Promoters and uses thereof
11098306 · 2021-08-24
Assignee
Inventors
Cpc classification
C12N15/70
CHEMISTRY; METALLURGY
C12N15/11
CHEMISTRY; METALLURGY
C12N15/635
CHEMISTRY; METALLURGY
International classification
C12N15/11
CHEMISTRY; METALLURGY
Abstract
The present invention relates to synthetic promoters, as well as expression cassettes, and recombinant scaffolds, and methods thereof. In particular embodiments, the synthetic promoter is inducible by one or more chemical compounds present during lignin depolymerization.
Claims
1. A phenolic-inducible synthetic promoter comprising a spacer region, wherein the spacer region comprises: a first element comprising a nucleic acid sequence having at least 80% sequence identity to any one of SEQ ID NOs: 22-25; a second element comprising a nucleic acid sequence having at least 80% sequence identity to any one of SEQ ID NOs: 26-33; and a third element comprising a nucleic acid sequence having at least 80% sequence identity to any one of SEQ ID NOs: 34-37; wherein the promoter comprises a nucleic acid sequence having at least 98% sequence identity to any one of SEQ ID NOs: 1-9.
2. The synthetic promoter of claim 1, further comprising: an element upstream of the first element, wherein the element comprises a nucleic acid sequence having at least 80% sequence identity to any one of SEQ ID NOs: 10-21.
3. The synthetic promoter of claim 1, further comprising: an element downstream of the third element, wherein the element comprises a nucleic acid sequence having at least 80% sequence identity to any one of SEQ ID NOs: 38-42.
4. An expression cassette comprising: (i) a phenolic-inducible synthetic promoter, wherein the synthetic promoter comprises a spacer region, wherein the spacer region comprises: a first element comprising a nucleic acid sequence having at least 80% sequence identity to any one of SEQ ID NOs: 22-25; a third element comprising a nucleic acid sequence having at least 80% sequence identity to any one of SEQ ID NOs: 34-37; and a second element comprising a variable nucleic acid sequence disposed between the first and third elements; and (ii) a gene operably linked to the synthetic promoter, wherein the gene encodes a first protein that interacts with a first phenolic compound; wherein the promoter comprises a nucleic acid sequence having at least 98% sequence identity to any one of SEQ ID NOs: 1-9; wherein the first phenolic compound comprises a structure of formula (I) or a salt thereof or an anionic form thereof; ##STR00001## in which X is a bond, an optionally substituted alkylene, an optionally substituted alkenylene, or an optionally substituted heteroalkylene R.sub.1 is H, optionally substituted alkyl, optionally substituted alkoxy, optionally substituted alkanoyl, carboxyaldehyde, carboxyaldehydealkyl, hydroxyl, hydroxyalkyl, thiol, thioalkoxy, or carboxyalkyl; each of R.sub.2 is, independently, H or optionally substituted alkyl; and R.sub.3 is H, optionally substituted alkyl, optionally substituted alkoxy, optionally substituted alkanoyl, or hydroxyl.
5. The expression cassette of claim 4, wherein the first phenolic compound induces the synthetic promoter.
6. The expression cassette of claim 5, wherein the first phenolic compound comprises vanillin, vanillic acid, ferulic acid, coumaric acid, syringaldehyde, syringate, or protocatechuate or a salt thereof or an anionic form thereof.
7. The expression cassette of claim 4, wherein the first protein comprises alcohol dehydrogenase, aldehyde dehydrogenase, protocatechuate decarboxylase, benzaldehyde dehydrogenase, benzaldehydederivatives dehydrogenase, catechol dioxygenase, 20 catechol 1,2-dioxygenase, coumarate transporter, DesA-syringate O-demethylase, DesB-gallate dioxygenase, DesV dehydrogenase or benzaldehyde dehydrogenase, 3-0-25 methylgallate 3,4-dioxygenase, decarboxylase subunit, noyl-CoAhydratase or phydroxycinnamoyl-CoA hydratase/lyase, feruloyl-CoA synthetase, feruloyl-CoA synthetase, feruloyl-CoA hydratase/lyase, feruloyl-CoA hydratase/lyase, FerC, ferulic acid decarboxylase, 3-hydroxyacyl-CoA dehydrogenase, hydroxylase, choline dehydrogenase or a β-hydroxypropiovanillone (HPV) oxidase, protocatechuate 4,5-dioxygenase, protocatechuate 4,5-dioxygenase, 4-carboxy-2-hydroxymuconate-6-semialdehyde (CHMS) dehydrogenase, C-α-dehydrogenase, β-etherase or a glutathione S-transferase (GSTase), β-etherase or a GSTase, glutathione lyase, 10-formyltetrahydrofolate synthetase, 2-pyrone-4,6-dicarboxylate (PDC) hydrolase, 4-oxalomesaconate (OMA) hydratase, 4-carboxy-4-hydroxy-2-oxoadipate (CHA) aldolase, C-α-dehydrogenase, 3-0-methylgallate-O-demethylase, C-α-dehydrogenase, C-α-dehydrogenase, β-etherase, tautomerase or an OMA tautomerase, vanillin dehydrogenase, decarboxylase or 5-carboxyvanillate decarboxylase, decarboxylase or a 5-carboxyvanillate decarboxylase, 5,5′-dehydrodivanillate (DDVA) O-demethylase component, hydrolase or a 2,2′, 3-trihydroxy-3′-methoxy-5,5′-dicarboxybiphenyl (OHDDVA) meta-cleavage compound hydrolase, dioxygenase, or a OH-DDVA dioxygenase, gallate decarboxylase or 3-octaprenyl-4-hydroxybenzoate carboxy-lyase, lignostilbene dioxygenase, methylene folate reductase, protocatechuate decarboxylase, p-hydroxybenzoate-3-hydroxylase, p-hydroxybenzaldehyde synthase, p-hydroxybenzoate decarboxylase, (+)-DCA-C oxidase, (−)-DCA-C oxidase, p-hydroxycinnamoyl-CoA synthetase, p-hydroxycinnamoyl-CoA hydratase/lyase, pinoresinol/lariciresinol reductase, p-hydroxybenzoate hydroxylase, thiolase, vanillate-O-demethylase oxygenase subunit, vanillate-O-demethylase reductase subunit, or vanillin dehydrogenase, each as present in E. coli.
8. The expression cassette of claim 4, wherein the first protein comprises a C-α-dehydrogenase, a β-etherase, a dioxygenase, a hydrolase, an aromatic transporter, a vanillin dehydrogenase, or a feruloyl-CoA synthetase.
9. The expression cassette of claim 4, further comprising: a second phenolic-inducible synthetic promoter, wherein the second phenolic-inducible synthetic promoter comprises a spacer region, wherein the spacer region comprises: a first element comprising a nucleic acid sequence having at least 80% sequence identity to any one of SEQ ID NOs: 22-25; a third element comprising a nucleic acid sequence having at least 80% sequence identity to any one of SEQ ID NOs: 34-37; and a second element comprising a variable nucleic acid sequence disposed between the first and third elements; and a second gene operably linked to the second synthetic promoter, wherein the second gene encodes a second protein that interacts with a second phenolic compound and wherein the second phenolic compound is a product of a reaction between the first phenolic compound and the first protein.
10. The expression cassette of claim 9, wherein the first phenolic compound comprises vanillin and the second phenolic compound comprises vanillate.
11. The expression cassette of claim 10, wherein the first protein comprises vanillin dehydrogenase as present in E. coli.
12. A recombinant gene comprising a phenolic-inducible synthetic promoter of claim 1.
13. A recombinant vector comprising an expression cassette of claim 1.
14. An isolated host cell comprising a modified gene that comprises a phenolic-inducible synthetic promoter of claim 1.
15. A method of treating lignin or a derivative thereof, the method comprising: introducing to a source comprising lignin or a derivative thereof a host cell comprising a modified gene that comprises a phenolic-inducible synthetic promoter comprising a spacer region, wherein the spacer region comprises: a first element comprising a nucleic acid sequence having at least 80% sequence identity to any one of SEQ ID NOs: 22-25; a second element comprising a nucleic acid sequence having at least 80% sequence identity to any one of SEQ ID NOs: 26-33; and a third element comprising a nucleic acid sequence having at least 80% sequence identity to any one of SEQ ID NOs: 34-37; wherein the promoter comprises a nucleic acid sequence having at least 98% sequence identity to any one of SEQ ID NOs: 1-9.
16. The method of claim 15, wherein the source comprises one or more phenolic compounds, lignin, lignocellulose, or a lignin derivative.
17. The expression cassette of claim 4, wherein the second element comprises a nucleic acid sequence having at least 80% sequence identity to any one of SEQ ID NOs: 26-33.
18. The synthetic promoter of claim 1, wherein the promoter is characterized in E. coli and comprises SEQ ID NO: 6; wherein the first element is SEQ ID NO: 25, the second element is SEQ ID NO: 33; and the third element is SEQ ID NO: 37; further comprising intact full-length SEQ ID NO: 10 or SEQ ID NO: 39.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
DETAILED DESCRIPTION OF THE INVENTION
(13) The present invention relates, in part, to a synthetic promoter and methods thereof. In particular embodiments, the synthetic promoter is a phenolic-inducible synthetic promoter, in which one or more phenolic compounds facilitate the transcription of a gene and/or binding of a polymerase to one or more promoter sites.
(14) The synthetic promoter can include any useful regions or sites to bind a polymerase (e.g., an RNA polymerase), interact with transcription factor(s), recognize phenolic compound(s), and/or facilitate protein expression.
(15) Exemplary sequences for synthetic promoters (or a portion thereof) are provided in
(16) As can be seen, the spacer region is disposed between the UP and DOWN elements. The spacer region 170 can further include regions that facilitate polymerase recognition. For instance, the spacer region 170 can include a first element 171 (e.g., a −35 element), a second element 172 (e.g., a variable element), and a third element 173 (e.g., a −10 element).
(17) Exemplary sequences for regions of synthetic promoters or spacer regions are provided in
(18) Synthetic promoters can be provided to a host cell in any useful manner or form. In one non-limiting instance, the synthetic promoter is provided as an expression cassette, in which a gene is operably linked to the synthetic promoter (e.g., located downstream of the synthetic promoter and/or linked by one or more covalent bonds or nucleic acid sequence(s)). The desired gene can have any useful property. In one non-limiting instance, the gene (e.g., a first gene) encodes a protein (e.g., a first protein) that is beneficial for degrading or breaking down lignin or a lignin derivative. The expression cassette can then provide one or more modified portions of the host cell's genome.
(19) One or more expression cassettes can be designed to facilitate a dynamic regulator system, in which delivery of such expression cassette(s) to a host cell can establish one or more modified gene regions within the host. For instance and without limitation, a first phenolic compound that induces expression can result in expression of a first protein, which interacts with a substrate to produce the first phenolic compound. In this instance, a feedback-type loop can be established, in which presence of the first phenolic compound induces an in situ biological network to produce additional first phenolic compounds. For example, a feedback-type loop can be established by having a vanillin-inducible synthetic promoter operable linked to a nucleic acid encoding a LigF gene. Then, the presence of vanillin would promote expression of the LigF protein, which in turn will increase cellular concentrations of LigF to convert a substrate (e.g., MPHPV) into vanillin. Further increases in vanillin using this feedback-type loop could further stimulate production of LigF by way of the vanillin-inducible synthetic promoter.
(20)
(21) In another non-limiting instance, a first phenolic compound that induces expression can result in expression of a first protein, which interacts with the first phenolic compound to produce a second phenolic compound. In this instance, a feedforward-type loop can be established, in which presence of the first phenolic compound induces an in situ biological network to produce a second phenolic compound that propagates intracellular degradation of the first phenolic compound. For example, a feedforward-type loop can be established by having a vanillin-inducible synthetic promoter operable linked to a nucleic acid encoding a LigV gene. Then, the presence of vanillin would promote expression of the LigV protein, which in turn will increase cellular concentrations of LigV to convert vanillin into vanillate, thus promoting conversion of vanillin into other phenolic degradation products.
(22) A dynamic regulator system can include use of two or more expression cassettes, in which gene products from such cassettes can interact in parallel or consecutive reactions. In one non-limiting instance, cascading reaction networks can be implemented. For instance and without limitation, a first expression cassette can be inducible by a first phenolic compound, and a second expression cassette can be inducible by a second phenolic compound. Expression of the first gene (provided within the first expression cassette) can provide a first protein, which in turn provides the second phenolic compound. For example, a cascading network can be established by having a vanillin-inducible synthetic promoter operable linked to a nucleic acid encoding a LigV gene (provided by a first expression cassette) and a vanillate-inducible synthetic promoter operable linked to a nucleic acid encoding a VanA gene (provided by a second expression cassette). Then, the presence of vanillin would promote expression of the LigV protein, which in turn will increase cellular concentrations of LigV to convert vanillin into vanillate. Next, produced vanillate could promote expression of the VanA protein, which in turn can convert vanillate into PCA. In this manner, interacting reactions can be controlled by providing designed expression cassettes to a host cell.
(23)
(24) The first synthetic promoter P.sub.1 255 is induced by the presence of a first phenolic compound 271, and expression of gene G.sub.1 256 provides a first protein 281, which converts a first phenolic compound 271 into a second phenolic compound 272. Then, the second synthetic promoter P.sub.2 257 is induced by the presence of the second phenolic compound 272, and expression of gene G.sub.2 258 provides a second protein 282, which converts a second phenolic compound 272 into a third phenolic compound 273.
(25) As can be seen, the synthetic promoter can be induced by any useful phenolic compound and be operably linked by any useful gene to express any useful protein (e.g., for degradation or conversion of a phenolic compound, lignin, or a lignin derivative).
(26) A host cell can modified to include genes capable of expression one or more proteins (e.g., proteins in
(27) In one non-limiting embodiment, the expression cassette includes a first synthetic promoter inducible by a first phenolic compound and a first gene operable linked to the first promoter that is configured to express a first protein. Exemplary constructs can include any of the following: a vanillin-inducible promoter upstream of a gene encoding LigV, DesV, Vdh, LigF, LigE, LigP, LigG, FerA, FerB, FerB2, Fcs, Ech, ADH, ALDH, BzaA, PhcC, PhcD, and/or PinZ, as well as any other protein described herein (e.g., in
(28) In another non-limiting embodiment, the expression cassette includes a first synthetic promoter inducible by a first phenolic compound and a first gene operable linked to the promoter that is configured to express a first protein, as well as a second synthetic promoter inducible by a second phenolic compound and a second gene operable linked to the promoter that is configured to express a second protein. The first and second phenolic compounds can be the same or different.
(29) A recombinant gene can include any useful synthetic promoter (e.g., any described herein) that is upstream of a gene. Expression cassettes (e.g., any described herein) can be provided in any useful vector. Furthermore, a host cell can include a modified gene that include any useful synthetic promoter (e.g., any described herein), which can be provided in any useful manner (e.g., an expression cassette, a vector, etc.).
(30) Phenolic Compounds
(31) The present invention relates, in part, to a synthetic promoter capable of being induced by the presence of one or more phenolic compounds. Induction can be characterized by enhanced transcription of a gene operably linked to the promoter in the presence of a phenolic compound, as compared to transcription in the absence of the phenolic compound.
(32) Exemplary phenolic compounds include one or more lignin-derived aromatics (e.g., one or more degradation products of lignin). Non-limiting phenolic compounds include monoaryl compounds (e.g., vanillin; vanillate or vanillic acid, as well as salts thereof and deprotonated forms thereof, ferulate or ferulic acid, as well as salts thereof and deprotonated forms thereof; coumarate or coumaric acid (e.g., p-coumaric acid), as well as salts thereof and deprotonated forms thereof; syringaldehyde; syringate or syringic acid, as well as salts thereof and deprotonated forms thereof, vanilloyl acetaldehyde (VAL); vanilloyl acetic acid; 5-carboxyvanillate (5CVA); or protocatechuate (PCA).
(33) Further exemplary phenolic compounds include those having a structure of formula (I) (
(34) Genes and Gene Products, Including Proteins
(35) The present invention relates, in part, to a novel promoter that can be operably linked to a gene (e.g., a heterologous gene). In particular embodiments, the gene is a protein (e.g., involved in the catabolism or synthesis of one or more phenolic compounds, such as any described herein).
(36) Exemplary genes and proteins include one or more of the following: ADH (e.g., an alcohol dehydrogenase), ALDH (e.g., an aldehyde dehydrogenase), AroY (e.g., a protocatechuate decarboxylase, such as in GenBank Acc. Nos. KX774258, ADF61496, and BAH20873), BADH (e.g., a benzaldehyde dehydrogenase), BzaA (e.g., a benzaldehyde-derivatives dehydrogenase, such as in GenBank Acc. No. BAK67466), CatA (e.g., a catechol dioxygenase, such as in GenBank Acc. No. BAA07037, D37782, or GAM30370), CatA2 (e.g., a catechol 1,2-dioxygenase, such as in GenBank Acc. No. D37782), CouP (e.g., a coumarate transporter, such as in GenBank Acc. No. 4JB2_A or in GenBank Acc. No. CAE27230), DesA (e.g., a syringate O-demethylase, such as in GenBank Acc. No. BAK67175), DesB (e.g., a gallate dioxygenase, such as in GenBank Acc. No. BAK65008), DesV (e.g., a dehydrogenase or a benzaldehyde dehydrogenase, such as in GenBank Acc. No. BAK67507), DesZ (e.g., a 3-O-methylgallate 3,4-dioxygenase, such as in GenBank Acc. No. BAK66578), EcdB (e.g., a decarboxylase subunit, such as in GenBank Acc. No. ADF63617), EcdD (e.g., a decarboxylase subunit, such as in GenBank Acc. No. ADF63615), Ech (e.g., enoyl-CoA-hydratase or p-hydroxycinnamoyl-CoA hydratase/lyase, such as in GenBank Acc. No. Y13067 and in Gene ID Nos. 1046422 and 1047000), Fcs (e.g., a feruloyl-CoA synthetase, such as in GenBank Acc. Nos. AJ238746 or NP_745496.2 and in Gene ID No. 1046999), FerA (e.g., a feruloyl-CoA synthetase, such as in GenBank Acc. No. BAK67177), FerB (e.g., a feruloyl-CoA hydratase/lyase, such as in GenBank Acc. No. BAK67178), FerB2 (e.g., a feruloyl-CoA hydratase/lyase, such as in GenBank Acc. No. BAK65462), FerC (e.g., such as in GenBank Acc. No. BAK67179), FDC (e.g., a ferulic acid decarboxylase, such as FDC1 or in GenBank Acc. No. BK006938), HADH (3-hydroxyacyl-CoA dehydrogenase), HDE (e.g., a hydroxylase), HpvZ (e.g., a choline dehydrogenase or a β-hydroxypropiovanillone (HPV) oxidase, such as exemplary amino acid sequences provided as UniProt Acc. Nos. G2IQT6, G2IPY4, G2INY6, and G2INY7, as well as exemplary nucleic acid sequences provided as Ensembl Gene ID Nos. SLG 09500, SLG_09510, and SLG_12830), LigA (e.g., a protocatechuate 4,5-dioxygenase, such as in DDBJ Acc. No. M34835-1 or in GenBank Acc. No. BAK65926), LigB (e.g., a protocatechuate 4,5-dioxygenase, such as in DDBJ Acc. No. M34835-2 or in GenBank Acc. No. BAK65925), LigC (e.g., a 4-carboxy-2-hydroxymuconate-6-semialdehyde (CHMS) dehydrogenase, such as in GenBank Acc. No. BAK65924), LigD (e.g., a C-α-dehydrogenase, such as in DDBJ Acc. No. D11473-1 and in GenBank Acc. No. BAK65539), LigE (e.g., a β-etherase or a glutathione S-transferase (GSTase), such as in DDBJ Acc. No. M11473-3 and in GenBank Acc. No. BAK65541), LigF (e.g., a 3-etherase or a GSTase, such as in DDBJ Acc. No. D11473-2 and in GenBank Acc. No. BAK65540), LigG (e.g., a glutathione lyase or a GSTase, such as in DDBJ Acc. No. AB026292 and in GenBank Acc. No. BAK65542; UniProt Acc. Nos. Q9WXJ9, G2IN94, and A0A158S6W2; or Ensembl Gene ID Nos. SPHV1_50078 and SPHV1_50078), LigDFG, LigH (e.g., a 10-formyltetrahydrofolate synthetase, such as in DDBJ Acc. No. AB006079-1 or in GenBank Acc. No. BAK65951), LigI (e.g., a 2-pyrone-4,6-dicarboxylate (PDC) hydrolase, such as in DDBJ Acc. No. AB015964 or in GenBank Acc. No. BAK65932), LigJ (e.g., an 4-oxalomesaconate (OMA) hydratase, such as in GenBank Acc. No. BAK65927), LigK (e.g., a 4-carboxy-4-hydroxy-2-oxoadipate (CHA) aldolase, such as in GenBank Acc. No. BAK65930), LigL (e.g., a C-α-dehydrogenase, such as in GenBank Acc. No. BAK68041), LigM (e.g., a 3-O-methylgallate-O-demethylase, such as in GenBank Acc. No. KX774255 or in GenBank Acc. Nos. BAK65949 or BAK65949.1), LigN (e.g., a C-α-dehydrogenase, such as in GenBank Acc. No. BAK68265), LigO (e.g., a C-α-dehydrogenase, such as in GenBank Acc. No. BAK68263), LigP (e.g., a β-etherase, such as in GenBank Acc. No. BAK67935), LigR (e.g., such as in GenBank Acc. No. BAK65929), LigU (e.g., a tautomerase or an OMA tautomerase, such as in GenBank Acc. No. BAK65931), LigV (e.g., a vanillin dehydrogenase, such as in GenBank Acc. Nos. KX774254, BAK65381, or BAK65381.1), LigW (e.g., a decarboxylase or a 5-carboxyvanillate decarboxylase, such as in GenBank Acc. No. BAK65460), LigW2 (e.g., a decarboxylase or a 5-carboxyvanillate decarboxylase, such as in GenBank Acc. No. BAK65956), LigX (e.g., a 5,5′-dehydrodivanillate (DDVA) O-demethylase component, such as in GenBank Acc. Nos. BAK65452, BAK65525, or BAK66795; including LigXa, LigXb, LigXc, and/or LigXd), LigY (e.g., a hydrolase or a 2,2′, 3-trihydroxy-3′-methoxy-5,5′-dicarboxybiphenyl (OH-DDVA) meta-cleavage compound hydrolase, such as in DDBJ Acc. No. AB018415 and in GenBank Acc. No. BAK65450), LigZ (e.g., a dioxygenase and a OH-DDVA dioxygenase, such as in DDBJ Acc. No. AB007823-1 and in GenBank Acc. No. BAK65447), Lpdc (e.g., a gallate decarboxylase or 3-octaprenyl-4-hydroxybenzoate carboxy-lyase, such as in GenBank Acc. No. NC_004567.2 or Gene ID No. 1063372, locus tag Lp_2945), LsdA (e.g., a lignostilbene dioxygenase, such as in DDBJ Acc. No. AB015964), MetF (e.g., a methylene folate reductase, such as in GenBank Acc. No. BAK65950), PCADC (e.g., a protocatechuate decarboxylase), pHB3H (e.g., a p-hydroxybenzoate-3-hydroxylase), pHBALS (e.g., a p-hydroxybenzaldehyde synthase), pHBDC (e.g., a p-hydroxybenzoate decarboxylase), PhcC (e.g., a (+)-DCA-C oxidase, such as in GenBank Acc. No. BAK65623), PhcD (e.g., a (−)-DCA-C oxidase, such as in GenBank Acc. No. BAK65625), pHCHL (e.g., a p-hydroxycinnamoyl-CoA hydratase/lyase), pHCS (e.g., a p-hydroxycinnamoyl-CoA synthetase), PinZ (e.g., a pinoresinol/lariciresinol reductase, such as in GenBank Acc. No. BAK65407), PobA (e.g., a p-hydroxybenzoate hydroxylase, such as in GenBank Acc. No. X68438), TE (e.g., a thiolase), VanA (e.g., a vanillate-O-demethylase oxygenase subunit, such as in GenBank Acc. No. Y14759), VanB (e.g., a vanillate-O-demethylase reductase subunit, such as in GenBank Acc. No. Y14759), and Vdh (e.g., a vanillin dehydrogenase, such as in GenBank Acc. No. Y11520 and Gene ID No. 1047002).
(37) In particular embodiments, the gene encodes for one or more of LigV, DesV, HpvZ, LigF, LigE, LigP, LigD, LigDFG, LigL, LigN, LigG, LigY, LigW, LigW2, LigM, DesA, LigA, LigB, LigC, LigX, LigZ, DesZ, FerA, FerB, FerB2, AroY, CatA, CouP, pHCS, Ech, FDC, HADH, or Lpdc. In other embodiments, the protein is selected from the group of LigV, DesV, HpvZ, LigF, LigE, LigP, LigD, LigDFG, LigL, LigN, LigG, LigY, LigW, LigW2, LigM, DesA, LigA, LigB, LigC, LigX, LigZ, DesZ, FerA, FerB, FerB2, AroY, CatA, CouP, pHCS, Ech, FDC, HADH, and Lpdc.
(38) Further exemplary genes and proteins include one or more C-α-dehydrogenases (e.g., LigD, LigL, LigN, and LigO, such as exemplary amino acid sequences provided as UniProt Acc. Nos. Q01198, G0EUA3, G8Q248, A0A2W7NR13, C0SUJ9, C0SUK1, and C0SUK3, as well as exemplary nucleic acid sequences provided as Ensembl Gene ID Nos. ACIDI_44c00110, CNE_1c15670, GOACH_04_03020, SLG_08640, SLG_33660, SLG_35880, SLG_35900, and SPHV1_50071); one or more β-etherases (e.g., LigF, LigE, and LigP, such as exemplary amino acid sequences provided as UniProt Acc. Nos. P30347, P27457, G21N92, A0A2K8MHZ7, G21N93, A0A0M3FT69, and E1CJ68, as well as exemplary nucleic acid sequences provided as Ensembl Gene ID Nos. A8U91_02108, ACIDI_4c01430, BGL_2c14680, JAB1_29170, LOKO_01842, PsAD26_02197, PsWM33_05031, PsW74_02125, SHLA_51c000130, SE99_00257, SLG 08650, SLG_08660, SLG 32600, SPHV1_50077, and USDA257_c08850); one or more aromatic transporters (e.g., CouP or VanK, such as in GenBank Acc. Nos. AF009672, 4JB2_A, or CAE27230); one or more vanillin dehydrogenases (e.g., LigV or Vdh, such as in GenBank Acc. Nos. KX774254, BAK65381, BAK65381.1, or Y11520); and one or more feruloyl-CoA synthetases (e.g., FerA or Fcs, such as in GenBank Acc. Nos. BAK67177 or AJ238746).
(39) Further exemplary genes and proteins include one or more of the following: an alcohol dehydrogenase, an aldehyde dehydrogenase, a benzaldehyde dehydrogenase (e.g., DesV), a benzaldehyde-derivative dehydrogenase (e.g., BzaA), a C-α-dehydrogenase (e.g., LigD, LigL, LigN, or LigO), a 4-carboxy-2-hydroxymuconate-6-semialdehyde (CHMS) dehydrogenase (e.g., LigC), a 4-carboxy-4-hydroxy-2-oxoadipate (CHA) aldolase (e.g., LigK), a catechol dioxygenase (e.g., CatA or CatA2), a choline dehydrogenase (e.g., a DCA-C oxidase and including HpvZ, PhcC, or PhcD), a coumarate transporter (e.g., CouP or VanK), a decarboxylase subunit (e.g., EcdB or EcdD), an enoyl-CoA-hydratase (e.g., a p-hydroxycinnamoyl-CoA hydratase/lyase), a β-etherase (e.g., LigE, LigF, or LigP), a ferulic acid decarboxylase (e.g., FDC1), a ferulic acid responsive repressor (e.g., FerC), a feruloyl-CoA synthetase (e.g., FerA or Fcs), a feruloyl-CoA hydratase/lyase (e.g., FerB or FerB2), a 10-formyltetrahydrofolate synthetase (e.g., LigH), a gallate demethylase (e.g., a 3-O-methylgallate-O-demethylase and including LigM), a gallate decarboxylase (e.g., a 3-octaprenyl-4-hydroxybenzoate carboxy-lyase and including Lpdc), a gallate dioxygenase (e.g., a 3-O-methylgallate 3,4-dioxygenase and including DesB or DesZ), a glutathione lyase (e.g., LigG), a glutathione S-transferase (GSTase) (e.g., LigE, LigF, or LigG), a 3-hydroxyacyl-CoA dehydrogenase, a hydroxylase, a p-hydroxypropiovanillone oxidase, a lignostilbene dioxygenase (e.g., LsdA), a LysR-type transcriptional regulator (LTTR) (e.g., LigR), a methylene folate reductase (e.g., MetF), an 4-oxalomesaconate (OMA) hydratase (e.g., LigJ), an OMA tautomerase (e.g., LigU), a p-hydroxybenzoate decarboxylase, a p-hydroxybenzoate hydroxylase (e.g., PobA), a p-hydroxybenzaldehyde synthase, a p-hydroxycinnamoyl-CoA hydratase/lyase, a p-hydroxycinnamoyl-CoA synthetase, a phthalate dioxygenase (e.g., a 5,5′-dehydrodivanillate (DDVA) O-demethylase component or a OH-DDVA dioxygenase; and including LigX, LigXa, LigXb, LigXc, LigXd, or LigZ), a phthalate hydrolase (e.g., a 2,2′,3-trihydroxy-3′-methoxy-5,5′-dicarboxybiphenyl (OH-DDVA) meta-cleavage compound hydrolase and including LigY), a pinoresinol/lariciresinol reductase (e.g., PinZ), a protocatechuate decarboxylase (e.g., AroY), a protocatechuate dioxygenase (e.g., a protocatechuate 4,5-dioxygenase and including LigA and LigB), a 2-pyrone-4,6-dicarboxylate (PDC) hydrolase (e.g., LigI), a syringate O-demethylase (e.g., DesA), a thiolase, a vanillate decarboxylase (e.g., a 5-carboxyvanillate decarboxylase and including LigW and LigW2), a vanillin dehydrogenase (e.g., LigV or Vdh), and a vanillate demethylase oxygenase (e.g., a vanillate-O-demethylase oxygenase subunit and including VanA and VanB).
(40) Each accession number (Acc. No.) and identification number (ID No.) recited herein, as well as associated sequences, is incorporated herein by reference in its entirety Such genes and proteins can be from any useful organism, including and not limited to any of the following: Sphingomonas (e.g., S. paucimobilis), Sphingobium (e.g., Sphingobium sp. SYK-6 or Cra20), Pseudomonas (e.g., P. paucimobilis or P. fluorescens), Novosphingobium (e.g., Novosphingobium sp. AAP83 or Novosphingobium sp. KN65.2), Acidiphilium (e.g., Acidiphilium sp. JA12-A), Cupriavidus spp. (e.g., C. necator), Gordonia (e.g., Gordonia aichiensis NBRC 108223), etc.), Acinetobacter (e.g., A. baumannii), Burkholderia (e.g., Burkholderia glumae PGI), Ceratocystis (e.g., C. fimbriata CBS 114723), Halomonas (e.g., H. chromatireducens or H. elongata), Pseudovibrio (e.g., Pseudovibrio sp. Ad26, Pseudovibrio sp. W74, or Pseudovibrio sp. WM33), Pseudomonas (e.g., P. putida), Sinorhizobium (e.g., S. fredii USDA 257), Bradyrhizobium (e.g., B. diazoefficiens), Corynebacterium (e.g. C. glutamicum), Rhodopseudomonas (e.g., R. palustris), etc.
(41) Exogenous Nucleic Acids and Proteins
(42) Hosts can be engineered to include an exogenous nucleic acid (e.g., any described herein), in which expression of such an exogenous nucleic acid produces exogenous proteins (e.g., any described herein). The term “heterologous” or “exogenous” as used herein with reference to nucleic acids and amino acids (e.g., enzymes), indicates nucleic acids and amino acids that are expressed in an organism other than the organism from which they originated or are found in nature, independently on the level of expression that can be lower, equal to, or higher than the level of expression of the molecule in the native microorganism. An exogenous nucleic acid may be from a different species (and so heterologous) or from the same species (and so homologous), relative to the cell being transformed. Thus, an exogenous nucleic acid (e.g., a gene) can include a homologous nucleic acid that occupies a different location in the genome of the cell or is under different control, relative to the endogenous copy of the nucleic acid. An exogenous nucleic acid may be present in more than one copy in the cell. An exogenous nucleic acid may be maintained in a cell as an insertion into the genome (nuclear or plastid) or as an episomal molecule.
(43) In some embodiments, the exogenous nucleic acid is a nucleic acid that has been generated via human intervention, including by recombinant means or direct chemical synthesis, with a series of specified nucleic acid elements that permit transcription and/or translation of a particular nucleic acid in a host cell. The exogenous nucleic acid (e.g., an expression vector or an expression cassette) may be part of a plasmid, virus, or nucleic acid fragment. One of skill in the art understands that a “recombinant nucleic acid” that encodes a particular gene, or portion thereof, is isolated from the specific context in which it naturally occurs.
(44) In particular embodiments, the exogenous nucleic acid includes one or more coding sequences (e.g., a nucleic acid to be transcribed) that is in operable linkage with a promoter (e.g., any described herein). In other embodiments, the coding sequence is in operable linkage with a control element (e.g., one or more promoters, enhancers, transcription termination sequences, and translation initiation sequences). In some embodiments, the exogenous nucleic acid includes a coding sequence and a promoter (e.g., any described herein, such as a phenolic-inducible synthetic promoter), optionally in combination with one or more control sequences. Expression cassettes for enzymes include, for example and without limitation, a translation initiation control sequence. An exogenous nucleic acid may be present or provided as a vector.
(45) Promoters can include any useful combinations of regions or elements (e.g., any described herein). Further elements include, e.g., in the case of a polymerase II type promoter, a TATA element. A promoter also optionally includes distal enhancer or repressor elements, which may be located as much as several thousand base pairs from the start site of transcription. Non-limiting promoters can include a nucleic acid sequence having at least 80% sequence identity to any one of SEQ ID NOs:1-9 or a fragment thereof.
(46) Sources
(47) Exemplary sources include any including a phenolic compound (e.g., any described herein), lignin, or a lignin derivative (e.g., formed from a combination of one or more monomers, such as a monolignol monomer, a p-coumaryl alcohol or an alkoxyl form thereof (e.g., a methoxylated form), a coniferyl alcohol or an alkoxyl form thereof (e.g., a methoxylated form), and a sinapyl alcohol or an alkoxyl form thereof (e.g., a methoxylated form). In other embodiments, lignin or a lignin derivative can be characterized by the presence of one or more aromatic functional groups, such as a p-hydroxyphenyl group, a guaiacyl group, and/or a syringyl group.
(48) Lignin can have different compositions depending on the plant material from which the lignin is derived. Exemplary lignin can include softwood lignin (e.g., derived from softwood and including of from about 25% to about 30% (w/w) of lignin), compression wood lignin (e.g., derived from compression wood and including of from about 35% to about 40% (w/w) of lignin), typical hardwood lignin (e.g., derived from hardwood and including of from about 20% to about 25% (w/w) of lignin), tropical hardwood lignin (e.g., derived from tropical hardwood and including of from about 30% to about 40% (w/w) of lignin), tension wood lignin (e.g., derived from tension wood and including of from about 20% to about 25% (w/w) of lignin), wheat lignin (e.g., derived from wheat, including any useful part of plant, such as the root, leaves, shoots, and/or stems), maize lignin (e.g., derived from maize, including any useful part of plant, such as the root, leaves, shoots, and/or stems; and including of from about 20% to 75% (w/w) of lignin), mixed grasses lignin (e.g., derived from mixed grasses, including any useful part of plant, such as the root, leaves, shoots, and/or stems).
(49) The source can include any useful material, such as, e.g., various monosaccharides (e.g., dextrose, fructose, galactose, glucose, maltose, xylose, etc.), oligosaccharides, polysaccharides (e.g., cellulose, hemicellulose, starch, etc.), cellulosic material, fatty acids (e.g., saturated or unsaturated fatty acids), biomass hydrolysates, metabolic intermediates (e.g., acetate, lactate, succinate, etc.), alcohols and sugar alcohols (e.g., ethanol, ethylene glycol, glycerol, inositol, malitol, mannitol, sorbitol, or xylitol), lignin and lignin compounds (e.g., lignocellulose and lignocellulosic material), plants and plant products (e.g., corn, liquefied corn meal, corn steep liquor (a byproduct of corn wet milling process that contains nutrients leached out of corn during soaking), corn stover, corn fiber, rice straw, woody plants, herbaceous plants, molasses, etc., which can be found in, for example, in the stems, leaves, hulls, husks, and cobs of plants; or in the leaves, branches, and wood of trees), herbaceous material, agricultural residues, forestry residues, municipal solid wastes, waste paper, as well as pulp and paper mill residues, or mixtures thereof.
EXAMPLES
Example 1: Novel Promoter Engineering Technique to Increase Protein Expression
(50) Lignin valorization is viewed as a key for the development of a cost effective lignocellulosic biorefinery. Employing promoters inducible by phenolics can provide numerous advantages, including (1) the development of substrate-inducible systems, in which selected substrates within a reaction can further enhance protein expression; (2) the lower operating costs by replacing expensive inducers (e.g., isopropyl β-D-1-thiogalactopyranoside (IPTG) currently used for induction) with in situ inducers that are present or produced during lignin breakdown; (3) the development of dynamic regulatory systems; and (4) increased flexibility in operating conditions.
(51) As described herein, hybrid synthetic promoters were constructed by replacing the spacer region of an endogenous promoter (e.g., P.sub.emrR) with an exogenous nucleic acid sequence. The strength of the promoters was interrogated using a fluorescent reporter. In the presence of an exemplary phenolic compound (e.g., vanillin), the strains with the engineered promoters showed increased expression of the fluorescence reporter, as compared to a strain with the native promoter. Flow cytometry was employed to identify heterogeneity if present in the cell population after induction with phenolic compounds. In particular experiments, we observed the emergence of a sub-population constituting healthy and dividing cells in cultures induced with an exemplary phenolic compound (vanillin) at mM concentration levels (e.g., of from about 0.1 mM to about 100 mM). In particular experiments, the size of this sub-population remained the same, regardless of the promoter employed; and further analysis uncovered that this smaller sub-population of cells were primarily responsible for the increased expression that was observed with the engineered promoters. In part, the study also revealed that to achieve higher density of heterologous protein expression, efforts may include both approaches of increasing the expression level of genes and also maintaining a healthy cell population in the presence of phenolic compounds. Additional details are provided herein.
Example 2: Hybrid Phenolic-Inducible Promoters Towards Construction of Self-Inducible Systems for Microbial Lignin Valorization
(52) Background: Engineering strategies to create promoters that are both higher strength and tunable in the presence of inexpensive compounds are of high importance to develop metabolic engineering technologies that can be commercialized. Lignocellulosic biomass stands out as the most abundant renewable feedstock for the production of biofuels and chemicals. However, lignin a major polymeric component of the biomass is made up of aromatic units and remains as an untapped resource. Novel synthetic biology tools for the expression of heterologous proteins are one critical component for the effective engineering of a microbe to valorize lignin. To our knowledge, this study demonstrates the first successful attempt in the creation of engineered promoters that can be induced by aromatics present in lignocellulosic hydrolysates to increase heterologous protein production.
(53) Results: A hybrid promoter engineering approach was used for the construction of phenolic-inducible promoters of higher strength. The exemplary hybrid promoters were constructed by replacing the spacer region of an endogenous promoter P.sub.emrR present in E. coli that was naturally inducible by phenolics. In the presence of vanillin, the engineered promoters P.sub.vtac, P.sub.vtrc, and P.sub.vtic increased protein expression by 4.6-, 3.0-, and 1.5-fold, respectively, in comparison with a native promoter, P.sub.emrR. In the presence of vanillic acid, P.sub.vtac, P.sub.vtrc, and P.sub.vtic improved protein expression by 9.5-, 6.8-, and 2.1-fold, respectively, in comparison with P.sub.emrR. Among the cells induced with vanillin, the emergence of a sub-population constituting the healthy and dividing cells using flow cytometry was observed. The analysis also revealed this smaller sub-population to be the primary contributor for the increased expression that was observed with the engineered promoters.
(54) Conclusions: This study demonstrates the first successful attempt in the creation of engineered promoters that can be induced by aromatics to increase heterologous protein production. Employing promoters inducible by phenolics can provide the following exemplary advantages: (1) develop substrate inducible systems; (2) lower operating costs by replacing expensive IPTG currently used for induction; (3) develop dynamic regulatory systems; and (4) provide flexibility in operating conditions. The flow cytometry findings strongly suggest the need for novel approaches to maintain a healthy cell population in the presence of phenolics to achieve increased heterologous protein expression and, thereby, valorize lignin efficiently. Additional details follow.
Example 3: Exemplary Experimental Methods
(55) Materials: Restriction enzymes, T4 DNA ligase, and plasmid miniprep kit were purchased from Thermo Fisher Scientific (Waltham, Mass.). Gel purification kit and Q5 polymerase were purchased from Promega (Madison, Wis.) and New England Biolabs (Ipswich, Mass.), respectively. All the reagents and cell culture media were purchased from Sigma-Aldrich (St. Louis, Mo.). Oligonucleotides were synthesized by Integrated DNA Technologies (Coralville, Iowa). The FluoSphere® beads used for calibration of the flow cytometer were purchased from Invitrogen (Carlsbad, Calif.). The E. coli strain carrying the plasmid pNW33N was purchased from the Bacillus Genetic Stock Center (Columbus, Ohio). E. coli Mach purchased from Invitrogen was used for all the cloning and fluorescence experiments.
(56) Construction of plasmids and strains: The vector pNW33N containing a gene encoding for chloramphenicol resistance served as the backbone for all the plasmids constructed in this study. mCherry was PCR amplified from the plasmid pCtl-RFP-S.sub.Arac (see, e.g., Chou H H et al., “Programming adaptive control to evolve increased metabolite production,” Nat. Commun. 2013; 4:2595 (8 pp.)). The promoters to be tested were incorporated in the forward primers (Table 1) that were employed for amplifying mCherry. Therefore, the DNA fragments obtained from this PCR amplification step had the promoters incorporated in the region upstream to the transcription initiation site of mCherry.
(57) TABLE-US-00001 TABLE 1 Exemplary oligonucleotides Primer name Sequence (5′.fwdarw.3′) SEQ ID NO: Pr_f10a gegeggatccgaatcattrnctaa 43 aacaatacatttactttatttgtc actgtegttactatateggctgaa attaatgaggtcatacccaaataa ggaggatattatggtttccaaggg egaggag Pr_fl1a gcgcggatccgaatcatifitcta 44 aaacaatacatttgacaattaatc atcggctcgtataatgatcggctg aaattaatgaggtcatacccaaat aaggaggggaattcatggtttcca agggcgaggag Pr_fl2a gcgcggatccgaatcatifitcta 45 aaacaatacatttgacaattaatc atccggctcgtataatgatcggct gaaattaatgaggtcatacccaaa taaggaggggaattcatggtttcc aagggcgaggag Pr_fl3a gcgcggatccgaatcatttttcta 46 aaacaatacatttgacaattaatc atcgcggctcgtataatgatcggc tgaaattaatgaggtcatacccaa ataaggaggggaattcatggtttc caagggcgaggag Pr_f110b cggctgaaattaatgaggtcatac 47 ccaa Pr_r1c gcgcaagcttgcggccgcagagtt 48 tgtagaaacgcaaaaaggcc Pr_r1d aagettgeggccgcagagttt 49 Pr_f9 gtcgatcggttcatcattcaccaaa 50 Pr_r2 tgtgagttagctcactcattaggca 51
(58) The PCR obtained fragments were digested using the restriction enzymes BamHI and HindIII. The digested fragments were purified and ligated into the same restriction sites of pNW33N using T4 DNA ligase. The ligation products were transformed into E. coli Mach1 cells using electroporation.
(59) The plasmids and strains constructed in this study to interrogate the strength of the promoters are listed in Table 2. Sequencing of the plasmid constructs was performed by Quintara Biosciences. A vector map of the plasmid constructed for interrogating the strength of the different engineered promoters is shown in
(60) TABLE-US-00002 TABLE 2 Plasmids and strains Plasmids/strains Description Source or reference Plasmids pNW33N Backbone plasmid for all vectors constructed in Bacillus Genetic Stock this study Center (BGSC) pRIF01 Derived from pNW33N with mCherry and the Described herein promoter, P.sub.emrR pRIF02 Derived from pNW33N with mCherry and the Described herein promoter, P.sub.vtac pRIF03 Derived from pNW33N with mCherry and the Described herein promoter, P.sub.vtrc pRIF04 Derived from pNW33N with mCherry and the Described herein promoter, P.sub.vtic Strains E. coli Mach1 Host strain Invitrogen RIF00 E. coli with pNW33N BGSC RIF01 E. coli P.sub.emrR::mCherry::Cm.sup.r Described herein RIF02 E. coli P.sub.vtac::mCherry::Cm.sup.r Described herein RIF03 E. coli P.sub.vtrc::mCherry::Cm.sup.r Described herein RIF04 E. coli P.sub.vtic::mCherry::Cm.sup.r Described herein
(61) Sequences of the promoters are listed in Table 3.
(62) TABLE-US-00003 TABLE 3 Exemplary nucleotide sequence of promoters Promoter name Sequence (5′.fwdarw.3′) SEQ ID NO: PemrR gaatcatttttctaaaacaataca 52 tttactttatttgtcactgtcgtt actatatcggctgaaattaatgag gtcatacccaaat Pvtac gaatcatttttctaaaacaataca 53 tttgacaattaatcatcggctcgt ataatgatcggctgaaattaatga ggtcatacccaaat Pvtrc gaatcatttttctaaaacaataca 54 tttgacaattaatcatccggctcg tataatgatcggctgaaattaatg aggtcatacccaaat Pvtic gaatcatttttctaaaacaataca 55 tttgacaattaatcatcgcggctc gtataatgatcggctgaaattaat gaggtcatacccaaat
(63) Cell growth and bulk fluorescence measurements: For the fluorescence experiments, frozen stocks of the strains were used to inoculate 5 ml of LB medium containing 25 mg l.sup.−1 chloramphenicol and incubated at 37° C. with an orbital shaking of 250 r.p.m. Overnight cultures were used to inoculate (0.1% volume/volume) an M9 salt medium containing 25 mg l.sup.−1 chloramphenicol, 20 g l.sup.−1 glucose, and 5 g l.sup.−1 yeast extract. The M9 salt medium (Sigma-Aldrich) contains 6.78 g l.sup.−1 Na.sub.2HPO.sub.4, 3 g l.sup.−1 KH.sub.2PO.sub.4, 0.5 g l.sup.−1 NaCl, 1 g l.sup.−1 NH.sub.4Cl, 0.1 mM CaCl.sub.2), and 2 mM MgSO.sub.4. 200 μl cultures of each strain (in triplicates) were loaded into black 96-well plates (black polystyrene plates with flat pclear bottom from Greiner Bio-One) and covered with Breathe-Easier sealing membrane (Sigma).
(64) The cultures were grown until mid-log phase at 37° C. and 250 rpm. The mid-log phase cells were induced with phenolics such as vanillin, coumaric acid, and vanillic acid at varying concentrations. The induced cells were incubated in a plate reader (Tecan Infinite 200 Pro) at 30° C. and a 3 mm shaking amplitude. The optical density of the cultures and the mCherry fluorescence was monitored at required intervals in the plate reader. Cell density was measured by monitoring the absorption of the cultures at 600 nm (OD600). Fluorescence was recorded using an excitation wavelength of 575±9 nm and an emission wavelength of 610±20 nm with a manual gain of 100 and a Z-position of 20,000 μm. Fluorescence readings are reported as normalized fluorescence given by the ratio of fluorescence of the cells to the OD600. The fold changes were reported as the ratio of fluorescence level of the strain with engineered promoter to the strain with the basal promoter.
(65) Flow cytometric analysis: Flow cytometric measurements were performed to study the heterogeneity amongst the E. coli cell population. The cells were transferred to a BD Accuri® C6 Flow Cytometer® (Accuri Cytometers, Ann Arbor, Mich.) 24 h after induction with either vanillin or coumaric acid. The fluorescence emission from the cells was detected from all detector positions, and to study the expression of mCherry (Em.sub.max=610 nm), the signal from standard FL3 long-pass filter was utilized (see, e.g., Dinkelmann M et al., “Expanding fluorescence detection options with the Accuri® C6 Flow Cytometer® System,” Nat. Methods 2010; 7(9):768 (2 pp.)).
(66) In addition, data were collected for the cells from forward scatter (FSC) and side scatter (SSC) channels. For all measurements, a flow rate of 14 μl min.sup.−1 was employed, corresponding to a core size of 10 μm. Calibrations were performed for scatter and fluorescence intensity using a set of fluorescently doped polystyrene beads with varying diameter (2.0, 7.52, 9.7, and 15.41 μm diameter) suspended in filter sterilized (0.22 μm, Millipore) de-ionized water (see, e.g., Davis R W et al., “Multiplex fluorometric assessment of nutrient limitation as a strategy for enhanced lipid enrichment and harvesting of Neochloris oleoabundans,” Biotechnol. Bioeng. 2012; 109(10):2503-12; and Shapiro H M (ed.), Practical flow cytometry (4th ed.), John Wiley & Sons, Inc. (Hoboken, N.J.), July 2003 (736 pp.)). The primary threshold for an event was adjusted to a signal intensity value of 10,000 on FSC-H. Measurements were collected in triplicates from approximately 70×10.sup.3 cells per well to ensure statistical significance. The data generated by the flow cytometer were plotted and analyzed with FlowJo V7.
Example 4: Diversification of Synthetic Biology Tools with Phenolics-Inducible Synthetic Promoters
(67) Lignin, an alkyl-aromatic polymer comprising 15-40% weight of the plant biomass, is generated in large quantities as a byproduct from the pulp and paper industry and also from the second-generation biofuel industry (see, e.g., Bruijnincx P C A et al., “Biomass conversion: lignin up for break-down,” Nat. Chem. 2014; 6(12):1035-6; and Cotana F et al., “Lignin as co-product of second generation bioethanol production from ligno-cellulosic biomass.” Energy Procedia 2014; 45:52-60). Its rich aromatic carbon content makes it an attractive renewable resource for the production of valuable materials, chemicals, and alternatives to fossil fuels (see, e.g., Xia Q et al. “Direct hydrodeoxygenation of raw woody biomass into liquid alkanes,” Nat. Commun. 2016; 7:11162 (10 pp.); Salvachúa D et al., “Towards lignin consolidated bioprocessing: simultaneous lignin depolymerization and product generation by bacteria,” Green Chem. 2015; 17(11):4951-67; and Varanasi P et al., “Survey of renewable chemicals produced from lignocellulosic biomass during ionic liquid pretreatment,” Biotechnol. Biofuels 2013; 6:14 (9 pp.)).
(68) However, lignin has thus far been underutilized; the most common current application is combustion of the solid-phase residue for its thermal energy content (see, e.g., White R H, “Effect of lignin content and extractives on the higher heating value of wood,” Wood Fiber Sci. 1987; 19(4):446-52). Lignin valorization based on lignin-degrading microbes and enzymes can contribute to more efficient and environmentally benign use of lignin for sustainable production of value-added chemicals (see, e.g., Salvachna D et al., Green Chem. 2015; 17(11):4951-67).
(69) Lignin is highly recalcitrant to microbial attack due to the presence of phenylpropanoid aryl-C.sub.3 units cross-linked via C—C and C—O bonds-its chemical heterogeneity further complicates the problem (see, e.g., Bugg T D H et al., “Pathways for degradation of lignin in bacteria and fungi,” Nat. Prod. Rep. 2011; 28(12):1883-96). Metabolic pathway engineering is emerging as a successful route to valorize lignin for the production of valuable renewable chemicals such as vanillin and cis, cis-muconic acid, which can serve the food, flavor, plastic, and adhesive industries (see, e.g., Sainsbury P D et al., “Breaking down lignin to high-value chemicals: the conversion of lignocellulose to vanillin in a gene deletion mutant of Rhodococcus jostii RHA1,” ACS Chem. Biol. 2013; 8(10):2151-6; Vardon D R et al., “Adipic acid production from lignin,” Energy Environ. Sci. 2015; 8(2):617-28; and Wu W et al., “Lignin valorization: two hybrid biochemical routes for the conversion of polymeric lignin into value-added chemicals,” Sci. Rep. 2017; 7:8420 (13 pp.)). Synthetic biology tools such as promoters, ribosome-binding sites, terminators, and ribozymes for the regulation of biological modules are some essential components for the development of an efficient metabolic engineering chassis for these applications (see, e.g., Yadav V G et al., “The future of metabolic engineering and synthetic biology: towards a systematic practice,” Metab. Eng. 2012; 14(3):233-41; and Blazeck J et al., “Promoter engineering: recent advances in controlling transcription at the most fundamental level,” Biotechnol. J. 2013; 8(1):46-58).
(70) One of the most promising route to increase flux for product synthesis is to regulate or increase protein expression at the transcriptional level (see, e.g., Blazeck J et al., Biotechnol. J. 2013; 8(1):46-58; Lee J W et al., “Systems metabolic engineering of microorganisms for natural and non-natural chemicals,” Nat. Chem. Biol. 2012; 8(6):536-46; and Ajikumar P K et al., “Isoprenoid pathway optimization for taxol precursor overproduction in Escherichia coli,” Science 2010; 330(6000):70-4). Promoter engineering enables discovery of additional synthetic promoter elements that lie beyond the endogenous promoters and allows tunable control of gene expression. Therefore, constructing novel synthetic promoters through promoter engineering is critical to aid lignin valorization efforts.
(71) Promoters inducible by phenolics can provide the following advantages in a lignin valorization chassis (see, e.g.,
(72) In a prokaryotic promoter, the conserved hexameric −35 element (e.g., TTGACA) and the −10 element (e.g., TATAAT), also known as the Pribnow box, are the primary binding sites for the RNA polymerase (see, e.g., Pribnow D, “Bacteriophage T7 early promoters: nucleotide sequences of two RNA polymerase binding sites,” J. Mol. Biol. 1975; 99(3):419-43; and Pribnow D, “Nucleotide sequence of an RNA polymerase binding site at an early T7 promoter,” Proc. Nat'l Acad. Sci. USA 1975; 72(3):784-8). Improvement in promoter strength can be achieved by random mutagenesis of the entire promoter region (see, e.g., Alper H et al., “Tuning genetic control through promoter engineering,” Proc. Nat'l Acad. Sci. USA 2005; 102(36):12678-83 (correction in Proc. Nat'l Acad. Sci. USA 2006; 103(8):3006-7); and Nevoigt E et al., “Engineering promoter regulation,” Biotechnol. Bioeng. 2007; 96(3):550-8), saturation mutagenesis of nucleotide spacer regions (see, e.g., Jensen P R et al., “The sequence of spacers between the consensus sequences modulates the strength of prokaryotic promoters,” Appl. Environ. Microbiol. 1998; 64(1):82-7; De Mey M et al., “Construction and model-based analysis of a promoter library for E. coli: an indispensable tool for metabolic engineering,” BMC Biotechnol. 2007; 7:34 (14 pp.); and Tornoe J et al., “Generation of a synthetic mammalian promoter library by modification of sequences spacing transcription factor binding sites,” Gene 2002; 297(1-2):21-32), or through a hybrid promoter engineering approach (see, e.g., De Boer H A et al., “The tac promoter: a functional hybrid derived from the trp and lac promoters,” Proc. Nat'l Acad. Sci. USA 1983; 80(1):21-5; Blazeck J et al., “Tuning gene expression in Yarrowia lipolytica by a hybrid promoter approach,” Appl. Environ. Microbiol. 2011; 77(22):7905-14; and Blazeck J et al., “Controlling promoter strength and regulation in Saccharomyces cerevisiae using synthetic hybrid promoters,” Biotechnol. Bioeng. 2012; 109(11):2884-95).
(73) Hybrid promoter engineering has resulted in the creation of powerful promoters that are being used by researchers around the world. P.sub.tac, which was developed in 1983, was the first of the widely used hybrid promoters (see, e.g., De Boer H A et al., Proc. Nat'l Acad. Sci. USA 1983; 80(1):21-5). In fact, P.sub.tac along with its derivatives P.sub.trc and P.sub.tic are still commonly used today after more than thirty years of its discovery (see, e.g., Brosius J et al., “Spacing of the −10 and −35 regions in the tac promoter: effect on its in vivo activity,” J. Biol. Chem. 1985; 260(6):3539-41). The use of these promoters for the expression of heterologous proteins is routine for Escherichia coli, Bacillus subtilis, and Synechocystis 6803, among others (see, e.g., Lee B R et al., “Utilization of Escherichia coli tac promoter in Bacillus subtilis,” Biotechnol. Lett. 1990; 12(12):925-30; Varman A M et al., “Metabolic engineering of Synechocystis sp. strain PCC 6803 for isobutanol production,” Appl. Environ. Microbiol. 2012; 79(3):908-14; and Oxer M D et al., “High level heterologous expression in E. coli using the anaerobically-activated nirB promoter,” Nucleic Acids Res. 1991; 19(11):2889-92).
(74) Hybrid promoters based on the assembly of enhancer element and core promoter fusions have been successfully employed to improve the transcription efficiency or enable novel promoter regulation in eukaryotic systems as well (see, e.g., Blazeck J et al., Biotechnol. Bioeng. 2012; 109(11):2884-95; Madzak C et al., “Heterologous protein expression and secretion in the non-conventional yeast Yarrowia lipolytica: a review,” J. Biotechnol. 2004; 109(1-2):63-81; and Juven-Gershon T et al., “Rational design of a super core promoter that enhances gene expression,” Nat. Methods 2006; 3(11):917-22). This further demonstrates hybrid promoter engineering to be a promising and an efficient promoter engineering strategy for applications beyond prokaryotes.
(75) In this study, we have utilized a hybrid promoter engineering approach to create novel promoters that have improved gene expression in the presence of phenolics. The various aromatic compounds present in the lignin-rich liquor generated after the pretreatment of lignocellulosic biomass are listed in Table 4. Vanillin is one of the primary phenolic compounds explored as an inducer in this study, since it appears in majority of the streams generated from the lignin depolymerization (Table 4, see also, e.g., Harris E E et al., “Reaction of hardwood lignin with hydrogen,” J. Am. Chem. Soc. 1938; 60(6):1467-70; Oasmaa A et al., “Catalytic hydrotreating of lignin with water-soluble molybdenum catalyst,” Energy Fuels 1993; 7(3):426-9; Voitl T et al., “Oxidation of lignin using aqueous polyoxometalates in the presence of alcohols,” ChemSusChem 2008; 1(8-9):763-9; Xiang Q et al., “Production of oxychemicals from precipitated hardwood lignin,” Appl. Biochem. Biotechnol. 2001; 91(1):71-80; Villar J C et al., “Oxidation of hardwood kraft-lignin to phenolic derivatives with oxygen as oxidant,” Wood Sci. Technol. 2001; 35(3):245-55; Varanasi P et al., “Survey of renewable chemicals produced from lignocellulosic biomass during ionic liquid pretreatment,” Biotechnol. Biofuels 2013; 6:14 (9 pp.); Duan J et al., “Biodegradation of kraft lignin by a newly isolated anaerobic bacterial strain, Acetoanaerobium sp. WJDL-Y2,” Lett. Appl. Microbiol. 2016; 62(1):55-62; Raj A et al., “Identification of low molecular weight aromatic compounds by gas chromatography-mass spectrometry (GC-MS) from kraft lignin degradation by three Bacillus sp.,” Int. Biodeterior. Biodegradation 2007; 59(4):292-6; Sainsbury P D et al., “Breaking down lignin to high-value chemicals: the conversion of lignocellulose to vanillin in a gene deletion mutant of Rhodococcus jostii RHA1,” ACS Chem. Biol. 2013; 8(10):2151-6; Chen Y et al., “Kraft lignin biodegradation by Novosphingobium sp. B-7 and analysis of the degradation process,” Bioresour. Technol. 2012; 123:682-5; and Reiter J et al., “Enzymatic cleavage of lignin β-O-4 aryl ether bonds via net internal hydrogen transfer,” Green Chem. 2013; 15(5):1373-81).
(76) TABLE-US-00004 TABLE 4 Aromatic compounds generated from the depolymerization of lignin Depolymerization Method agent Lignin source Major products Catalytic Cu-CrO Hardwood lignin Methanol, 4-n- propylcyclohexanol, 4-n- propylcyclohexanediol, and glycol Mo Kraft pine lignin Phenol, cyclohexane, benzene, naphthalene, and phenanthrene H.sub.3PMo.sub.12O.sub.40 Kraft lignin Vanillin and methyl vanillate CuSO.sub.4/FeCl.sub.3 Yellow poplar Vanillin, syringaldehyde, wood chips acetovanillone, and acetosyringone CuO Hardwood kraft Syringaldehyde, vanillin, lignin syringic acid, and vanillic acid Ionic [C2mim][OAc] at Kraft lignin, eucalyptus, Guaiacol, vanillin, syringol, liquid 160° C. switchgrass, pine eugenol, and catechol Microbial Aneurinibacillus Kraft lignin Guaiacol, acetoguiacone, aneurinilyticus gallic acid, and ferulic acid Bacillus sp. Kraft lignin Ferulic acid, 3,4,5 trimethoxy benzaldehyde, and t-cinnamic acid Rhodococcus jostii Wheat straw Vanillin, 4-hydroxybenzaldehyde, RHA1 mutant lignocellulose and ferulic acid Novosphingobium sp. Kraft lignin Ethanediol, p-hydroxybenzoic B-7 acid, and vanillic acid Enzymatic A β-O-4 linkage Softwood alkali- Guaiacol, ferulic acid, cleaving enzyme lignin and eugenol, vanillin, and system (LigDFG) hardwood alkali- acetovanillone lignin
(77) Hybrid promoter engineering in general involves the fusion of two promoters comprising different characteristics, resulting in either a promoter of higher strength or an optimal promoter tailored to perform a specific function. The first step in this work was to identify an appropriate endogenous promoter that exhibits gene regulation in the presence of phenolics. The basal promoter from which the hybrid promoters for this study were developed was identified from an earlier research conducted by Strachan et al. (see, e.g., Strachan C R et al., “Metagenomic scaffolds enable combinatorial lignin transformation,” Proc. Nat'l Acad. Sci. USA 2014; 111(28):10143-8). Strachan and others interrogated the intergenic regions in E. coli leading to the discovery of the promoter P.sub.emrR, which was found to be active in the presence of a few lignin derived monoaromatic compounds. In this study, towards diversifying the synthetic biology tools, three engineered promoters were constructed by swapping the spacer region of P.sub.emrR to increase heterologous protein production in the presence of phenolics. Additional details follow.
Example 5: Construction of Hybrid Promoters Inducible by Phenolics
(78) A biosensor was constructed to interrogate the activity of the promoter P.sub.emrR by introducing a gene coding mCherry downstream of it and expressed in the E. coli strain Mach1. In addition, to verify that the promoter was active under the experimental conditions for this study, the strain RIF01 (Table 2) expressing mCherry under the control of P.sub.emrR was tested in the presence of vanillin. Vanillin was chosen as the first phenolic compound to be explored; since it appears as a common substrate in most of the lignin, depolymerization methods employed (Table 4).
(79)
(80) The strength of a promoter is primarily dependent on the similarity of the hexameric elements (−35 element and the −10 element) to the consensus sequence along with the length and sequence of the spacer region in between (see, e.g., Haugen S P et al., “Advances in bacterial promoter recognition and its control by factors that do not bind DNA,” Nat. Rev. Microbiol. 2008; 6(7):507-19; and Ross W et al., “Escherichia coli promoters with UP elements of different strengths: modular structure of bacterial promoters,” J. Bacteriol. 1998; 180(20):5375-83). The sequences upstream and downstream of the spacer region have been known to contain activator and repressor-binding sites to either enhance or repress transcription of a gene in some bacterial promoters (see, e.g., Nelson D L & Cox M M, Lehninger principles of biochemistry (6th ed.), W. H. Freeman and Company (New York, N.Y.), 2013 (1328 pp.)).
(81) One of the previous successful efforts for engineering E. coli promoters involved fusing the enhancer element from different promoters to the core promoter of Pia resulting in transcription increase by 1.5-90-fold (see, e.g., Ross W et al., J. Bacteriol. 1998; 180(20):5375-83). However, given the lack of knowledge on the architecture of the endogenous promoter, P.sub.emrR, it is prudent not to disturb these sites on the first trial as they may interact with the phenolics or a phenolic bound complex to modify transcription. The spacer provides flexibility for the binding of the sigma factor and mutagenesis of the spacer region has been successful in increasing transcription in several cases (see, e.g., Jensen P R et al., Appl. Environ. Microbiol. 1998; 64(1):82-7). Therefore, in this study as a new strategy to both diversify and increase the promoter strength, engineered promoters were created by importing the spacer regions from strong E. coli promoters and by fusing them with P.sub.emrR (
Example 6: Vanillin as an Inducer
(82) Engineered promoters P.sub.vtac, P.sub.vtrc, and P.sub.vtic were constructed utilizing the strategy discussed in the previous section. To evaluate the performance of the engineered promoters, strains RIF02, RIF03, and RIF04 were constructed that had mCherry expressing downstream of the promoters P.sub.vtac, P.sub.vtrc, and P.sub.vtic, respectively. The fluorescence measured from the promoters demonstrated that RIF02 carrying the engineered promoter P.sub.vtac had the highest fluorescence 12 h after induction followed by the other strains with engineered promoters P.sub.vtrc and P.sub.vtic (
(83) Fluorescence from the negative control strain, RIF00, containing an empty vector was 39-fold less in comparison with RIF01. This confirms that the background fluorescence from the culture due to the medium, vanillin, and E. coli is negligible. However, the experiment also revealed that the engineered promoters were highly leaky in comparison with P.sub.emrR. Even in the absence of vanillin, the normalized fluorescence of the strains RIF02, RIF03, and RIF04 was higher than RIF01. Therefore, further engineering studies may be conducted on the flanking regions of the −10 and −35 motifs that may contain the activation and repression sites required to reduce the leaky expression of genes in the presence of engineered promoters.
Example 7: Promoter Activity with Other Phenolics
(84) The study was further extended to other phenolics, including vanillic acid, coumaric acid, guaiacol, and syringate, by testing the strains RIF01, RIF02, RIF03, and RIF04 for their fluorescence emission. These phenolics were chosen, since they are closer in structure to vanillin, and at the same time, some of these compounds are also commonly present in the lignin depolymerized products, as listed in Table 4. However, not all of these phenolics were discovered to have gene regulation potential for the promoters that were tested.
(85) Vanillic acid and coumaric acid had some level of induction; nevertheless, it took a long duration (24 h) for the induction effect to emerge. The longer duration required for the induction could possibly be due to the transport limitation of the phenolics across the cell wall in comparison with vanillin. In comparison with P.sub.emrR, the engineered promoters P.sub.vtac, P.sub.vtrc, and P.sub.vtic resulted in the improvement of expression levels by 9.5-, 6.8-, and 2.1-fold, respectively, with the addition of 5 mM vanillic acid (
(86) In the presence of 1 mM coumaric acid (
Example 8: Flow Cytometric Analysis of the Cell Population
(87) The fluorescence results discussed thus far were obtained from a microplate reader and these values are not representative of the entire cell population, but an average behavior of all the cells. However, heterogeneity in gene expression can be present in the cell population due to several reasons. For example, a difference in gene expression may result among the cells due to either cell differentiation or morphogenesis (see, e.g., Tracy B P et al., “Flow cytometry for bacteria: enabling metabolic engineering, synthetic biology and the elucidation of complex phenotypes,” Curr. Opin. Biotechnol. 2010; 21(1):85-99).
(88) Identifying population heterogeneity can help identify variables that negatively impact the gene expression and thereby aid in the development of robust expression systems. Flow cytometry is a technique that allows for the measurement of multiple physical and biological properties of single cells. Therefore, to analyze the heterogeneity within the cell population resulting from the induction of the promoters by phenolics, flow cytometry was employed in this study.
(89) Vanillin and coumaric acid-induced cultures were analyzed 24 h after induction for their fluorescence and light-scattering intensities with a flow cytometer. While intensity of fluorescence can be used as inference for protein levels, forward scattering can be used as a measure for the size of the bacterial cell. The correlation between forward scattering and fluorescence intensities among the different strains of E. coli with variation in inducer concentration are shown for vanillin as the inducer (
(90) In agreement with our previous findings, the strains with the engineered promoters have a cell population that fluoresces much higher than the control strain, RIF01. In addition, a distinct sub-population of cells with higher forward scattering and higher fluorescence appeared for cultures that were induced with high concentrations of vanillin (greater than 1 mM vanillin). Light-scattering intensity has been considered to be roughly proportional to relative cell size and it has been observed that stationary phase cultures have a decreased cell size in comparison with exponential phase cultures (see, e.g., Akerlund T et al., “Analysis of cell-size and DNA content in exponentially growing and stationary-phase batch cultures of Escherichia coli,” J. Bacteriol. 1995; 177(23):6791-7). A sub-population with lower forward scattering contained only background fluorescence, likely corresponding to the stationary phase cells with lower relative cell size. Interestingly, majority of the increase in fluorescence resulting from the engineered promoters was observed to come from the sub-population that had higher forward scattering.
(91) Furthermore, the heterogeneity within the cell population was not observed for E. coli cells that were induced with IPTG (see, e.g., Balzer S et al., “A comparative analysis of the properties of regulated promoter systems commonly used for recombinant gene expression in Escherichia coli,” Microb. Cell Fact. 2013; 12:26 (14 pp.)). With coumaric acid, although highly fluorescent cells had higher forward scattering, distinct sub-population did not appear as was the case with vanillin. To methodically identify the impact of promoter engineering on the heterogeneity of the cell population, the results were tabulated for cells with high forward scattering and high fluorescence for induction with vanillin (Table 5) or coumaric acid (Table 6).
(92) TABLE-US-00005 TABLE 5 Vanillin-induced sub-population of cells with high fluorescence and forward scattering Concentration, Cell population % Cell population % Strain mM (FL3-A >10.sup.3) (FSC-A >10.sup.4) RIF01 0 2.91 ± 0.51 54.38 ± 4.47 0.1 2.87 ± 0.44 54.46 ± 1.65 1.0 2.09 ± 0.28 40.10 ± 2.17 3.0 2.22 ± 0.22 28.57 ± 0.48 5.0 5.18 ± 0.73 24.26 ± 2.98 RIF02 0 8.62 ± 0.05 59.51 ± 1.67 0.1 6.37 ± 0.31 54.19 ± 2.99 1.0 7.08 ± 0.28 44.72 ± 1.97 3.0 8.68 ± 0.67 30.35 ± 0.56 5.0 13.52 ± 1.02 26.17 ± 2.44 RIF03 0 7.81 ± 0.46 61.97 ± 0.41 0.1 6.21 ± 0.93 55.98 ± 1.29 1.0 6.48 ± 0.74 39.91 ± 1.73 3.0 8.58 ± 0.77 27.39 ± 0.47 5.0 16.89 ± 0.60 21.34 ± 0.50 RIF04 0 7.61 ± 0.48 69.11 ± 0.39 0.1 7.21 ± 0.52 66.87 ± 0.72 1.0 7.48 ± 0.59 57.25 ± 2.04 3.0 15.67 ± 1.06 39.13 ± 2.03 5.0 18.22 ± 1.11 25.24 ± 1.21
(93) TABLE-US-00006 TABLE 6 Coumaric acid induced sub-population of cells with high fluorescence and forward scattering Concentration, Cell population % Cell population % Strain mM (FL3-A >10.sup.3) (FSC-A >10.sup.4) RIF01 0 3.34 ± 0.15 53.49 ± 0.87 0.1 3.07 ± 0.01 44.25 ± 0.71 1.0 3.87 ± 0.26 36.46 ± 0.51 5.0 4.01 ± 0.44 35.23 ± 3.34 RIF02 0 20.88 ± 1.12 55.27 ± 1.47 0.1 24.90 ± 0.58 46.40 ± 1.81 1.0 24.37 ± 0.99 37.67 ± 0.55 5.0 21.43 ± 1.05 34.60 ± 1.45 RIF03 0 16.67 ± 1.88 57.80 ± 2.17 0.1 20.49 ± 0.2 48.20 ± 1.31 1.0 22.95 ± 0.71 39.70 ± 0.89 5.0 21.62 ± 1.28 37.90 ± 1.40 RIF04 0 12.93 ± 0.92 65.47 ± 0.38 0.1 12.58 ± 0.86 61.27 ± 0.15 1.0 14.45 ± 0.97 55.90 ± 0.87 5.0 15.85 ± 2.35 47.37 ± 2.99
(94) It can be verified from the tables that in the presence of 5 mM vanillin, the highly fluorescent cell population increased from 500 in RIF01 to between 13 and 1700 for the strains with engineered promoters (i.e., the strains RIF02, RIF03, and RIF04). However, the population of the cells with high forward scattering intensity remained about the same for all the promoters (i.e., between 24 and 27% of the total). These data suggest that there is no negative impact on the healthy and dividing cell population due to overexpression with the engineered promoters.
(95) In addition, the high forward scattering intensity population decreased from between 50 and 70% in the absence of vanillin to between 24 and 27% with 5 mM vanillin. These data along with the presence of sub-population in
Example 9: Promoter Strength with Variations in Temperature
(96) Temperature is one fundamental parameter in controlling the productivity of microbial fermentations, since each microbial species have their optimal growth temperature and the optimal temperature for the heterologous enzyme being expressed may vary. In addition, for certain heterologous expressions, low-temperature fermentations may be preferred to ensure proper folding and thereby the function of the heterologous proteins (see, e.g., Baneyx F et al., “Recombinant protein folding and misfolding in Escherichia coli,” Nat. Biotechnol. 2004; 22(11):1399-408; and Khow O et al., “Strategies for production of active eukaryotic proteins in bacterial expression system,” Asian Pac. J. Trop. Biomed. 2012; 2(2):159-62). Therefore, to study the impact of operating temperatures on promoter strength, protein expression at two different operating temperatures, 25° C. and 37° C., was examined. The cells were incubated at either of these temperatures after induction with vanillin instead of 30° C. that was regularly employed.
(97) From
(98) These experiments reveal that a change in temperature does not necessarily impact the intensity of the expression strength for these promoters. Therefore, the microbial systems developed for lignin valorization with such engineered promoters can be operated at temperatures that are optimal for the microbe and the heterologous protein under study. We also envision that this work will serve as a springboard for the development of more promoters that will be inducible by a variety of other phenolics generated from lignin depolymerization and their subsequent deployment towards the development of an efficient lignin valorization chassis.
Example 10: Further Directions
(99) As described herein, to demonstrate the strategy of swapping spacer region to modulate promoter strength while retaining inducibility, we have constructed three different phenolic-inducible promoters from a basal promoter. To our knowledge, this is the first research work that focuses exclusively on the development of promoters inducible by lignin-derived phenolics. By employing a hybrid promoter-engineering approach, three different engineered promoters were constructed by incorporating the spacer region of higher strength endogenous promoters in E. coli. In the subsequent experiments, we demonstrated that this engineering strategy resulted in significant improvements in the strength of the hybrid promoters. Therefore, this strategy should be generally applicable for improving the strength of engineered promoters by incorporating spacer regions from other high strength promoters.
(100) Furthermore, the strategy may also be employed to improve or diversify the strength of promoters that are inducible by other chemicals and factors. However, the engineered promoters were observed to be highly leaky, and therefore, reducing the leakiness of the promoters may require further engineering of the regions upstream and downstream of the −10 and −35 elements. The promoters were also observed to have a very long response time in the presence of vanillic acid and coumaric acid. We hypothesize that this could possibly be due to limitation in the transport of phenolics across the cell membrane. Therefore, studies on transporters and engineering host cells with transporters are critical for the development of an efficient microbial lignin valorization system.
(101) Flow cytometry was employed to identify any heterogeneity in the cell population after induction with phenolics. The emergence of a sub-population constituting the metabolically active and dividing cells was observed especially in the cultures that were induced with 5 mM vanillin. In addition, this sub-population was identified as the major contributor for the heterologous protein that was expressed by the addition of phenolics as inducers. Therefore, further research effort will be required to increase the fitness of the strains in the presence of the phenolics which are known growth inhibitors at moderate-to-high concentrations. This aim can be achieved, e.g., by applying the following techniques: (1) utilizing a rich media; (2) evolving the strains to improve their growth in the presence of the phenolics; and (3) engineering the strains with stress tolerance genes. This study should stimulate expansion of promoter engineering efforts to utilize cheap chemicals present in lignocellulosic biomass hydrolysates as inducers, potentially eliminating the need for common supplemental inducers (e.g., such as IPTG, arabinose, etc.).
OTHER EMBODIMENTS
(102) All publications, patents, and patent applications mentioned in this specification are incorporated herein by reference to the same extent as if each independent publication or patent application was specifically and individually indicated to be incorporated by reference.
(103) While the invention has been described in connection with specific embodiments thereof, it will be understood that it is capable of further modifications and this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure that come within known or customary practice within the art to which the invention pertains and may be applied to the essential features hereinbefore set forth, and follows in the scope of the claims.
(104) Other embodiments are within the claims.