Nucleic acid unit and polymeric nucleic acid and application thereof

Abstract

Disclosed are a new-type nucleic acid unit for construction of a polymeric nucleic acid and the polymeric nucleic acid for interfering with target gene expression. In the present application, by design and construction of the new-type nucleic acid unit and the self-assembled polymeric nucleic acid thereof, multiple target interference may be realized, wherein the same may be used for inhibiting multiple gene expressions in a signaling pathway of disease occurrence or development, or simultaneously inhibiting multiple disease target genes expression, possessing broad application prospects in multiple subject fields such as biology and chemistry. The polymeric nucleic acid may target multiple sequences simultaneously, wherein the sequences may be located in one or more genes.

Claims

1. A polymeric nucleic acid molecule for interfering with an expression of a target gene, wherein the polymeric nucleic acid molecule is formed by n X-type nucleic acid molecules; each of the X-type nucleic acid molecules is formed by a targeting segment I, a targeting segment II and a linker segment III successively from a 5′-end; the targeting segment I of each of the X-type nucleic acid molecules is complementary-paired with the linker segment III of an adjacent X-type nucleic acid molecule thereof; the targeting segment I and the targeting segment II of each of the X-type nucleic acid molecules is complementary-paired with a target gene; a length of each of the X-type nucleic acid molecules is the same; and the n is an integer greater than or equal to 3.

2. The polymeric nucleic acid molecule as claimed in claim 1, wherein the polymeric nucleic acid molecule further comprises a H-type nucleic acid molecule; the H-type nucleic acid molecule is formed by a H1-type nucleic acid molecule and a Hn-type nucleic acid molecule; the n X-type nucleic acid molecules are respectively named as an X1 unit, an X2 unit, an X3 unit, and so on, an Xn-1 unit, and an Xn unit; the linker segment III of the X1 unit is complementary-paired with the targeting segment I of the X2 unit, the linker segment III of the X2 unit is complementary-paired with the targeting segment I of the X3 unit, and so on, the linker segment III of the Xn-1 unit is complementary-paired with the targeting segment I of the Xn unit; the H1-type nucleic acid molecule is complementary-paired with the targeting segment I of the X1 unit, and the Hn-type nucleic acid molecule is complementary-paired with the linker segment III of the Xn unit.

3. The polymeric nucleic acid molecule as claimed in claim 2, wherein 5′-end or 3′-end of the H-type nucleic acid molecule further comprises a Hy segment; and the H-type nucleic acid molecule is formed by an Hx segment and the Hy segment; the Hx segment of the H1-type nucleic acid molecule is complementary-paired with the targeting segment I of the X1 unit; the Hx segment of the Hn-type nucleic acid molecule is complementary-paired with the linker segment III of the Xn unit; and the Hy segment is complementary-paired with one, two or more continuous nucleic acid molecules of the targeting segment II of the X1 unit or the Xn unit from 5′-end or 3′-end.)

4. The polymeric nucleic acid molecule as claimed in claim 1, wherein the polymeric nucleic acid molecule further comprises a C-type nucleic acid molecule; the C-type nucleic acid molecule is formed by n segments connected successively, the n segments are respectively reverse complementary sequences of the targeting segment II in the n X-type nucleic acid molecules.

5. The polymeric nucleic acid molecule as claimed in claim 1, the polymeric nucleic acid molecule further comprises a C-type nucleic acid molecule; the C-type nucleic acid molecule is formed by n segments connected successively, the n segments are respectively reverse complementary sequences of the targeting segment II in the n X-type nucleic acid molecules; wherein the X-type nucleic acid molecule, the H-type nucleic acid molecule and the C-type nucleic acid molecule are a single-stranded RNA molecule.

6. The polymeric nucleic acid molecule as claimed in claim 1, wherein a length of the X-type nucleic acid molecule is 15-50 nt; preferably is 24-36 nt; a length of the targeting segment I is 5-24 nt; a length of the targeting segment II is 1-20 nt; a length of the linker segment III is 5-24 nt; and a sum of the lengths of the targeting segment I and the targeting segment II is 14-16 nt at least.

7. (canceled)

8. The polymeric nucleic acid molecule as claimed in claim 1, wherein the polymeric nucleic acid molecule at least comprises a modified nucleotide; preferably, a modification of the modified nucleotide is a phosphoric acid backbone modification, a base modification and/or a ribose modification; more preferably, the ribose modification is that a ribose 2-site hydroxyl group is substituted by a halogen group or an O-alkyl group; further preferably, an alkyl of the O-alkyl group is a methyl, an ethyl, a propyl or a methylethyl.

9. (canceled)

10. (canceled)

11. (canceled)

12. The polymeric nucleic acid molecule as claimed in claim 8, wherein the ribose 2-site hydroxyl groups of 5-9 continuous nucleotides, from the first nucleotide at the 3′-end, of the linker segment III of the X-type nucleic acid molecule are substituted by the halogen group or the O-alkyl group; or, the ribose 2-site hydroxyl groups of 5-9 continuous nucleotides, from the first nucleotide at the 3′-end, of the Hx segment of the H-type nucleic acid molecule are substituted by the halogen group or the O-alkyl group; or, the ribose 2-site hydroxyl groups of 8-30 continuous nucleotides, from the first nucleotide at the 3′-end, of the H-type nucleic acid molecule are substituted by the halogen group or the O-alkyl group; or, the ribose 2-site hydroxyl groups of 2-6 continuous nucleotides, from the first nucleotide at the 5′-end, of each segment in the C-type nucleic acid molecule complementary-paired with the targeting segment II of the X-type nucleic acid molecule are substituted by the halogen group or the O-alkyl group.)

13. The polymeric nucleic acid molecule as claimed in claim 12, wherein the ribose 2-site hydroxyl groups of 14-18 continuous nucleotides, from the first nucleotide at the 3′-end, of the H-type nucleic acid molecule are substituted by the halogen group or the O-alkyl group.)

14. The polymeric nucleic acid molecule as claimed in claim 1, wherein the n is 3 or 4 or 5 or 6 or 7 or 8.

15. (canceled)

16. The polymeric nucleic acid molecule as claimed in claim 1, wherein the number of the target gene is one or two or more, and the number of the target gene does not exceed n; or, the number of the target gene is 1 or 4 or 6.)

17. The polymeric nucleic acid molecule as claimed in claim 1, wherein the target gene is at least one of the following genes: PPIB, p65, BIRC5, CTNNB, COPS5, CLU, EIF4E, HIF1A, TP53, VEGFA and SOD1.

18. The polymeric nucleic acid molecule as claimed in claim 17, wherein the polymeric nucleic acid molecule for interfering with an expression of the target gene PP1B is the following a1)-a5): a1) is formed by single-stranded RNA molecules shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4; a2) is formed by single-stranded RNA molecules shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 20 and SEQ ID NO: 21; a3) is formed by single-stranded RNA molecules shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4 and SEQ ID NO: 8; a4) is formed by single-stranded RNA molecules shown in SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11 and SEQ ID NO: 12; a5) is formed by single-stranded RNA molecules shown in SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 6, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 13 and SEQ ID NO: 14; or, the polymeric nucleic acid molecule for interfering with an expression of the target gene P65 is the following b1)-b5): b1) is formed by single-stranded RNA molecules shown in SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17 and SEQ ID NO: 18; b2) is formed by single-stranded RNA molecules shown in SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17 and SEQ ID NO: 19; b3) is formed by single-stranded RNA molecules shown in SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18 and SEQ ID NO: 22; b4) is formed by single-stranded RNA molecules shown in SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 23, SEQ ID NO: 24 and SEQ ID NO: 25; b5) is formed by single-stranded RNA molecules shown in SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 20, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 26 and SEQ ID NO: 27; or, the polymeric nucleic acid molecule for simultaneously interfering with expressions of the target genes BIRC5, CTNNB, COPS5 and CLU is formed by single-stranded RNA molecules shown in SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30 and SEQ ID NO: 31; or, the polymeric nucleic acid molecule for simultaneously interfering with expressions of the target genes BIRC5, CTNNB, COPS5, CLU, EIF4E and HIF1A is formed by single-stranded RNA molecules shown in SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 33 and SEQ ID NO: 34; or, the polymeric nucleic acid molecule for simultaneously interfering with expressions of the target genes SOD1, PP1B, P65 and VEGFA is the following c1)-c3): c1) is formed by single-stranded RNA molecules shown in SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37 and SEQ ID NO: 38; c2) is formed by single-stranded RNA molecules shown in SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39 and SEQ ID NO: 40; c3) is formed by single-stranded RNA molecules shown in SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38 and SEQ ID NO: 41; or, the polymeric nucleic acid molecule for interfering with an expression of the target gene VEGFA is the following d1)-d11): d1) is formed by single-stranded RNA molecules shown in SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO:46 and SEQ ID NO: 47; d2) is formed by single-stranded RNA molecules shown in SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52 and SEQ ID NO: 53; d3) is formed by single-stranded RNA molecules shown in SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58 and SEQ ID NO: 59; d4) is formed by single-stranded RNA molecules shown in SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 46 and SEQ ID NO: 47; d5) is formed by single-stranded RNA molecules shown in SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 52 and SEQ ID NO: 53; d6) is formed by single-stranded RNA molecules shown in SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 58 and SEQ ID NO: 59; d7) is formed by single-stranded RNA molecules shown in SEQ ID NO: 42, SEQ ID NO: 45, SEQ ID NO: 46 and SEQ ID NO: 47; d8) is formed by single-stranded RNA molecules shown in SEQ ID NO: 48, SEQ ID NO: 51, SEQ ID NO: 52 and SEQ ID NO: 53; d9) is formed by single-stranded RNA molecules shown in SEQ ID NO: 54, SEQ ID NO: 57, SEQ ID NO: 58 and SEQ ID NO: 59; d10) is formed by single-stranded RNA molecules shown in SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 64 and SEQ ID NO: 65; d11) is formed by single-stranded RNA molecules shown in SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 70 and SEQ ID NO: 71; or, the polymeric nucleic acid molecule for interfering with an expression of the target gene TP53 is the following e1 )-e11): e1) is formed by single-stranded RNA molecules shown in SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76 and SEQ ID NO: 77; e2) is formed by single-stranded RNA molecules shown in SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 81, SEQ ID NO: 82 and SEQ ID NO: 83; e3) is formed by single-stranded RNA molecules shown in SEQ ID NO: 84, SEQ ID NO: 85, SEQ ID NO: 86, SEQ ID NO: 87, SEQ ID NO: 88 and SEQ ID NO: 89; e4) is formed by single-stranded RNA molecules shown in SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76 and SEQ ID NO: 77; e5) is formed by single-stranded RNA molecules shown in SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 81, SEQ ID NO: 82 and SEQ ID NO: 83; e6) is formed by single-stranded RNA molecules shown in SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 58 and SEQ ID NO: 59; e7) is formed by single-stranded RNA molecules shown in SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76 and SEQ ID NO: 77; e8) is formed by single-stranded RNA molecules shown in SEQ ID NO: 80, SEQ ID NO: 81, SEQ ID NO: 82 and SEQ ID NO: 83; e9) is formed by single-stranded RNA molecules shown in SEQ ID NO: 86, SEQ ID NO: 87, SEQ ID NO: 88 and SEQ ID NO: 89; e10) is formed by single-stranded RNA molecules shown in SEQ ID NO: 90, SEQ ID NO: 91, SEQ ID NO: 92, SEQ ID NO: 93, SEQ ID NO: 94 and SEQ ID NO: 95; and e11) is formed by single-stranded RNA molecules shown in SEQ ID NO: 96, SEQ ID NO: 97, SEQ ID NO: 98, SEQ ID NO: 99, SEQ ID NO: 100 and SEQ ID NO: 101.

19. A derivative of the polymeric nucleic acid molecule as claimed in claim 1 is any one of the following (m1)-(m5): (m1) the polymeric nucleic acid molecule as claimed in claim 1 is deleted or added one or more nucleotides, to obtain a derivative of the polymeric nucleic acid molecule having the same function as the polymeric nucleic acid molecule; (m2) the polymeric nucleic acid molecule as claimed in claim 1 is performed nucleotide substitution or modification, to obtain a derivative of the polymeric nucleic acid molecule having the same function as the polymeric nucleic acid molecule; (m3) a backbone of the polymeric nucleic acid molecule as claimed in claim 1 is transformed into a phosphorothioate backbone, to obtain a derivative of the polymeric nucleic acid molecule having the same function as the polymeric nucleic acid molecule; (m4) a peptide nucleic acid, a locked nucleic acid or an unlocked nucleic acid coded by the polymeric nucleic acid molecule as claimed in claim 1 is used, to obtain a derivative of the polymeric nucleic acid molecule having the same function as the polymeric nucleic acid molecule; and (m5) one end or middle of the polymeric nucleic acid molecule as claimed in claim 1 is linked with a signal molecule and/or an active molecule and/or a functional group, to obtain a derivative of the polymeric nucleic acid molecule having the same function as the polymeric nucleic acid molecule.

20. A preparation method for the polymeric nucleic acid molecule as claimed in claim 1, comprising the following steps: M1) synthesizing the X-type nucleic acid molecule and/or the H-type nucleic acid molecule and/or the C-type nucleic acid molecule of the polymeric nucleic acid molecule as claimed in claim 1; and M2) annealing the X-type nucleic acid molecule and/or the H-type nucleic acid molecule and/or the C-type nucleic acid molecule, to obtain the polymeric nucleic acid molecule.)

21. An application of the polymeric nucleic acid molecule as claimed in claim 1 in the following method -A1) or A2): A1) controlling a target gene expression level in a cell; A2) preparing a product for preventing and/or relieving and/or treating a disease caused by the target gene expression.

22. The application as claimed in claim 21, wherein the controlling is inhibition or reduction or interference; preferably, the cell is a tumor cell.

23. (canceled)

24. The application as claimed in claim 21, wherein the target gene is a disease-related gene; or, the disease-related gene is a tumor-related gene; or, the tumor-related gene is at least one of the following genes: PPIB, p65, BIRC5, CTNNB, COPS5, CLU, EIF4E, HIF1A, TP53, VEGFA and SOD1.

25. A reagent or a kit or a drug for inhibiting or reducing or interfering with a target gene expression level in a cell, comprising the polymeric nucleic acid molecule as claimed in claim 1 .

26. A method for inhibiting or reducing or interfering with a target gene expression level in a cell, comprising the following steps: the polymeric nucleic acid molecule as claimed in claim 1 is introduced into the cell, and the expression level of the target gene in the cell is inhibited or reduced.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0120] FIG. 1 is a schematic diagram of a targeting nucleic acid unit X-type.

[0121] FIG. 2 is a schematic diagram of a flanking nucleic acid unit H-type.

[0122] FIG. 3 is a schematic diagram of a capping-end nucleic acid unit C-type.

[0123] FIG. 4 is a plane and ring schematic diagram of an R-structure polymeric nucleic acid. The upper diagram is a plane schematic diagram of the R-structure polymeric nucleic acid. The lower diagram is a ring schematic diagram of the R-structure polymeric nucleic acid (left: R=(Xi)4; and right: R=(Xi)6).

[0124] FIG. 5 is a plane schematic diagram of an L-structure polymeric nucleic acid.

[0125] FIG. 6 is a plane schematic diagram of a Cr-structure polymeric nucleic acid.

[0126] FIG. 7 is a single-gene relative expression level.

[0127] FIG. 8 is a multi-gene relative expression level.

[0128] FIG. 9 is a multi-gene relative expression level (n=4).

DETAILED DESCRIPTION OF THE EMBODIMENTS

[0129] Unless otherwise specified, experiment methods used in the following embodiments are conventional methods.

[0130] Unless otherwise specified, materials, reagents and the like used in the following embodiments may be obtained from commercial sources.

Embodiment 1. Design and synthesis of nucleic acid units and polymeric nucleic acids

[0131] I. Design of Nucleic Acid Unit

[0132] The present disclosure designs three types of nucleic acid units which are respectively named as an X-type targeting nucleic acid unit, an H-type flanking nucleic acid unit, and a C-type capping-end nucleic acid unit. These nucleic acid units may be freely combined into polymeric nucleic acids in various structures.

[0133] 1. Targeting Nucleic Acid Unit: X-Type

[0134] A structure of the X-type targeting nucleic acid unit is as follows: 5i-T1-T2-A3-3′. Herein T1 is a targeting segment I, T2 is a targeting segment II, A3 is a linker segment III, the T1 and T2 forms a sequence complementary to a target gene sequence. In certain specific cases, a region complementary to the target gene sequence may be extended to a partial sequence of the A3. A length of the X-type targeting nucleic acid unit is 15-50 nt, preferably 24-36 nt. Herein a length of the T1 is 5-24 nt, a length of the T2 is 1-20 nt, and a length of the A3 is 5-24 nt. The schematic diagram of the X-type targeting nucleic acid unit is as shown in FIG. 1.

[0135] 2. Flanking Nucleic Acid Unit: H-Type

[0136] A structure of the H-type flanking nucleic acid unit is as follows: 3′-Hx-Hy-5′ or 3′-Hy-Hx-5′. Herein Hx is a flanking body segment, and Hy is a flanking extending segment (the Hy may not exist). The Hx and Hy are connected by a phosphate diester bond. The Hy is positioned at 5′-end or 3′-end of the Hx. The Hx is complementary-paired with the T1 segment or the A3 segment of the X unit; and the Hy is complementary-paired with one, two or more continuous nucleotides, from the 5′-end or the 3′-end, of the T2 segment of the X unit. A length of the Hy may be 2-6 nt or longer. The schematic diagram of the H-type Flanking nucleic acid unit is as shown in FIG. 2.

[0137] 3. Capping-End Nucleic Acid Unit: C-Type

[0138] A structure of the C-type capping-end nucleic acid unit is as follows: 3′-C1-C2- . . . Cn-5′. Herein C1 is a capping-end segment 1, and reverse-complementary to the T2 segment of the X1 unit; C2 is a capping-end segment 2, and reverse-complementary to the T2 segment of the X2 unit, and so on, Cn is a capping-end segment n, and reverse-complementary to the T2 segment of the Xn unit. The schematic diagram of the C-type capping-end nucleic acid unit is as shown in FIG. 3.

[0139] II. Design of Polymeric Nucleic Acid Molecules

[0140] The present disclosure designs three structures of polymeric nucleic acids according to the three nucleic acid units in the step I, which are respectively named as a R-structure polymeric nucleic acid, an L-structure polymeric nucleic acid and a Cr-structure polymeric nucleic acid. These structures may be simultaneously targeted to the different sites of the same gene, and may also be simultaneously targeted to the different sites of the different genes, to interfere with the expression of the target gene.

[0141] 1. Polymeric Nucleic Acid Structure I: R-Structure

[0142] A structure of the R-structure polymeric nucleic acid is as follows: (Xi)n. Herein Xi is a targeting nucleic acid unit. n is an integer greater than or equal to 3, preferably the integer of 3-8, more preferably 4, 5 and 6.

[0143] The n X-type targeting nucleic acid units are respectively named as an X1 unit, an X2 unit, an X3 unit, and so on, an Xn-1 unit, and an Xn unit.

[0144] In the R-structure polymeric nucleic acid of the present disclosure, each targeting nucleic acid unit forms a double-stranded region with the other two targeting nucleic acid units in the polymeric nucleic acid except for itself through sequence complementation, namely the adjacent X units are connected by complementary pairing of the T1 segment and the A3 segment, specifically, the A3 segment of the X1 unit is complementary-paired with the T1 segment of the X2 unit, the A3 segment of the X2 unit is complementary-paired with the T1 segment of the X3 unit, and so on, the A3 segment of the Xn unit is complementary-paired with the T1 segment of the X1 unit (the T1 segment of each targeting nucleic acid unit is complementary-paired with the A3 segment of the adjacent targeting nucleic acid unit thereof, and the T1 segment of each targeting nucleic acid unit is not complementary-paired with other targeting nucleic acid unit sequences), thereby a cyclic secondary structure is formed. In the cyclic structure, each targeting nucleic acid unit has the same structure and length.

[0145] Each targeting nucleic acid unit may be combined with a specific sequence of the target gene through the T1 and T2 thereof, thereby the expression of the target gene is controlled.

[0146] The plane and ring schematic diagram of the R-structure polymeric nucleic acid is as shown in FIG. 4.

[0147] 2. Polymeric Nucleic Acid Structure II: L-Structure

[0148] A structure of the L-structure polymeric nucleic acid is as follows: H1-(Xi)n-Hn. Herein H1 and Hn are flanking nucleic acid units, Xi is the targeting nucleic acid unit. n is an integer greater than or equal to 3, preferably the integer of 3-8, more preferably 4, 5 and 6.

[0149] The n X-type targeting nucleic acid units are respectively named as an X1 unit, an X2 unit, an X3 unit, and so on, an Xn-1 unit, and an Xn unit.

[0150] In the L-structure polymeric nucleic acid of the present disclosure, the A3 segment of the X1 unit is complementary-paired with the T1 segment of the X2 unit, the A3 segment of the X2 unit is complementary-paired with the T1 segment of the X3 unit, and so on, the A3 segment of the Xn-1 unit is complementary-paired with the T1 segment of the Xn unit; and the H1 unit is complementary-paired with the T1 segment of the X1 unit. A complementary region of the H1 unit and the X1 unit may also be extended to a part or all of the T2 segment of the X1 unit; the Hn unit is complementary-paired with the A3 segment of the Xn unit, and a complementary region of the Hn unit and the Xn unit may also be extended to a part or all of the T2 segment of the Xn unit. The 5′-end of the H1 unit or the 3′-end of the Hn unit further includes a Hy segment, the Hy segment is complementary-paired with one, two or more continuous nucleic acid molecules, from the 5′-end or the 3′-end, of the targeting segment II of the X1 unit or the Xn unit.

[0151] The plane schematic diagram of the L-structure polymeric nucleic acid is as shown in FIG. 5.

[0152] 3. Polymeric Nucleic Acid Structure III: Cr-Structure

[0153] A structure of the Cr-structure polymeric nucleic acid is as follows: (Xi)n-C. Herein Xi is a targeting nucleic acid unit, and C is a capping-end nucleic acid unit. n is an integer greater than or equal to 3, preferably the integer of 3-8, more preferably 4, 5 and 6.

[0154] The n X-type targeting nucleic acid units are respectively named as an X1 unit, an X2 unit, an X3 unit, and so on, an Xn-1 unit, and an Xn unit.

[0155] In the Cr-structure polymeric nucleic acid of the present disclosure, the A3 segment of the X1 unit is complementary-paired with the T1 segment of the X2 unit, the A3 segment of the X2 unit is complementary-paired with the T1 segment of the X3 unit, and so on, the A3 segment of the Xn-1 unit is complementary-paired with the T1 segment of the Xn unit; the capping-end nucleic acid unit C is formed by a capping-end segment 1, a capping-end segment 2, and so on, a capping-end segment n, the capping-end segment 1 is complementary-paired with the T2 segment of the X1 unit, the capping-end segment 2 is complementary-paired with the T2 segment of the X2 unit, and so on, the capping-end segment n is complementary-paired with the T2 segment of the Xn unit, the capping-end segment 1, the capping-end segment 2, and so on, and the capping-end segment n are connected into a single-stranded nucleic acid through a phosphate diester bond.

[0156] The plane schematic diagram of the Cr-structure polymeric nucleic acid is as shown in FIG. 6.

[0157] III. Synthetic Method of Polymeric Nucleic Acid and Modification Method of Nucleic Acid Unit

[0158] 1. Synthetic Method of Polymeric Nucleic Acid

[0159] The nucleic acid units of the present disclosure are annealed each other in a sequence specificity mode, the complementarity thereof promotes self-assembly of this polymeric nucleic acid, and a polymeric nucleic acid molecule with a secondary structure is formed. The specific synthetic method is as follows:

[0160] 1) the nucleic acid units required by a polymeric nucleic acid structure is synthesized; and

[0161] 2) the nucleic acid units are placed in an annealing condition, and annealed mutually, to form a secondary structure body by the self-assembly.

[0162] A reaction system for annealing is a system obtained by uniformly mixing each nucleic acid unit in equal molar weight, RNA annealing buffer (5X) (Biyuntian Annealing Buffer for RNA oligos (5X), R0051) and water (DEPC water).

[0163] A reaction condition for annealing is that a temperature is 90 DEG C in a polymerase chain reaction (PCR) meter, it is adequately denaturized in 2 min, and then the temperature in the PCR meter is reduced to 25 DEG C so that it is annealed.

[0164] 2. Modification Method of the Nucleic Acid Units

[0165] In order to increase stability and biological activity of a nuclease, suitable modifications of nucleotide sugar, base and phosphate moieties may be introduced into the nucleic acid, including chemical modification of ribose, such as a 2′ ribose hydroxyl group is substituted by a halogen group or an O-alkyl group, the alkyl group includes a methyl, an ethyl, a propyl or a methylethyl and the like, such nucleic acid modification may not reduce the interference activity of the polymeric nucleic acid. The nucleic acid units designed by the present disclosure include the following modifications.

[0166] 1) The ribose 2-site hydroxyl groups of 5-9 continuous nucleotides, from the first nucleotide at the 3′-end, of the linker segment A3 in the targeting nucleic acid unit are substituted by the halogen group or the O-alkyl group.

[0167] 2) The ribose 2-site hydroxyl groups of 5-9 continuous nucleotides, from the first nucleotide at the 3′-end, of the flanking body segment of the flanking nucleic acid unit are substituted by the halogen group or the O-alkyl group; or the ribose 2-site hydroxyl groups of 8-30 continuous nucleotides, from the first nucleotide at the 3′-end, of the flanking nucleic acid unit are substituted by the halogen group or the O-alkyl group. Preferably, the ribose 2-site hydroxyl groups of 14-18 continuous nucleotides, from the first nucleotide at the 3′-end, of the flanking nucleic acid unit are substituted by the halogen group or the O-alkyl group.

[0168] 3) The ribose 2-site hydroxyl groups of 2-6 continuous nucleotides, from the 5′-end to the 3′-end, of each capping-end segment of the capping-end nucleic acid unit are substituted by the halogen group or the O-alkyl group.

[0169] Embodiment 2. Preparation of polymeric nucleic acid and application thereof in interference of target gene expression

[0170] (I) R-structure polymeric nucleic acid: inhibition experiment targeting to different regions of a same gene

[0171] 1. Polymeric Nucleic Acid

[0172] A polymeric nucleic acid in the following structure is prepared, a targeting nucleic acid unit of each structure is respectively targeting to 4, 5 or 6 different regions of VEGFA and TP53 genes.

[0173] A represents that T1 and A3 segments of the targeting nucleic acid unit are 12 nt, and a T2 segment is 6 nt.

[0174] B represents that T1 and A3 segments of the targeting nucleic acid unit are 12 nt, and a T2 segment is 5 nt.

[0175] C represents that T1 and A3 segments of the targeting nucleic acid unit are 12 nt, and a T2 segment is 3 nt.

[0176] D represents that T1 and A3 segments of the targeting nucleic acid unit are 11 nt, and a T2 segment is 6 nt.

[0177] E represents that T1 and A3 segments of the targeting nucleic acid unit are 10 nt, and a T2 segment is 6 nt.

[0178] While n is 4, the annealing system is as follows (a total volume is 100 μL): 20 μL of each nucleic acid unit solution (the concentration is 100 μM), 15 μL of the RNA annealing buffer (5X), and 5 μL of the DEPC water.

[0179] While n is 5, the annealing system is as follows (the total volume is 150 μL): 20 μL of each nucleic acid unit solution (the concentration is 150 μM), 30 μL of the RNA annealing buffer (5X), and 20 μL of the DEPC water.

[0180] While n is 6, the annealing system is as follows (the total volume is 200 μL): 20 μL of each nucleic acid unit solution (the concentration is 200 μM), 40 μL of the RNA annealing buffer (5X), and 40 μL of the DEPC water.

[0181] The polymeric nucleic acid of which the target gene is VEGFA is the following 1)-11):

[0182] 1) VEGFA-R6-A (R-structure, n=6): an X unit sequence thereof is sequences 42-47 in Table 1 successively from X1-X6.

[0183] 2) VEGFA-R6-B (R-structure, n=6): an X unit sequence thereof is sequences 48-53 in Table 1 successively from X1-X6.

[0184] 3) VEGFA-R6-C(R-structure, n=6): an X unit sequence thereof is sequences 54-59 in Table 1 successively from X1-X6.

[0185] 4) VEGFA-R5-A (R-structure, n=5): an X unit sequence thereof is sequences 42, 43, 45, 46 and 47 in Table 1 successively from X1-X5.

[0186] 5) VEGFA-R5-B (R-structure, n=5): an X unit sequence thereof is sequences 48, 49, 51, 52 and 53 in Table 1 successively from X1-X5.

[0187] 6) VEGFA-R5-C(R-structure, n=5): an X unit sequence thereof is sequences 54, 55, 57, 58 and 59 in Table 1 successively from X1-X5.

[0188] 7) VEGFA-R4-A (R-structure, n=4): an X unit sequence thereof is sequences 42, 45, 46 and 47 in Table 1 successively from X1-X4.

[0189] 8) VEGFA-R4-B (R-structure, n=4): an X unit sequence thereof is sequences 48, 51, 52 and 53 in Table 1 successively from X1-X4.

[0190] 9) VEGFA-R4-C(R-structure, n=5): an X unit sequence thereof is sequences 54, 57, 58 and 59 in Table 1 successively from X1-X4.

[0191] 10) VEGFA-R6-D (R-structure, n=6): an X unit sequence thereof is sequences 60-65 in Table 1 successively from X1-X6.

[0192] 11) VEGFA-R6-E (R-structure, n=6): an X unit sequence thereof is sequences 66-71 in Table 1 successively from X1-X6.

[0193] The polymeric nucleic acid of which the target gene is TP53 is the following 1)-11):

[0194] 1) TP53-R6-A (R-structure, n=4): an X unit sequence thereof is sequences 72-77 in Table 2 successively from X1-X6.

[0195] 2) TP53-R6-B (R-structure, n=6): an X unit sequence thereof is sequences 78-83 in Table 2 successively from X1-X6.

[0196] 3) TP53-R6-C(R-structure, n=6): an X unit sequence thereof is sequences 84-89 in Table 2 successively from X1-X6.

[0197] 4) TP53-R5-A (R-structure, n=5): an X unit sequence thereof is sequences 73-77 in Table 2 successively from X1-X5.

[0198] 5) TP53-R5-B (R-structure, n=5): an X unit sequence thereof is sequences 79-83 in Table 2 successively from X1-X5.

[0199] 6) TP53-R5-C(R-structure, n=5): an X unit sequence thereof is sequences 85-89 in Table 2 successively from X1-X5.

[0200] 7) TP53-R4-A (R-structure, n=4): an X unit sequence thereof is sequences 74-77 in Table 2 successively from X1-X4.

[0201] 8) TP53-R4-B (R-structure, n=4): an X unit sequence thereof is sequences 80-83 in Table 2 successively from X1-X4.

[0202] 9) TP53-R4-C(R-structure, n=5): an X unit sequence thereof is sequences 86-89 in Table 2 successively from X1-X4.

[0203] 10) TP53-R6-D (R-structure, n=6): an X unit sequence thereof is sequences 90-95 in Table 2 successively from X1-X6.

[0204] 11) TP53-R6-E (R-structure, n=6): an X unit sequence thereof is sequences 96-101 in Table 2 successively from X1-X6.

TABLE-US-00001 TABLE 1 Sequences of nucleic acid units Target gene Sequence (5′-3′) SEQ ID NO: VEGFA AGCAGAAAGUUCAUGGUUUCUUGggugcau 42 VEGFA AUGCACCCAAGACAGCAGAGAUCgaguaca 43 VEGFA UGUACUCGAUCUCAUCAGGGUGGacaucuu 44 VEGFA AAGAUGUCCACCAGGGUCAUGCGgaucaaa 45 VEGFA UUUGAUCCGCAUAAUCUGGGCCAgcacaua 46 VEGFA UAUGUGCUGGCCUUGGUGGAACUuucugcu 47 VEGFA AGCAGAAAGUUCAUGGUUCUUGggugcau 48 VEGFA AUGCACCCAAGACAGCAAGAUCgaguaca 49 VEGFA UGUACUCGAUCUCAUCAGGUGGacaucuu 50 VEGFA AAGAUGUCCACCAGGGUAUGCGgaucaaa 51 VEGFA UUUGAUCCGCAUAAUCUGGCCAgcacaua 52 VEGFA UAUGUGCUGGCCUUGGUGAACUuucugcu 53 VEGFA AGCAGAAAGUUCAUGUCUUGggugcau 54 VEGFA AUGCACCCAAGACAGAGAUCgaguaca 55 VEGFA UGUACUCGAUCUCAUGGUGGacaucuu 56 VEGFA AAGAUGUCCACCAGGAUGCGgaucaaa 57 VEGFA UUUGAUCCGCAUAAUGGCCAgcacaua 58 VEGFA UAUGUGCUGGCCUUGGAACUuucugcu 59 VEGFA AGCAGAAAGUUCAUGGUCUUGggugcau 60 VEGFA AUGCACCCAAGACAGCAGAUCgaguaca 61 VEGFA UGUACUCGAUCUCAUCAGUGGacaucuu 62 VEGFA AAGAUGUCCACCAGGGUUGCGgaucaaa 63 VEGFA UUUGAUCCGCAUAAUCUGCCAgcacaua 64 VEGFA UAUGUGCUGGCCUUGGUAACUuucugcu 65 VEGFA AGCAGAAAGUUCAUGGUUGggugcau 66 VEGFA AUGCACCCAAGACAGCAUCgaguaca 67 VEGFA UGUACUCGAUCUCAUCUGGacaucuu 68 VEGFA AAGAUGUCCACCAGGGGCGgaucaaa 69 VEGFA UUUGAUCCGCAUAAUCCCAgcacaua 70 VEGFA UAUGUGCUGGCCUUGGACUuucugcu 71

TABLE-US-00002 TABLE 2 Nucleic acid unit sequences Target gene Sequence (5′-3′) SEQ ID NO: TP53 UGUGGAAUCAACCCACAGUUUGCgugugga 72 TP53 UCCACACGCAAAUUUCCUACAGAaacacuu 73 TP53 AAGUGUUUCUGUCAUCCAACUACaugugua 74 TP53 UACACAUGUAGUUGUAGUUGGUAaucuacu 75 TP53 AGUAGAUUACCACUGGAGUCUCCgcaagaa 76 TP53 UUCUUGCGGAGAUUCUCUGUUGAuuccaca 77 TP53 UGUGGAAUCAACCCACAUUUGCgugugga 78 TP53 UCCACACGCAAAUUUCCACAGAaacacuu 79 TP53 AAGUGUUUCUGUCAUCCACUACaugugua 80 TP53 UACACAUGUAGUUGUAGUGGUAaucuacu 81 TP53 AGUAGAUUACCACUGGAUCUCCgcaagaa 82 TP53 UUCUUGCGGAGAUUCUCGUUGAuuccaca 83 TP53 UGUGGAAUCAACCCAUUUGCgugugga 84 TP53 UCCACACGCAAAUUUACAGAaacacuu 85 TP53 AAGUGUUUCUGUCAUACUACaugugua 86 TP53 UACACAUGUAGUUGUUGGUAaucuacu 87 TP53 AGUAGAUUACCACUGUCUCCgcaagaa 88 TP53 UUCUUGCGGAGAUUCGUUGAuuccaca 89 TP53 UGUGGAAUCAACCCACAUUGCgugugga 90 TP53 UCCACACGCAAAUUUCCCAGAaacacuu 91 TP53 AAGUGUUUCUGUCAUCCCUACaugugua 92 TP53 UACACAUGUAGUUGUAGGGUAaucuacu 93 TP53 AGUAGAUUACCACUGGACUCCgcaagaa 94 TP53 UUCUUGCGGAGAUUCUCUUGAuuccaca 95 TP53 UGUGGAAUCAACCCACUGCgugugga 96 TP53 UCCACACGCAAAUUUCAGAaacacuu 97 TP53 AAGUGUUUCUGUCAUCUACaugugua 98 TP53 UACACAUGUAGUUGUAGUAaucuacu 99 TP53 AGUAGAUUACCACUGGUCCgcaagaa 100 TP53 UCUUGCGGAGAUUCUUGAuuccaca 101 Note: lower case letters represent that the nucleotide ribose is modified by 2′-O-methyl ribose. The underlined sequence is a target sequence.

[0205] 2. Inhibition Experiment

[0206] 5×10.sup.5 HeLa cells (an ATCC number is CRL-1958) are inoculated in a 12-pore culture plate of a DMEM culture medium containing 10% of fetal bovine serum, and the polymeric nucleic acid prepared in the step 1 is used to respectively transfect the HeLa cells: after the polymeric nucleic acid is mixed with a transfection reagent and buffer (GUANGZHOU RIBOBIO CO., LTD., named as riboFECT™ CP Buffer, and Article No. C10511-1), it is added to the cell culture medium, a volume of each pore is 1 mL, so that the final transfection concentration of the polymeric nucleic acid is 50 nM, and the culture plate is placed in an incubator with 5% of CO.sub.2 and 37 DEG C of a constant temperature, and cultured for 48 h. The transfection reagent and specific steps of transfection refer to a method in riboFect™ (GUANGZHOU RIBOBIO CO., LTD).

[0207] In addition to a test group, a negative control group (NC) and an untreated control group (NT) are also set for each time of cell plating. There are 3 replicates in the test group and the control groups. A control sequence of the NC group is siRNA, and is a double-stranded RNA molecule obtained by complementary-binding of the following two single-stranded RNA molecules: 5′-UUCUCCGAACGUGUCACGUdTdT-3′(SEQ ID NO:102) and 5′-ACGUGACACGUUCGGAGAAdTdT-3. (SEQ ID NO:103).

[0208] In 37 DEG C and 5% of the CO.sub.2, after being incubated for 48 h, transfected cells are collected, RNAs of the transfected cells are extracted by a Trizol method and a real-time quantitative PCR is performed, an mRNA expression level of the target gene is detected, q-PCR is repeated 3 times, and all of results are represented by an average value±SD. Sequences of real-time quantitative PCR primers for detecting the target genes are as shown in the attached table.

[0209] Detection results are as shown in Table 3. It is indicated from an experiment result that the above polymer molecules in different structures may efficiently inhibit the expression of the target gene.

TABLE-US-00003 TABLE 3 mRNA relative expression level VEGFA TP53 R6-A 0.05 0.10 R6-B 0.02 0.06 R6-C 0.13 0.21 R5-A 0.06 0.06 R5-B 0.03 0.02 R5-C 0.12 0.12 R4-A 0.04 0.04 R4-B 0.06 0.01 R4-C 0.23 0.13 R6-D 0.06 0.22 R6-E 0.06 0.07 Note: the negative control expression level is 1. (II) R-structure polymeric nucleic acid: low-concentration inhibition experiment

[0210] 1. Polymeric Nucleic Acid

[0211] A step of preparing an X unit sequence of the polymeric nucleic acid VEGFA-R6-A and an X unit sequence of the polymeric nucleic acid TP53-R6-A is the same as the step (I); and an X unit sequence of the polymeric nucleic acid P65-R6-A prepared is successively sequences 15, 16, 17, 23, 24 and 25 in Table 5 from X1-X6.

[0212] 2. Inhibition experiment

[0213] Only the final transfection concentration of the polymeric nucleic acid in the inhibition experiment in the step (I) is changed to 1 nM, and the other steps are not changed.

[0214] A detection result is as shown in Table 4. It is indicated from an experiment result that the polymeric nucleic acid of the present disclosure with the low-concentration may also achieve a purpose of reducing the expression level of the target gene.

TABLE-US-00004 TABLE 4 mRNA relative expression level VEGFA TP53 P65 R6-A (1 nM) 0.53 0.64 0.51 Note: the negative control expression level is 1. (III) Three structures of polymeric nucleic acids: inhibition experiment targeted to different regions of a same gene

[0215] 1. Polymeric Nucleic Acids

[0216] The polymeric nucleic acids in the following structures are prepared, a targeting nucleic acid unit of each structure is respectively targeted to 4 or 6 different regions of PPIB or P65 gene.

[0217] The polymeric nucleic acid of which the target gene is PPIB is the following 1)-5):

[0218] 1) PPIB-R4 (R-structure, n=4): an X unit sequence thereof is successively sequences 1-4 in Table 5 from X1-X4.

[0219] 2) PPIB-L4 (L-structure, n=4): an X unit sequence thereof is successively sequences 1-3 and the sequence 5 in Table 5 from X1-X4, an H1 unit sequence thereof is the sequence 20, and an H4 unit sequence thereof is the sequence 21.

[0220] 3) PPIB-Cr4 (Cr-structure, n=4): an X unit sequence thereof is successively sequences 1-4 in Table 5 from X1-X4, and a C unit sequence thereof is the sequence 8.

[0221] 4) PPIB-R6 (R-structure, n=6): an X unit sequence thereof is successively sequences 2, 3, 9, 10, 11 and 12 in Table 5 from X1-X6.

[0222] 5) PPIB-L6 (L-structure, n=6): an X unit sequence thereof is successively sequences 2, 3, 9, 10, 11 and 13 in Table 5 from X1-X6, an H1 unit sequence thereof is the sequence 6, and an H6 unit sequence thereof is the sequence 14.

[0223] The polymeric nucleic acid of which the target gene is P65 is the following 1)-5):

[0224] 1) P65-R4 (R-structure, n=4): an X unit sequence thereof is successively sequences 15-18 in Table 5 from X1-X4.

[0225] 2) P65-L4 (L-structure, n=4): an X unit sequence thereof is successively sequences 15-17 and the sequence 19 in Table 5 from X1-X4, an H1 unit sequence thereof is the sequence 6, and an H4 unit sequence thereof is the sequence 7.

[0226] 3) P65-Cr4 (Cr-structure, n=4): an X unit sequence thereof is successively sequences 15-18 in Table 5 from X1-X4, and a C unit sequence thereof is the sequence 22.

[0227] 4) P65-R6 (R-structure, n=6): an X unit sequence thereof is successively sequences 15, 16, 17, 23, 24 and 25 in Table 5 from X1-X6.

[0228] 5) P65-L6 (L-structure, n=6): an X unit sequence thereof is successively sequences 15, 16, 17, 23, 24 and 26 in Table 5 from X1-X6, an H1 unit sequence thereof is the sequence 20, and an H6 unit sequence thereof is the sequence 27.

TABLE-US-00005 TABLE 5 Sequences of nucleic acid units Target gene Sequence (5′-3′) SEQ ID NO: PPIB AGAUGCUCUUUCCUCCUGCAAGGuguauuu 1 PPIB AAAUACACCUUGACGGUGGAUGAagaugua 2 PPIB UACAUCUUCAUCUCCAAUUCUCUucggaaa 3 PPIB UUUCCGAAGAGACCAAAGGAAAGagcaucu 4 PPIB UUUCCGAAGAGACCAAAGUCUACgagaaag 5 PPIB GGAGGAAAGagcaucu 6 PPIB cuuucucguagacuuu 7 PPIB cuuuGGauugGAcaccGUcaggAG 8 PPIB AGAUGCUCUUUCCUCCUGCAUGAaggugcu 9 PPIB AGCACCUUCAUGUUGCGUCAAGGuguauuu 10 PPIB UUUCCGAAGAGACCAAAGCGUGUaaucaag 11 PPIB CUUGAUUACACGAUGGAAGAAAGagcaucu 12 PPIB CUUGAUUACACGAUGGAAUCUACgagaaag 13 PPIB cuuucucguagauucc 14 P65 UGUGUAGCCAUUGAUCUUGCAUCaugaaga 15 P65 UCUUCAUGAUGCUCUUGAAUACCaccaaga 16 P65 UCUUGGUGGUAUCUGUGCUCGUCaccggau 17 P65 AUCCGGUGACGAUCGUCUAAUGGcuacaca 18 P65 AUCCGGUGACGAUCGUCUACACAucgguaa 19 P65 GAUCAAUGGcuacaca 20 P65 uuaccgauguguagac 21 P65 agacGAgcacAGucaaGAaagaUC 22 P65 AUCCGGUGACGAUCGUCUUCAGGagaugaa 23 P65 UUCAUCUCCUGAAAGGAGAUCAGcuccuaa 24 P65 UUAGGAGCUGAUCUGACUAAUGGcuacaca 25 P65 UUAGGAGCUGAUCUGACUACACAucgguaa 26 P65 uuaccgauguguaguc 27 Note: lower case letters represent that the nucleotide ribose is modified by 2-O-methyl ribose. The underlined sequence is a target sequence. X unit: the 1-12th sites are T1; the 13-18th sites are T2; and the 19-30th sites are A3. H1 unit: the 1-4th sites are Hy; and the 5-16th sites are Hx. H4 unit: the 1-12th sites are Hx; and the 13-16th sites are Hy. C unit: the 1-6th sites are C4, the 7-12th sites are C3, the 13-18th sites are C2, and the 19-24th sites are C1.

[0229] 2. Inhibition Experiment

[0230] Steps of the inhibition experiment are the same as the step (I).

[0231] An inhibition result is as shown in FIG. 7. It is indicated from the result that 5 structures of the polymeric nucleic acids effectively inhibit the expression of the target genes. Inhibition levels in allusion to the target gene PP/B are above 80%, and the inhibition levels in allusion to the target gene P65 are above 75%.

[0232] (IV) Inhibition experiment of R-structure polymeric nucleic acid targeted to different genes (n=4 and 6)

[0233] 1. Polymeric Nucleic Acid

[0234] A polymeric nucleic acid in the following R-structure is prepared, and the polymeric nucleic acid is targeted to 4 or 6 different target genes.

[0235] BCCC-R4: the target genes are BIRC5, CTNNB, COPS5 and CLU, an X unit sequence thereof is successively sequences 28-31 in Table 3 from X1-X4.

[0236] BCCCEH-R6: the target genes are BIRC5, CTNNB, COPS5, CLU, EIF4E and HIF1A, an X unit sequence thereof is successively sequences 32, 33, 28, 29, 30 and 34 in Table 6 from X1-X6.

[0237] 2. Inhibition Experiment

[0238] Steps of the inhibition experiment are the same as the step (I).

TABLE-US-00006 TABLE 6 Sequences of nucleic acid units Target gene Sequence (5′-3′) SEQ ID NO: BIRC5 AGAAGAAACACUGGGCCAACUGCugaucuu 28 CTNNB1 AAGAUCAGCAGUCUCAUUUGGUCaggucuu 29 COPS5 AAGACCUGACCAGUGGUAUUUGAcucugau 30 CLU AUCAGAGUCAAAGAGCUUAGUGUuucuucu 31 HIF1A UCAAGUUGCUGGUCAUCAGGAGGuugcuaa 32 EIF4E UUAGCAACCUCCUGAUUAAGUGUuucuucu 33 CLU AUCAGAGUCAAAGAGCUUCCAGCaacuuga 34 Note: lower case letters represent that the nucleotide ribose is modified by 2-O-methyl ribose. The underlined sequence is a target sequence. X unit: the 1-12th sites are T1; the 13-18th sites are T2; and the 19-30th sites are A3.

[0239] A result of the inhibition experiment is as shown in FIG. 8. It is indicated from the result that 2 structures of the polymeric nucleic acids effectively inhibit the expressions of 4 or 6 target genes. Expression levels of the polymeric nucleic acid in R4-structure targeted to 4 genes are reduced below 0.2.

[0240] (V) Inhibition experiment of polymeric nucleic acids in R-structure, L-structure and Cr-structure targeted to different genes (n=4)

[0241] 1. Polymeric Nucleic Acid

[0242] A polymeric nucleic acid in each following structure is prepared, and the polymeric nucleic acid is targeted to 4 different target genes.

[0243] SPPV-R4: the target genes are SOD1, PPIB, P65, and VEGFA, an X unit sequence thereof is successively sequences 35-38 in Table 7 from X1-X4.

[0244] SPPV-L4: the target genes are SOD1, PP/B, P65, and VEGFA, an X unit sequence thereof is successively sequences 35-38 in Table 7 from X1-X4, an H1 unit sequence thereof is the sequence 39, and an H4 unit sequence thereof is the sequence 40.

[0245] SPPV-Cr4: the target genes are SOD1, PPIB, P65, and VEGFA, an X unit sequence thereof is successively sequences 35-38 in Table 7 from X1-X4, and a C unit sequence thereof is the sequence 41.

[0246] 2. Inhibition Experiment

[0247] It is the same as the inhibition experiment in the step (I).

[0248] A result of the inhibition experiment is as shown in FIG. 9. It is indicated from the result that 3 structures of the polymeric nucleic acids effectively inhibit the expressions of 4 target genes. It is also discovered that in three polymeric structures, the inhibition effect of the polymeric nucleic acid in Cr4-structure is better, and an expression level of each target gene thereof is the lowest.

TABLE-US-00007 TABLE 7 Sequences of nucleic acid units Target gene Sequence (5′-3′) SEQ ID NO: SOD1 UACUUUCUUCAUUUCCACCUGUUccaaaaa 35 PPIB UUUUUGGAACAGUCUUUCUGAGAccuucaa 36 P65 UUGAAGGUCUCAUAUGUCCAUGCagauuau 37 VEGFA AUAAUCUGCAUGGUGAUGAUGAAgaaagua 38 H GGAAAUGAAgaaagua 39 H4 uacuuucuucaucauc 40 C caucACgacaUAgaaaGAguggAA 41 Note: lower case letters represent that the nucleotide ribose is modified by 2-O-methyl ribose. The underlined sequence is a target sequence. X unit: the 1-12th sites are T1; the 13-18th sites are T2; and the 19-30th sites are A3. H1 unit: the 1-4th sites are Hy; and the 5-16th sites are Hx. H4 unit: the 1-12th sites are Hx; and the 13-16th sites are Hy. C unit: the 1-6th sites are C4, the 7-12th sites are C3, the 13-18th sites are C2, and the 19-24th sites are C1.

[0249] Sequences of real-time quantitative PCR primers for detecting the target genes in each of the above experiments are as shown in Table 8.

TABLE-US-00008 TABLE 8 Sequences of real-time quantitative PCR primers for detecting target genes SEQ ID Primer name Primer sequence (5′-3′) NO: H-TP53-qPCR-F TTGTGCCTGTCCTGGGAGAG 104 H-TP53-qPCR-R GGAGAGGAGCTGGTGTTGTTG 105 H-HIF1A-qPCR-F GCCCTAACGTGTTATCTGTC 106 H-HIF1A-qPCR-R CGCTTTCTCTGAGCATTCTG 107 h-EIF4E-qPCR-F GGAGGTTGCTAACCCAGAACAC 108 h-EIF4E-qPCR-R GGAGATCAGCCGCAGGTTTG 109 h-VEGFA-qPCR-F GAGGGCAGAATCATCACGAAG 110 h-VEGFA-qPCR-R ACTCGATCTCATCAGGGTACTC 111 h-PPIB-qPCR-F GGCAAGCATGTGGTGTTTGG 112 h-PPIB-qPCR-R GGTTTATCCCGGCTGTCTGTC 113 h-p65-qPCR-F GGGAAGGAACGCTGTCAGAG 114 h-p65-qPCR-R TAGCCTCAGGGTACTCCATCA 115 h-SOD1-qPCR-F GCAGGGCATCATCAATTTCG 116 h-SOD1-qPCR-R GAATCCATGCAGGCCTTCAG 117 H-BIRC5-qPCR-F AGAACTGGCCCTTCTTGGAG 118 H-BIRC5-qPCR-R GAAACACTGGGCCAAGTCTG 119 H-CTNNB1-qPCR-F GCTCGGGATGTTCACAACC 120 H-CTNNB1-qPCR-R CCCTGCAGCTACTCTTTGG 121 H-COPS5-qPCR-F TGGAATAAATACTGGGTGAATACG 122 H-COPS5-qPCR-R GGCTTCTGACTGCTCTAAC 123 H-CLU-qPCR-F CAAGGCGAAGACCAGTACTATC 124 H-CLU-qPCR-R CAGTGACACCGGAAGGAAC 125

INDUSTRIAL APPLICATION

[0250] The present disclosure provides a new-type nucleic acid unit for constructing a polymeric nucleic acid and the polymeric nucleic acid for interfering with an expression of a target gene. The present disclosure is capable of, through designing and constructing the new-type nucleic acid unit and the self-assembled polymeric nucleic acid thereof, achieving multi-target interference, and may be used for inhibiting multiple gene expressions in a signaling pathway of disease occurrence or development, or simultaneously inhibiting multiple disease target gene expressions, possessing broad application prospects in multiple subject fields such as biology and chemistry. The polymeric nucleic acid may target multiple sequences simultaneously, herein the sequences may be located in one gene, or located in multiple genes. The advantages of the present disclosure include: 1) a high RNAi performance; 2) good stability; 3) reduction of an off-target rate; 4) enhanced ability to be introduced into cells; and 5) a modular design.