METHOD FOR TREATING CARDIOVASCULAR DISEASE
20210254075 · 2021-08-19
Inventors
Cpc classification
C12N15/1138
CHEMISTRY; METALLURGY
C12N2310/15
CHEMISTRY; METALLURGY
C07K14/4705
CHEMISTRY; METALLURGY
A61P9/04
HUMAN NECESSITIES
International classification
C12N15/113
CHEMISTRY; METALLURGY
Abstract
The invention relates to a method of treating a cardiovascular disease, such as heart failure, in a subject in need comprising the step of administering an inhibitor of bZIP repressor or an activator of p38 or a combination thereof to a subject in need thereby treating the cardiovascular disease. The inhibitor to bZIP repressor is: an inhibitor of ATF3; an inhibitor of JDP2; a co-inhibitor to both ATF3 and JDP2; or a combination of an inhibitor of ATF3 and an inhibitor of JDP2.
Claims
1. A method of treating a cardiovascular disease in a subject in need comprising the step of administering an inhibitor of bZIP repressor or an activator of p38 or a combination thereof to a subject in need thereby treating the cardiovascular disease.
2. The method of claim 1, wherein the inhibitor to bZIP repressor is: an inhibitor of ATF3; an inhibitor of JDP2; a co-inhibitor to both ATF3 and JDP2; or a combination of an inhibitor of ATF3 and an inhibitor of JDP2.
3. The method of claim 2, wherein the inhibitor to ATF3 and the inhibitor to JDP2 are administered simultaneously or sequentially.
4. The method of claim 1, wherein the inhibitor is a protein, a peptide, a small molecule or an agent, which prevents or reduces the expression of the bZIP repressor.
5. The method of claim 1, wherein the activator of p38 is a protein, a peptide, a small molecule or an agent, which increases the activity of the p38.
6. The method of claim 4, wherein the agent which decreases the expression of the bZIP repressor is an inhibitor of the mRNA encoding the bZIP repressor.
7. The method of claim 6, wherein the inhibitor of the mRNA encoding the bZIP repressor is an antisense RNA, triple helix molecule, ribozyme, microRNA, or siRNA that recognizes the bZIP repressor mRNA.
8. The method of claim 5, wherein the agent which increases the expression of the p38 is an mRNA encoding the p38 or an activator thereof.
9. The method of claim 6, wherein the activator of the mRNA encoding the p38 or the activator thereof is an antisense RNA, triple helix molecule, ribozyme, microRNA, or siRNA that recognizes the bZIP repressor mRNA.
10. The method of claim 1, wherein the cardiovascular disease is heart failure.
11. The method of claim 10, wherein the heart failure is a chronic heart failure (CHF).
12. The method of claim 1, wherein the cardiovascular disease is accompanied by maladaptive cardiac remodeling process.
13. The method of claim 1, wherein the cardiovascular disease is accompanied by reduced contractile function.
14. The method of claim 1, wherein the cardiovascular disease is accompanied by maladaptive cardiac remodeling process.
15. The method of claim 1, wherein the cardiovascular disease is accompanied by reduced contractile function.
16. The method of claim 1, wherein the treating is effected by improvement of the contraction of the cardiomyocyte.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0018] The invention is herein described, by way of example only, with reference to the accompanying drawings. With specific reference now to the drawings in detail, it is stressed that the particulars shown are by way of example and for purposes of illustrative discussion of the preferred embodiments of the present invention only, and are presented in the cause of providing what is believed to be the most useful and readily understood description of the principles and conceptual aspects of the invention. In this regard, no attempt is made to show structural details of the invention in more detail than is necessary for a fundamental understanding of the invention, the description taken with the drawings making apparent to those skilled in the art how the several forms of the invention may be embodied in practice.
[0019] In the drawings:
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
DETAILED EMBODIMENTS OF THE INVENTION
[0029] c-Jun dimerization protein (JDP2) and Activating Transcription Factor 3 (ATF3) are closely related basic leucine zipper proteins. Transgenic mice with cardiac expression of either JDP2 or ATF3 showed maladaptive remodeling and cardiac dysfunction. Surprisingly, JDP2 knockout (KO) did not protect the heart following transverse aortic constriction (TAC). Instead, the JDP2 KO mice performed worse than their wild type (WT) counterparts. To test whether the maladaptive cardiac remodeling observed in the JDP2 KO mice is due to ATF3, ATF3 was removed in the context of JDP2 deficiency, referred as double KO mice (dKO). Mice were challenged by TAC, and followed by detailed physiological, pathological and molecular analyses. dKO mice displayed no apparent differences from WT mice under unstressed condition, except a moderate better performance in dKO male mice. Importantly, following TAC the dKO hearts showed low fibrosis levels, reduced inflammatory and hypertrophic gene expression and a significantly preserved cardiac function as compared with their WT counterparts in both genders. Consistent with these data, removing ATF3 resumed p38 activation in the JDP2 KO mice which correlates with the beneficial cardiac function. Collectively, mice with JDP2 and ATF3 double deficiency had reduced maladaptive cardiac remodeling and lower hypertrophy following TAC. As such, the worsening of the cardiac outcome found in the JDP2 KO mice is due to the elevated ATF3 expression. Simultaneous suppression of both ATF3 and JDP2 activity is highly beneficial for cardiac function in health and disease.
[0030] JDP2 and ATF3 are bZIP transcription factors that share 90% homology in their bZIP region. Both proteins can form heterodimers with other bZIP family members and can either suppress or activate transcription as homodimers or heterodimers in a context-dependent manner A key difference between them is their bioavailability and mode of regulation. Whereas JDP2 is ubiquitously expressed, ATF3 is an immediate-early gene that is normally expressed at a low or undetectable level, but is highly induced by numerous stress signals. Interestingly, these proteins regulate the expression of each other. Therefore, deficiency in either one of them results in an elevated expression of the other gene. Thus far, each gene has been shown to play a role in a variety of pathophysiological contexts using various mouse disease models such as cancer, neurodegeneration, diabetes, atherosclerosis, and heart failure. Among these, cardiac disease is a model that has been used to investigate JDP2 and ATF3. Using a gain-of-function approach, it was shown that transgenic mice ectopically expressing either JDP2 or ATF3 displayed maladaptive cardiac remodeling and hypertrophy. The effects were independent of developmental events, since hypertrophic cardiac growth was observed following expression in adult mice using an inducible tet-off system. Further their roles in the heart using a loss-of-function approach was investigated.
[0031] Consistent with the detrimental role of ATF3, its deletion afforded partial cardiac protection in the ATF3 KO mice in phenylephrine infusion model, while in the TAC model, ATF3 had a very mild beneficial outcome compared with WT mice. In contrast, JDP2 deletion resulted in deterioration of cardiac function following TAC. A possible explanation for this discrepancy is that JDP2 overexpression mimics ATF3 function due to their high sequence homology. On the other hand, JDP2 deficiency results in elevated expression of ATF3, which was previously shown to promote cardiac maladaptive remodeling as well. Therefore, both JDP2 overexpression and deficiency results in a net elevation of bZIP repressor activity. This may alter the delicate equilibrium between numerous bZIP family members resulting in a deteriorated outcome. Indeed, in the study it was demonstrated that JDP2 KO mice lacking ATF3 display improved cardiac outcome with preserved contractile function, supporting the above hypothesis. These results were observed in both male and female dKO mice and were significantly different than the expected additive mixed single KO genotypes. The interplay between JDP2 and ATF3 single KOs and dKO and their role in cardiac adaptation or maladaptation under stress is summarized (
[0032] Since the dKO mice are deficient of JDP2 and ATF3 upon fertilization, one caveat is that the improved cardiac performance is due to some yet unidentified developmental beneficial effects, rather than better adaptation to the TAC stress. To address this issue, the mice were analyzed under un-stressed condition. In dKO male mice displayed higher VW/BW ratio than the WT mice. The higher VW/BW ratio in males is due to lower BW and is not observed in female mice. Functionally, dKO mice showed improved cardiomyocyte contractile function when compared with WT mice in both gender. This improvement was sustained in older mice at 50 and 80 weeks of age as well. In contrast, in the females VW/BW ratio, cardiac function and sarcomeric actin levels were indistinguishable between the genotypes; yet, following TAC, the dKO females displayed a cardiac protective phenotype. Thus, the beneficial phenotype that was observed following TAC in the dKO mice is independent of their basal cardiac function, making it unlikely to exhibit cardiac protection due to some unspecified developmental benefits.
[0033] It is noted that, in an apparent contradiction, two studies showed that ATF3 deficiency resulted in a deteriorated phenotype under TAC. The mice were examined at 8 weeks post TAC, while the others at 4 weeks. It is well known that cardiac stress initially induces an adaptive response aiming to preserve cardiac function; however, when stress becomes chronic, the adaptive process turns into a maladaptive one. This fits well with the current understanding of the ATF3 biology. ATF3 is a stress gene induced by a long list of signals that disturb cellular homeostasis. On the one hand, its induction under acute conditions appears to be beneficial, facilitating the cells to adapt. On the other hand, its expression under chronic conditions almost invariably leads to pathological consequences. As an example, acute induction of ATF3 in the pancreatic beta cells upon exposure to glucose increases their ability to up-regulate insulin gene expression and subsequent secretion. However, chronic induction of ATF3 leads to beta cell apoptosis. Thus, the potential dichotomous role of ATF3 under acute versus chronic stress may be an explanation for the apparent discrepancy in the literature (above).
[0034] Both JDP2 and ATF3 are transcription factors. Clearly, an important mechanistic question is “what are the functionally relevant downstream targets for ATF3 and JDP2 in the context of cardiac stress?” It appears that the activity of the p38 signaling pathway plays a significant role and positively correlates with the cardiac function. Previously, it was shown that the p38 pathway was completely abrogated in JDP2 deficient mice following TAC (See Kalfon et al. Int J Cardiol. 2017; 249:357-363). However, the present study showed a resumption of the p38 activation in the dKO mice. In addition, the level of p38 activation in the dKO mice was higher than that in the WT mice with or without TAC, and is correlated with the beneficial cardiac outcomes.
[0035] Although much advance is made through the use of genetically modified mice, compensatory mechanisms can obscure interpretation and may not truly represent the functional role of the targeted molecule. The identification of such compensatory mechanisms in the future is crucial for better understanding the complex interplay between key regulatory molecules.
[0036] In summary, it is suggested that JDP2 and ATF3 double deficiency correlates positively with p38 activation and afforded a beneficial cardiac effect in both genders in response to pressure overload. Current treatments for heart failure are very limited. The inhibition of both JDP2 and ATF3, or the activation of p38 in the heart may serve as promising means to reduce maladaptive cardiac remodeling and improve cardiac function.
[0037] In an embodiment of the invention, there is provided a method of treating a cardiovascular disease in a subject in need comprising the step of administering an inhibitor of bZIP repressor or an activator of p38 or a combination thereof to a subject in need thereby treating the cardiovascular disease.
[0038] In some embodiments of the invention, the inhibitor to bZIP repressor is:
[0039] an inhibitor of ATF3;
[0040] an inhibitor of JDP2;
[0041] a co-inhibitor to both ATF3 and JDP2; or a combination of an inhibitor of ATF3 and an inhibitor of JDP2.
[0042] In some embodiments of the invention, the inhibitor to ATF3 and the inhibitor to JDP2 are administered simultaneously or sequentially.
[0043] In some embodiments of the invention, the inhibitor is a protein, a peptide, a small molecule or an agent, which prevents or reduces the expression of the bZIP repressor.
[0044] In some embodiments of the invention, the activator of p38 is a protein, a peptide, a small molecule or an agent, which increases the activity of the p38.
[0045] In some embodiments of the invention, the agent which decreases the expression of the bZIP repressor is an inhibitor of the mRNA encoding the bZIP repressor.
[0046] In some embodiments of the invention, the inhibitor of the mRNA encoding the bZIP repressor is an antisense RNA, triple helix molecule, ribozyme, microRNA, or siRNA that recognizes the bZIP repressor mRNA.
[0047] In some embodiments of the invention, the agent which increases the expression of the p38 is an mRNA encoding the p38 or an activator thereof.
[0048] In some embodiments of the invention, the activator of the mRNA encoding the p38 or the activator thereof is an antisense RNA, triple helix molecule, ribozyme, microRNA, or siRNA that recognizes the bZIP repressor mRNA.
[0049] In some embodiments of the invention, wherein the cardiovascular disease is heart failure.
[0050] In some embodiments of the invention, the heart failure is a chronic heart failure (CHF).
[0051] In some embodiments of the invention, the cardiovascular disease is accompanied by maladaptive cardiac remodeling process.
[0052] In some embodiments of the invention, the cardiovascular disease is accompanied by reduced contractile function.
[0053] In some embodiments of the invention, the cardiovascular disease is accompanied by maladaptive cardiac remodeling process.
[0054] In some embodiments of the invention, the cardiovascular disease is accompanied by reduced contractile function.
[0055] In some embodiments of the invention, the treating is effected by improvement of the contraction of the cardiomyocyte.
[0056] As used herein, the term “cardiomyocyte” refers to any cell in the cardiac myocyte lineage that shows at least one phenotypic characteristic of a cardiac muscle cell. Such phenotypic characteristics can include expression of cardiac proteins, such as cardiac sarcomeric or myofibrillar proteins or atrial natriuretic factor, or electrophysiological characteristics. As used herein, the term “cardiomyocyte” and “myocyte” are interchangeable.
[0057] As used herein, the term “heart failure” refers to the loss of cardiomyocytes such that progressive cardiomyocyte loss over time leads to the development of a pathophysiological state whereby the heart is unable to pump blood at a rate commensurate with the requirements of the metabolizing tissues or can do so only from an elevated filling pressure. The cardiomyocyte loss leading to heart failure may be caused by apoptotic mechanisms.
[0058] In some embodiments of the invention the subject in need thereof has a damaged myocardium.
[0059] In some embodiments of the invention the subject in need thereof is diagnosed with or suffering from heart failure.
[0060] In some embodiments of the invention the subject in need thereof is diagnosed with or suffering from an age-related cardiomyopathy.
[0061] In some circumstances, one or more symptoms associated with cardiovascular diseases, e.g., heart failure, myocardial infarction, an age-related cardiomyopathy or a damaged myocardium, can be reduced or alleviated following administration of the inhibitors to bZIP repressor and in particular from a combined treatment with an inhibitor of ATF3 and an inhibitor of JDP2. Symptoms of heart failure include, but are not limited to, fatigue, weakness, rapid or irregular heartbeat, dyspnea, persistent cough or wheezing, edema in the legs and feet, and swelling of the abdomen. Symptoms for myocardial infarction include, but are not limited to, prolonged chest pain, heart palpitations (i.e. abnormality of heartbeat), shortness of breath, and extreme sweating. Non-limiting symptoms of an age-related cardiomyopathy, e.g., restrictive cardiomyopathy, include coughing, difficulty breathing during normal activities or exercise, extreme fatigue, and swelling in the abdomen as well as the feet and ankles.
[0062] In some embodiments of the invention, the treatment of the invention is considered to be pharmaceutically effective if the dosage alleviates at least one symptom of cardiovascular disease described above by at least about 10%, at least about 15%, at least about 20%, at least about 30%, at least about 40%, or at least about 50%. In one embodiment, at least one symptom is alleviated by more than 50%, e.g., at least about 60%, or at least about 70%. In another embodiment, at least one symptom is alleviated by at least about 80%, at least about 90% or greater, as compared to a subject having the same disease that was not treated by an inhibitor of bZIP repressor and in particular was not treated by a combination of an inhibitor to ATF3 and an inhibitor to JDP2.
[0063] In some embodiments of the invention, the treatment of the invention is considered to be pharmaceutically effective if the dosage alleviates the cardiomyocytes contractile function in at least about 10%, at least about 15%, at least about 20%, at least about 30%, at least about 40%, or at least about 50%. In one embodiment, the cardiomyocytes contractile function is alleviated by more than 50%, e.g., at least about 60%, or at least about 70%. In another embodiment, the cardiomyocytes contractile function is alleviated by at least about 80%, at least about 90% or greater, as compared to a subject having the same disease that was not treated by an inhibitor of bZIP repressor and in particular was not treated by a combination of an inhibitor to ATF3 and an inhibitor to JDP2.
[0064] In some embodiments of the invention, the treatment of the invention is considered to be pharmaceutically effective if the dosage alleviates the contractile function of the cardiac sarcomere
[0065] in at least about 10%, at least about 15%, at least about 20%, at least about 30%, at least about 40%, or at least about 50%. In one embodiment, the contractile function of the cardiac sarcomere is alleviated by more than 50%, e.g., at least about 60%, or at least about 70%. In another embodiment, the contractile function of the cardiac sarcomere is alleviated by at least about 80%, at least about 90% or greater, as compared to a subject having the same disease that was not treated by an inhibitor of bZIP repressor and in particular was not treated by a combination of an inhibitor to ATF3 and an inhibitor to JDP2.
[0066] In some embodiments of the invention, the potential small molecules inhibitors may be screened using a reporter of ATF3 and/or JDP2 activity. This can be done, for example, by using a reporter cell line designed to report for bZIP repression activity using a luciferase reporter. Such a reporter has a basal activity which is dampened by a JDP2 and/or ATF3 activity Small molecule that is able to suppress bZIP activity is expected to relief the luciferase activity up to the level presented by the reporter cell line in the absence of either JDP2 or ATF3 expression.
The small molecule inhibitor can function through several mechanisms including inhibition of the association of the bZIP repressor with their cognate DNA binding elements, prevent homo and hetero dimerization, or prevent association with histone deacetylase proteins (HDAC).
EXAMPLES
Materials and Methods
Mice
[0067] All animal studies have been approved by the Technion animal ethics committee and have therefore been performed in accordance with the ethical standards laid down in the 1964 Declaration of Helsinki and its later amendments. This study was carried out in strict accordance with the Guide for the Care and Use of Laboratory Animals of the National Institute of Health. In addition, the protocol was approved by the Committee of the Ethics of Animal Experiments of the Technion. All surgeries were performed under isoflurane anesthesia and all efforts were made to minimize mice suffering using Buprenorphine injection post-surgery (120 μg/Kg). The ATF3 gene is located on chromosome 1, whereas the JDP2 gene is located on chromosome 12. C57BL/6 mice with whole-body ATF3-KO and JDP2-KO were crossed in a ratio of female:male=2:1. This enabled the generation of double knock-out mice (designated hereafter dKO). The dKO mice were born in a Mendelian distribution, and display no overt phenotype. Male and female mice were used in all the experiments performed in this study and analyzed separately.
TAC Surgery
[0068] All experimental protocols were approved by the Institutional Committee for Animal Care and Use at the Technion, Israel Institute of Technology, Faculty of Medicine, Haifa, Israel. All study procedures were complied with the Animal Welfare Act of 1966 (P.L. 89-544), as amended by the Animal Welfare Act of 1970 (P.L.91-579) and 1976 (P.L. 94-279). Transverse aortic constriction (TAC) surgery was performed on male and female Wild type (WT) and dKO mice (10-12 weeks old). All TAC procedures along this study were performed by a single person blinded to the mice genotype.
Magnetic Resonance Imaging (MRI) Acquisition and Analysis
[0069] Cardiac MRI was performed to measure cardiac function and determine the severity of the TAC surgery. Details of the MRI and all other related experimental methods were described previously in Kalfon R, Haas T, Shofti R, Moskovitz J D, Schwartz O, Suss-Toby E, et al. c-Jun dimerization protein 2 (JDP2) deficiency promotes cardiac hypertrophy and dysfunction in response to pressure overload. Int J Cardiol. 2017; 249:357-363. EF was calculated as follows: EF (%)=[(LVEDV−LVESV)/LVEDV] *100.
Echocardiography
[0070] Mice were anesthetized with 1% of isoflurane and kept on a 37° C. heated plate throughout the procedure. An echocardiography was performed using a Vevo2100 micro-ultrasound imaging system (VisualSonics, Fujifilm) which was equipped with 13-38 MHz (MS 400) and 22-55 MHz (MS550D) linear array transducers. Those performing echocardiography and data analysis were blinded to the mice genotype. Cardiac size, shape, and function were analyzed by conventional two-dimensional imaging and M-Mode recordings. Maximal left ventricular end-diastolic (LVDd) and end-systolic (LVDs) dimensions were measured in short-axis M-mode images. Fractional shortening (FS) was calculated as follows: FS (%)=[(LVDd-LVDs)/LVDd] X 100. All values were based on the average of at least five measurements.
Heart Harvesting
[0071] Following eight weeks of TAC, mice were anesthetized, weighed and sacrificed.
[0072] Hearts were excised, and ventricles were weighed and then divided into three pieces that were used for protein extraction, RNA purification, and histological analysis.
mRNA Extraction
[0073] mRNA was purified from ventricles using an Aurum total RNA fatty or fibrous tissue kit (#732-6830, Bio-Rad) according to the manufacturer's instructions.
Quantitative Real Time PCR (qRT-PCR)
[0074] cDNA was synthesized from 800 ng of purified mRNA derived from the ventricles. Purified mRNA was added to a total reaction mix of high-capacity cDNA reverse transcription kit (#4368814, Applied Biosystems) in a final volume of 20 μl. Real-time PCR was performed using Rotor-Gene 6000TM (Corbett) equipment with absolute blue SYBR green ROX mix (Thermo Scientific AB-4162/B). Serial dilutions of a standard sample were included for each gene to generate a standard curve. Values were normalized to ubiquitin-conjugating enzyme E2D 2A (Ube2d2a) expression levels. The primer sequences are shown in Table 1 below.
TABLE-US-00001 Primer Sequence ATF3 F- GAGGATTTTGCTAACCTGACACC (SEQ IS No. 1) R- TTGACGGTAACTGACTCCAGC (SEQ IS No. 2) ACTA1 F- CCCAAAGCTAACCGGGAGAAG (SEQ IS No. 3) R- CCAGAATCCAACACGATGCC (SEQ IS No. 4) ACTA2 F- GTCCCAGACATCAGGGAGTAA (SEQ IS No. 5) R- TCGGATACTTCAGCGTCAGGA (SEQ IS No. 6) ACTC1 F- GTGCCAGGATGTGTGACGA (SEQ IS No. 7) R- CTGTCCCATACCCACCATGAC (SEQ IS No. 8) BNP F- GAGGTCACTCCTATCCTCTGG (SEQ IS No. 9) R- GCCATTTCCTCCGACTTTTCTC (SEQ IS No. 10) αMHC F- TGCAAAGGCTCCAGGTCTGA (SEQ IS No. 11) R- CTTGAACCTGTCCAACCACAA (SEQ IS No. 12) col1α F- CTGGCGGTTCAGGTCCAAT (SEQ IS No. 13) R- TTCCAGGCAATCCACGAGC (SEQ IS No. 14) F4/80 F- CCCCAGTGTCCTTACAGAGTG (SEQ IS No. 15) R- GTGCCCAGAGTGGATGTCT (SEQ IS No. 16) IL-1β F- GCAACTGTTCCTGAACTCAACT (SEQ IS No. 17) R- ATCTTTTGGGGTCCGTCAACT (SEQ IS No. 18) IL-6 F- TAGTCCTTCCTACCCCAATTTCC (SEQ IS No. 19) R- TTGGTCCTTAGCCACTCCTTC (SEQ IS No. 20) JDP2 F- GAAGAAGAGCGAAGGAAAAGGC (SEQ IS No. 21) R- GCATCAGGATAAGCTGTTGCC (SEQ IS No. 22) TGFβ3 F- CCTGGCCCTGCTGAACTTG (SEQ IS No. 23) R- GACGTGGGTCATCACCGAT (SEQ IS No. 24) Ube2d2a F- ACAAGGAATTGAATGACCTGGC (SEQ IS No. 25) R- CACCCTGATAGGGGCTGTC (SEQ IS No. 26)
Cell Size Analysis
[0075] Heart tissue was fixed in 4% formaldehyde overnight, embedded in paraffin, serially sectioned at 10 μm intervals, and then mounted on slides. Sections were stained following deparaffinization with Wheat-germ agglutinin FITC-conjugated (Sigma Aldrich Cat #L4895) and diluted to a 1:100 phosphate-buffered saline (PBS). Sections were washed three times with PBS and mounted in Fluorescence Mounting Medium (Dako, S3023). Images were acquired by using panoramic flash series digital scanner (3DHistech Pannoramic 250 Flash III). Quantification of the cell size was performed with Image Pro Plus software. Five fields in each slide were photographed. Unstained areas were then identified and segmented using Image Pro Plus software. In each stained area, the mean cell perimeter and area was calculated, and the number of cells was measured.
Fibrosis Staining
[0076] Heart tissue was fixed in 4% formaldehyde overnight, embedded in paraffin, serially sectioned at 10 μm intervals, and then mounted on slides. Masson's trichrome staining was performed according to the standard protocol. Images were acquired by using Virtual Microscopy (Olympus). The percent of the interstitial fibrosis was determined as the ratio of the fibrosis area to the total area of the heart section using Image Pro Plus software.
Western Blot Analysis and Quantification
[0077] Harvested tissues were homogenized in RIPA buffer (PBS containing 1% NP-40, 5 mg/ml Na-deoxycholate, 0.1% SDS) and supplemented with a protease inhibitor cocktail (P-8340, Sigma Aldrich). Homogenization was performed at 4° C. using the Bullet Blender homogenizer (BBX24; Next advance) according to the manufacturer's instructions as previously described (Koren, 2015 #1364).
Antibodies
[0078] The primary antibodies used: anti-phospho-ERK (Cat #M-9692) was purchased from Sigma Aldrich. Anti-p38 (Cat #9212), anti-phospho-p38 (Cat #9211) and anti-ERK (Cat #9102) were purchased from Cell Signaling.
Statistics
[0079] The data in here is expressed as means±SE. The comparison between several means was analyzed by one-way ANOVA followed by Tukey's post hoc analysis. All statistical analyses were performed using GraphPad Prism 5 software (La Jolla, Calif.). A P value ≤0.05 was accepted as statistically significant.
EXPERIMENTAL RESULTS
Example 1
[0080] To test the hypothesis that elevated expression of ATF3 in JDP2-KO mice is responsible for the deteriorated cardiac phenotype following TAC, ATF3 was deleted in the JDP2-KO background by crossing the JDP2 KO with the ATF3-KO mice to generate the whole body dKO mice.
Analysis of Cardiac Hypertrophy at Basal
[0081] The mice under control (unstressed) condition was examined first. Hearts from 20-weeks-old dKO male mice were bigger in size and had a slightly higher (statistically significant, P<0.05) ventricular weight/body weight (VW/BW) ratio than the WT male mice (
Example 2
Analysis of Cardiac Hypertrophy Following TAC
[0082] To test the role of dual deficiency in JDP2 and ATF3 expression in stress-induced cardiac remodeling, 12-week-old mice were exposed to TAC for 8 weeks before analyses. To reveal the potential role of ATF3 and JDP2, their expression levels following TAC was assessed by qRT-PCR (
[0083] To assess the size of cardiomyocytes following TAC, heart sections were stained by fluorescently labeled wheat germ agglutinin to delineate the cell boundary, and cardiomyocyte cross sectional area (CSA) of control and TAC-operated mice was calculated. In both genders, WT mice showed an increase of cardiomyocyte CSA by about 50% following TAC, but the dKO mice showed no significant increase (
Example 3
Analyses of Fibrosis and Inflammatory Markers
[0084] The cardiac fibrosis as part of cardiac remodeling hallmark was next examined. Quantitative analysis of fibrosis showed no difference between the genotypes at baseline (
[0085] The inflammatory response of the heart following TAC was next examined by examining IL-6 and IL-1β inflammatory markers, and F4/80, the marker for macrophages. All three markers were lower in TAC-operated dKO male mice than in the WT counterparts (
[0086] In previous analyses of JDP2 KO mice, the activation of p38 was completely lost following TAC, and this lack of p38 activation correlated with maladaptive cardiac remodeling in these mice. Thus, the activation state of p38 was examined by immunoblot. At baseline, a higher phospho-p38/p38 ratio was observed in the hearts of dKO mice as compared with WT (
Example 4
[0087] Analyses of Cardiac Function: The JDP2/ATF3 dKO Mice Performed Better than the WT Mice Under TAC
[0088] Maladaptive cardiac remodeling characterized by hypertrophy, inflammation and fibrosis is associated with reduced cardiac function. To assess cardiac contractile function, MRI was used to calculate ejection fraction (EF) in control and TAC-operated male mice. The calculated EF in control mice suggests an improved basal contractile function in the dKO mice (higher EF than WT) at 20 weeks of age (
TABLE-US-00002 TABLE 2 Table 2 demonstrates the following parameters that were measured: left ventricular (LV) mass, left ventricular end-diastolic (LVEDV) and left ventricular end-systolic volume (LVESV), and ejection fraction (EF) was calculated. The results represent the mean ± SE of the indicated number (n) of animals per group. Control TAC (n) WT (6) dKO (6) WT (7) dKO (8) LVEDV, 55.4 ± 3.9 62.3 ± 4.5 69.3 ± 3.4 63.9 ± 3.4 .sup. μl LVESV, 25.8 ± 2.2 22.8 ± 2.6 42.7 ± 5.9*** 29.7 ± 2.1***.sup.† μl LV mass, 76.3 ± 5.3 72.8 ± 5.6 124.8 ± 3.7*** 105.4 ± 4.2***.sup.† mg EF, % 53.5 ± 2.0 .sup. 63.5 ± 2.5.sup.† 37.4 ± 4.2*** 53.7 ± 2.4.sup.† ***P ≤ 0.05, control vs. TAC; .sup.†P ≤ 0.05, difference between genotypes.
TABLE-US-00003 TABLE 3 Table 3 shows age-related decline in cardiac function as was assessed at 50- and 80-weeks-old mice. Results were compared with control mice (20 weeks old). Left ventricular cardiac volumes, mass and function were examined by a cardiac MRI as described in FIG. 4A. The results represent the mean ± SE of the indicated number (n) of animals per group. 50 weeks old 80 weeks old (n) WT (10) dKO (12) WT (9) dKO (12) LVEDV, 63.1 ± 3.0 66.2 ± 3.0 60.0 ± 4.3 64.1 ± 4.1 μl LVESV, 28.1 ± 1.7 25.9 ± 1.8 30.8 ± 3.6 26.9 ± 2.9 μl LV mass, 76.1 ± 2.9 77.0 ± 4.4 87.8 ± 3.1 82.8 ± 5.6 mg EF, % 54.8 ± 2.7 .sup. 61.1 ± 1.5.sup.† 49.3 ± 3.1*** .sup. 58.8 ± 2.6.sup.† ***P ≤ 0.05, control vs. TAC; .sup.†P ≤ 0.05, difference between genotypes. ***P ≤ 0.05, different from 20- and 50-weeks-old mice; .sup.†P ≤ 0.05, difference between genotypes.
[0089] At basal, no significant differences in FS was observed between WT and dKO control mice (
TABLE-US-00004 TABLE 4 Table 4 is a table showing that dKO female mice preserve contractile function following TAC. Cardiac hypertrophy was induced by TAC in female mice. Eight weeks following TAC, mice hearts were examined by micro ultrasound. The following parameters were measured: interventricular septal end diastole (IVSd); left ventricular posterior wall end diastole (LVPWd); maximal left ventricular internal end-diastole (LVIDd); end-systole (LVIDs); and fractional shortening (FS). FS was assessed according to: FS (%) = [(LVDd − LVDs)/LVDd] * 100. All results represent the means ± SE of the indicated number (n) of animals per group. Control TAC (n) WT (6) dKO (6) WT (7) dKO (9) IVSd, 0.73 ± 0.02 0.72 ± 0.02 0.94 ± 0.04*** 0.93 ± 0.04*** mm LVPWd, 0.78 ± 0.04 0.73 ± 0.02 1.05 ± 0.05*** 0.94 ± 0.03*** mm LVIDd, 3.82 ± 0.11 3.78 ± 0.07 4.47 ± 0.15*** 4.17 ± 0.14 mm LVIDs, 2.75 ± 0.10 2.65 ± 0.10 3.91 ± 0.24*** 3.06 ± 0.10.sup.† mm FS, % 28.0 ± 0.77 29.9 ± 1.50 14.0 ± 2.78*** 26.4 ± 1.10.sup.† ***P ≤ 0.05, control vs. TAC; .sup.†P ≤ 0.05, difference between genotypes.
[0090] Collectively, following TAC, the hearts derived from both WT and dKO mice underwent hypertrophy, yet, the hearts derived from dKO mice showed reduced cardiac hypertrophy and suppressed maladaptive remodeling processes with highly preserved contractile function as compared with WT mice in both genders.
[0091] While certain features of the invention have been illustrated and described herein, many modifications, substitutions, changes, and equivalents will now occur to those of ordinary skill in the art. It is, therefore, to be understood that the appended claims are intended to cover all such modifications and changes as fall within the true spirit of the invention.