17β-hydroxysteroid dehydrogenase mutants and application thereof

Abstract

The disclosure discloses 17β-hydroxysteroid dehydrogenase mutants and application thereof, and belongs to the technical field of biology. The disclosure provides 17β-hydroxysteroid dehydrogenase mutants V107A, T155N, H164Y and V107A/T155N/H164Y with high specific enzyme activities, and the specific enzyme activities of the 17β-hydroxysteroid dehydrogenase mutants V107A, T155N, H164Y and V107A/T155N/H164Y are as high as 1.85, 1.93, 2.06 and 5.15 U/mg, respectively, which are 1.11, 1.16, 1.24 and 3.10 times larger than that of wild-type 17β-hydroxysteroid dehydrogenase (1.66 U/mg).

Claims

1. A 17β-hydroxysteroid dehydrogenase mutant, wherein the 17β-hydroxysteroid dehydrogenase mutant comprises an amino acid sequence having all of SEQ ID NO: 2 except for: a mutation of valine at position 107 to alanine; a mutation of threonine at position 155 to asparagine; a mutation of histidine at position 164 to tyrosine; or a mutation of threonine at position 155 to asparagine, and a mutation of histidine at position 164 to tyrosine.

2. A gene, wherein the gene encodes the 17β-hydroxysteroid dehydrogenase mutant according to claim 1.

3. A recombinant plasmid, wherein the recombinant plasmid carries the gene according to claim 2.

4. A host cell, wherein the host cell carries the gene according to claim 2.

5. The host cell according to claim 4, wherein the host cell is Escherichia coli.

6. A method for producing boldenone, comprising: adding the host cell according to claim 4 to a transformation system containing 1,4-androstenedione to be transformed to obtain a transformation solution containing boldenone; and separating the transformation solution containing boldenone to obtain boldenone.

7. The method for producing boldenone according to claim 6, wherein the transformation temperature is 35 to 40° C. and the pH is 7.0 to 8.0.

8. The method for producing boldenone according to claim 6, wherein the transformation system further contains methylated-β-cyclodextrin.

9. A host cell, wherein the host cell comprises the recombinant plasmid according to claim 3.

Description

BRIEF DESCRIPTION OF FIGURES

(1) FIG. 1: Enzyme digestion verification results of different recombinant plasmids; in which, M: DNA Marker; 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21: recombinant plasmids digested with BamH I: pET28a-HSDBo.sup.V106L, pET28a-HSDBo.sup.V107A, pET28a-HSDBo.sup.F109D, pET28a-HSDBo.sup.N154S, pET28a-HSDBo.sup.T155N, pET28a-HSDBo.sup.D158R, pET28a-HSDBo.sup.F159G, pET28a-HSDBo.sup.V161F, pET28a-HSDBo.sup.H164Y, pET28a-HSDBo.sup.V208G and pET28a-HSDBo.sup.V107A/T155N/H164Y; 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22: recombinant plasmids digested with BamH I and Sac I: pET28a-HSDBo.sup.V106L, pET28a-HSDBo.sup.V107A, pET28a-HSDBo.sup.F109D, pET28a-HSDBo.sup.N154S, pET28a-HSDBo.sup.T155N, pET28a-HSDBo.sup.D158R, pET28a-HSDBo.sup.F159G, pET28a-HSDBo.sup.V161F, pET28a-HSDBo.sup.H164Y, pET28a-HSDBo.sup.V208G, and pET28a-HSDBo.sup.V107A/T155N/H164Y.

(2) FIG. 2: SDS-PAGE analysis results of cell disruption supernatants obtained by fermentation of different recombinant E. coli; in which, M: protein Marker; 1: cell disruption supernatant obtained by fermentation of E. coli BL21/pET28a; 2: cell disruption supernatant obtained by fermentation of E. coli BL21/pET28a-HSDBo.sup.V106L; 3: cell disruption supernatant obtained by fermentation of E. coli BL21/pET28a-HSDBo.sup.V107A; 4: cell disruption supernatant obtained by fermentation of E. coli BL21/pET28a-HSDBo.sup.F109D; 5: cell disruption supernatant obtained by fermentation of E. coli BL21/pET28a-HSDBo.sup.N154S; 6: cell disruption supernatant obtained by fermentation of E. coli BL21/pET28a-HSDBo.sup.T155N; 7: cell disruption supernatant obtained by fermentation of E. coli BL21/pET28a-HSDBo.sup.D158R; 8: cell disruption supernatant obtained by fermentation of E. coli BL21/pET28a-HSDBo.sup.F159G; 9: cell disruption supernatant obtained by fermentation of E. coli BL21/pET28a-HSDBo.sup.V161F; 10: cell disruption supernatant obtained by fermentation of E. coli BL21/pET28a-HSDBo.sup.H164Y; 11: cell disruption supernatant obtained by fermentation of E. coli BL21/pET28a-HSDBo.sup.V208G; 12: cell disruption supernatant obtained by fermentation of E. coli BL21/pET28a-HSDBo.sup.V107A/T155N/H164Y.

(3) FIG. 3: SDS-PAGE analysis results of different purified 17β-hydroxysteroid dehydrogenase mutants; in which, M: protein Marker; 1: cell disruption supernatant obtained by fermentation of E. coli BL21/pET28a-HSDBo.sup.V107A/T155N/H164Y; 2: purified 17β-hydroxysteroid dehydrogenase mutant V106L; 3: purified 17β-hydroxysteroid dehydrogenase mutant V107A; 4: purified 17β-hydroxysteroid dehydrogenase mutant F109D; 5: purified 17β-hydroxysteroid dehydrogenase mutant N154S; 6: purified 17β-hydroxysteroid dehydrogenase mutant T155N; 7: purified 17β-hydroxysteroid dehydrogenase mutant D158R; 8: purified 17β-hydroxysteroid dehydrogenase mutant F159G; 9: purified 17β-hydroxysteroid dehydrogenase mutant V161F; 10: purified 17β-hydroxysteroid dehydrogenase mutant H164Y; 11: purified 17β-hydroxysteroid dehydrogenase mutant V208G; 12: purified 17β-hydroxysteroid dehydrogenase mutant V107A/T155N/H164Y.

DETAILED DESCRIPTION

(4) The Escherichia coli BL21 involved in the following examples was purchased from Invitrogen company; the pET-28a plasmid involved in the following examples was purchased from Novagen company; 1,4-androstenedione (ADD) and boldenone involved in the following examples were purchased from SIGMA company, USA; Ellman reagent (DTNB) and cysteine involved in the following examples were purchased from Shanghai Aladdin Biochemical Technology Co., Ltd.

(5) The media and reagents involved in the following examples are as follows:

(6) LB liquid medium: peptone 10 g/L, yeast extract 5 g/L, NaCl 10 g/L.

(7) LB solid medium: peptone 10 g/L, yeast extract 5 g/L, NaCl 10 g/L, agar 20 g/L.

(8) The detection methods involved in the following examples are as follows:

(9) Determination of 1,4-androstenedione and boldenone contents: An HPLC method was used to determine the product concentration; in which, the chromatographic conditions are as follows: chromatographic column: DimosoilC18 (5 μL, 250 mm×4.6 mm), mobile phase: methanol-water (V/V=70:30), detector: UV Detector, detection wavelength: 254 nm, column temperature: 30° C., injection volume: 5 μL, and flow rate: 1.0 mL/min.

(10) Determination of enzyme activity of 17β-hydroxysteroid dehydrogenase: The reaction system (2 mL) contains a 10 mM phosphate buffer (pH 7.5), 200 μM 1,4-androstenedione pre-dissolved in 2% (v/v) methanol, 0.5 mM NADPH and an appropriate amount of purified 17β-hydroxysteroid dehydrogenase; after the reaction system reacted in a 37° C. water bath for 1 h, the reaction was terminated after reacting in a boiling water bath for 5 min, a supernatant was taken by centrifuging, and the content of boldenone in the supernatant was determined by the HPLC method, and then the enzyme activity of 17β-hydroxysteroid dehydrogenase was calculated.

(11) The enzymatic activity of 17β-hydroxysteroid dehydrogenase is defined as: the amount of enzyme required to transform 1 μmol 1,4-androstenedione to produce boldenone under the conditions of 37° C. and pH 7.5 is defined as one enzyme activity unit (1 U).

(12) Determination of specific enzyme activity of 17β-hydroxysteroid dehydrogenase: Specific enzyme activity of 17β-hydroxysteroid dehydrogenase=enzyme activity/protein concentration;

(13) The protein concentration was determined by the Bradford method, and the Bradford method was recorded in the reference “Bradford, M M 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dyebinding. Anal. Biochem. 72:248-254.”

Example 1: Preparation of 17β-Hydroxysteroid Dehydrogenase Mutants

(14) Specific steps are as follows:

(15) 1. Construction of Recombinant E. coli

(16) The pET-28a plasmid was transformed into Escherichia coli BL21 to obtain a transformation product; the transformation product was applied to the LB solid medium (containing 50 μg-mL.sup.−1 kanamycin), and inverted and cultured in a 37° C. constant temperature incubator for 8 to 12 h to obtain transformants; the transformants were picked, the LB liquid medium was inoculated with the transformants, the transformants were cultured in a shake flask at 37° C. and 180 rpm for 8 to 12 h, and then the plasmid was extracted for enzyme digestion verification and sequencing verification, and the engineered E. coli BL21/pET28a was obtained if the verification was correct.

(17) The gene encoding 17β-hydroxysteroid dehydrogenase (SEQ ID NO. 2) having a nucleotide sequence shown in SEQ ID NO. 1 was synthesized; the gene encoding 17β-hydroxysteroid dehydrogenase was used as a template and HSDBo-F and HSDBo-R were used as primers (see Table 1 for details) to perform PCR amplification to obtain an amplified product; the amplified product was ligated to the pET-28a plasmid digested with restriction enzymes BamH I and Hind III to obtain a ligation product; the ligation product was transformed into E. coli BL21 to obtain a transformation product; the transformation product was applied to the LB solid medium (containing 50 μg-mL.sup.−1 kanamycin), and inverted and cultured in a 37° C. constant temperature incubator for 8 to 12 h to obtain transformants; the transformants were picked, the LB liquid medium was inoculated with the transformants, the transformants were cultured in a shake flask at 37° C. and 180 rpm for 8 to 12 h, and then the plasmid was extracted for enzyme digestion verification and sequencing verification, and the recombinant plasmid pET28a-HSDBo and the engineered E. coli BL21/pET28a-HSDBo were obtained if the verification was correct.

(18) Using fusion PCR technology, the recombinant plasmid pET28a-HSDBo was used as a template, and HSDBo.sup.V106L-F and HSDBo.sup.V106L-R, HSDBo.sup.V107A-F and HSDBo.sup.V107A-R, HSDBo.sup.F109D-F and HSDBo.sup.F109D-R, HSDBo.sup.N154S-F and HSDBo.sup.N154S-R, HSDBo.sup.N155N-F and HSDBo.sup.T155N-R, HSDBo.sup.D158R-F and HSDBo.sup.D158R-R, HSDBo.sup.F159G-F and HSDBo.sup.F159G-R, HSDBo.sup.V161F-F and HSDBo.sup.V161F-R, HSDBo.sup.H164Y-F and HSDBo.sup.H164Y-R, HSDBo.sup.V208G-F and HSDBo.sup.V208G-R were respectively used as primers (see Table 1 for details) to carry out site-directed mutagenesis to obtain PCR products; the PCR products were transformed into E. coli BL21 to obtain transformation products; the transformation products were applied to the LB solid medium (containing 50 μg-mL.sup.−1 kanamycin), and inverted and cultured in a 37° C. constant temperature incubator for 8 to 12 h to obtain transformants; the transformants were picked, the LB liquid medium was inoculated with the transformants, the transformants were cultured in a shake flask at 37° C. and 180 rpm for 8 to 12 h, then the plasmids were extracted for enzyme digestion verification (see FIG. 1 for the verification results) and sequencing verification (sequencing was completed by Shanghai Sangon), and the recombinant plasmids pET28a-HSDBo.sup.V106L, pET28a-HSDBo.sup.V107A, pET28a-HSDBo.sup.F109D, pET28a-HSDBo.sup.N154S, pET28a-HSDBo.sup.T155N, pET28a-HSDBo.sup.D158R, pET28a-HSDBo.sup.F159G, pET28a-HSDBo.sup.V161F, pET28a-HSDBo.sup.H164Y, pET28a-HSDBo.sup.V208G and pET28a-HSDBo.sup.V107A/T155N/H164Y, and, the engineered E. coli BL21/pET28a-HSDBo.sup.V106L, E. coli BL21/pET28a-HSDBo.sup.V107A, E. coli BL21/pET28a-HSDBo.sup.F109D, E. coli BL21/pET28a-HSDBo.sup.N154S, E. coli BL21/pET28a-HSDBo.sup.T155N, E. coli HBL21/pET28a-HSDBo.sup.D158R, E. coli BL21/pET28a-HSDBo.sup.F159G, E. coli BL21/pET28a-HSDBo.sup.V161F, E. coli BL21/pET28a-HSDBo.sup.H164Y, E. coli BL21/pET28a-HSDBo.sup.V208G and E. coli BL21/pET28a-HSDBo.sup.V107A/T155N/H164Y where obtained if the verification was correct.

(19) TABLE-US-00001 TABLE 1 Primers used by PCR and nucleotide sequences thereof Primers Sequences (5′-3′) HSDBo-F CGGGATCCCGATGCCACACGTAGAAAGCACACCCTCC (SEQ ID NO. 3) HSDBo-R CGAGCTCGCTATGCGGCACCACCATCCAGCGTAAG (SEQ ID NO. 4) HSDBo.sup.V106L-F GCAACTCGGGCCTCGTAAGCTTCGG (SEQ ID NO. 5) HSDBo.sup.V106L-R CCGAAGCTTACGAGGCCCGAGTTGC (SEQ ID NO. 6) HSDBo.sup.V107A-F ACTCGGGCGTCGCCAGCTTCGGCCA (SEQ ID NO. 7) HSDBo.sup.V107A-R TGGCCGAAGCTGGCGACGCCCGAGT (SEQ ID NO. 8) HSDBo.sup.F109D-F GCGTCGTAAGCGACGGCCACTTGAA (SEQ ID NO. 9) HSDBo.sup.F109D-R TTCAAGTGGCCGTCGCTTACGACGC (SEQ ID NO. 10) HSDBo.sup.N154S-F TGACTTCCTCCAGCACCTCGCGCGA (SEQ ID NO. 11) HSDBo.sup.N154S-R TCGCGCGAGGTGCTGGAGGAAGTCA (SEQ ID NO. 12) HSDBo.sup.T155N-F CTTCCTCCAACAACTCGCGCGACTT (SEQ ID NO. 13) HSDBo.sup.T155N-R AAGTCGCGCGAGTTGTTGGAGGAAG (SEQ ID NO. 14) HSDBo.sup.D158R-F ACACCTCGCGCAGGTTTAGCGTGCC (SEQ ID NO. 15) HSDBo.sup.D158R-R GGCACGCTAAACCTGCGCGAGGTGT (SEQ ID NO. 16) HSDBo.sup.F159G-F CCTCGCGCGACGGTAGCGTGCCAAA (SEQ ID NO. 17) HSDBo.sup.F159G-R TTTGGCACGCTACCGTCGCGCGAGG (SEQ ID NO. 18) HSDBo.sup.V161F-F GCGACTTTAGCTTCCCAAAGCACTC (SEQ ID NO. 19) HSDBo.sup.V161F-R GAGTGCTTTGGGAAGCTAAAGTCGC (SEQ ID NO. 20) HSDBo.sup.H164Y-F GCGTGCCAAAGTACTCGCTGTACTC (SEQ ID NO. 21) HSDBo.sup.H164Y-R GAGTACAGCGAGTACTTTGGCACGC (SEQ ID NO. 22) HSDBo.sup.V208G-F TGTTTCATGAGGGTTCGCATCATTA (SEQ ID NO. 23) HSDBo.sup.V208G-R TAATGATGCGAACCCTCATGAAACA (SEQ ID NO. 24)

(20) 2. Preparation of 17β-Hydroxysteroid Dehydrogenase Mutants

(21) The engineered E. coli BL21/pET28a, E. coli BL21/pET28a-HSDBo, E. coli BL21/pET28a-HSDBo.sup.V106L, E. coli BL21/pET28a-HSDBo.sup.V107A, E. coli BL21/pET28a-HSDBo.sup.F109D, E. coli BL21/pET28a-HSDBo.sup.N154S, E. coli BL21/pET28a-HSDBo.sup.T155N, E. coli BL21/pET28a-HSDBo.sup.D158R, E. coli BL21/pET28a-HSDBo.sup.F159G, E. coli BL21/pET28a-HSDBo.sup.V161F, E. coli BL21/pET28a-HSDBo.sup.H164Y, E. coli BL21/pET28a-HSDBo.sup.V208G and E. coli BL21/pET28a-HSDBo.sup.V107A/T155N/H164Y were respectively streaked on the LB solid medium and cultured at 37° C. for 8 to 12 h to obtain single colonies; the single colonies were picked, the LB liquid medium was inoculated with the single colonies, and the single colonies were cultured at 37° C. for 8 to 12 h to obtain a seed liquid; the LB liquid medium was inoculated with the seed liquid at an inoculum amount of 1% (v/v), and the seed liquid was cultured at 37° C. and 180 rpm for 12 to 24 h to obtain a fermentation broth; the fermentation broth was centrifuged to take cells; the cells were disrupted with ultrasonics and centrifuged to obtain cell disruption supernatants (SDS-PAGE analysis results of the cell disruption supernatant are shown in FIG. 2); the cell disruption supernatants were subjected to affinity chromatography on a nickel column to obtain purified wild-type 17β-hydroxysteroid dehydrogenase and 17β-hydroxysteroid dehydrogenase mutants V106L, V107A, F109D, N154S, T155N, D158R, F159G, V161F, H164Y, V208G and V107A/T155N/H164Y (SDS-PAGE analysis results of pure enzymes are shown in FIG. 3).

(22) The specific enzyme activities of the purified wild-type 17β-hydroxysteroid dehydrogenase and 17β-hydroxysteroid dehydrogenase mutants V106L, V107A, F109D, N154S, T155N, D158R, F159G, V161F, H164Y, V208G, and V107A/T155N/H164Y were detected. The detection results were as follows: the specific enzyme activity of the purified wild-type 17β-hydroxysteroid dehydrogenase was 1.66 U/mg, and the specific enzyme activities of the purified 17β-hydroxysteroid dehydrogenase mutants V106L, V107A, F109D, N154S, T155N, D158R, F159G, V161F, H164Y, V208G and V107A/T155N/H164Y were 0.27, 1.85, 1.03, 1.26, 1.93, 1.42, 0.74, 0.67, 2.06, 0.38 and 5.15 U/mg, respectively. It can be seen that only the 17β-hydroxysteroid dehydrogenase mutants V107A, T155N, H164Y and V107A/T155N/H164Y have specific enzyme activities higher than that of the wild-type 17β-hydroxysteroid dehydrogenase.

(23) 3. Enzymatic Properties of 17β-Hydroxysteroid Dehydrogenase Mutants

(24) 3.1. Optimum Temperature

(25) The enzyme activities of the purified wild-type 17β-hydroxysteroid dehydrogenase and 17β-hydroxysteroid dehydrogenase mutants V107A, T155N, H164Y, and V107A/T155N/H164Y were determined at 20 to 60° C. (the temperature gradient interval is 5° C., including 37° C.), and other enzyme activities were compared with the highest enzyme activity of 100% to calculate the relative enzyme activities to investigate the optimal operative temperature of the enzyme.

(26) The detection results are as follows: the optimal temperatures of the wild-type 17β-hydroxysteroid dehydrogenase and 17β-hydroxysteroid dehydrogenase mutants V107A, T155N, H164Y, and V107A/T155N/H164Y are 37° C.

(27) 3.2. Optimal pH

(28) After the 10 mM phosphate buffer (pH 7.5) in the reaction system was respectively replaced with a 10 mM Na.sub.2HPO.sub.4-citrate buffer with pH 4 to 6, a 10 mM Na.sub.2HPO.sub.4—NaH.sub.2PO.sub.4 buffer with pH 6 to 8; and a 10 mM Na.sub.2CO.sub.3—NaHCO.sub.3 buffer with pH 8 to 10 (the pH gradient interval is 1, including pH 7.5), the enzyme activities of the purified wild-type 17β-hydroxysteroid dehydrogenase and 17β-hydroxysteroid dehydrogenase mutants V107A, T155N, H164Y, and V107A/T155N/H164Y were determined, and other enzyme activities were compared with the highest enzyme activity of 100% to calculate the relative enzyme activities to investigate the optimal operative pH of the enzyme.

(29) The detection results are as follows: the optimal pH of the wild-type 17β-hydroxysteroid dehydrogenase and 17β-hydroxysteroid dehydrogenase mutants V107A, T155N, H164Y, and V107A/T155N/H164Y is 7.5.

Example 2: Production of Boldenone

(30) Specific steps are as follows:

(31) Taking the engineered E. coli BL21/pET28a-HSDBo obtained in Example 1 as a control, the engineered E. coli BL21/pET28a-HSDBo.sup.V107A, E. coli BL21/pET28a-HSDBo.sup.T155N, E. coli BL21/pET28a-HSDBo.sup.H164Y and E. coli BL21/pET28a-HSDBo.sup.V107A/T155N/H164Y cells obtained in Example 1 were respectively added at the addition amount of 200 g/L to the transformation system containing a 1 g/L substrate, 1,4-androstenedione, and 3 g/L methylated-β-cyclodextrin (substrate cosolvent) to be transformed at 37° C. and pH 7.5 for 24 h to obtain a transformation solution.

(32) The yield of boldenone in the transformation solution was detected, and the detection results are as follows: the engineered E. coli BL21/pET28a-HSDBo.sup.V107A, E. coli BL21/pET28a-HSDBo.sup.T155N, E. coli BL21/pET28a-HSDBo.sup.H164Y and E. coli BL21/pET28a-HSDBo.sup.V107A/T155N/H164Y were respectively added to the transformation system containing 1,4-androstenedione to be transformed for 24 h, so that the yields of boldenone in the transformation solution was as high as 2.12, 2.20, 2.16 and 2.49 g/L, respectively, which were 1.11, 1.15, 1.18, and 1.30 times larger than that of the engineered E. coli BL21/pET28a-HSDBo (1.91 g/L).