IMMUNE COMPOSITION, PREPARATION METHOD THEREFOR, AND APPLICATION THEREOF
20210290759 · 2021-09-23
Inventors
- Ting MU (Wuhan, CN)
- Ping ZHAO (Wuhan, CN)
- Long XU (Wuhan, CN)
- Yang XIAO (Wuhan, CN)
- Jean-philippe JULIEN (Wuhan, CN)
- Yue WU (Wuhan, CN)
- Liang XIE (Wuhan, CN)
- Xueting CHEN (Wuhan, CN)
- Qi Liu (Wuhan, CN)
- Charles Dwo Yuan SIA (Wuhan, CN)
- Pele Choi Sing CHONG (Wuhan, CN)
- Michel KLEIN (Wuhan, CN)
- Linsen DU (Wuhan, CN)
- Ke Wu (Wuhan, CN)
Cpc classification
C12N2710/16734
CHEMISTRY; METALLURGY
A61K39/39
HUMAN NECESSITIES
Y02A50/30
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
C12N2710/16722
CHEMISTRY; METALLURGY
C07K2319/40
CHEMISTRY; METALLURGY
C12N15/70
CHEMISTRY; METALLURGY
C07K2319/01
CHEMISTRY; METALLURGY
C12N15/86
CHEMISTRY; METALLURGY
A61K2039/545
HUMAN NECESSITIES
C12N2710/10043
CHEMISTRY; METALLURGY
International classification
C12N15/70
CHEMISTRY; METALLURGY
Abstract
A prokaryotic expression system or a recombinant adenovirus system is used to highly efficiently express VZV envelope gE glycoprotein and the flagellin fusion protein thereof. The produced recombinant gE protein, gE flagellin fusion protein and recombinant adenovirus vector, or composition thereof is used to immunize a mouse so as to promote the body to generate gE and VZV-specific antibody titer, as well as gE-specific and VZV-specific cell immunity.
Claims
1. An immune composition comprising at least a varicella zoster virus glycoprotein E (gE)-based antigen, wherein the gE-based antigen comprises at least: (i) a gE extracellular region or a fragment thereof, or a nucleic acid molecule encoding the same; (ii) a gE-based fusion protein, or a nucleic acid molecule encoding the same; (iii) a gE-based recombinant vector; or (iv) a combination of two or more of the above, and wherein the gE-based fusion protein comprises: a gE extracellular region or a fragment thereof that is covalently coupled with a bacterial flagellin protein or a fragment thereof, wherein the bacterial flagellin protein or a fragment thereof acts as a TLR-5 agonist.
2. The immune composition according to claim 1, wherein the gE extracellular region has at least 90% homology to the amino acid sequence as set forth in SEQ ID No: 1.
3. The immune composition according to claim 1, wherein the gE-based fusion protein comprises at least: an N-terminal D0-D1 region of the flagellin protein, a C-terminal D0-D1 region of the flagellin protein, and the gE extracellular region or a fragment thereof.
4. The immune composition according to claim 3, wherein the gE extracellular region or a fragment thereof is located at the N-terminal or C-terminal of the fusion protein, or is inserted between the N-terminal and C-terminal of the flagellin protein; or the fusion protein is selected from any one of the following fusion forms: fusion form 1: N-terminal region of the flagellin protein—C-terminal region of the flagellin protein—gE extracellular region or a fragment thereof; fusion form 2: gE extracellular region or a fragment thereof—N-terminal region of the flagellin protein—C-terminal region of the flagellin protein; fusion form 3: N-terminal region of the flagellin protein—gE extracellular region or a fragment thereof—C-terminal region of the flagellin protein; wherein the N-terminal region or the C-terminal region of the flagellin protein is linked to the gE extracellular region or a fragment thereof either directly or via a linker; or the N-terminal region of the flagellin protein is linked to the C-terminal region of the flagellin protein either directly or via a linker.
5. The immune composition according to claim 4, wherein the linker has 1-20 amino acids linked via peptide bonds.
6. The immune composition according to claim 5, wherein the linker is linker I or linker II, linker I has the sequence as set forth in SEQ ID NO: 4, and linker II has the sequence as set forth in SEQ ID NO: 7.
7. The immune composition according to claim 6, wherein the N-terminal region or C-terminal region of the flagellin protein is linked to the gE extracellular region or a fragment thereof via linker II; or the N-terminal region of the flagellin protein is linked to the C-terminal region of the flagellin protein via linker I.
8. The immune composition according to claim 1, wherein the bacterial flagellin protein is from salmonella.
9. The immune composition according to claim 8, wherein the salmonella is S. typhirnuriurn or S. typhi.
10. The immune composition according to claim 9, wherein the amino acid sequence of the flagellin protein is set forth in SEQ ID No: 3 or SEQ ID No: 29; the N-terminal region of the flagellin protein has an amino acid sequence having at least 95% homology to the amino acid region from 2 to 176 in SEQ ID NO: 3, and the C-terminal region of the flagellin protein has an amino acid sequence having at least 95% homology to the amino acid region from 392 to 495 in SEQ ID NO: 3; the amino acid sequence of the N-terminal region of the flagellin protein is set forth in SEQ ID NO: 5, and the amino acid sequence of the C-terminal region of the flagellin protein is set forth in SEQ ID NO: 6; the N-terminal region of the flagellin protein has an amino acid sequence having at least 95% homology to the amino acid region from 2 to 180 in SEQ ID NO: 29, and the C-terminal region of the flagellin protein has an amino acid sequence having at least 95% homology to the amino acid region from 400 to 506 in SEQ ID NO: 29; or the amino acid sequence of the N-terminal region of the flagellin protein is set forth in SEQ ID NO: 30, and the amino acid sequence of the C-terminal region of the flagellin protein is set forth in SEQ ID NO: 31.
11. The immune composition according to claim 1, wherein the amino acid sequence of the gE-based fusion protein is set forth in any one of SEQ ID NOs: 8-10, 32-34.
12. The immune composition according to claim 1, wherein the nucleic acid molecule encoding the gE extracellular region or a fragment thereof has the sequence as set forth in any one of SEQ ID NOs: 2, 18 and 19.
13. The immune composition according to claim 1, wherein the nucleic acid molecule encoding the gE-based fusion protein has the sequence as set forth in any one of SEQ ID NOs: 11-13, 20-26.
14. The immune composition according to claim 1, wherein the gE-based recombinant vector comprises the nucleic acid molecule according to claim 1.
15. The immune composition according to claim 14, wherein the vector is an adenovirus vector, an adenovirus-associated virus vector, a poxvirus vector, a vesicular stomatitis virus vector, a bovine parainfluenza virus vector, a human parainfluenza virus vector, a newcastle disease virus vector, a Sendai virus vector, a measles virus vector, an attenuated RSV vector, a paramyxovirus vector, a type A virus vector (e.g., Venezuelan equine encephalitis virus vector, Semliki Forest virus vector, Sindbis virus vector), a rhabdovirus vector, a rabies virus vector, a picornavirus vector, a lentivirus vector, a herpesvirus vector, or a plant-derived virus for expression in a plant expression system.
16. The immune composition according to claim 15, wherein the adenovirus vector is a human adenovirus vector, a chimpanzee adenovirus vector or a gorilla adenovirus vector.
17. The immune composition according to claim 16, wherein the human adenovirus vector is an adenovirus type-5 vector (Ad5), and the chimpanzee adenovirus vector is ChAd68.
18. The immune composition according to claim 16, wherein the adenovirus vector is a replication-defective adenovirus vector.
19. The immune composition according to claim 18, wherein the E1 region of the adenovirus vector is deleted or functionally deleted to form a replication-defective vector; or both the E1 region and the E3 region are deleted or functionally deleted.
20. The immune composition according to claim 19, wherein the E4 region of the chimpanzee adenovirus vector is further replaced by the corresponding E4 region of the human adenovirus type-5 to enhance the function of the vector.
21. The immune composition according to claim 14, wherein the gE-based recombinant vector is referred to as recombinant adenovirus vector A when it carries the nucleic acid molecule encoding the gE extracellular region or a fragment thereof; and the recombinant adenovirus vector A carries the nucleic acid molecule as set forth in any one of SEQ ID NOs: 2, 18 and 19; or wherein the gE-based recombinant vector is referred to as recombinant adenovirus vector B when it carries the nucleic acid molecule encoding the gE-based fusion protein; and the recombinant adenovirus vector B carries the nucleic acid molecule as set forth in any one of SEQ ID NOs: 11-13, 20-26.
22. The immune composition according to claim 21, wherein the backbone plasmid used to construct the recombinant adenovirus vector A or B is pAd5-CMV/V5-DEST.
23. The immune composition according to claim 21, wherein the shuttle plasmid used to construct the recombinant adenovirus vector A or B is pDONR221.
24. The immune composition according to claim 21, wherein the host cell line used to construct the recombinant adenovirus vector A or B includes, but is not limited to, HEK 293 cell line or PER.C6 cell line.
25. The immune composition according to claim 21, wherein the recombinant adenovirus vector A is constructed as follows: performing homologous recombination on a correctly sequenced recombinant shuttle plasmid pDONR221-gE gene-PolyA and the virus backbone plasmid pAd5-CMV/V5-DEST, transforming the recombination mixture into E. coli TOP10 competent cells, screening a correctly sequenced adenovirus vector pAd5-CMV-gE gene-PolyA, linearizing it, then transfecting HEK 293 or PER.C6 cells with the linearized adenovirus vector pAd5-CMV-gE gene-PolyA for packaging, and thus obtaining the recombinant adenovirus vector A.
26. The immune composition according to claim 21, wherein the recombinant adenovirus vector B is constructed as follows: performing homologous recombination on a correctly sequenced recombinant shuttle plasmid pDONR221-gE-flagellin fusion protein gene-PolyA and the virus backbone plasmid pAd5-CMV/V5-DEST, transforming the recombination mixture into E. coli TOP10 competent cells, screening a correctly sequenced adenovirus vector pAd5-CMV-gE-flagellin fusion protein gene-PolyA, linearizing it, then transfecting HEK 293 or PER.C6 cells with the linearized adenovirus vector pAd5-CMV-gE-flagellin fusion protein gene-PolyA for packaging, and thus obtaining the recombinant adenovirus vector B.
27. The immune composition according to claim 1, further comprising a pharmaceutically acceptable carrier, and/or an adjuvant, and/or an immunostimulatory molecule.
28. The immune composition according to claim 27, wherein the adjuvant includes, but is not limited to: aluminum salts, oil-in-water or water-in-oil emulsions, MF-59, Quil A or QS21 components thereof, TLR agonists, chitosan, immunostimulatory complexes (ISCOMs), or combinations of two or more of the above.
29. Use of the immune composition according to claim 1 in the manufacture of a pharmaceutical composition for preventing and/or treating varicella zoster infection.
30. The use according to claim 29, wherein the immune composition is used to prepare a chickenpox vaccine or a shingles vaccine, or is used to prepare a medicament for treating shingles or postherpetic neuralgia.
31. A combination vaccine comprising at least the immune composition according to claim 1 and other vaccines, wherein the other vaccines include, but are not limited to: mumps, measles and rubella vaccines.
32. The gE-based fusion protein as described in the immune composition according to claim 1.
33. The nucleic acid molecule as described in the immune composition according to claim 1.
34. The gE-based recombinant vector as described in the immune composition according to claim 14.
35. An isolated host cell comprising the nucleic acid molecule according to claim 33.
36. A method for preparing the gE extracellular region or a fragment thereof, or the gE-based fusion protein according to claim 32; wherein the preparation is carried out via a prokaryotic expression system or a eukaryotic expression system.
37. The method according to claim 36, wherein the prokaryotic expression is E. coli expression, the E. coli is BL21(DE3), and the expression vector is pET28a; the amino acid sequence of the gE extracellular region is set forth in SEQ ID NO: 35, and the gene sequence of the gE extracellular region is set forth in SEQ ID NO: 36; the amino acid sequence of the gE-based fusion protein is set forth in SEQ ID NOs: 37-39; and the gene sequence of the gE-based fusion protein is set forth in SEQ ID NOs: 40-42.
38. (canceled)
39. A prime-boost immunization regimen, comprising: a prime immunization with the gE-based recombinant vector according to claim 34, and a boost immunization with the gE extracellular region or a fragment thereof or the gE-based fusion protein; or conversely, a prime immunization with the gE extracellular region or a fragment thereof or the gE-based fusion protein and a boost immunization with the gE-based recombinant vector, wherein when the gE extracellular region or a fragment thereof is used for immunization, the adjuvant may be added.
40. A prime-boost immunization regimen, comprising: a prime immunization with the gE-based recombinant heterologous vector according to claim 15, and a boost immunization with the gE-based recombinant adenovirus vector; or conversely, a prime immunization with the gE-based recombinant adenovirus vector, and a boost immunization with the gE-based recombinant heterologous vector; wherein, the heterologous vector refers to a non-adenovirus vector.
41. A prime-boost immunization regimen, wherein the two gE-based recombinant adenovirus vectors that are of different types or derived from different species according to claim 16 are used as a prime immunization and a boost immunization, respectively, wherein the recombinant adenovirus vector carries either a gE extracellular region gene or a gE-based fusion protein gene.
42. A recombinant adenovirus vector pAd5-CMV-gE gene-PolyA, wherein the gE gene has the nucleic acid sequence as set forth in any one of SEQ ID NOs: 2, 18 and 19.
43. A recombinant adenovirus vector pAd5-CMV-gE-flagellin fusion gene-PolyA, wherein the gE-flagellin fusion gene has a nucleic acid sequence as set forth in any one of SEQ ID NOs: 11-13, 20-26.
44. A modified flagellin protein, wherein the N-terminal region of the flagellin protein has an amino acid sequence having at least 95% homology to the amino acid region from 2 to 176 in SEQ ID NO: 3, and the C-terminal region of the flagellin protein has an amino acid sequence having at least 95% homology to the amino acid region from 392 to 495 in SEQ ID NO: 3, wherein the N-terminal region of the flagellin protein is linked to the C-terminal region of the flagellin protein either directly or via a linker.
45. The modified flagellin protein according to claim 44, wherein the linker has 1-20 amino acids linked via peptide bonds.
46. The modified flagellin protein according to claim 45, wherein the linker has an amino acid sequence as set forth in SEQ ID NO: 4.
47. The modified flagellin protein according to claim 44, wherein the amino acid sequence of the N-terminal region is set forth in SEQ ID NO: 5, and the amino acid sequence of the C-terminal region is set forth in SEQ ID NO: 6; or wherein the modified flagellin protein has an amino acid sequence as set forth in SEQ ID NO: 27.
48. Use of the modified flagellin protein according to claim 44 as an immune adjuvant.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0137]
[0138]
[0139]
[0140]
[0141]
[0142]
[0143]
[0144]
[0145]
[0146]
[0147]
[0148]
[0149]
[0150]
[0151]
[0152]
EMBODIMENTS
[0153] Materials and Methods:
[0154] Animals and Cells:
[0155] Special pathogen-free (SPF grade) female C57BL/6 mice aged 6-8 weeks were purchased from Hubei Provincial Center for Disease Control and Prevention. All animal studies were performed under GLP (Good Laboratory) laboratory conditions, and animals were treated according to “Laboratory Animal-Guideline for Ethical Review of Animal Welfare”. Human embryonic kidney cells HEK293 were purchased from Thermo Fisher Scientific, USA, and cultured in DMEM containing 10% fetal bovine serum (FBS). THP-1 cells were purchased from ATCC and cultured in RPMI-1640 medium containing 10% FBS and 1% penicillin/streptomycin double antibody (Gibco, USA).
[0156] Reagents:
[0157] All gene fragments were synthesized by Sangon Biotech (Shanghai, China), and primers were synthesized by Wuhan TsingKe Biological Technology (Wuhan, China); pDONR221, pAd5-CMV/V5-Dest vector, Gateway BP recombination, LR recombinase, E. coli TOP10 competent cells and lip2000 transfection reagents were all purchased from Thermo Fisher Scientific (USA). The pET28a expression plasmid was purchased from Novagen (USA). Plasmid extraction kit and gel extraction kit were purchased from Axygen (USA). Mouse anti-VZV-gE monoclonal antibody was purchased from Merck (USA), and rabbit anti-flagellin D0-D1 antibody was prepared by immunization of rabbits. Three synthetic polypeptides from flagellin D0 and D1 domains (see Table 1) were conjugated to a carrier protein (CCH, Thermo Fisher scientific, USA). Immune process: rabbits were immunized according to the following regimen: the first dose, 0.4 mg of the conjugate containing complete Freund's adjuvant, intramuscular injection; the second dose and the third dose, 0.2 mg of the conjugate containing incomplete Freund's adjuvant, intramuscular injection; finally, 0.1 mg of the conjugate, intravenous pulse. Rabbit anti-Ad5 monoclonal antibody was purchased from Abcam Inc. (UK). Cell culture flasks and pipettes were purchased from Corning Inc. (USA). Endotoxin-free flagellin protein was purchased from Alpha Diagnostic (USA); IL-8 and TNF-α ELISA kits and Elispot kits were purchased from Dakewe; guinea pig complement serum for neutralizing antibody detection was purchased from BD (USA). All antibodies used in the flow cytometry were purchased from Thermo Fisher. The commercially available live attenuated varicella vaccine was produced by Changchun Keygene (China) or Changchun Bcht (China).
TABLE-US-00002 TABLE 1 Polypeptide sequences of the flagellin protein D0-D1 Serial number Polypeptide sequence 1 LNKSQSALGTAIERLSSGLRINSAKDDAAC 2 NNLQRVRELAVQSANSTNC 3 LTSARSRIEDSDYATEVSNM
[0158] PCR and Agarose Electrophoresis:
[0159] 25 μL of 2×PCR premixed solution and 50-100 ng of a DNA template were added into a tube containing 1 μL of upstream and downstream primers, and then ddH.sub.2O was supplemented to 50 μL, wherein the conditions for cycling were as follows: first step, 95° C. for 2 min; second step: 95° C. for 15 s, 45-55° C. for 15 s, and 72° C. for 1 min and 30 s, 30 cycles in total; and third step: 72° C. for 5 min. After completion of PCR, the PCR product was added into a sample buffer solution, and 1% agarose gel electrophoresis was performed under the electrophoresis condition of 180 V for 20-30 min, and the PCR results were detected by ultraviolet.
[0160] SDS-PAGE and Western Blotting:
[0161] 20 μL of 5× concentrated loading buffer was added into 80 μL of sample, and the mixture was boiled for 5 min. The boiled sample was subjected to 10% SDS-PAGE (100 V, 20 min, and then 160 V, 1 h and 20 min). After the completion of electrophoresis, the proteins were wet-transferred onto PVDF membrane (Merck, USA) and blocked overnight at 4° C. with PBST solution containing 5% skimmed milk powder (PBS solution containing 0.05% Tween 20); the membrane was washed twice with PBST, a mouse anti-VZV-gE protein monoclonal antibody (1:5000 dilution, Millipore) or rabbit anti-flagellin antiserum (1:10000 dilution) or rabbit anti-Ad5 polyclonal antibody (1:10000 dilution) was added, and then the mixture was incubated at 37° C. for 1 h; the membrane was washed twice with PBST, horse radish peroxidase (HRP) labeled goat anti-mouse IgG (1:5000 dilution, Beyotime) or HRP labeled goat anti-rabbit IgG (1:5000 dilution, Beyotime) was added, and then the mixture was incubated at 37° C. for 1 h; the membrane was washed twice with PBST, and Western Blotting ECL solution was used for color development by chemiluminescence.
[0162] Adenovirus Titer-TCID.sub.50 Method:
[0163] A flask of 293 cells at 90% confluence that were grown in DMEM medium with 10% FBS was taken (T-75 flask). One day before the assay, the cells were washed with PBS, digested with 1× TypLE for 2 min, then the digestion was terminated with DMEM medium containing 2% FBS, and cells were counted after resuspension in the same medium. The cells were adjusted to a concentration of 1.0-2.0×10.sup.5 cells/mL, and seeded into a 96-well plate at 100 μL per well; then the 96-well plate was incubated in an incubator at 37° C., 5% CO.sub.2 for 16-20 h; the virus solutions to be tested and the reference substance were subjected to serial ten-fold dilution (from 10-1 to 10-10) with DMEM+2% FBS medium, respectively. The diluted virus solutions were added into 1-10 columns respectively at 100 μL per well, and 8 replicate wells were set for each dilution degree of virus. 100 μL of DMEM+2% FBS medium was added into columns 11 and 12 as a negative control. The 96-well plate was incubated in a CO.sub.2 incubator at 37° C. for 10 days and then observed under an inverted microscope to determine and record the cytopathic effect (CPE) status of cells in each column. The result was determined as positive as long as a small number of cells developed CPE. Finally, the virus titer was calculated according to the Karber method. (Karber G., Archiv f experiment Pathol u Pharmakol, 162: 480-483, 1931).
[0164] Detection of TLR-5 Activity:
[0165] THP-1 cells expressing TLR-5 receptor in logarithmic growth phase and grown in RPM-1640 medium containing 10% FBS were taken and centrifuged at 125 g for 5 min, and the supernatant was discarded. The cells were resuspended in RPMI-1640 medium containing 10% FBS, adjusted to a concentration of 1×10.sup.7 cells/mL, and then seeded into a 96-well cell culture plate at 100 μL/well. The positive control was diluted to a final concentration of 2.5 μg/mL (flagellin protein without endotoxin) with RPMI-1640 medium solution containing 10% FBS. The purified gE-flagellin fusion protein with an endotoxin content <5 EU/mL was diluted to equimolar concentration (5 μg/mL) with the same medium, and the purified gE protein served as a negative control. The diluted samples, endotoxin-free flagellin and gE were added to a 96-well plate at 100 μL per well, respectively. The 96-well plate was incubated in a CO.sub.2 incubator at 37° C. for 12-24 h. After the incubation was completed, the cells in each well were pipetted out and centrifuged at 2000 g for 10 min, and the cell supernatant was collected. The activity of TLR-5 was detected by detecting the contents of IL-8 and TNF-α cytokines in cultural supernatant, and the contents were detected according to the manual in an IL-8 and TNF-α Elisa kit.
[0166] Detection of Anti-gE Antibody Titer in Serum by Enzyme-Linked Immunosorbent Assay (ELISA):
[0167] The purified prokaryotically expressed gE protein was diluted to 1 μg/mL with sterile sodium carbonate buffer (8.4 g/L NaHCO.sub.3, 3.5 g/L Na.sub.2CO.sub.3, pH 9.6), added to a 96-well microplate at 100 per well and then coated overnight at 4° C. The next day, the microplate was taken out, the liquid in each well was discarded, and the plate was washed 3 times with PBST (PBS solution containing 0.1% Tween 20). Blocking solution (PBST solution containing 10% skimmed milk powder) was added to each well, followed by blocking at 37° C. for 1 h. After the blocking was completed, the blocking solution was discarded. The serum of the immunized mouse was subjected to serial gradient dilution with the blocking solution, and the sealing solution was set as the blank control. The diluted serum was added to the 96-well plate at 100 μL per well, three replicate wells were set for each dilution degree of serum, and then the plate was incubated at 37° C. for 1 h. After the plate was washed three times with PBST, a 1:1000 diluted peroxidase (HRP) labeled goat anti-mouse IgG antibody was added at 100 μL per well, and then the plate was incubated at 37° C. for 1 h. After the plate was washed 3 times with PBST, TMB substrate (3,3′,5,5′-tetramethylbenzidine, KPL, USA) was added. The reaction was terminated by adding 0.2 M sulfuric acid. The absorbance was measured at a wavelength of 450 nm and a reference wavelength of 620 nm using a microplate reader.
[0168] Detection of Neutralizing Antibody:
[0169] The determination procedure of antibody-mediated neutralizing titers for VZV infection was as follows: VZV was diluted to 2×10.sup.3 PFU/mL with VZV diluent (phosphate buffered saline (PBS), sucrose 5%, glutamic acid 1%, fetal bovine serum (FBS) 10%, pH 7.1). 150 μL of virus was incubated with 150 μL serially diluted heat inactivated serum and 5 μL of guinea pig complement at 37° C. for 1 h. The incubated virus-serum mixture was added to a 24-well plate (100 μL/well) full of MRC-5 monolayer cells, two duplicate wells were set for each dilution degree of serum, and then the plate was incubated at 37° C. for 2 h. After 2 h, 2 mL of virus maintenance solution (MEM containing 2% FBS) was added. After 7 days, the medium was removed, the cells were fixed and stained with Coomassie blue solution (Coomassie blue 0.5%, methanol 45%, acetic acid 10%) for 10 min, and then the plate was washed with distilled water and the spots were counted. Two duplicate wells were tested for each dilution degree of serum. The reciprocal of the dilution degree of serum that reduced the number of plaques by 50% was taken as the neutralizing antibody titer.
[0170] Isolation of Mouse Splenocytes:
[0171] The mouse spleen was aseptically taken out and transferred to a cell strainer placed in a single well of a 6-well plate, and then 3 mL of medium (RPMI-1640 containing 5% FBS) was added. The splenocytes were released by grinding the spleen, and then filtered through a 200 mesh cell strainer. The cells were collected, placed in a 15 mL tube and centrifuged at 350×g for 5 min at 4° C. The supernatant was discarded, and the deposited cells were resuspended and then lysed for 10 min at room temperature by adding 2 mL of red blood cell (RBC) lysis buffer (Thermo Fisher Scientific). 6 mL of RPMI-1640 medium was then added to terminate the lysis of red blood cells, and the mixture was centrifuged (4° C., 350 g, 5 min). The supernatant was discarded, 10 mL of RPMI-1640 medium was added to resuspend the cells, and the mixture was centrifuged (4° C., 350 g, 5 min). The supernatant was discarded and 5 mL of RPMI-1640+10% FBS was added to resuspend the cells. The resuspended spleen cell suspension was subjected to cell counting and then preserved for later use.
[0172] Elispot Detection:
[0173] gE-specific cellular immunity was detected by Elispot detection of interferon-y (IFN-γ) and IL-4, and a mixture of 15 overlapping polypeptides covering the entire gE extracellular region was used as a stimulant. An Elispot plate (Dakewe) pre-coated with IFN-γ or IL-4 antibody was added with RPMI-1640 medium at 200 μL per well and then left to stand at room temperature for 10 min before removing the medium. The splenocytes were adjusted to a concentration of 2-8×10.sup.6 cells/mL. 100 μL of the splenocyte suspension was mixed with the polypeptides (concentration of each peptide was 2 μg/mL) and three replicate wells were set for each sample. The Elispot plate was incubated in an incubator at 37° C. for 36-72 h. After the incubation was completed, the color development of spots was performed according to the manual for Elispot plate (see the manufacturer's manual for the specific procedures). After the plate was air dried, the spots were counted by using an enzyme-linked spot imaging system. The number of spot-forming cells (SFC) per 5×10.sup.5 cells was calculated. The background level of the medium was typically <15 SFC/5×10.sup.5 cells.
[0174] Intracellular Cytokine Staining:
[0175] Splenocytes were stimulated in vitro with a mixture of polypeptides (2 μg/mL) covering the entire gE extracellular region (15 peptides containing 11 overlapping amino acids) at 37° C. for 2 h, and then Brefeldin A (3 μg/mL) and ionomycin (1 μg/mL) were added, followed by incubation overnight at 37° C. The cells from each well were harvested, placed in an EP tube, centrifuged at 350 g for 5 min, and the supernatant was discarded. The cells were resuspended with 50 μL of PBS solution containing 2% Fc antibody and 1% FBS, and then incubated at 4° C. for 10 min. 50 μL of an antibody mixture containing anti-CD3 Alex fluor 700, anti-CD4-FITC and anti-CD8-PE-Cy7 (BD Biosciences, 1:100 dilution) was then added, and the resulting mixture was incubated at 4° C. for 30 min in the absence of light. After the cells were washed once with FACS washing buffer, 200 μL of stationary liquid was added, followed by incubation for 25 min at room temperature in the absence of light. After the completion of fixation, 1.5 mL of the diluted permeabilization reagent was added to wash the cells. The cell suspension was centrifuged at 350 g for 5 min, and then the supernatant was discarded. IFN-γ-APC, IL-2-PerCp-Cy5.5 and IL-4-PE antibodies were diluted with the permeabilization reagent, and the diluted antibody mixture was then added to the cell suspension. The resulting mixture was incubated for 30 min at room temperature in the absence of light. CD3+/CD4+ positive T cells and CD3+/CD8+ positive T cells subsets were analyzed with CytoFLEX S flow cytometer (Beckman) and Flow Jo software.
Example 1
[0176] Construction, Identification, Amplification and Purification of Recombinant Adenovirus
[0177] 1.1 Design of Experiment
[0178] 1.1.1 A linker sequence for gE-flagellin fusion protein was designed according to calculation and simulation by a computer. A computer-simulated diagram of the binding of the flagellin protein and TLR-5 receptor is shown in
[0179] 1.1.2 Primers used in this study are shown in Table 2, and inserted genes and abbreviations of recombinant adenoviruses prepared accordingly are shown in
TABLE-US-00003 TABLE 2 Primers used in this study Name of primer Sequence AttB1-JEV-F GGGGACAAGTTTGTACAAAAAAGCAGGCTTCGC CGCCGCCATGGGAAAACGGTCC AttB2-SV40-R GGGGACCACTTTGTACAAGAAAGCTGGGTCAGA CATGATAAGATACATTGATGAG AttB2-GE-R GGGGACCACTTTGTACAAGAAAGCTGGGTCTTA TTATTATCTGATCAGGGGGCTAG AttB2-hOACF-R GGGGACCACTTTGTACAAGAAAGCTGGGTCTTA TTATTACCTCAGCAGGCTCAG AttB2-hOANF-R GGGGACCACTTTGTACAAGAAAGCTGGGTCTTA TTATTATCTAATCAGAGGGCTAG Note: 1. in the name of primer, F represents a forward primer, and R represents a reverse primer; 2. forward primers used to amplify gE and gE-flagellin genes with and without SV40 polyA are the same, namely AttB1-JEV-F; 3. reverse primers used for amplifying gE and gE-flagellin genes containing SV40 polyA are all AttB2-SV40-R.
[0180] 1.2 Construction of Recombinant Adenovirus
[0181] 1.2.1 Construction of pDONR221 Transfer Vector
[0182] The gene fragments as shown in Section 1.1 were subjected to gene synthesis, and then each target gene fragment was amplified by high fidelity DNA polymerase (the sequence of the amplification primer is shown in Table 2 in Section 1.1.2). After PCR amplification, PCR products were detected by 1% agarose gel electrophoresis and target DNA fragments were extracted by using a DNA gel extraction kit, wherein the conditions for PCR cycling were as follows: first step, 95° C. for 2 min; second step, 95° C. for 15 s, 55° C. for 15 s, and 72° C. for 1 min and 30 s, 30 cycles in total; and third step, 72° C. for 5 min. The extracted target DNA fragments were subjected to BP-recombination with pDONR221 plasmid (Thermo Fisher Scientific, Cat 11789020) according to the manufacturer's manual, respectively, and the recombination mixture was transformed into E. coli TOP10 competent cells, and the later were then coated on a solid Kana-resistant LB plate. The plasmids were extracted and sent for sequencing.
[0183] The prepared TOP10/pDONR221-Js-ASF-SV40plyA, TOP10/pDONR221-Js-ACF-SV40plyA and TOP10/pDONR221-Js-ANF-SV40plyA were deposited at China Center for Type Culture Collection (CCTCC) on Sep. 10, 2019, and the deposit numbers are respectively as follows: CCTCC M 2019707, CCTCC M 2019708 and CCTCC M 2019709.
[0184] 1.2.2 Construction of Recombinant Adenovirus Expression Vectors
[0185] The correctly sequenced recombinant pDONR221 plasmids were subjected to LR-recombination with the target plasmid pAd5-CMV/V5-DEST (Thermo Fisher Scientific, Cat 11791020) according to the manufacturer's manual, respectively. The recombination mixture was transformed into E. coli TOP10 competent cells, and the later were then coated on a solid Ampicillin-resistant (Amp, 100 μg/mL) LB plate. The next day, different colonies were selected, which might contain different pAd5-CMV plasmids, and these colonies were made to carry a pAd5-CMV plasmid of the gE or gE-flagellin fusion gene with or without SV40 polyA (referred to as pAd5-CMV (VZV)). The selected colonies were cultured in Amp-resistant LB medium. Plasmids were extracted and sequenced.
[0186] 1.2.3 Preparation of Recombinant Adenovirus Plasmid
[0187] The correctly sequenced pAd5-CMV (VZV) plasmids were transformed into E. coli TOP10 competent cells, respectively, and the later were then coated on a solid Amp-resistant LB plate. The next day, single clones were selected and seeded into 200 mL of LB liquid medium containing Amp, and after overnight culture, a large number of pAd5-CMV (VZV) plasmids were extracted by using plasmid maxi kits.
[0188] The prepared TOP10/pAd5-Js-gE-SV40plyA was deposited at the China Center for Type Culture Collection (CCTCC) on Sep. 10, 2019, and the deposit number was CCTCC M 2019710.
[0189] 1.2.4 Linearization of Recombinant Adenovirus Vectors
[0190] The plasmids obtained in 1.2.3 were digested with a PacI restriction enzyme (NEB, USA) for 3 h at 37° C., respectively, and the digestion system was as follows: pAd5-CMV (VZV) plasmid: 10 μg; 10*NEB CutSmart buffer: 5 μL; PacI enzyme: 5 with ddH.sub.2O added to a final volume of 50 μL. After the enzyme digestion, DNA fragments were extracted by using PCR product extraction kits. The extracted DNA fragments were quantified with a micro nucleic acid quantitative analyzer.
[0191] 1.2.5 Packaging of Recombinant Adenovirus
[0192] The Pac I-linearized pAd5-CMV (VZV) plasmids were respectively transfected into HEK293 cells at 60-70% confluence in a 6-well plate according to the instructions for the Lipofectamine2000 transfection reagent. 2 h before transfection, the medium was changed to an antibiotic-free medium and a DNA/liposome complex was added. 5 h after transfection, the medium was changed to a DMEM medium containing 10% FBS and 1% double antibody was used. The cytopathic effect was observed under an inverted microscope every other day, and the cells were collected when 60% of HEK293 cells generate plaques. The cells were subjected to three repeated freeze-thaw cycles between an ultralow temperature of −80° C. and room temperature, and then were centrifuged at 1200 g for 5 min. The supernatant was collected to obtain recombinant adenoviruses rAd5-gE (Js), rAd5-gE-SV40 (Js), rAd5-ANF (Js), rAd5-ANF-SV40 (Js), rAd5-ACF (Js), rAd5-ACF-SV40 (Js), rAd5-ASF (Js) and rAd5-SE-SV40 (Ig x), which were stored in a refrigerator at −80° C.
[0193] 1.3 Identification of Target Gene Expression of Recombinant Adenovirus
[0194] 1.3.1 PCR Identification
[0195] Viral genomic DNA was extracted from the initial virus amplification preservation solution by using viral RNA/DNA extraction kit (Takara, Japan) according to the manual, and the extracted viral genomic DNA was subjected to PCR amplification to identify the VZV gE or gE-flagellin fusion gene that was inserted into the recombinant adenovirus vector. Primer: T7-F/V5-C-R; PCR conditions: viral DNA 1 μL; forward and reverse primers: each 0.5 μL; 5 μL of 2× PrimerSTAR mix; ddH.sub.2O: 3 μL; and conditions for cycling: first step, 95° C. for 2 min; second step, 95° C. for 15 s, 45° C. for 15 s, and 72° C. for 1 min and 30 s, 30 cycles in total; and third step, 72° C. for 5 min. After the PCR amplification was completed, the PCR products were subjected to 1% agarose gel electrophoresis, and then the gel was cut to extract target bands for sequencing by a sequencing company.
[0196] 1.3.2 VZV gE and gE-Flagellin Fusion Gene Expression of Recombinant Adenovirus
[0197] HEK293 cells or Vero cells were seeded into a 6-well plate (5×10.sup.5/well). When the confluence in the 6-well plate was 90%, P3-generation recombinant adenoviruses were seeded into the 6-well plate at MOI 0.2 (HEK293 cells) and 20 (Vero cells), and normal cells were set as the negative control. After being cultured at 37° C. for 48 h, the cells were scraped off with a cell scraper, and then centrifuged; and the cell precipitate and supernatant were collected separately. The supernatant was labeled as cell culture supernatant. The cell precipitate was added with 100 μL of mammalian cell lysate (Beyotime, China), lysed on ice and then centrifuged at 3500 g for 5 min, and the lysed supernatant was labeled as cell lysate. 20 μL of 5× loading buffer was added to 80 μL of cell culture supernatant and cell lysate separately, and the mixtures were boiled at 100° C. for 5 min. The expression of gE protein or gE-flagellin fusion protein was detected by SDS-PAGE and WB. The results of Vero cell detection are shown in
[0198] 1.4 Small-Scale Amplification of Recombinant Adenovirus:
[0199] HEK293 cells at 90% confluence were inoculated with different recombinant adenoviruses at MOI 0.01-1, and then placed in an incubator at 37° C., 5% CO.sub.2 for continuous culturing. When more than 70% of the cells became round and fell off, the cells were scraped off by a cell scraper and centrifuged at 2265 g for ten minutes. The supernatant and cell precipitate were harvested separately. The cell precipitate was resuspended with PBS, then placed in a freezer at −80° C. and subjected to three repeated freeze-thaw cycles. The cells were then centrifuged at 2265 g for ten minutes to harvest the supernatant for further purification.
[0200] 1.5 Purification of Recombinant Adenovirus
[0201] The centrifuge rotor was pre-cooled to 4° C. In a biosafety cabinet, 12 mL of 1.4 g/mL cesium chloride (53 g+87 mL 10 mM Tris-HCl, pH 7.9) was slowly added to the centrifuge tube, and then 9 mL of 1.2 g/mL cesium chloride (26.8 g+92 mL 10 mM Tris-HCl, pH 7.9) was added quite gently. 13 mL of virus preservation solution was then added to the top of the discontinuous gradient, the tube was equilibrated, and the mixture was centrifuged at 100,000 g (23,000 rpm on SW28 rotor) at 4° C. for 120 min. The viral bands were carefully pipetted, the virus-containing solution was transferred to a 15 mL sterile centrifuge tube, and an equal volume of 10 mM Tris HCl (pH 7.9) was added. 20 mL of 1.35 g/mL cesium chloride was added to the centrifuge tube. 15 mL of the virus suspension diluted in the previous step was added from the top very slowly. After the tube was equilibrated, the mixture was centrifuged at 100,000 g for 18 h at 4° C. After ultracentrifugation, the blue-white viral bands were carefully collected. The viruses were dialyzed into PBS solution at 4° C. in a 10,000 Dalton cellulose ester membrane (purchased from BD, USA) to remove cesium chloride salt. The dialyzed virus solution was added with 10% glycerol, aliquoted, and cryopreserved in a refrigerator at −80° C.
[0202] 1.6 Assay and Analysis of Recombinant Adenovirus
[0203] The purified recombinant adenoviruses were detected by Western blotting (WB) (see
Example 2
[0204] Expression, Purification and Assay of gE Protein and gE-Flagellin Fusion Protein in Prokaryotic System
[0205] 2.1 Names of Genes and Proteins
[0206] The names of the inserted genes and the correspondingly expressed gE protein and gE-flagellin fusion protein are shown in
[0207] 2.2 Construction of pET28a Expression Vector
[0208] The genes as shown in Section 2.1 were respectively digested with NcoI and XhoI and then inserted into pET28a vectors digested with the same enzymes. After ligation and transformation, single clones were selected and seeded into kanamycin-resistant (50 μg/mL) LB medium. After culturing overnight, plasmids were extracted for sequencing by a sequencing company. Expression plasmids pET28a-gE, pET28a-ENF, pET28a-ECF and pET28a-ESF were obtained.
[0209] 2.3 Expression of gE Protein and gE-Flagellin Fusion Protein
[0210] The correctly sequenced plasmids pET28a-gE, pET28a-ENF, pET28a-ECF and pET28a-ESF, were transformed into BL21(DE3) competent cells, and single clones were selected, seeded into kanamycin-resistant LB medium and cultured at 37° C. overnight at 200 rpm. The next day, the strains were transferred to fresh kanamycin-resistant LB medium. After culturing at 37° C. for 4 h at 200 rpm, 0.1-1 mM IPTG was added for inducing expression when OD600 reached 0.6-0.8. After inducing at an expression temperature of 16-37° C. for 4-16 h, the thalli were harvested for further purification.
[0211] 2.3 Purification and Renaturation of gE Protein and gE-Flagellin Fusion Protein
[0212] The collected thalli were crushed by a high-pressure homogenizer and centrifuged at 2265 g for 10 min. The inclusion bodies were collected, washed 3-4 times with detergent-containing normal saline, and then dissolved in a buffer solution (20 mM Tris+5 mM imidazole+500 mM NaCl+6 M guanidine hydrochloride/8 M urea, pH 8.0). The washed nickel column was equilibrated with 5 column volumes (CV) of equilibration buffer A (20 mM Tris+8M urea+5 mM imidazole+500 mM NaCl, pH 8.0). The dissolved inclusion bodies were loaded onto the nickel column. After the loading, the nickel column was washed with 5 CV of the equilibrium solution and then eluted with 20 CV of eluent buffer B (linear gradient to 100%), wherein the eluent buffer B was 20 mM Tris+8 M urea+500 mM imidazole+500 mM NaCl (pH 8.0). Each elution peak was collected.
[0213] Dialysis and renaturation: the purified inclusion bodies (dissolved in 8 M urea) were gradually dialyzed into 6 M, 4 M and 2 M urea-containing PBS solutions using dialysis bags. The dialysate was changed every 2 h. Finally, the purified inclusion body proteins were slowly dialyzed into a PBS solution.
[0214] Renaturation on column: after the loading of inclusion bodies, the column was washed with 5 CV of equilibration solution A, and then renaturation on column was performed with 20 CV-40 CV of renaturation solution B (linear gradient to 100%), wherein the renaturation solution B was 20 mM Tris+2 M urea+5 mM imidazole+500 mM NaCl+0.1 mM GSSG/1 mM GSH (pH 8.0). After renaturation was completed, the column was washed with 5 CV of buffer C (20 mM Tris+2 M urea+5 mM imidazole+500 mM NaCl, pH 8.0). The column was then eluted with 20 CV of eluent buffer D (linear gradient to 100%), which was 20 mM Tris+2 M urea+5 mM imidazole+500 mM NaCl (pH 8.0). Each elution peak was collected. The collected elution peaks were dialyzed into PBS solution using dialysis bags.
[0215] 2.4 Assay of gE Protein and gE-Flagellin Fusion Protein
[0216] The results of 10% SDS-PAGE electrophoresis and WB analysis of the purified proteins are shown in
Example 3
[0217] Expression, Purification, Assay and Activity Analysis of gE Protein and gE-Flagellin Fusion Protein in Eukaryotic Cells
[0218] 3.1 Expression of gE Protein and gE-Flagellin Fusion Protein in Vero Cells
[0219] Vero cells at 90% confluence in one flask (T-75 flask) were washed twice with PBS, and then infected separately with the recombinant adenovirus A and recombinant adenovirus B obtained through packaging at MOI 100-200. After adsorption for 1 h at 37° C., 20 mL of DMEM medium was added into each flask. The culture flasks were placed into a CO.sub.2 incubator and incubated at 37° C. for 4-5 days. The culture supernatant was then harvested for further purification.
[0220] 3.2 Purification of gE Protein and gE-Flagellin Fusion Protein
[0221] The harvested gE or gE-flagellin fusion protein expression supernatant was added to an equal volume of a mixed solution of 10 mM PBS and 1 M (NH.sub.4).sub.2SO.sub.4 (pH 7.5). After filtration through a 0.2 μm filter membrane, the resulting mixture was loaded onto a well-equilibrated Capto Phenyl Impress column. The equilibration buffer was 10 mM PBS+500 mM (NH.sub.4).sub.2SO.sub.4 (pH 7.5). After the loading, the column was washed with 5 CV of the equilibration buffer, and then eluted with 10 CV of solution B (linear gradient to 100%), wherein solution B was 10 mM PBS (pH 7.5). The elution peak at 100% B was collected.
[0222] The collected elution peak was loaded onto a Source 30Q column equilibrated with 10 mM PBS (pH 7.5). After the loading, the column was washed with 5 CV of the equilibration buffer and then subjected to gradient elution with 10 mM PB+250 mM NaCl (pH 7.5). A purified solution was collected, which was the final purified liquid. The purified liquid (100 μg-5 mg/mL) was added with 10% glycerol and then cryopreserved in a refrigerator at −80° C.
[0223] 3.3 Assay and Activity Analysis of gE Protein and gE-Flagellin Fusion Protein
[0224] According to the SDS-PAGE analysis of the purified gE protein and gE-flagellin fusion protein (see
[0225] WB analysis of the purified protein revealed that (see
[0226] TLR-5 activity analysis (see Table 3) showed that three fusion proteins ANF, ACF and ASF could, by activating THP-1 TLR-5 receptor, induce THP-1 cells to secrete IL-8 and TNF-α cytokines at higher concentration in a dose-dependent manner. However, the gE protein prepared and purified according to the same method could not induce the secretion of TLR-5-active cytokines. All three gE-flagellin fusion proteins were shown to have the activity of allowing the specific functioning of the flagellin protein through TLR-5. The flagellin activity of the ASF was substantially identical to that of the commercially available flagellin protein.
TABLE-US-00004 TABLE 3 TLR-5 activity assay Experimental Molecular stimulation IL-8 TNF-α In vitro relative Sample weight concentration content content potency (%) name Batch number (Kd) (μg/mL) (ng) (pg) IL-8 TNF-α gE MB20180731 80 5 0 0 0 0 ACF MB20181220 120 5 6.41 111.94 32.7 11.6 ANF MB20181218 120 5 10.83 552.00 55.3 57.0 ASF MB20180916 120 5 27.84 1004.00 142.0 103.6 Flagellin XA1204-L 60 2.5 19.60 969.05 100 100
Example 4 Immunogenicity Test
[0227] 4.1 Immunogenicity Detection of Recombinant Adenovirus a and Recombinant Adenovirus B
[0228] 4.1.1 Animal Immunization and Sample Collection
[0229] All animal experiments were performed according to protocols approved by Hubei Provincial Center for Food and Drug Safety Evaluation and International Animal Care and Use Committee (IACUC). 36 special pathogen-free (SPF grade) female C57BL/6 mice, weighing 12-16 g, were bred in Hubei Provincial Center for Food and Drug Safety Evaluation. After the inspection and quarantine, the mice were randomly divided into 6 groups according to their body weight, and were intramuscularly inoculated with 10.sup.9 TCID.sub.50/dose of recombinant adenovirus A, recombinant adenovirus B, or 700 pfu commercially available VZV vaccine (Changchun Keygene, China) on day 1 and day 28. Table 4 shows the grouping details. Blood was collected from the orbital venous plexus on day 0, day 12, day 42 and day 56, respectively.
TABLE-US-00005 TABLE 4 Group information for immunogenicity detection of recombinant adenoviruses Dosage (TCID.sub.50/ Administration Group Treatment dose) route Number Empty rAd5 vector 10.sup.9 Intramuscular 6 vector injection, 0.1 mL/mouse rAd5-gE rAd5-gE (Js) 10.sup.9 Intramuscular 6 injection, 0.1 mL/mouse rAd5-ANF rAd5-ANF (Js) 10.sup.9 Intramuscular 6 injection, 0.1 mL/mouse rAd5-ACF rAd5-ACF (Js) 10.sup.9 Intramuscular 6 injection, 0.1 mL/mouse rAd5-SE rAd5-SE(Igκ) 10.sup.9 Intramuscular 6 injection, 0.1 mL/mouse Commercially Live attenuated 700 pfu Intramuscular 6 available VZV varicella injection, vaccine 0.15 mL/mouse (Changchun Bcht)
[0230] 4.1.5 Comparison of Immunogenicities of Different Adenovirus Vector Vaccines and Commercially Available Chickenpox Vaccine for Mice
[0231] Serum anti-gE IgG antibody: the anti-gE IgG antibody titer in the serum after immunization was detected by ELISA (see the detection results shown in
TABLE-US-00006 TABLE 5 gE-specific IgG antibody titers induced by recombinant adenoviruses Geometric Mean Titers (GMT) Groups Mouse No. Day 0 Day 12 Day 42 Day 56 Commercially 1~6 <100 898 20159 7155 available VZV Empty vector 7~12 <100 <100 <100 <100 rAd5-gE 13~18 <100 6142 32000 32000 rAd5-ANF 19~24 <100 22627 73517 84449 rAd5-ACF 25~30 <100 8652 45255 71838 rAd5-SE 31~36 <100 5080 14154 48503
[0232] Serum neutralizing antibody titer: as shown in
[0233] Detection of cellular immunity level: according to the results of intracellular cytokine staining shown in
[0234] 4.2 Immunogenicity Detection of gE-Flagellin Fusion Proteins
[0235] 4.2.1 Animal Immunization and Sample Collection
[0236] All animal experiments were performed according to protocols approved by Hubei Provincial Center for Food and Drug Safety Evaluation and International Animal Care and Use Committee (IACUC). 60 special pathogen-free (SPF grade) female C57BL/6 mice, weighing 12-16 g, were bred in Hubei Provincial Center for Food and Drug Safety Evaluation. After the inspection and quarantine, the mice were randomly divided into 10 groups according to their body weight, and were intramuscularly inoculated with gE protein (5 μg/dose) (with or without MF59 (50 μL/dose)), gE-flagellin fusion protein (8 μg/dose) (with or without MF59), or 700 pfu commercially available VZV vaccine (Changchun Keygene, China) on day 1 and day 14, respectively. Table 6 shows the grouping details. Blood was collected from the orbital venous plexus on day 0 and day 28.
TABLE-US-00007 TABLE 6 Group information of animals for gE- flagellin fusion protein experiment Dosage Administration Group Treatment (μg/dose) route Number Negative Normal / Intramuscular 6 control saline injection, group 0.1 mL/mouse gE gE 5 Intramuscular 6 injection, 0.1 mL/mouse ANF ANF 8 Intramuscular 6 injection, 0.1 mL/mouse ACF ACF 8 Intramuscular 6 injection, 0.1 mL/mouse ASF ASF 8 Intramuscular 6 injection, 0.1 mL/mouse gE + MF59 gE + MF59 5 + 50 μl Intramuscular 6 injection, 0.1 mL/mouse ANF + MF59 ANF + MF59 8 + 50 μl Intramuscular 6 injection, 0.1 mL/mouse ACF + MF59 ACF + MF59 8 + 50 μl Intramuscular 6 injection, 0.1 mL/mouse ASF + MF59 ASF + MF59 8 + 50 μl Intramuscular 6 injection, 0.1 mL/mouse Positive Commercially 700 PFU Intramuscular 6 vaccine available VZV injection, 0.15 mL/mouse
[0237] 4.2.2 Comparison of Immunogenicities of gE Protein with or without Adjuvant, gE-Flagellin Fusion Protein with or without Adjuvant, and Commercially Available Chickenpox Vaccine
[0238] Serum anti-gE IgG antibody titer: the serum of mice was collected on day 28 after immunization, i.e., day 14 after the second dose of immunization, and tested for gE-specific antibody titers by ELISA (see
TABLE-US-00008 TABLE 7 gE-specific IgG antibody titers induced by gE and gE-flagellin fusion proteins Geometric Mean Titers (GMT) Groups Mouse No. Day 0 Day 28 gE 1~6 <100 566 gE + MF59 7~12 <100 182456 ACF 13~18 <100 14368 ACF + MF59 19~24 <100 36204 ANF 25~30 <100 1270 ANF + MF59 31~36 <100 7184 ASF 37~42 <100 4525 ASF + MF59 43~48 <100 18102 Commercially 49~54 <100 8063 available VZV vaccine Saline 55~60 <100 <100
[0239] Serum neutralizing antibody titer: as shown in
[0240] Cellular immunity: the results of IFN-γ and IL-4 Elispot assay are shown in
[0241] Conclusion: there is still a need to develop a safer modified VZV vaccine. The commercially available live attenuated varicella vaccines would still put the vaccines, especially infants and immunosuppressed populations, at the risk of rare but very serious adverse reactions. Once these reactions occur, urgent medical treatment is required. In addition, the commercially available live attenuated varicella vaccines also present the risk of infecting immunocompromised individuals. One third of the subjects vaccinated with live attenuated vaccines will be at risk of developing shingles in the future, and one fifth of them will suffer from debilitating chronic postherpetic neuralgia. Therefore, pregnant women and immunocompromised people are prohibited from using live attenuated varicella and herpes zoster vaccines at present. Although Shingrix, a subunit shingles vaccine with adjuvant, is more effective than live attenuated vaccines, it has more adverse reactions and may cause more local and systemic adverse reactions (Tricco A C et al., BMJ, 363:k4029, 2018).
[0242] The present invention discloses methods for preparing and implementing novel immune components, which can be used in vaccines for preventing VZV infection and induce extensive protective humoral and cellular immunity. The immune components select VZV-gE glycoprotein as the immunogen because the gE protein is the most abundant and most immunogenic protein in VZV virus. The immune components described herein include recombinant VZV-gE proteins with adjuvant and gE-flagellin fusion proteins having intrinsic adjuvant properties. The immune components can be prepared by the expression in a prokaryotic or eukaryotic expression system, and can also be prepared in a replication-defective adenovirus vector expressing gE or gE-flagellin protein. The moiety of the flagellin protein that is covalently linked to gE protein by genetic engineering has been shown to be able to bind to and activate TLR-5, thus triggering innate immunity. Such fusion proteins may not require further adjuvants in human vaccines, thereby reducing the risk of adverse reactions caused by adjuvants. According to the present invention, all immune components have high immunogenicity and can induce strong gE-specific antibodies and in vitro functional neutralizing antibodies related to the protection; meanwhile, the immune components can induce CD4+Th1 and Th2 T cell immunity, which plays an important role in the prevention and recovery of shingles. Self-adjuvanted gE-flagellin fusion proteins are more immunogenic than the corresponding gE proteins, either directly purified or delivered via adenovirus vectors. If desired, the immunogenicity of the purified protein can be significantly improved by using a conventional adjuvant that is much less reactive than AS01 in Shingrix. The non-replicating adenovirus vector expressing gE or gE-flagellin fusion protein can not only induce good gE-specific antibodies, VZV neutralization responses and CD4+ T cell responses, but also induce the body to generate CD8+ T cell immunity, thereby further destroying cells infected by VZV.
[0243] Almost all of the immune components of the present invention are more immunogenic than the commercially available live attenuated varicella vaccine. In addition, the various immune components described herein can be used as part of a prime-boost immunization regimen to enhance and augment VZV-specific immunity. The various immune components can also be mixed with other immunogens for use in combination vaccines. These immune components are safer than the commercially available live attenuated varicella vaccines, because they are not infectious, do not cause occasional serious adverse events that may be associated with use thereof, and most importantly, they do not put the vaccines at a significant risk of developing shingles and postherpetic neuralgia. The present invention also discloses a method for preparing the gE and gE-flagellin protein fusion protein by expression in a prokaryotic system, and the method can reduce the production cost of the vaccine. The adenovirus vector disclosed herein can also be developed into a vaccine for single immunization, so that the immunization frequency can be reduced.
[0244] In conclusion, the immune components provided herein can be used to produce a new vaccine for the prevention and control of chickenpox and shingles, which is safer, effective and possibly cheaper. It should be noted that the above examples are only used for illustrating the technical solutions of the present invention, which should not be construed as limiting the present invention. Further modification and adjustment for the above content disclosed herein made by those skilled in the art should fall within the protection scope of the present invention.
SEQUENCE LISTING
[0245]
TABLE-US-00009 TABLE 8 Sequence listing Sequence number Sequence details SEQ ID NO: 1 Amino acid sequence of gE extracellular region SEQ ID NO: 2 Gene sequence of gE extracellular region SEQ ID NO: 3 Amino acid sequence of flagellin protein from strain LT2 SEQ ID NO: 4 Linker I (SPGISGGGGGILDSMG) SEQ ID NO: 5 Amino acid sequence of N-terminal region of flagellin protein from strain LT2 SEQ ID NO: 6 Amino acid sequence of C-terminal region of flagellin protein from strain LT2 SEQ ID NO: 7 Linker II (GGGGSGGGGSGGGGS) SEQ ID NO: 8 Amino acid sequence of ANF fusion protein (N-terminal D0-D1-C terminal D1-D0-gE, LT2) SEQ ID NO: 9 Amino acid sequence of ACF fusion protein (gE-N-terminal D0-D1-C-terminal D1-D0, LT2) SEQ ID NO: 10 Amino acid sequence of ASF fusion protein (N-terminal D0-D1-gE-C-terminal D1-D0, LT2) SEQ ID NO: 11 Gene encoding ANF fusion protein (N-terminal D0-D1-C-terminal D1-D0-gE, LT2) SEQ ID NO: 12 Gene encoding ACF fusion protein (gE-N-terminal D0-D1-C-terminal D1-D0, LT2) SEQ ID NO: 13 Gene encoding ASF fusion protein (N-terminal D0-D1-gE-C-terminal D1-D0, LT2) SEQ ID NO: 14 JEV prM leader sequence SEQ ID NO: 15 Mouse IgGκ light chain leader sequence SEQ ID NO: 16 Kozak sequence SEQ ID NO: 17 SV40 polyA SEQ ID NO: 18 Kozak sequence-JEV prM leader sequence-gE extracellular region gene SEQ ID NO: 19 Kozak sequence-JEV prM leader sequence-gE extracellular region gene-SV40 polyA SEQ ID NO: 20 Kozak sequence-JEV prM leader sequence-5′ terminal D0-D1 gene-linker I-3′ terminal D1-D0 gene-3 × (GGGGS)-gE extracellular region gene SEQ ID NO: 21 Kozak sequence-JEV prM leader sequence-5′ terminal D0-D1 gene-linker I-3′ terminal D1-D0 gene-3 × (GGGGS)-gE extracellular region gene-SV40 polyA SEQ ID NO: 22 Kozak sequence-JEV prM leader sequence-gE extracellular region gene-3 × (GGGGS)-5′ terminal D0-D1 gene-linker I-3′ terminal D1-D0 gene SEQ ID NO: 23 Kozak sequence-JEV prM leader sequence-gE extracellular region gene-3 × (GGGGS)-5′ terminal D0-D1 gene-linker I-3′ terminal D1-D0 gene-SV40 polyA SEQ ID NO: 24 Kozak sequence-JEV prM leader sequence-5′ terminal D0-D1 gene-3 × (GGGGS)-gE extracellular region gene-3 × (GGGGS)-3′ terminal D1-D0 gene SEQ ID NO: 25 Kozak sequence-JEV prM leader sequence-5′ terminal D0-D1 gene-3 × (GGGGS)-gE extracellular region gene-3 × (GGGGS)-3′ terminal D1-D0 gene-SV40 polyA SEQ ID NO: 26 Kozak sequence-mouse IgGκ light chain leader peptide sequence-SE-SV40 polyA (ty2) SEQ ID NO: 27 Amino acid sequence of modified flagellin protein (N-terminal D0-D1-Linker I-C-terminal D1-D0, LT2) SEQ ID NO: 28 Gene encoding modified flagellin protein (N-terminal D0-D1-Linker I-C-terminal D1-D0, LT2) SEQ ID NO: 29 Amino acid sequence of flagellin protein from strain Ty2 SEQ ID NO: 30 Amino acid sequence of N-terminal region of flagellin protein from strain Ty2 SEQ ID NO: 31 Amino acid sequence of C-terminal region of flagellin protein from strain Ty2 SEQ ID NO: 32 Amino acid sequence of ANF fusion protein (N-terminal D0-D1-C terminal D1-D0-gE, Ty2) SEQ ID NO: 33 Amino acid sequence of ACF fusion protein (gE-N-terminal D0-D1-C-terminal D1-D0, Ty2) SEQ ID NO: 34 Amino acid sequence of ASF fusion protein (N-terminal D0-D1-gE-C-terminal D1-D0, Ty2) SEQ ID NO: 35 Amino acid sequence of E. coli-expressed gE extracellular region SEQ ID NO: 36 Gene sequence of E. coli-expressed gE extracellular region SEQ ID NO: 37 Amino acid sequence of ENF fusion protein (N-terminal D0-D1-C-terminal D1-D0-gE, LT2) SEQ ID NO: 38 Amino acid sequence of ECF fusion protein (gE-N-terminal D0-D1-C-terminal D1-D0, LT2) SEQ ID NO: 39 Amino acid sequence of ESF fusion protein (N-terminal D0-D1-gE-C-terminal D1-D0, LT2) SEQ ID NO: 40 Gene encoding ENF fusion protein (N-terminal D0-D1-C-terminal D1-D0-gE, LT2) SEQ ID NO: 41 Gene encoding ECF fusion protein (gE-N-terminal D0-D1-C-terminal D1-D0, LT2) SEQ ID NO: 42 Gene encoding ESF fusion protein (N-terminal D0-D1-gE-C-terminal D1-D0, LT2)