACGCTCTTCCGATCTNNNNN Sequence AATTTCTGAATGGCCCAGGTCT mActB3 Forward 3 CTACACGACGCTCTTCCGATCTNNNNN Sequence ATGGTGGGAATGGGTCAGAAGG mActB4 Forward 4 CTACACGACGCTCTTCCGATCTNNNNN Sequence TGAAGTGTGACGTTGACATCCG mGapdh1 Forward 5 CTACACGACGCTCTTCCGATCTNNNNN Sequence TCCGTCGTGGATCTGACGTG mGapdh2 Forward 6 CTACACGACGCTCTTCCGATCTNNNNN Sequence CTCTTCCACCTTCGATGCCG mGapdh3 Forward 7 CTACACGACGCTCTTCCGATCTNNNNN Sequence AGGACACTGAGCAAGAGAGGC mGapdh4 Forward 8 CTACACGACGCTCTTCCGATCTNNNNN Sequence CAGCAATGCATCCTGCACCA hMYC1 Forward 26 CTACACGACGCTCTTCCGATCTNNNNN Sequence CTTGGCGGGAAAAAGAACGG hMYC2 Forward 27 CTACACGACGCTCTTCCGATCTNNNNN Sequence GCATCCACGAAACTTTGCCC hMYC3 Forward 28 CTACACGACGCTCTTCCGATCTNNNNN Sequence TACTGCGACGAGGAGGAGAA hMYC4 Forward 29 CTACACGACGCTCTTCCGATCTNNNNN Sequence CAGGACTGTATGTGGAGCGG mActB1 Reverse 9 CAGACGTGTGCTCTTCCGATCTTCCTG Sequence AGTCAAAAGCGCCAAAAC mActB2 Reverse 10 CAGACGTGTGCTCTTCCGATCTGGTGT Sequence GGCACTTTTATTGGTCTCAAGTC mActB3 Reverse 11 CAGACGTGTGCTCTTCCGATCTGCCAC Sequence ACGCAGCTCATTGTAG mActB4 Reverse 12 CAGACGTGTGCTCTTCCGATCTGAGGA Sequence GCAATGATCTTGATCTTCATGG mGapdh1 Reverse 13 CAGACGTGTGCTCTTCCGATCTCATCG Sequence AAGGTGGAAGAGTGGG mGapdh2 Reverse 14 CAGACGTGTGCTCTTCCGATCTGGTGG Sequence GTGGTCCAGGGTTTC mGapdh3 Reverse 15 CAGACGTGTGCTCTTCCGATCTGTGGG Sequence TGCAGCGAACTTTATTG mGapdh4 Reverse 16 CAGACGTGTGCTCTTCCGATCTACAGC Sequence TTTCCAGAGGGGCC hMYC1 Reverse 30 CAGACGTGTGCTCTTCCGATCTTATTC Sequence GCTCCGGATCTCCCT hMYC2 Reverse 31 CAGACGTGTGCTCTTCCGATCTCCTTT Sequence CAGAGAAGCGGGTCC hMYC3 Reverse 32 CAGACGTGTGCTCTTCCGATCTCGAAG Sequence GGAGAAGGGTGTGAC hMYC4 Reverse 33 CAGACGTGTGCTCTTCCGATCTGGTAC Sequence AAGCTGGAGGTGGAG Forward PCR 17 CAGACGTGTGCTCTTCCGATC Amplification primer Reverse PCR 18 CTACACGACGCTCTTCCGATCT Amplification primer
(160) Targeted TimeLapse-seq of K562 RNA was performed similarly with the following exceptions. Cells were grown at 37° C. in RPMI containing 10% FBS and 1% P/S. At approximately 50% confluence, the media was supplemented with a range of s.sup.4U concentrations (10-40 μM) for 1 hour. Total RNA was isolated and chemically treated as described previously. The chemically treated RNAs were then reverse transcribed using a mixture of human MYC-specific mRNA RT primers. A targeted sequencing library was prepared and analyzed as described above.
(161) Cell Viability.
(162) MEF cells were grown at 37° C. in DMEM containing 10% FBS and 1% P/S. Cells were plated at 10.sup.6 cells/mL in a 96-well microtiter plate and allowed to recover overnight. Cells were then treated in triplicate with increasing concentrations of s.sup.4U (0-1 mM) for 1 hour, and the ATCC MTT Cell Proliferation Assay kit was used according to manufacturer's instructions to assess cell viability.
(163) Transcriptome-Wide TimeLapse-seq
(164) MEF cells were grown at 37° C. in DMEM containing 10% FBS and 1% P/S. At approximately 60% confluence, the media was replaced and supplemented with s.sup.4U (1 mM). The cells were incubated at 37° C. for 1 hour, at which point total RNA was isolated and chemically treated as described in the targeted sequencing section. For heat shock analyses, at approximately 60% confluence, the media was replaced and supplemented with s.sup.4U (1 mM), and heat shocked cells were incubated at 42° C. for 1 hour. RNA was prepared as described for the Targeted TimeLapse-seq libraries. For each sample, 10 ng of total RNA was used to construct a sequencing library using the Clontech SMARTer Stranded Total RNA-Seq kit (Pico Input) with ribosomal cDNA depletion. Paired-end 100 bp sequencing was performed on an Illumina HiSeq 4000 instrument. TimeLapse-seq was performed in duplicate using biologically distinct samples for experimental samples both with and without heat shock. Raw and processed sequencing data have been submitted to the GEO database.
(165) TT-TimeLapse-seq
(166) K562 cells were grown at 37° C. in RPMI containing 10% FBS and 1% P/S. At approximately 50% confluence, the media was supplemented with s.sup.4U (1 mM). The cells were incubated at 37° C. for 5 minutes, at which point total RNA isolation and genomic DNA depletion were performed as described above. 50 μg of total RNA was subjected to MTS chemistry, followed by biotinylation and streptavidin enrichment essentially as previously described (Duffy et al., (2015) Mol Cell, 59:858-866) with the following modification: after SAV beads were washed three times with high-salt wash buffer (1 M NaCl, 100 mM Tris pH 7.4, 10 mM EDTA, 0.05% Tween), beads were incubated in TE buffer (10 mM Tris pH 7.4, 1 mM EDTA) at 55° C. for 15 min, followed by two washes with prewarmed 55° C. TE buffer. After elution from SAV beads, enriched RNA was purified using one equivalent volume of Agencourt RNAclean XP beads according to manufacturer's instructions instead of purification by ethanol precipitation. Enriched RNA and input RNA were chemically treated as previously described. Chemically treated RNA was purified using 1 equivalent volume of Agencourt RNAclean XP beads according to manufacturer's instructions. Purified material was then incubated in a reducing buffer (10 mM DTT, 100 mM NaCl, 10 mM Tris pH 7.4, 1 mM EDTA) at 37° C. for 30 min, followed by a second RNAclean bead purification. For each sample, all enriched material or 10 ng of total RNA input was used to construct a sequencing library using the Clontech SMARTer Stranded Total RNA-Seq kit (Pico Input) with ribosomal cDNA depletion. Paired-end 150 bp sequencing was performed on an Illumina HiSeq 4000 instrument. TimeLapse-seq was performed in duplicate using biologically distinct samples for experimental samples. Raw and processed sequencing data have been submitted to the GEO database.
(167) Samples for TimeLapse-seq Analysis of K562 mRNA
(168) K562 cells were grown as previously described. At approximately 50% confluence, the media was supplemented with s.sup.4U (100 μM). The cells were incubated at 37° C. for 4 h, at which point total RNA was isolated using the RNeasy mini kit with the following modifications: buffers RLT and RPE were supplemented with 1% final 2-mercaptoethanol (BME); an additional 80% EtOH wash was performed after the RPE step; and the column was spun at maximum speed for 5 minutes to dry before elution with water. The isolated RNA was then chemically treated and purified as previously described. For each sample, 10 ng of total RNA was used to construct a sequencing library using the Clontech SMARTer Stranded Total RNA-Seq kit (Pico Input) with ribosomal cDNA depletion. Paired-end 150 bp sequencing was performed on an Illumina HiSeq 4000 instrument. TimeLapse-seq was performed in duplicate using biologically distinct samples for experimental samples. Raw and processed sequencing data have been submitted to the GEO database.
(169) Transcriptional Inhibition
(170) K562 cells were grown as described above. At approximately 50% confluence, cells were treated in duplicate with actinomycin D (2 μg/mL final) for 30 min, 1 hour, 3 hours, 5 hours, and 9 hours, or left untreated. Total RNA isolation and genomic DNA depletion were then performed as previously described. RT was performed using the SuperScript VILO cDNA synthesis kit, and qPCR was performed using primers specific to ACTB, DHX9, and ASXL1 (Table 3). qPCR ct values for DHX9 and ASXL1 were then averaged and normalized to those of ACTB for each timepoint. The normalized fraction remaining was estimated for each primer pair by dividing the relative abundance of each timepoint by the relative abundance at t=0.
(171) TABLE-US-00003 TABLE 3 qPCR primer sequences SEQ Identifier ID NO: Sequence Rsrp1 (a) Forward 34 AAGTACAGGCGCTACTCACG Sequence Rsrp1 (b) Forward 35 AAGATCCAGAACCAGGTCGC Sequence Rsrp1 (c) Forward 36 TCCTTGGACAGCTAGGGGAT Sequence Rsrp1 (d) Forward 37 GAGGGGTTTGTGTCCAGCAT Sequence Hist1h1d (a) Forward 38 AAGAAGGCAGCAAAGAGTCCA Sequence Hist1h1d (b) Forward 39 AAGCCTAAGAAGGCGACTGG Sequence ACTB Forward 40 GGCATGGGTCAGAAGGATT Sequence DHX9 Forward 41 CCGATTCCTCCATGCGAGTT Sequence ASXL1 (Pair 1) 42 TCGGATGCTCCAATGACACC Forward Sequence ASXL1 (Pair 2) 43 ACCAGGCCCCTTCATCTTAAT Forward Sequence ASXL1 (Pair 3) 44 GAAGCCCCGGCTTGAAGAT Forward Sequence ASXL1 (Pair 4) 45 ATCCTCACCGACTGATTGCC Forward Sequence ASXL1 (Pair 5) 46 TGCATTGCCTGGGGATTTGA Forward Sequence Rsrp1 (a) Reverse 47 GACGGCGACTTGTAGTACCT Sequence Rsrp1 (b) Reverse 48 GCAGTGGCTTTGCTACGGAA Sequence Rsrp1 (c) Reverse 49 CACGAATACCCGACTCCTGT Sequence Rsrp1 (d) Reverse 50 ACCTCAACCATGAACGTCCC Sequence Hist1h1d (a) Reverse 51 AGATTTTCAAAGCAGGACGCA Sequence Hist1h1d (b) Reverse 52 TCTACTTCTTGCGAGGGGCA Sequence ACTB Reverse 53 CACACGCAGCTCATTGTAGA Sequence DHX9 Reverse 54 TCTGGCCTTCTACCGAGACA Sequence ASXL1 (Pair 1) 55 CCTTCTGCCTCTATGACCTGC Reverse Sequence ASXL1 (Pair 2) 56 TCCCAAGCTTACAGCAGGTT Reverse Sequence ASXL1 (Pair 3) 57 TGTGGCTTTTCGGTGTGAAC Reverse Sequence ASXL1 (Pair 4) 58 CATGAGCCACCAAGCCCTAA Reverse Sequence ASXL1 (Pair 5) 59 CTCGAGATGGCACAGTCCAG Reverse Sequence
(172) Sequencing Alignment and Mutational Analysis
(173) Reads were filtered for unique sequences using FastUniq (Xu et al., (2012) PLoS One, 7:e52249), trimmed using cutadapt (Martin, (2011) EMBnet.journal, 17:10-12) to remove illumine adaptor sequences filtering for reads greater than 20 nt (—minimum-length=20). Filtered reads were aligned to the mouse mm10genome, mouse GRCm38 or human GRCh38 genome and transcriptome annotations. Alignment to the mouse mm10 genome was performed using STAR 2.4.2a, using parameters adapted from the standard ENCODE pipeline (parameters: —genomeDir $GENOME DIR, —runThreadN 20—outFilterType BySJout—outFilterMultimapNmax 5—alignSJoverhangMin 8—alignSJDBoverhangMin 1—outFilterMismatchNmax 999—outFilterMismatchNoverLmax 0.04—alignIntronMin 20—alignIntronMax 1000000—alignMatesGapMax 1000000—clip5pNbases 5). Only reads that aligned uniquely (flag: 83/163, 99/147), with MAPQ≥5, and without insertions (because of ambiguity in mutational analysis) were considered for further analysis. The statistics for the sequenced samples are provided in
(174) Reads that uniquely map to UCSC transcripts (e.g., human GRCh38 version 26 (Ensembl 88) or mouse GRCm38 (p6)) were identified using HTSeq-count (Anders et al., 2015, Bioinformatics, 31:166-169) using union mode. Reads mapping to only mature isoforms or to anywhere in the gene body were determined separately and compared to identify intron-only reads. To determine the number of uridine residues inferred from each read, and the sites of T-to-C mutations, the aligned bam files were processed in R using Rsamtools and the sites and numbers of mutations were determined using a custom R script. Only mutations at positions with a base quality score of greater than 45 that were at least three nt from the end of the read were counted. Reads were excluded where there were greater than five T-to-C mutations, and these mutations did not account for at least one-third of the observed mutations (NM tag). Without adequate filtering, SNPs could interfere with TimeLapse analysis. To identify sites of SNPs (or RNA modifications that could be mis-identified as TimeLapse mutations), the following two strategies were used. First, T-to-C SNP sites were identified in control samples using bcftools and these sites were excluded from the subsequent analysis. Second, locations where T-to-C mutations were high in non-s.sup.4U treated controls were identified and excluded from the subsequent analysis. Once the putative SNPs were filtered, the total number of unique mutations in each read pair was counted. To examine the distribution of reads with each minimum number of T-to-C mutations, the bam files were filtered using Picard tools. To make genome-coverage tracks, STAR aligner (inputAlignmentsFromBam mode, outWigType bedGraph) was used and the tracks were normalized using values derived from RNA-seq analyses using values from DESeq2 (estimateSizeFactors) (Robinson et al., (2011) Nat Biotechnol, 29:24-26). Tracks were converted to binary format (toTDF, IGVtools) and visualized in IGV (Van Herreweghe et al., (2007) EMBO J, 26:3570-3580). Heatmaps were made using rlog transfored data (DESeq2) and the pheatmap package.
(175) Secondary Structure Analysis.
(176) Aligned reads from the 4 hour K562 TimeLapse-seq experiment overlapping the 5′ stem loop of 7SK were extracted using samtools. A Python script developed for analyses of chemical probing data (RTEventsCounter; Sexton et al., (2017) Biochemistry, 56:4713-4721) was used to calculate the U-to-C mutation frequency for each uridine nucleotide. These frequencies were normalized by subtracting mutation frequencies of control samples that were not subjected to TimeLapse chemistry. The frequencies of mutations at each position were binned and mapped onto a conformational model of this region of human 7SK (Love et al., (2014) Genome Biol, 15:550). Each nucleotide was classified as either single stranded or basepaired. A two-sided Wilcoxon test was used to determine the significance of differences between mutation rates of the basepaired and single-stranded nucleotides.
(177) Estimation of the Fraction of New Transcripts and Transcript Half-Lives
(178) Two different models were used to examine the mutation distribution in TimeLapse-seq data set: a simpler Poisson model (which does not take into account the uridine content of different reads) and a binomial model that does take the number of uridines into account. Consistent results were obtained from both models. For the simpler Poisson model, for each sample (s.sub.j), the distribution of T-to-C mutations (Y.sub.i) was determined in each read, and the reads were grouped based on the transcripts to which they map. A negative control sample (no s.sup.4U treatment) was used to estimate the background rate of read pairs containing T-to-C mutations that map to each transcript. These frequencies depended on the cell line used (MEF samples required higher s.sup.4U treatment to obtain similar levels of mutations compared to K562 cells) as well as the sequencing experiment (different samples led to different background rates independent of chemistry or s.sup.4U treatment). The mutation rate and fraction of new transcripts was modeled as a two-component mixture of Poisson distributions with probability mass function:
f(y|λ.sub.o, λ.sub.n, θ.sub.n)=θ.sub.n Poisson (y; λ.sub.n)+(1−θ.sub.n) Poisson (y; λ.sub.o)
(179) where θ.sub.n is the fraction of new transcripts, λ.sub.O is the rate of background mutations (determined from −s.sup.4U controls), λ.sub.n is the rate of mutations found in new transcripts, and y.sub.i is the number of passing T-to-C mutations found in read i. Reasonable estimates of these values could be approximated by examining the mutation rates in fast turnover RNAs such as introns. To obtain more objective estimates of the global parameters λ.sub.O and λ.sub.n while allowing for low levels of transcript-to-transcript variability, a Bayesian hierarchical modeling approach was taken using RStan software (Version 2.16.2; Carpenter et al., (2017) J Stat Spftw, 76:1-32) that uses no-U-turn Markov Chain Monte Carlo (MCMC) sampling. To estimate a global mean and standard deviation (s.d.) for λ.sub.O and λ.sub.n, weakly informative priors were used (see below). Gene-specific rates were estimated by drawing from the global mean and s.d., with a mixing rate with an uninformative prior (θ.sub.n˜Uniform(0,1)) where the mixing rate (θ.sub.n) estimates the fraction of each transcript that was new:
(180) Global parameters:
λ.sub.o,μ˜Normal(μ=0, σ=1)
λ.sub.n,μ˜Normal(μ=0, σ=10)
λ.sub.o,σ˜Normal(μ=0, σ=10)
λ.sub.n,σ˜Normal(μ=0, σ=10)
λ˜Normal(μ=λ.sub.o,μ, σ=λ.sub.o,σ)
(181)
g ∈{1,2, . . . , n.sub.genes}
(182) Priors:
.sup.λn,g˜Normal(μ=λ.sub.n,μ, σ=λ.sub.n,σ)
.sup.λo, g˜Normal(μ=λ.sub.o,σ, σ=λ.sub.o,σ)
(183) for read i ∈{1, 2, . . . n.sub.g}:
(184)
(185) Attempts to model entire TimeLapse-seq data sets using this approach were computationally challenging, but it was found that consistent results were obtained using 20 representative transcripts from each sample. The majority of these transcripts were chosen randomly from all reasonably expressed transcripts (>200 reads), but a few transcripts that were hand chosen to ensure the modeling included both fast and slow turnover RNAs such as M.sub.yc and Actb were included. The results using 20 transcripts were consistent with results from 200 transcripts. In the case of the MEF samples shown in
(186) Once these global parameters were determined, they were used to estimate the fraction of new transcripts (θ.sub.new), using expectation maximization by minimizing the log likelihood using the nlm function in the MASS package in R:
(187)
(188) The 95% Wald confidence interval was calculated using the Hessian (nlm option hessian=TRUE), to calculate:
{circumflex over (θ)}.sub.new±z.sub.0.975×std eer({circumflex over (θ)}.sub.new)
(189) To ensure the mutations were both s.sup.4U-treatment and TimeLapse-chemistry dependent, only included transcripts where there was sufficient data (reads>100 counts in at least two samples), and where the fit converged (−0.05<θ.sub.n<1.05; hessian>1,000) were included. The inferred new read counts were determined by multiplying the estimated fraction of new transcripts by the total RNA-seq transcript count. Correlations between replicates were determined using the logio-transformed counts (
(190) To account for differences in the number of uridine residues in each read pair, an alternative model was used based on the binomial distribution. Specifically, the data were modeled as mixture of two binomial distributions:
f(γ|θ.sub.n, p.sub.o, p.sub.n)=θ.sub.nBinom(y; p.sub.n, n.sub.u,i)+(1−θ.sub.n)Binom(y; p.sub.o, n.sub.u,i)
where p.sub.o, p.sub.n are the probabilities of mutation at each uridine nucleotide for old and new transcripts, and n.sub.u is the number of uridines observed for read i. To determine the global mutation rate, Bayesian hierarchical modeling was used as described above for the Poisson model but using a mixture of binomial distributions. From this analysis, the background mutation rate (p.sub.o) was estimated to be 0.0012 mutations/uridine (50% CI 0.00121, 0.00123) and the mutation rate for new reads (p.sub.n) to be 0.0332 mutations/uridine (50% CI 0.0329, 0.0335). In other words, ˜0.1% of Us are mutated to C in pre-existing reads, and in new reads ˜3% of Us are mutated to C. Using these global parameters, the distributions of individual genes were fit with nlm similarly to what is described above, except by minimizing the log likelihood of the binomial model instead:
(191)
(192) In addition to computing the confidence interval using the hessian, the quality of the fit was examined by plotting the observed frequency of mutations in each replicate in the TimeLapse data (gray points in distribution plots) to a simulated distribution of the expected new and old reads based on the binomial model (
(193) To account for any specific loss of transcripts that might arise from biased loss of s.sup.4U-RNA transcripts independent of TimeLapse chemistry, or TimeLapse-depended loss due to reverse-transcription termination, a means of estimating the loss of fast-turnover transcripts in the data was developed. This correction was only used when estimating transcript half-lives after observing a modest, but statistically significant loss of reads from high turnover RNAs (
(194)
(195) where s.sub.y and s.sub.o are scale factors that adjust for library sizes determined using DESeq2 with the total (RNA-seq) transcript counts for the experimental sample and control, respectively; N.sub.y and N.sub.o are the counts for each transcript; and θ.sub.n is the unadjusted fraction new of each transcript. This equation was fit using transcripts where 0.8<θ.sub.n for K562 RNA, but 0.5<θ.sub.n in the case of MEF RNA (the shorter s.sup.4U treatment lead to fewer transcripts with high θ.sub.n, so the threshold was lowered to increase the number of transcripts). In the case of the comparison shown in
(196) The transcript half-lives were determined using the adjusted fraction of new RNA assuming a simple exponential model of their kinetics. The half-life values were compared to similar reports and the r.sup.2 determined using the lm function in R.
(197) Gene Ontology Analysis.
(198) GO analysis from the PANTHER database (version 12.0) (Thomas et al., (2003) Genome Res, 13:2129-2141) was performed using a statistical over-representation test (default parameters) on the complete biological process annotation set using the top 10% slow or top 10% fast turnovers RNAs in the 1 hour MEF TimeLapse-seq data as determined by the half-life analyses described above.
(199) Differential Expression Analysis
(200) Differential expression analysis was performed using DESeq2. To examine the inferred differences in the new transcript pool based on TimeLapse mutations, the unadjusted estimates of the fraction of new RNA were used to infer the number of counts resulting from new transcripts as described above. As TimeLaspse-seq data are internally controlled, the size factors determined from total counts were used to scale each data set (i.e., DESeq2 was run on the total RNA-seq data and the sizeFactors function was used to scale the inferred new RNA counts to the RNA-seq-determined values) with default conditions including the Benjamini-Hochberg (Benjamini and Hochberg, (1995) J. R. Stat. Soc. B Stat. Methodol, 57:289-300) adjusted P value (p.sub.adj in text). RNA-seq analysis was performed on all reads (i.e., reads that had zero or more T-to-C mutations) using DESeq2 with default parameters.
(201) Estimation of Contaminating Reads in TT-TimeLapse-seq
(202) Reads from TT-TimeLapse-seq were processed and analyzed as for TimeLapse-seq. Junction-containing reads were determined from the presence of “N” characters in the CIGAR string in the aligned bam file using bamtools (version 2.3). The levels of contaminating reads were estimated by assuming the contaminating reads have the same ratios as RNA-seq data, and that reads with three or more mutations constitute the true ratio of reads. Reads with three or more mutations were used as true positives, because the probability of a read containing three or more mutations without s.sup.4U is <10.sup.−5. The fraction of intron- or junction-containing reads was used for the RNA-seq data (r.sub.o), the total in the true positive population (r.sub.tp), and the total for each population (r.sub.x). In each analysis, only reads that had nonzero ratios and ratios that were less than one were considered. The fraction of reads from contamination (c.sub.x) was then estimated:
(203)
(204) For comparisons with the TT-TimeLapse-seq data presented here, the data from Schwalb et al. ((2016) Science, 352:1225-1228; SRR4000390, SRR4000391 and SRR4000397) were aligned and processed using the same pipeline described for TimeLapse-seq. For this comparison, TT-TimeLapse-seq data was reprocessed using only 75 nt of each read, and this trimming was performed on fastq files before alignment. This step was performed because the probability of a sequencing read containing a splice junction or being an intron-only read is dependent on the read length. Otherwise, all processing was handled equally between data sets.
(205) The experimental results are now described
(206) To track RNA dynamics directly in a sequencing experiment, TimeLapse-seq (
(207) For the development of TimeLapse-seq, s.sup.4U was focused on based on its demonstrated utility in RNA metabolic labeling experiments (Rabani et al., 2011, Nat Biotechnol, 29:436-442; Duffy et al., 2015, Mol Cell, 59:858-866) and the orthogonal reactivity of its thione relative to other functional groups found in RNA. The s.sup.4U base itself leads to low levels of U-to-C transitions upon reverse transcription (Hafner et al., 2010, Cell, 141:129-141), but does so at levels too low to robustly identify new transcripts. While recent applications of s.sup.4U have mostly focused on the thione as a nucleophile, or exploited the photochemistry of this nucleoside to induce UV crosslinks (Mishima and Steitz, 1995, Embo J, 14:2679-2687; Moore and Sharp, 1992, Science, 256:992-997), the focus of this study is on transforming s.sup.4U into other bases using oxidative-nucleophilic-aromatic substitution (Yano and Hayatsu, 1970, Biochim Biophys Acta, 199:303-315; Saladino et al., 1996, Tetrahedron, 52:6759-6780). Without being bound to a particular theory, it was reasoned that oxidation of s.sup.4U would effectively transform it into a convertible nucleoside, providing an activated intermediate that could be transformed into an analogue of cytosine by aminolysis (
(208) Chemistry to convert the free nucleoside (s.sup.4U) to cytosine derivatives was explored using an LC-MS assay to test a range of oxidants and amines (
(209) These reaction conditions were found to convert s.sup.4U to C analogues in the context of an oligoribonucleotide. This was accomplished using an RNA substrate containing a single s.sup.4U (introduced by in vitro transcription of a template with one adenosine and s.sup.4UTP) and a mutation-dependent restriction digestion assay to reveal T-to-C mutations after chemical treatment and reverse transcription (
(210) NaIO.sub.4 is an oxidant commonly used in RNA biology to oxidize the 3′-end vicinal diol of RNAs with minimal effects on other functional groups, even through multiple rounds of oxidation (Dai et al., (2017) Nat. Methods, 14:695-698). To test NaIO.sub.4 and TFEA with cellular s.sup.4U-RNA, mouse and human cells were exposed to a range of concentrations of s.sup.4U. After RNA isolation and chemical treatment, the apparent U-to-C conversion rates were examined (inferred from T-to-C mutations in the cDNA, hereafter referred to as T-to-C) by targeted RT-PCR coupled to paired-end sequencing. A notable and specific increase in T-to-C transitions was observed in chemically treated samples
(211) To test whether this chemistry could reveal newly transcribed RNAs for TimeLapse-seq, MEF cells were exposed to s.sup.4U for two hours, and the total RNA was isolated (s.sup.4U2A). A dramatic increase in T-to-C transitions in samples that were chemically treated (
(212) To examine the dynamics of cellular RNAs, MEF cells were treated with s.sup.4U for 1 hour (where no s.sup.4U toxicity was observed;
(213) Distinguishing Transient Transcripts from Contaminating Reads
(214) Very transient RNA species, such as reads beyond the poly-A termination signal in a gene body, provide insight into transcriptome dynamics but are generally too rare to be observed at high levels by RNA-seq. While these dynamics can be studied through biochemical enrichment of very recently made RNAs after short (5 min) s.sup.4U treatments through transient transcriptome sequencing (TT-seq; Schwalb et al., (2016) Science, 352:1225-1228), biochemically enriched s.sup.4U-RNA always contains contaminating reads from unlabeled RNAs (estimated to be up to 30% in some experiments; Hafner et al., (2010) Cell, 141:129-141). This contaminating background can limit analyses; for example, abundant spliced transcripts observed in RNA enriched after short s.sup.4U pulses have been interpreted as fast splicing (Mukherjee et al., (2017) Nat. Struct. Mol. Biol. 24:86-96), but these results could also be explained by contaminating background (e.g., from fully spliced mature RNAs). To test if TimeLapse chemistry could be used in conjunction with TT-seq to distinguish bona fide new RNAs from contaminating background, K562 cells were labeled for 5 minutes with s.sup.4U, and biochemical enrichment was performed as in TT-seq (Schwalb et al., (2016) Science, 352:1225-1228), except with more efficient MTS chemistry to biotinylate the s.sup.4U-RNA (Duffy et al., (2015) Mol. Cell, 59:858-866;
(215) Identifying Acute Transcriptional Changes with TimeLapse-seq
(216) TimeLapse-seq was next used to study global RNA dynamics upon heat shock. The TimeLapse was started by adding s.sup.4U and tracking the dynamics in cells with and without relatively mild heat shock (42° C.), where only modest changes in total RNA levels are apparent (Trinklein et al., 2004, Mol Biol Cell, 15:1254-1261; Mahat et al., 2016, Mol Cell, 62:63-78). After allowing the RNA populations to evolve for 1 hour under these two conditions, total RNA was isolated from the cells. Then TimeLapse-seq was performed by treating the RNA with TFEA and sodium periodate prior to reverse transcription and paired-end sequencing. After sequencing, the reads were aligned to the genome, filtered for high quality alignments, and the number of T-to-C mutations in each read were counted.
(217) Analysis of the total RNA reads that cover each transcript from these samples revealed that all RNA-seq samples were highly correlated irrespective of heat shock, treatment with s.sup.4U, or chemical treatment (Pearson's r≥0.93,
(218) By providing simultaneous information about total RNA and the new RNA that was made during the time cells were exposed to s.sup.4U, TimeLapse-seq provides information about RNA turnover. Indeed, TimeLapse-seq revealed much higher ratios of reads with T-to-C mutations in transcripts with high turnover rates such as Myc and Fos12 (
(219) Induction of a few transcripts such as Hspa1b by RNA-seq was observed (
(220) Similarly, as described above, this analyses showed that global transcript levels are highly correlated with and without heat shock. This high correlation, driven by abundant pre-existing transcripts, masks extensive transcriptional changes, as has been demonstrated with PRO-seq analysis under similar heat shock conditions (Mahat et al., 2016, Mol Cell, 62:63-78). TimeLapse-seq was also able to reveal the greater dynamics of the new transcript pool (
(221) Although most heat-shock-induced differences were dominated by changes in the pool of new RNAs (consistent with regulation at the level of transcription), surprisingly, some changes were driven instead by changes in pre-existing RNAs. It was found that many histone mRNAs were depleted (27 of top 57 transcripts that are depleted upon heat shock in RNA-seq analysis), and this depletion was driven by loss of the pre-existing RNA population, consistent with induced degradation of histone mRNAs rather than transcriptional shutdown (e.g., Hist1h1d,
(222) Discovering Isoform-Specific Transcript Dynamics
(223) TimeLapse-seq was applied using treatment conditions optimized for studying mRNA turnover (4 hour s.sup.4U) (Russo et al., (2017) Methods, 120:39-48) in a chronic myelogenous leukemia model cell line (K562). Highly reproducible half-life estimates were obtained that correlated with previous observations (Friedel et al., (2009) Nucleic Acids Res. 37:e115;
(224) TimeLapse-seq is based on the establishment of s.sup.4U as a latent convertible nucleoside. The chemistry described here accomplishes the opposite of the chemistry used in bisulfite mapping of methylated bases; that is, it results in conversion of a U to a C analogue rather than C to U, as in bisulfite mapping experiments (Frommer et al., 1992, Proc Natl Acad Sci U.S.A., 89:1827-1831; Hayatsu et al., 1970, Biochemistry, 9:2858-2865). The method reveals different rates of RNA turnover, changes in RNA processing, and acute changes in the transcriptome that are not apparent using standard RNA-seq. TimeLapse-seq is conceptually similar to SLAM-seq (Herzog et al., (2017) Nat. Methods 14:1198-1204), a method that was reported during the revision of this manuscript. Whereas SLAM-seq uses alkylation of the s.sup.4U thione to induce mutations, TimeLapse-seq instead uses an oxidative nucleophilic aromatic substitution reaction to fully recode the hydrogen bonding pattern of s.sup.4U to match the native pattern of cytidine. TimeLapse-seq allowed for the first enrichment-free analysis RNA dynamics transcriptome wide, covering entire transcripts including their intronic sequences. TimeLapse-seq is broadly applicable to any application compatible with metabolic labeling (e.g., TT-seq).
(225) TimeLapse-seq provides a more accessible approach that complements existing methods to study RNA dynamics. Methods that require biochemical enrichment such as TT-seq, PRO-seq and NET-seq are better suited for studying the dynamics of RNA polymerase (e.g., transcriptional pausing) or transcriptional products that do not accumulate. On the other hand, whenever experiments are compatible with metabolic labeling, TimeLapse-seq can capture changes in the new transcript pool that develop over time, including changes in RNAs processing. An important advantage of TimeLapse-seq is that it requires substantially less starting RNA and is internally controlled—the T-to-C mutations are measured relative to the total RNA population of the same sample, thereby avoiding the challenges of external normalization. TimeLapse-seq makes analysis of temporal dynamics accessible to a standard sequencing pipeline, establishing it as a powerful tool to analyze the changing RNA populations that reflect the biological state of a sample. Without being bound to a particular theory, it is believed that TimeLapse-seq will provide a broad and flexible platform to investigate dynamic biological systems.
Example 2
Protocol
(226) Provided below is an exemplary protocol for preparation of a TimeLapse-seq library.
(227) Materials
(228) K562 cells, HyClone RPMI 1640 Media, Fetal bovine serum (FBS), certified, Penicillin-Streptomycin, 100× solution, Phosphate buffered saline (PBS), 1×, 4-thiouridine, DEPC-treated water, Qiagen RNeasy Mini kit, 2-mercaptoethanol (BME), Ethanol, 200 proof, molecular biology grade, 3 M sodium acetate, pH 5.2, 2,2,2-trifluoroethylamine (TFEA), 0.5 M EDTA, pH 8, Sodium periodate (NaIO4), 0.2 mL PCR tube strips, 1.5 mL microcentrifuge tubes, PCR clean, 15 mL conical centrifuge tubes, 1 M dithiothreitol (DTT), 22-gauge disposable needle, Luer slip syringe, Agencocurt RNAClean XP beads, Magnetic PCR tube separation rack, SMARTer Stranded Total RNA-Seq Kit—Pico Input Mammalian, PCR Thermocycler, Nanodrop spectrophotometer, Mini centrifuge for PCR strips, Benchtop microcentrifuge.
(229) Methods
(230) K562 cells were cultured at 37° C. to approximately 50% confluence in RPMI media supplemented with 10% FBS and 1% P/S.
(231) 4-thiouridine was dissolved in a minimal volume of water and 5 mL was added cultured cells at 100 mM final concentration. Cells were agitated gently to evenly distribute the metabolic label and incubated 4 hours at 37° C. Steps were taken to protect 4-thiouridine treated cells and RNA in all subsequent steps from light exposure. The 4-thiouridine treatment time and concentration will vary by cell type and desired application. The provided protocol is an exemplary method to examine relatively long RNA half-lives.
(232) Cells were transferred to a 15 mL conical Eppendorf tube and place on ice for 1 min.
(233) Cells were pelleted by centrifugation at 4° C. for 3 minutes at 300×g in a pre-chilled centrifuge. Cell culture medium was aspirated from the cell pellet.
(234) The cell pellet was rinsed with ice-cold 1× PBS then pelleted and aspirated as above prior to modified RNeasy isolation.
(235) Modified RNeasy Isolation
(236) The cell pellet was resuspended in 350 μl RLT buffer supplemented with 1% BME. The cell suspension was passed through a 22-gauge needle 5 times to lyse the cells and the mix was transferred to a 1.5 mL Eppendorf tube.
(237) 350 μl freshly prepared 70% ethanol was added to the lysis mixture and mixed well by inversion. 700 μl of mixture was transferred to an RNeasy spin column, and centrifuged at >10,000 RPM for 15 seconds. The flow through was discarded.
(238) 700 μl RW1 was added to the column and the column was centrifuged at >10,000 RPM for 15 seconds. The flow through was discarded.
(239) 500 μl RPE supplemented with 1% BME to was added to the column and the column was centrifuged at >10,000 RPM for 15 seconds. The flow through was discarded.
(240) 700 μl freshly prepared 80% ethanol to was added to the column and the column was centrifuged at maximum speed for 2 minutes. The column was transferred to a fresh collection tube and centrifuged at maximum speed for an additional 5 minutes.
(241) The column was transferred to a 1.5 ml Eppendorf tube and 30 μl DEPC-treated water was added directly to the column membrane. The column was allowed to stand 1 min, then centrifuged >10,000 RPM for 1 minute. RNA concentration in the flow through was assessed by nanodrop.
(242) TimeLapse Chemistry
(243) A master mix was created by combining the following on ice (15 μl total per sample, +10% to account for pipetting errors): 0.84 μl 3M sodium acetate, pH 5.2; 12.7 μl DEPC-treated water; 0.2 μl 0.5M EDTA, pH 8; 1.3 μl TFEA, and combining well by vortexing. TFEA is volatile, therefore it was pipetted up and down several times prior to dispensing the reagent to ensure vapor pressure equilibration and accurate volumes.
(244) 15 μl of the above master mix was added to 8.7 μl RNA sample (e.g. 2 μg RNA in DEPC-treated water) in a 0.2 ml PCR tube strip. The reaction was combined well by flicking the PCR tubes, and was briefly spun to collect the sample at the bottom of the tube.
(245) 1.3 μl of a 192 mM solution of NaIO.sub.4 in DEPC-treated water was added to the reaction. The reaction was combined well by flicking the PCR tubes, and was briefly spun to collect the sample at the bottom of the tube.
(246) The sample was incubated at 45° C. for 1 hour in a pre-heated PCR thermocycler with a heated lid. The sample was cooled to 4° C. after incubation.
(247) An equal volume (25 μl) of RNAClean beads was added to each sample and the mixture was gently vortexed to combine and incubated at room temperature for 10 minutes. An aliquot of RNAClean beads was brought to room temperature for 30 minutes prior to use.
(248) A brief spin was performed to collect the sample at the bottom of the tube, and the tube was placed on a magnetic isolation rack until the solution was clear (˜5 min).
(249) The supernatant was removed without disturbing the bead pellet, and 2 washes were performed with 200 μl of freshly prepared 80% ethanol.
(250) After removing the second ethanol wash, a spin was performed to collect the bead pellet at the bottom of the tube, and the beads were recaptured on the magnetic isolation rack for 1 minute. Residual ethanol was removed with a pipette and the bead pellet was allowed to dry until just cracked (2-4 minutes).
(251) 18 μl of DEPC-treated water was added to the dried beads. The samples were flicked until the beads were resuspended, and allowed to rehydrate for 2 minutes.
(252) A brief spin was performed to collect the sample at the bottom of the tube, and the tube was placed on a magnetic isolation rack until the solution was clear (˜2 min).
(253) The supernatant was collected carefully and transferred to a fresh PCR tube strip.
(254) 2 μl of a freshly made 10× reducing master mix (100 μl recipe): 10 μl 1 M Tris-HCl, pH 7.4; 10 μl 1 M DTT; 20 μl 5 M NaCl; 2 μl 0.5 M EDTA, pH 8; 58 μl DEPC-treated water was added to the tube. Samples were incubated at 37° C. for 30 minutes.
(255) Following incubation, the RNA was isolated using 20 μl of RNAClean beads following the steps as described above, and the samples were eluted into 12 μl DEPC-treated water. The RNA concentration and integrity was assessed by bioanalyzer.
(256) The sample then proceeded to undergo RNA-seq library preparation using the SMARTer Stranded Total RNA-Seq Kit-Pico Input Mammalian according to the manufacturer's methods.
(257) While the invention has been disclosed with reference to specific embodiments, it is apparent that other embodiments and variations of this invention may be devised by others skilled in the art without departing from the true spirit and scope of the invention. The appended claims are intended to be construed to include all such embodiments and equivalent variations.