Engineered zymomonas for the production of 2,3-butanediol
11091782 · 2021-08-17
Assignee
Inventors
- Min Zhang (Lakewood, CO)
- Yat-Chen Chou (Lakewood, CO)
- Mary Ann Franden (Centennial, CO)
- Michael E. Himmel (Littleton, CO)
Cpc classification
C12N9/1022
CHEMISTRY; METALLURGY
International classification
Abstract
Non-naturally occurring Zymomonas strains useful for the production of 2,3-butanediol are provided.
Claims
1. A non-naturally occurring Zymomonas mobilis that does not produce ethanol, lacks a functional pyruvate decarboxylase gene, lacks antibiotic markers and that produces 2,3-butanediol through using the gene products of operably connected exogenous genes acetolactate synthase (ALS), acetolactate decarboxylase (ALDC), and butanediol dehydrogenase (BDH) wherein the exogenous genes are integrated into the chromosomal location of a pyruvate decarboxylase gene of the Zymomonas mobilis; and wherein the integration of the exogenous genes eliminates the native chromosomal gene for pyruvate decarboxylase; and wherein the Zymomonas mobilis produces 2,3-butanediol in a growth medium that lacks antibiotics; and wherein the 2,3-butanediol produced is at least 96% of the theoretical yield from a carbon source for the production of the 2,3-butanediol; and wherein the 2,3-butanediol is produced up to a concentration of about 120 g/L.
2. The non-naturally occurring Zymomonas mobilis of claim 1 that produces 2,3-butanediol for at least 150 hours.
3. The non-naturally occurring Zymomonas mobilis of claim 1 that produces 2,3-butanediol at about 2.18 g/L/h.
4. The non-naturally occurring Zymomonas species of claim 1 wherein the exogenous genes are endogenous to organisms selected from the group consisting of Bacillus subtilis, Enterobacter cloacae and Serratia marcescens.
5. A method for making 2,3-butanediol using the Zymomonas of claim 1 wherein the method comprises the step of contacting the Zymomonas with at least one sugar selected from the group consisting of glucose and xylose as a carbon source for the production of 2,3-butanediol.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
DETAILED DESCRIPTION
(12) Disclosed herein are non-naturally occurring Zymomonas organisms engineered for the production of 2,3-butanediol (2,3-BDO also referred to herein as BDO). In an embodiment the Zymomonas species is Z. mobilis.
(13) In an embodiment, the pdc gene of a Z. mobilis strain containing a plasmid with exogenous 2,3-BDO pathway genes was knocked out. As a result, an increase in 2,3-BDO titer of greater than about 40 g/L from 10% glucose and complete elimination of ethanol production was achieved. In an embodiment, non-naturally occurring Z. mobilis strains disclosed herein are capable of producing 42-48 g/L of 2,3-BDO from glucose and xylose in 20% solid loading DMR hydrolysate. In another embodiment, non-naturally occurring Z. mobilis strains disclosed herein are capable of producing about 120 g/L of 2,3-BDO from glucose and xylose.
(14) DMR Treatment of Corn Stover
(15) The deacetylation and mechanical refining (DMR) process of treating corn stover consists of a mild, dilute alkaline extraction stage followed by mechanical refining to overcome the recalcitrance of the lignocellulosic biomass. Deacetylation facilitates the enzymatic hydrolysis by removing most of the acetyl groups bound to hemicellulose and partial removal of the lignin component. The following mechanical refining stage increases the surface area of biomass by mechanical fibrillation and hence greatly improves the cellulose and hemicellulose accessibility to enzymes. Furthermore, high sugar concentrations and low chemical inhibitor concentrations achieved by the DMR process allow for high titers of fermentation metabolites and products.
(16) Engineered Z. mobilis
(17) Z. mobilis strains were engineered to develop pathways for biological upgrading of sugars to hydrocarbons. These pathways are capable of producing intermediates amenable to separation and catalytic upgrading to hydrocarbon fuels. In an embodiment, anaerobic xylose and glucose fermenting Z. mobilis strains were engineered to redirect carbon from ethanol production to 2,3-BDO by taking advantage of the high specific sugar uptake rate, rapid catabolism, and high carbon yield of Z. mobilis. Non-naturally occurring Z. mobilis strains disclosed herein were engineered to efficiently use biomass derived mixed C5/C6 sugar streams commonly used for ethanol production.
(18) 2,3-BDO is much less toxic than ethanol, the product of naturally occurring Z. mobilis. Z. mobilis is capable of growth at >100 g/L 2,3-BDO. Therefore, a much high titer of Z. mobilis producing 2,3-BDO as either the sole or primary product can be obtained when compared to the production of ethanol.
(19) In an embodiment, engineered 2,3-BDO-producing Z. mobilis strains can be used to solely produce 2,3-BDO or can be engineered to produce a mixture of 2,3-BDO and ethanol from mixed C5/C6 sugar streams derived from biomass. Both ethanol and 2,3-BDO can be further catalytically upgraded via deoxydehydration and oligomerization to hydrocarbon fuels. Alternatively, 2,3-BDO can be converted to MEK or 1,3-butadiene via a dehydration step, which can be used for polymer syntheses.
(20) In an embodiment, engineered Z. mobilis strains produced 2,3-BDO by using exogenous genes encoding acetolactate synthase (ALS), acetolactate decarboxylase (ALDC), and butanediol dehydrogenase (BDH), referred to herein as “the 2,3-BDO pathway”, from, but not limited to, Bacillus subtilis, Enterobacter cloacae and Serratia marcescens. In an embodiment, engineered Z. mobilis strains channeled pyruvate to acetolactate, then to acetoin, and then to 2,3-BDO using primarily glucose and xylose as a carbon source. The engineered 2,3-BDO pathway in Z. mobilis is efficient as it consists of only three enzymatic steps from pyruvate.
(21) Disclosed herein are engineered Z. mobilis strains where carbon is redirected from producing ethanol to producing 2,3-BDO. In an embodiment all carbon is redirected from producing ethanol to producing 2,3-BDO. In other embodiments, a portion of carbon is redirected from producing ethanol to producing 2,3-BDO. In an embodiment the pyruvate node is altered to shift carbon flux towards production of 2,3-BDO.
(22) Attempts at knocking out the pdc gene in native Zymomonas strains have been reported, but none have produced 2,3-BDO instead of ethanol. Previously, copies of both a disrupted pdc gene and a native copy of the pdc gene have been reported. These pseudo-pdc knockout Z. mobilis mutants produced ethanol due to the presence of native pdc gene.
(23) Without being bound by theory, an organism containing only copies of a pdc knockout mutant might result in lethality because there might be no other sustainable pathways capable of providing a redox balance. Disclosed herein are engineered Z. mobilis strains showing that the presence of a BDO pathway alleviates the redox imbalance due to a pdc knockout.
(24) In an embodiment, disclosed herein are Z. mobilis strains containing only disrupted (knockout) pdc genes. Knocking out the pdc gene in Z. mobilis strain BC21 resulted in redirecting carbon from ethanol production to 2,3-BDO production, substantially eliminating ethanol production. This lack of ethanol significantly improved product titer as well as simplifying any downstream purification processes. In an embodiment, 2,3-BDO titers of greater than 35 g/L from glucose and xylose at 35 g/L were obtained by growing engineered Z. mobilis strains using batch and/or fed-batch fermentations.
(25) As disclosed herein, engineered strains were selected for growth and production parameters such as 2,3-BDO titer, production rates, and yield. In an embodiment, engineered strains were selected for improved BDO production of at least 10 g/L at 24 h. Other parameters affecting 2,3-BDO production were discovered such as promoter strength for expression, sources of pathway genes (including ALS and BDH), as well as fermentation parameters affecting 2,3-BDO production. These experiments resulted in, for example, a Z. mobilis strain 9C-BC11 which produced 22.6 g 2,3-BDO/L from 10% glucose under low oxygen conditions obtaining 96% of the theoretical yield from glucose for the combined 2,3-BDO, acetoin, and ethanol products.
(26) Redirecting Carbon Flow Towards 2,3-BDO Synthesis
(27) In an embodiment, a heterologous 2,3-BDO pathway including the genes encoding acetolactate synthase (ALS), acetolactate decarboxylase (ALDC), and butanediol dehydrogenase (BDH) were introduced into Z. mobilis. In an embodiment, some engineered strains produced 2,3-BDO at 3 to 5 g/L from 8% glucose as well as producing ethanol. Experiments to determine gene expression, gene sources for ALS and BDH as well as fermentation conditions resulted in higher 2,3-BDO production of up to about 22.6 g/L 2,3-BDO from 10% glucose and had decreased ethanol production. This demonstrated that carbon can be significantly redirected from ethanol formation towards 2,3-BDO production at the pyruvate node. To further increase 2,3-BDO production, carbon flux towards ethanol was eliminated by knocking out the pdc gene, see
(28) In an embodiment, a BDO producing recombinant strain Z. mobilis BC21 was used as a host to “knock out” the pdc gene. BC21 is a derivative of Z. mobilis 9C (antibiotic resistance marker free) harboring a plasmid pBC21 (with BDO pathway genes—als, aldc and bdh).
(29) To knock out pdc, a PCR fragment (pdcup-CmloxP-pdcdn) containing CmloxP flanked with 1 kb each of up- and downstream of pdc (
(30) After four days of incubation, no colonies were found for BC21 transformed with PCR fragments whereas colonies were found with pJpdcKOCmloxP transformation: four colonies on a Cm plate (aerobic incubation), 17 colonies on CmSp plates (anaerobic incubation), and three colonies on a Cm plate (anaerobic). For 9C transformation, fewer colonies were obtained with PCR fragment (three colonies on Cm plates, aerobic) than with pJpdcKOCmloxP: 1280 colonies on Cm plates (anaerobic) and 71 on Cm plates (aerobic). Colonies were picked and patched onto fresh plates containing respective antibiotic(s) of which plates they were picked from and further incubated based on their respective aeration conditions of how the source plates were incubated. About 94% colonies grew up on Cm plates. Only two of the 17 colonies grew on CmSp plates from BC21 transformants. The grown colonies were patched two more times onto fresh sets of plates. Twenty-six colonies (representing aeration and antibiotics selection conditions) from the 3.sup.rd set of plates were inoculated in 5 mL RMG5 with Cm or CmSp for genomic DNA extraction. PCR analysis of the gDNAs indicated both the wild-type PDC and the knockout PDC were present in these colonies. Without being bound by theory, it is possible that colonies were not monocultures and/or these Zymomonas cultures contained two chromosomal copies, one with wild-type and the other with pdcKO.
(31) Serial transfers were performed for the liquid cultures of all 12 colonies (of the 26) under microaerobic condition to purify single colonies and encourage the PDC knockout selection. After 10 transfers (estimated 50 generations), cultures were streaked onto RMG5 plates with respective antibiotics for single colonies. Two colonies were picked per each of the 12 cultures (eight for BC21 transformants and four for 9C transformants) and inoculated in RMG5CmSp or RMG5Cm for overnight for gDNA extraction. The supernatants were analyzed by HPLC for BDO and ethanol. The results of the PCR of the gDNA are shown in
(32) Based on the PCR analysis and the agarose gel depicted in
(33) Table 1 summarizes the results of HPLC analysis of the culture supernatants of the PDC knockout transformants/integrants after 10 serial transfers from the above-mentioned colonies grown on RMG5. It clearly shows that only the colonies with pdcKO produced high amounts of 2,3-BDO and no ethanol (the low level of ethanol of 2.67 to 2.82 g/L was from the antibiotic Cm added which was dissolved in ethanol), while all other colonies either were poor users of glucose or produced high amounts of the ethanol. Thus, PDC activity was knocked out in a non-naturally occurring 2,3-BDO producing Z. mobilis.
(34) TABLE-US-00001 TABLE 1 Initial glucose 50 g/L 3-mL RMG5 in 15-mL flasks 30 C., 120 rpm PCR gDNA Medium Colony Glucose g/L Acetoin g/L BDO g/L Ethanol g/L BDO g/g glu ETOH g/g glu pdcKO out-1/-2 BC21 pdcKO integrants (after 10 transfers) single colonies RMG5SpCm 1-10-1 19.14 0.20 13.37 2.82 0.43 0.09 single 3.4 kb RMG5SpCm
2-10-1 20.84 0.21 12.65 2.76 0.43 0.09 single 3.4 kb RMG5SpCm 13-10-1 41.21 0.58 0.97 3.26 0.11 0.37 double 3.4/4 kb RMG5SpCm 14-10-1 18.57 0.13 13.44 2.67 0.43 0.08 single 3.4 kb RMG5SpCm 25-10-1 0 1.91 7.74 15.97 0.15 0.32 double 3.4/4 kb RMG5SpCm 26-10-3 0 1.80 4.53 19.03 0.09 0.38 double 3.4/4 kb 9C pdcKO integrants (after 10 transfers) RMG5Cm
4-10-1 17.92 2.60 0.93 11.99 0.03 0.37 double 3.4/4 kb RMG5Cm
7-10-1 36.32 1.32 1.25 4.21 0.09 0.31 double 3.4/4 kb RMG5Cm 16-10-1 39.77 0.81 1.19 3.24 0.12 0.32 double 3.4/4 kb RMG5Cm 19-10-1 0.41 3.27 0.67 20.38 0.01 0.41 single (high)
(35) BC21 integrants 1, 2 and 14 (with single PDC KO fragment) were selected; as well as 25 (still contains both bands of wild-type PDC and PDC knockout along with the parent strain BC21) and flask tests were conducted in RMG 8% glucose under 180 rpm shaking. The results are shown in
(36) The PDC knockout BDO producing Z. mobilis strain was subjected to further fermentation testing in a fermenter with pH control under limited oxygen conditions, initially using RMG medium. As shown in
(37) In another embodiment, 2,3-BDO produced by engineered Z. mobilis strains can be upgraded to butene, MEK and butadiene using aqueous catalytic processes resulting in significantly reduced separation costs. Further oligomerization of butene can produce long chain hydrocarbons used for gasoline, jet and diesel fuels having fuel production costs targeted at $2/GGE with coproduct.
(38) Materials and Methods
(39) Bacterial strain and growth conditions: Z. mobilis BC21 was revived from frozen glycerol stocks for about 6 to 8 h in 10 mL RMG2 (2% glucose, 10 g/L yeast extract, 2 g/L KH.sub.2PO.sub.4) with 50 μg/mL spectinomycin at 30° C. Strain BC21 is a derivative of Z. mobilis 9C (antibiotic resistance marker free) having a pBC21 plasmid (with BDO pathway genes—als, aldc and bdh). Strain 9C is an 8b derivative with both chloramphenicol and tetracycline antibiotics marker cured.
(40) PDC gene knockout fragment construction: To knock out pdc by homologous recombination, a fragment (pdc_KO_Cm_loxP) containing upstream and downstream DNA to pdc gene and a chloramphenicol resistance gene (Cm) flanked by loxP was constructed, see
(41) Electroporation transformation and 2,3-BDO strain selection: Z. mobilis or E. coli cells were transformed with plasmids by electroporation (Bio-Rad Gene Pulser, 0.1-cm gap cuvettes, 1.6 kV, 200 ohms, 25 μFD). Electro-competent Z. mobilis cells were prepared by centrifuging cells from cultures that had reached an optical density (OD.sub.600)=0.4 to 0.6. The cell pellets were washed once in ice-cold sterile water, re-centrifuged, and washed again in 10% glycerol. These pellets were resuspended in 10% glycerol at a concentration approximately 1,000-fold higher than the starting culture. Competent cells were stored at −80° C. as small aliquots for later use. Transformants of E. coli or Z. mobilis were selected on LB or MMG agar plates, respectively, containing appropriate antibiotics. Due to the presence of a restriction/modification system, all plasmids were built in and isolated from a methylation-deficient E. coli strain, C2925 (New England Biolabs, MA), for successful transformations in Z. mobilis ATCC31821 derived hosts, BC21. DNA fragments prepared directly by PCR were used for electroporation.
(42) The transformants grown on the selective spectinomycin (Sp) and chloramphenicol (Cm) antibiotics were further streaked on RMG plate with RMG Sp+Cm for single colony isolation, which were then used for colony PCR to confirm the introduction of plasmid and fragment with correct gene knockout using the primers of pdc genes to check the insert size. Colonies with expected PCR bands pattern were selected and inoculated into RMGSp200 for preservation and further flask evaluation.
(43) Shake flask fermentation: Seed cultures of Z. mobilis strains harvested at exponential phase were inoculated into 125-mL shake flasks containing 40 mL media to a starting OD.sub.600 of 0.1. The media were supplemented with spectinomycin (200 μg/mL) and Cm. Temperature was maintained at 30° C. with the shaking speed of 120 rpm or 180 rpm.
(44) Fermentation: Fermentations to evaluate the strains for 2,3-BDO production were conducted in BioStat-Q plus fermenters with a 300 mL working volume, 300 rpm, a temperature of 30° C., and pH 5.8 controlled with KOH (4 N). The fermenters were inoculated from an overnight grown seed with initial OD of 0.1 @ 600 nm. Samples were taken at different time points for detail analysis.
(45) Reviving: The strains were revived from a frozen state on RMG (5%) in 50 mL flat flask with 8 mL media and incubated overnight at 30° C. on a shaker incubator at 180 rpm. The grown, revived culture was used to start the seed for fermentation.
(46) Seed preparation: The seeds were prepared in 125 mL baffled shake flask with 40 mL RMG (8%) using the grown revived culture with initial OD of 0.1 @600 nm. The seed flask was incubated at 30° C. overnight in shaking incubator with 180 rpm.
(47) Hydrolysate: Hydrolysate used in this evaluation was DMR (A15). Hydrolysate was prepared from enzymatic saccharification of pretreated corn stover from mechanical disk refined processes.
(48) Fermentations to evaluate the strains for BDO production were performed in BioStat-Q plus fermenters with a 300 mL working volume, 500 rpm, a temperature of 30° C., and pH 5.8 controlled with KOH (4 N). Fermentors were aerated by overlay or sparging from an air supply at a desired cubic centimeter per minute (ccm) flow rate and filtered through a 0.2 μl filter. The fermenters were inoculated from an overnight grown seed with initial OD of 0.1 @ 600 nm. Samples were taken at different time points for various analyses.
(49) Fermentation data collection and analysis: Samples were taken at various time points and diluted for OD.sub.600 measurements. In addition, samples were filtered through a 0.2 μm syringe filter into HPLC vials. Concentrations of glucose, xylose, 2,3-BDO, acetoin, xylitol, ethanol, HMF, furfural, lactic acid, glycerol, and acetic acid were determined from filtered sample supernatants by high performance liquid chromatography (HPLC) Agilent1100 series (Agilent, CA) utilizing a BioRad HPX-87H organic acids column and Cation Et guard cartridge (Bio-Rad, CA) operating at 55° C. A refractive index detector was used for the detection of various compounds. Dilute sulfuric acid (0.01 N) was used as the isocratic mobile phase at a flow rate of 0.6 mL min′. Sugar utilization, 2,3-BDO, acetoin, and ethanol titers and yield were calculated based on the HPLC data.
(50) Integration of Genes for the Production of 2,3-BDO into the Z. mobilis Chromosome
(51) The plasmid pCR4-ZMO1650-loxPSp-BC21, see
(52) TABLE-US-00002 TABLE 2 PCR of fragments was prepared using NEB Q5 polymerase using the following primers, template sources and annealing temperatures. Size Annealing Template PCR fragment (kb) Primers used Temp pCR4 pCR4 TOPO vector 3.94 oZH163 66.2° C. TOPO backbone oZH172 gDNA from 1 kb homology region 1.06 oZH164 60.5° C. ZM4 left of ZMO1650 oZH175 pMod2LoxP loxP-Spec 1.22 oZH173 66.0° C. oZH174 pBC21 BDO genes 4.6 oZH176 61.2° C. oZH169 gDNA from 1 kb homology region 1.02 oZH170 67.9° C. ZM4 right of ZMO1650 oZH171
(53) TABLE-US-00003 TABLE 3 Primers used for Table 2 PCR experiments. Primer Sequence of Primer oZH163 (SEQ ID NO: 1) CGTTTAAACCTGCAGGACTAGTC oZH164 (SEQ ID NO: 2) gggactagtcctgcaggtttaaa cgATTGAGGTCATTGCATCTGAT ATTC oZH169 (SEQ ID NO: 3) agaccgcaccttaTACTAGATAT CGCTCATGATCG oZH170 (SEQ ID NO: 4) gcgatatctagtaTAAGGTGCGG TCTTGATTAGCC oZH171 (SEQ ID NO: 5) gaattgaatttagcggccgcgaa ttGATGATGTCGCCGCCTTGGA oZH172 (SEQ ID NO: 6) AATTCGCGGCCGCTAAATTC oZH173 (SEQ ID NO: 7) tttataagaataTTGTTGGCTAG TGCGTAGTC oZH174 (SEQ ID NO: 8) gggttgttgatcgaacCGGGGAT CCTCTAGAGTCGA oZH175 (SEQ ID NO: 9) CACTAGCCAACAATATTCTTAAG AAAGAATTCTTTTGTTCTTTC oZH176 (SEQ ID NO: 10) TAGAGGATCCCCGGTTCGATCAA CAACCCGAATC
(54) After assembly, the plasmid was electroporated into electrocompetent C2925 from NEB (dam-dcm-). The plasmid was verified by restriction mapping and the sequence confirmed and subsequently integrated into Z. mobilis 9C and plated both on MMGSp (mating medium with 5% glucose and 200 μg/mL spectinomycin) under both aerobic and anaerobic (in anaerobic chamber with CO2 pack) conditions. Only colonies plated under aerobic conditions were positive for BDO gene integration, the vector backbone was integrated via a single crossover recombination. Isolates were serially transferred 9 times in the presence of RMGSp200 @ 30° C. in test tubes shaken at 120 rpm to allow for the 2nd crossover event eliminating the vector backbone before isolating further on RMGSp200 plates. The strain was consequently designated ZHC129. In order to cure the strain of spectinomycin resistance, the strain was transformed with the plasmid expressing the Cre recombinase. Following serial transfers, the spectinomycin marker was removed and the plasmid cured resulting in strain ZHC133. Knockout of the pdc gene of ZHC133 was achieved using the above described procedures and resulted in the strain BC42C.
(55)
(56) For experiments, the results of which are depicted in
(57) For the results of fermentation experiments using strain BC42C under batch fed conditions as depicted in
(58)
(59) TABLE-US-00004 TABLE 4 Measurements of fermentation metabolites and BDO as depicted in FIG. 11. BDO OD Glucose Xylose BDO Glycerol Sugars yield Productivity Fermenter 600 nm g/L g/L g/L g/L consumed % (gS/gP) (g/L/h) 1 7.71 0.00 2.43 84.70 16.09 98.72 0.43 0.991 2 7.54 0.00 7.58 79.98 16.94 95.92 0.42 0.929 3 6.96 0.00 3.98 82.04 15.06 97.76 0.45 0.959
(60) The effects of various aeration and agitation conditions in RMG (rich medium with glucose) 10% with spectinomycin using the genome integrated strain BC42C are shown in Table 5.
(61) TABLE-US-00005 TABLE 5 Growth conditions and concentrations of fermentation metabolites using genome integrated strain BC42C. Fermenter Sparging Overlay Conditions Acetoin Productivity Yield (gS/ Acetoin Productivity Yield (gS/ RPM CCM BDO (g/L) (g/L) (g/L/h) gP) Time (h) BDO (g/L) (g/L) (g/L/h) gP) Time (h) 300 40 38.17 0.04 0.76 0.44 50 46.18 0.68 0.69 0.43 67 300 100 45.72 1.30 0.91 0.44 50 45.68 0.17 0.68 0.43 67 300 160 44.83 0.16 1.12 0.43 40 46.14 0.15 0.63 0.47 73 500 40 29.97 19.86 0.62 0.28 48 36.98 8.45 1.03 0.37 39 500 100 45.86 0.12 2.18 0.46 21 40.67 5.14 1.13 0.41 39 500 100 45.70 0.09 1.90 0.45 24 44.51 0.84 1.08 0.43 43 500 100 46.33 3.21 1.72 0.42 27 40.11 0.14 1.25 0.44 32 500 160 45.97 0.46 1.92 0.45 24 46.96 0.12 1.47 0.44 32 700 40 33.22 8.89 1.70 0.32 20 41.91 0.35 1.69 0.45 26 700 100 17.08 16.73 0.95 0.17 18 44.54 1.52 1.81 0.45 26 700 160 9.55 43.53 0.20 0.09 48 38.62 7.36 1.61 0.40 26
(62) The foregoing disclosure has been set forth merely to illustrate the invention and is not intended to be limiting. Since modifications of the disclosed embodiments incorporating the spirit and substance of the invention may occur to persons skilled in the art, the invention should be construed to include everything within the scope of the appended claims and equivalents thereof.
(63) Other objects, advantages, and novel features of the present invention will become apparent from the following detailed description of the invention when considered in conjunction with the accompanying drawings.