Method to Produce Cannabis Haploid Plants and Consequent Spontaneous or Chemically Induced Haploid/Di-Haploid in a Single Generation
20230397547 · 2023-12-14
Inventors
Cpc classification
A01H1/08
HUMAN NECESSITIES
International classification
A01H1/08
HUMAN NECESSITIES
Abstract
Provided herein are methods of producing a Cannabis haploid/di-haploid plant in a single generation. The methods comprise (a) obtaining pollen comprising a mutation in DMP8; (b) using the pollen to pollinate a Cannabis plant; (c) collecting a seed from the pollenated Cannabis plant; (d) identifying putative haploid Cannabis plants from the seed; and (e) producing a Cannabis haploid/di-haploid plant in a single generation.
Claims
1. A method of producing a Cannabis haploid/di-haploid plant in a single generation, the method comprising: (a) obtaining pollen comprising a mutation in DMP8; (b) using the pollen to pollinate a Cannabis plant; (c) collecting a seed from the pollenated Cannabis plant; (d) identifying putative haploid Cannabis plants from the seed; and (e) producing a Cannabis haploid/di-haploid plant in a single generation.
2. The method of claim 1, wherein the mutation in DMP8 results in a deletion of a single amino acid in the amino terminus of DMP8.
3. The method of claim 2, wherein the mutation in DMP8 is encoded by the nucleic acid sequence of SEQ ID NO: 4 or SEQ ID NO: 5.
4. The method of claim 1, wherein the Cannabis plant is selected from the group consisting of Cannabis sativa, Cannabis indica, and Cannabis ruderalis.
5. The method of claim 1, wherein the Cannabis haploid/di-haploid plant produced is identified by a phenotypic indicator.
6. The method of claim 5, wherein the phenotypic indicator is selected from the group consisting of dwarfism, ectopic hair/trichome presence on leaves, and a different leaf structure.
7. The method of claim 6, wherein the different leaf structure comprises leaves with 3 leaflets with 7 or 8 lobes in the central and lateral leaflets.
8. The method of claim 7, further comprising the step of confirming the putative haploid Cannabis plant utilizing genetic techniques.
9. The method of claim 8, wherein the genetic technique is selected from chromosome counting, seed sterility, and single nucleotide polymorphism (SNP) genetic analysis.
10. The method of claim 9, wherein the chromosome counting is performed by flow cytometry.
11. The method of claim 9, wherein the SNP genetic analysis is confirmed via DNA sequencing.
12. The method of claim 1, wherein the Cannabis haploid/di-haploid plant does not comprise the mutation in DMP8.
13. A Cannabis haploid/di-haploid plant produced by the method of claim 1.
14. The Cannabis haploid/di-haploid plant of claim 13, where the Cannabis haploid/di-haploid plant comprises cells, tissues, and organs.
15. The Cannabis haploid/di-haploid plant of claim 14, wherein the organs include seeds, leaves, fruits, flowers, stems, and/or roots.
16. The Cannabis haploid/di-haploid plant of claim 13, wherein the Cannabis haploid/di-haploid plant includes propagation materials selected from the group consisting of pollen, ovaries, ovules, germs, endosperms, egg cells, cleavage, roots, root tips, hypotcotyls, cotyledons, stems, leaves, flowers, anthers, seeds, meristematic cells, protoplasts, and tissue cultures.
17. The method of claim 1, further comprising: (f) obtaining a seed from the produced Cannabis haploid/di-haploid plant.
18. The method of claim 17, further comprising: (g) growing a Cannabis haploid/di-haploid plant from the seed.
19. A Cannabis haploid/di-haploid seed obtained by the method of claim 17.
20. The Cannabis haploid/di-haploid seed of claim 19, wherein the seed is genetically identical with the pollenated Cannabis plant.
Description
BRIEF DESCRIPTION OF DRAWINGS
[0020] The foregoing summary, as well as the following detailed description of the preferred embodiments of the present application, will be better understood when read in conjunction with the appended drawings. It should be understood, however, that the application is not limited to the precise embodiments shown in the drawings.
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
DETAILED DESCRIPTION OF THE INVENTION
[0028] Various publications, articles and patents are cited or described in the background and throughout the specification; each of these references is herein incorporated by reference in its entirety. Discussion of documents, acts, materials, devices, articles or the like which has been included in the present specification is for the purpose of providing context for the invention. Such discussion is not an admission that any or all of these matters form part of the prior art with respect to any inventions disclosed or claimed.
[0029] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood to one of ordinary skill in the art to which this invention pertains. Otherwise, certain terms used herein have the meanings as set forth in the specification.
[0030] It must be noted that as used herein and in the appended claims, the singular forms “a,” “an,” and “the” include plural reference unless the context clearly dictates otherwise.
[0031] Unless otherwise stated, any numerical values, such as a concentration or a concentration range described herein, are to be understood as being modified in all instances by the term “about.” Thus, a numerical value typically includes ±10% of the recited value. For example, a concentration of 1 mg/mL includes 0.9 mg/mL to 1.1 mg/mL. Likewise, a concentration range of 1% to 10% (w/v) includes 0.9% (w/v) to 11% (w/v). As used herein, the use of a numerical range expressly includes all possible subranges, all individual numerical values within that range, including integers within such ranges and fractions of the values unless the context clearly indicates otherwise.
[0032] Unless otherwise indicated, the term “at least” preceding a series of elements is to be understood to refer to every element in the series. Those skilled in the art will recognize or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the invention.
[0033] As used herein, the terms “comprises,” “comprising,” “includes,” “including,” “has,” “having,” “contains” or “containing,” or any other variation thereof, will be understood to imply the inclusion of a stated integer or group of integers but not the exclusion of any other integer or group of integers and are intended to be non-exclusive or open-ended. For example, a composition, a mixture, a process, a method, an article, or an apparatus that comprises a list of elements is not necessarily limited to only those elements but can include other elements not expressly listed or inherent to such composition, mixture, process, method, article, or apparatus. Further, unless expressly stated to the contrary, “or” refers to an inclusive or and not to an exclusive or. For example, a condition A or B is satisfied by any one of the following: A is true (or present) and B is false (or not present), A is false (or not present) and B is true (or present), and both A and B are true (or present).
[0034] As used herein, the conjunctive term “and/or” between multiple recited elements is understood as encompassing both individual and combined options. For instance, where two elements are conjoined by “and/or,” a first option refers to the applicability of the first element without the second. A second option refers to the applicability of the second element without the first. A third option refers to the applicability of the first and second elements together. Any one of these options is understood to fall within the meaning, and therefore satisfy the requirement of the term “and/or” as used herein. Concurrent applicability of more than one of the options is also understood to fall within the meaning, and therefore satisfy the requirement of the term “and/or.”
[0035] As used herein, the term “consists of,” or variations such as “consist of” or “consisting of,” as used throughout the specification and claims, indicate the inclusion of any recited integer or group of integers, but that no additional integer or group of integers can be added to the specified method, structure, or composition.
[0036] As used herein, the term “consists essentially of,” or variations such as “consist essentially of” or “consisting essentially of,” as used throughout the specification and claims, indicate the inclusion of any recited integer or group of integers, and the optional inclusion of any recited integer or group of integers that do not materially change the basic or novel properties of the specified method, structure or composition. See M.P.E.P. § 2111.03.
[0037] The words “right,” “left,” “lower,” and “upper” designate directions in the drawings to which reference is made.
[0038] It should also be understood that the terms “about,” “approximately,” “generally,” “substantially,” and like terms, used herein when referring to a dimension or characteristic of a component of the preferred invention, indicate that the described dimension/characteristic is not a strict boundary or parameter and does not exclude minor variations therefrom that are functionally the same or similar, as would be understood by one having ordinary skill in the art. At a minimum, such references that include a numerical parameter would include variations that, using mathematical and industrial principles accepted in the art (e.g., rounding, measurement or other systematic errors, manufacturing tolerances, etc.), would not vary the least significant digit.
[0039] The terms “identical” or percent “identity,” in the context of two or more nucleic acids or polypeptide sequences (e.g., nucleic acid sequences encoding DMP8 and mutations thereof), refer to two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same, when compared and aligned for maximum correspondence, as measured using one of the following sequence comparison algorithms or by visual inspection.
[0040] For sequence comparison, typically one sequence acts as a reference sequence, to which test sequences are compared. When using a sequence comparison algorithm, test and reference sequences are input into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. The sequence comparison algorithm then calculates the percent sequence identity for the test sequence(s) relative to the reference sequence, based on the designated program parameters.
[0041] Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith & Waterman, Adv. Appl. Math. 1981; 2:482, by the homology alignment algorithm of Needleman & Wunsch, J. Mol. Biol. 1970; 48:443, by the search for similarity method of Pearson & Lipman, Proc. Nat'l. Acad. Sci. USA 1988; 85:2444, by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, WI), or by visual inspection (see generally, Current Protocols in Molecular Biology, F. M. Ausubel et al., eds., Current Protocols, a joint venture between Greene Publishing Associates, Inc. and John Wiley & Sons, Inc., 1995 Supplement (Ausubel)).
[0042] Examples of algorithms that are suitable for determining percent sequence identity and sequence similarity are the BLAST and BLAST 2.0 algorithms, which are described in Altschul et al., J. Mol. Biol. 1990; 215: 403-410 and Altschul et al., Nucleic Acids Res. 1997; 25: 3389-3402, respectively. Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information. This algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence, which either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighborhood word score threshold (Altschul et al, supra). These initial neighborhood word hits act as seeds for initiating searches to find longer HSPs containing them. The word hits are then extended in both directions along each sequence for as far as the cumulative alignment score can be increased.
[0043] Cumulative scores are calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always >0) and N (penalty score for mismatching residues; always <0). For amino acid sequences, a scoring matrix is used to calculate the cumulative score. Extension of the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached. The BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment. The BLASTN program (for nucleotide sequences) uses as defaults a wordlength (W) of 11, an expectation (E) of 10, M=5, N=−4, and a comparison of both strands. For amino acid sequences, the BLASTP program uses as defaults a wordlength (W) of 3, an expectation (E) of 10, and the BLOSUM62 scoring matrix (see Henikoff & Henikoff, Proc. Natl. Acad. Sci. USA 1989; 89:10915).
[0044] In addition to calculating percent sequence identity, the BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, e.g., Karlin & Altschul, Proc. Nat'l. Acad. Sci. USA 1993; 90:5873-5787). One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance. For example, a nucleic acid is considered similar to a reference sequence if the smallest sum probability in a comparison of the test nucleic acid to the reference nucleic acid is less than about more preferably less than about 0.01, and most preferably less than about 0.001.
[0045] A further indication that two nucleic acid sequences or polypeptides are substantially identical is that the polypeptide encoded by the first nucleic acid is immunologically cross reactive with the polypeptide encoded by the second nucleic acid, as described below. Thus, a polypeptide is typically substantially identical to a second polypeptide, for example, where the two peptides differ only by conservative substitutions. Another indication that two nucleic acid sequences are substantially identical is that the two molecules hybridize to each other under stringent conditions.
[0046] As used herein, the term “polynucleotide,” synonymously referred to as “nucleic acid molecule,” “nucleotides” or “nucleic acids,” refers to any polyribonucleotide or polydeoxyribonucleotide, which can be unmodified RNA or DNA or modified RNA or DNA. “Polynucleotides” include, without limitation single- and double-stranded DNA, DNA that is a mixture of single- and double-stranded regions, single- and double-stranded RNA, and RNA that is mixture of single- and double-stranded regions, hybrid molecules comprising DNA and RNA that can be single-stranded or, more typically, double-stranded or a mixture of single- and double-stranded regions. In addition, “polynucleotide” refers to triple-stranded regions comprising RNA or DNA or both RNA and DNA. The term polynucleotide also includes DNAs or RNAs containing one or more modified bases and DNAs or RNAs with backbones modified for stability or for other reasons. “Modified” bases include, for example, tritylated bases and unusual bases such as inosine. A variety of modifications can be made to DNA and RNA; thus, “polynucleotide” embraces chemically, enzymatically or metabolically modified forms of polynucleotides as typically found in nature, as well as the chemical forms of DNA and RNA characteristic of viruses and cells. “Polynucleotide” also embraces relatively short nucleic acid chains, often referred to as oligonucleotides.
[0047] As used herein, the terms “peptide,” “polypeptide,” or “protein” can refer to a molecule comprised of amino acids and can be recognized as a protein by those of skill in the art. The conventional one-letter or three-letter code for amino acid residues is used herein. The terms “peptide,” “polypeptide,” and “protein” can be used interchangeably herein to refer to polymers of amino acids of any length. The polymer can be linear or branched, it can comprise modified amino acids, and it can be interrupted by non-amino acids. The terms also encompass an amino acid polymer that has been modified naturally or by intervention; for example, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation or modification, such as conjugation with a labeling component. Also included within the definition are, for example, polypeptides containing one or more analogs of an amino acid (including, for example, unnatural amino acids, etc.), as well as other modifications known in the art.
[0048] The peptide sequences described herein are written according to the usual convention whereby the N-terminal region of the peptide is on the left and the C-terminal region is on the right. Although isomeric forms of the amino acids are known, it is the L-form of the amino acid that is represented unless otherwise expressly indicated.
[0049] As used herein, the term “gene” refers to a hereditary unit including a sequence of DNA that occupies a specific location on a chromosome and that contains the genetic instructions for a particular characteristic or trait in an organism.
[0050] As used herein, a plant referred to as “haploid” has a single set (genome) of chromosomes and the reduced number of chromosomes (n) in the haploid plant is equal to that of the gamete.
[0051] As used herein, the term “phenotypic indicator” refers to one or more traits of a plant or a plant cell. The phenotype can be observable to the naked eye, or by any means of evaluation known in the art, e.g., microscopy or biochemical analysis. In certain cases, a phenotype is directly controlled by a single gene or a genetic locus.
[0052] As used herein, the term “plant” can refer to the whole plant, any part thereof, or a cell or tissue culture derived from the plant.
[0053] A plant cell is a cell of a plant, taken from a plant, or derived through culture from a cell taken from the plant. Thus, the term “plant cell” includes, without limitation, cells within seeds, suspension cultures, embryos, meristematic regions, callus tissue, leaves, shoots, gametophytes, sporophytes, pollen, and microspores. The phrase “plant part” refers to a part of a plant, including single cells and cell tissues such as plant cells that are intact in plants, cell clumps, and tissue cultures from which plants can be regenerated. Examples of plant parts include, but are not limited to, single cells and tissues from pollen, ovules, leaves, embryos, roots, root tips, anthers, flowers, fruits, stems, shoots, and seeds.
[0054] The invention consists of a method using specific Haploid Inducer lines to produce Cannabis haploid plants and consequent spontaneous or chemically induced haploids/di-haploids in one generation. Naturally occurring haploid inducer lines can be used to generate completely homozygous di-haploid lines from any heterozygous Cannabis plants. This technology provides a genetic platform to accomplish several breeding goals in one or two generations, that presently require up to 12 generations of selfing or backcrossing. The di-haploids obliviate the need to use multi-generational crosses to produce inbred or homozygous lines. These include but are not limited to the ability to combine or enhance phenotypic traits and establish uniformity and heterosis in true F1 hybrids. This platform can also be used to very rapidly create large numbers of homozygous recombinant (inbreds) lines for QTL (quantitative trait loci) or GWAS (genome wide association study) analyses (Hu et al., “The genetic basis of haploid induction in maize identified with a novel genome-wide association method,” Genetics 202(4):1267-76 (2016)), and other goals of reverse genetics or reverse breeding, such as the identification of parental gamete genomes present in important, useful, and valuable heterozygous lines. The combination of these identified gametes (haploid/di-haploid plants) by crossing may be used for recreation and clonal multiplication of such heterozygous lines. These valuable vegetatively clonally multiplied lines, or their selfed (Si) progeny and only the genome sequences of the parents of these lines obtained by genome sequencing of non-living whole tissue (e.g., purchased at a retail location) can be used to “recreate” the living parental lines for any practical use. The parents can be “brought back to life” for any use of interest. Crossing such “recreated” parents will produce only progeny genetically identical to the heterozygous progeny used as the commercial product being sold at retailers and elsewhere. This technology also may be used for the identification of haplotypes in heterozygous lines, to rapidly fix genetic information once an interesting gene combination is obtained (Srivarsha et al., “Reverse Breeding-A Breakthrough Approach of Modern Plant Breeding,” Int. J. Biotechnol. Biomed. Sci. 4(2):74-78 (2018)).
[0055] It is disclosed herein that pollination of any Cannabis genotype/phenotype named by any nomenclature, used to denote and describe various lineages of the originally named species Cannabis sativa L., with pollen from naturally occurring haploid inducers (“Inducer K, Inducer C”,
[0056] Thus, provided herein are methods of producing a Cannabis haploid/di-haploid plant in a single generation. The methods comprise (a) obtaining pollen comprising a mutation in DMP8; (b) using the pollen to pollinate a Cannabis plant; (c) collecting a seed from the pollenated Cannabis plant; (d) identifying putative haploid Cannabis plants from the seed; and (e) producing a Cannabis haploid/di-haploid plant in a single generation.
[0057] In certain embodiments, the mutation in DMP8 results in a deletion of a single amino acid in the amino terminus of DMP8. In certain embodiments, the mutation in DMP8 is encoded by a nucleic acid sequence comprising at least 80% identity with SEQ ID NO:4 or SEQ ID NO:5. The nucleic acid sequence can, for example, comprise at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identity with SEQ ID NO:4 or SEQ ID NO:5. The nucleic acid sequence can, for example, be 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical with SEQ ID NO:4 or SEQ ID NO:5. In certain embodiments, the mutation in DMP8 is encoded by the nucleic acid sequence of SEQ ID NO: 4 or SEQ ID NO: 5.
[0058] In certain embodiments, the Cannabis plant is selected from the group consisting of Cannabis sativa, Cannabis indica, and Cannabis ruderalis.
[0059] In certain embodiments, the Cannabis haploid/di-haploid plant produced is identified by a phenotypic indicator. The phenotypic indicator can, for example, be selected from the group consisting of dwarfism, ectopic hair/trichome presence on leaves, and a different leaf structure. The different leaf structure can, for example, comprise leaves with three (3) leaflets with seven (7) or eight (8) lobes in the central and lateral leaflets.
[0060] In certain embodiments, the methods further comprise the step of confirming the putative haploid Cannabis plant utilizing genetic techniques. The genetic technique can, for example, be selected from chromosome counting, seed sterility, and single nucleotide polymorphism (SNP) genetic analyses. In certain embodiments, chromosome counting is performed by flow cytometry. In certain embodiments, the SNP genetic analysis is confirmed via DNA sequencing.
[0061] In certain embodiments, the produced Cannabis haploid/di-haploid plant does not comprise the mutation in DMP8, but is capable of inducing haploid plants from elite genetic material.
[0062] In certain embodiments, the methods further comprise (f) obtaining a seed from the produced Cannabis haploid/di-haploid plant. In certain embodiments, the methods further comprise (g) growing a Cannabis haploid/di-haploid plant from the seed.
[0063] Also provided are Cannabis haploid/di-haploid plants produced by the methods as described herein. In certain embodiments, the Cannabis haploid/di-haploid plant comprises cells, tissues, and organs. The organs can, for example, include seeds, leaves, fruits, flowers, stems, and/or roots. In certain embodiments, the Cannabis haploid/di-haploid plant includes propagation materials selected from the group consisting of pollen, ovaries, ovules, germs, endosperms, egg cells, cleavage, roots, root tips, hypotcotyls, cotyledons, stems, leaves, flowers, anthers, seeds, meristematic cells, protoplasts, and tissue cultures.
[0064] Also provided is a Cannabis haploid/di-haploid seed obtained by the methods described herein. The Cannabis haploid/di-haploid seed can, for example, be genetically identical with the pollenated Cannabis plant.
EMBODIMENTS
[0065] The invention provides the following non-limiting embodiments.
[0066] Embodiment 1 is a method of producing a Cannabis haploid/di-haploid plant in a single generation, the method comprising: [0067] (a) obtaining pollen comprising a mutation in DMP8; [0068] (b) using the pollen to pollinate a Cannabis plant; [0069] (c) collecting a seed from the pollenated Cannabis plant [0070] (d) identifying putative haploid Cannabis plants from the seed; and [0071] (e) producing a Cannabis haploid/di-haploid plant in a single generation.
[0072] Embodiment 2 is the method of embodiment 1, wherein the mutation in DMP8 results in a deletion of a single amino acid in the amino terminus of DMP8.
[0073] Embodiment 2a is the method of embodiment 2, wherein the mutation in DMP8 is encoded by a nucleic acid sequence comprising at least 80% identity to SEQ ID NO: 4 or SEQ ID NO: 5.
[0074] Embodiment 3 is the method of embodiment 2 or 2a, wherein the mutation in DMP8 is encoded by the nucleic acid sequence of SEQ ID NO:4 or SEQ ID NO:5.
[0075] Embodiment 4 is the method of any one of embodiments 1-3, wherein the Cannabis plant is selected from the group consisting of Cannabis sativa, Cannabis indica, and Cannabis ruderalis.
[0076] Embodiment 5 is the method of any one of embodiments 1-4, wherein the Cannabis haploid/di-haploid plant produced is identified by a phenotypic indicator.
[0077] Embodiment 6 is the method of embodiment 5, wherein the phenotypic indicator is selected from the group consisting of dwarfism, ectopic hair/trichome presence on leaves, and a different leaf structure.
[0078] Embodiment 7 is the method of embodiment 6, wherein the different leaf structure comprises leaves with 3 leaflets with 7 or 8 lobes in the central and lateral leaflets.
[0079] Embodiment 8 is the method of any one of embodiments 1-7, further comprising the step of confirming the putative haploid Cannabis plant utilizing genetic techniques.
[0080] Embodiment 9 is the method of embodiment 8, wherein the genetic technique is selected from chromosome counting, seed sterility, and single nucleotide polymorphism (SNP) genetic analysis.
[0081] Embodiment 10 is the method of embodiment 9, wherein the chromosome counting is performed by flow cytometry.
[0082] Embodiment 11 is the method of embodiment 9, wherein the SNP genetic analysis is confirmed via DNA sequencing.
[0083] Embodiment 12 is the method of any one of embodiments 1-11, wherein the Cannabis haploid/di-haploid plant does not comprise the mutation in DMP8.
[0084] Embodiment 13 is a Cannabis haploid/di-haploid plant produced by the method of any one of embodiments 1-12.
[0085] Embodiment 14 is the Cannabis haploid/di-haploid plant of embodiment 13, where the Cannabis haploid/di-haploid plant comprises cells, tissues, and organs.
[0086] Embodiment 15 is the Cannabis haploid/di-haploid plant of embodiment 14, wherein the organs include seeds, leaves, fruits, flowers, stems, and/or roots.
[0087] Embodiment 16 is the Cannabis haploid/di-haploid plant of any one of embodiments 13-15, wherein the Cannabis haploid/di-haploid plant includes propagation materials selected from the group consisting of pollen, ovaries, ovules, germs, endosperms, egg cells, cleavage, roots, root tips, hypotcotyls, cotyledons, stems, leaves, flowers, anthers, seeds, meristematic cells, protoplasts, and tissue cultures.
[0088] Embodiment 17 is the method of any one of embodiments 1-12, further comprising: [0089] (f) obtaining a seed from the produced Cannabis haploid/di-haploid plant.
[0090] Embodiment 18 is the method of embodiment 13, further comprising: [0091] (g) growing a Cannabis haploid/di-haploid plant from the seed.
[0092] Embodiment 19 is a Cannabis haploid/di-haploid seed obtained by the method of embodiment 17.
[0093] Embodiment 20 is the Cannabis haploid/di-haploid seed of embodiment 19, wherein the seed is genetically identical with the pollenated Cannabis plant.
EXAMPLES
[0094] The sequence analysis of the DMP8 gene reveals mutation(s) at the 5′ end of the coding sequence (here called “genetic marker”) and identifies a haploid-inducer phenotype. The DMP8-like Coding DNA sequence (CDS) alignment (
Haploidy Confirmation
[0095] Because haploidy is induced in a subset of the individuals obtained after pollination with haploid inducer lines, haploids need to be identified in the progeny through some phenotypic indicators of haploidy (useful for large scale screening) and confirmed through genetic analyses. Indicators of haploidy include dwarfism (
TABLE-US-00001 TABLE 1 From 60 progeny of a male inducer C × female Cannabis plant, 16 putative haploid plants were chosen that displayed at least one of the haploid phenotypes. Eight SNP-containing loci on each of the different chromosomes of these plants were identified from the parents of the haploid induction cross and they were all checked for homozygosity or heterozygosity by deep sequencing. One of these putative haploids was homozygous (PH4) at three SNP loci (SNP 1, 2, 8). All ten diploid control plants were heterozygous at all of the SNP loci checked by sequencing. Inducer K Inducer C PH1 PH2 PH3 PH4 PH5 PH6 PH7 PH8 PH9 PH10 PH11 PH12 PH13 PH14 PH15 PH16 (Diploid) (Diploid) SNP1 He He He Ho He Ho He He Ho He He n.a He He He He Ho He 177 204 178 177 177 201 177 175 177 231 202 201 288 SNP2 Ho He Ho Ho He Ho He Ho Ho He He Ho He He He Ho He He SNP3 Ho SNP4 Ho SNP5 Ho SNP8 Ho SNP9 Ho DMP8 Ho n.a Ho Ho PH: Putative haploid; He: heterozygous, with SNP; Ho: homozygous, without SNP; n.a.: sequencing failed
[0096] Indeed, because haploids only carry one allele of each locus, lack of heterozygosity in polymorphic sequences located on different chromosomes can be used as highly probable evidence of haploidy. In the example reported in Table 1, these putative haploids first identified by plant morphology (PH1-16), presenting at least one of the haploid indicator morphology phenotypes, were selected for determination of allele sequence variation in genome sequence haplotypes known from Cannabis genome data based to be widely present among diverse Cannabis lineages (Welling et al., “An Extreme-Phenotype Genome-Wide Association Study Identifies Candidate Cannabinoid Pathway Genes in Cannabis,” Scientific Reports Vol. 10, Article 18643 (2020)). Selection of the specific SNPs used to confirm haploidy was based on their presence in genetic backgrounds of both the haploid inducer and the female parents used in our experiments to generate haploids. As shown in table 1, (PH4) individuals presented no sequence variants at any of the haplotypes identified, indicating strong evidence for haploidy in these individuals. In fact, the probability of homozygosity by independent assortment of gametes in this cross is 1:250 individual progeny. However, it was found that haploid plants occurred at a frequency of 1:16. This was confirmed by chromosome counting with flow cytometry (
REFERENCES
[0097] 1. Hu, H et al., 2016 The Genetic Basis of Haploid Induction in Maize Identified with a Novel Genome-Wide Association Method. Genetics Society of America, DOI [0098] 2. Jacquier, N et al., 2021. Maize In Planta Haploid Inducer Lines: A Cornerstone for Doubled Haploid Technology. Doubled Haploid Technology, 2288, pp. 25-48. [0099] 3. Jacquier, N et al., 2020. Puzzling Out Plant Reproduction by Haploid Induction for Innovations in Plant Breeding. Nature Plants, Vol 6, June 2020, 610-619 [0100] 4. Jiang, C et al., 2022. ROS Triggers Haploid induction. Molecular Plant, doi.org/10.1016/j.molp.2022.04.001 [0101] 5. Kurtz, L et al, 2020. Production of Tetraploid and Triploid Hemp. Hort Science, Vol. 1703-1707 [0102] 6. Liu C et al., 2020. Extension of the in vivo haploid induction system from diploid maize to hexaploid wheat. Plant biotechnology journal, 18(2), 316-318. doi.org/10.1111/pbi.13218. [0103] 7. McMahon, K, 2017. Double Haploid Induction Speeds Up Plant Breeding Process. Syngenta Thrive, Vol. Summer 2017 [0104] 8. Meng, D et al., 2021. Haploid induction and its application in maize breeding. Mol Breeding 41, 20. doi.org/10.1007/s11032-021-01204-5 [0105] 9. Parsons, J et al., 2019. Polyploidization fix the Genetic Improvement of Cannabis sativa. Frontiers in Plant Science, doi.org/10.3389/fpls.2019.00476 [0106] 10. Srivarsha, J et al., 2018. Reverse Breeding-A Breakthrough Approach of Modern Plant Breeding. International Journal of Biotechnology and Biomedical Sciences Vol 4. issue 2 pp. 74-78 [0107] 11. Wang, Na et al., 2022. In planta haploid induction by genome editing of DMP in the model legume Medicago truncatula. Plant biotechnology journal vol. 20, 1: 22-24. doi:10.1111/pbi.13740. [0108] 12. Welling, M et al., 2020. An Extreme-Phenotype Genome-Wide Association Study Identifies Candidate Cannabinoid Pathway Genes in Cannabis. Scientific Reports Vol 10, Article Number: 18643 [0109] 13. Yao L et al., 2018. OsMATL mutation induces haploid seed formation in indica rice. Nat Plants, 4, 530-533. [0110] 14. Zhang, X et al., 2021. Establishment of an Agrobacterium-Mediated Genetic Transformation and CRISPR/Cas9-Mediated Targeted Mutagenesis in Hemp (Cannabis Sativa L.) Plant Biotechnology Journal (2021), doi.org/10.1111/pbi.13611 [0111] 15. Zhong, Y et al., 2020. A DMP-Triggered In Vivo Maternal Haploid Induction System in the Dicotyledonous Arabidopsis. Nature Plants. 6.466-472. [0112] 16. Zhong Y et al., 2022. In Vivo Maternal Haploid Induction in Tomato. Plant Biotechnol J. 20(2):250-252. doi: 10.1111/pbi.13755.
PATENTS
[0113] CNA 136317115A—“Novel wheat CENH3 allele”. [0114] WO2017087682A1—“Haploid Induction Compositions and Methods for Use Therefor” [0115] WO2020239137—“Parthenogenic Haploid Induction Gene DMP and Application Thereof” [0116] US202100765871—“Method for the Production of Haploid and Subsequent Doubled Haploid Plants” [0117] CN104046694B—“A Kind Ofly to Identify or Whether Assistant Identification Arabidopsis thaliana to be Measured is the Method for Male Sterile Strain
TABLE-US-00002 SEQUENCES DMP8-like CDS Sequence (Reference) SEQ ID NO: 1 ATGGACACACCAGAAGAAGGAATCGGAATCAAAATCTACA ACACAACCCCACAAGACGACATAGAATCATCCTCACTACC TTACCACCCTCCATCCACGGCAGTTCCAGGACAAGGTCGA AAGCGACGCGCCGTCGCAAAGGGCGTGCAAAAGACGCTCT CAAAAACATCAATGCTCGCAAATTTTCTCCCAACGGGAAC TCTTCTGACTTTCGAGATGGTTCTTCCGTCAATCTACGGT AACGGCGAGTGTTCCCCTGTTTCAACCACCATGATGCACG TCTTATTGGGTCTCTGTTCTCTCTCCTGCTTCTTCTTCCA TTTCACCGACAGTTTCCGGGGACCGGACGGGAAGGTGTAT TACGGGTTTGTTACCACTAAGGGTTTGGCTGTGTTTAAGC CTGGATTGGATGTTGAAGTTCCCAAAGATGAGAGGTATAA ATTGGGTGTCACTGATTTTGTTCATGCTCTTATGTCTGTT TTGGTTTTCACGGCGATCGCTTTTTCCGATCACCGGATAA CTGACTGTGTTTTTCCTGGACATGAGAAAGCTATGGATGA AGTTATGGAGAGTTTTCCTTTGATGGTTGGGATTGTTTGT AGTGGCTTGTTTCTTGTTTTTCCAAATACTCGTTATGGTA TTGGATGCATGGCTACTTAA DMP8-like CDS Sequence (Sativa) SEQ ID NO: 2 ATGGACACACCAGAAGAAGGAATCGGAATCAAAATCTACA ACACAACCCCACAAGACGACATAGAATCATCCTCACTACC TTACCACCCTGATCAGCCTCCATCCACGGCAGTTCCAGGA CAAGGTCGAAAGCGACGCGCCGTCGCAAAGGGCGTGCAAA AGACGCTCTCAAAAACATCAATGCTCGCAAATTTTCTCCC AACGGGAACCCTTCTGACTTTCGAGATGGTTCTTCCGTCA ATCTACGGTAACGGCGAGTGTTCCCCTGTTTCAACCACCA TGATGCACGTCTTATTGGGTCTCTGTTCTCTCTCCTGCTT CTTCTTCCATTTCACCGACAGTTTCCGGGGACCGGACGGG AAGGTGTATTACGGGTTTGTTACCACTAAGGGTTTGGCTG TGTTTAAGCCTGGATTGGATGTTGAAGTTCCCAAAGATGA GAGGTATAAATTGGGTGTCACTGATTTTGTTCATGCTCTT ATGTCTGTTTTGGTTTTCACGGCGATCGCTTTTTCCGATC ACCGGATAACTGACTGTGTTTTTCCTGGACATGAGAAAGC TATGGATGAAGTTATGGAGAGTTTTCCTTTGATGGTTGGG ATTGTTTGTAGTGGCTTGTTTCTTGTTTTTCCAAATACTC GTTATGGTATTGGATGCATGGCTACTTAA DMP8-like CDS Sequence (Ruderalis) SEQ ID NO: 3 ATGGACACACCAGAAGAAGGAATCGGAATCAAAATCTACA ACACAACCCCACAAGACGACATAGAATCATCCTCACTACC TTACCACCCTGATCAGCCTCCATCCACGGCGGTTCCGGGA CAAGGTCGAAAGCGACGCGCCGTCGCAAAGGGCGTGCAAA AGACGCTCTCAAAAACATCAATGCTCGCAAATTTTCTCCC AACGGGAACTCTTCTGACTTTCGAGATGGTTCTTCCGTCA ATCTACGGTAACGGCGAGTGTTCCCCTGTTTCAACCACCA TGATGCACGTCTTATTGGGTCTCTGTTCTCTCTCCTGCTT CTTCTTCCATTTCACCGACAGTTTCCGGGGACCGGACGGG AAGGTGTATTATGGGTTTGTTACCACTAAGGGTTTGGCTG TGTTTAAGCCTGGATTGGATGTTGAAGTTCCCAAAGATGA GAGGTATAAATTGGGTGTTACTGATTTTGTTCATGCTCTT ATGTCTGTTTTGGTTTTCACGGCGATCGCTTTTTCCGATC ACCGGATAACTGACTGTGTTTTTCCTGGACATGAGAAAGC TATGGATGAAGTTATGGAGAGTTTTCCTTTGATGGTTGGG ATTGTTTGTAGTGGCTTGTTTCTTGTGTTTCCAAATACTC GTTATGGTATTGGATGCATGGCAACTTAA DMP8-like CDS Sequence (Inducer K) SEQ ID NO: 4 ATGGACACACCAGAAGGAATCGGAATCAAAATCTACGACA CAACCCCACAAGACGACATAGAATCATCCTCACTACCTTA CCACCCTCCATCCACGGCAGTTCCAGGACAAGGTCGAAAG CGACGCGCCGTCGCAAAGGGCGTGCAAAAGACGCTCTCAA AAACATCAATGCTGGCAAATTTTCTCCCAACGGGAACCCT TCTGACTTTCGAGATGGTTCTTCCGTCAATCTACGGTAAC GGCGAGTGTTCCCCTGTTTCAACCACCATGATGCACGTCT TATTGGGTCTCTGTTCTCTCTCCTGCTTCTTCTTCCATTT CACCGACAGTTTCCGGGGACCGGACGGGAAGGTGTATTAC GGGTTTGTTACCACTAAGGGTTTGGCTGTGTTTAAGCCTG GATTGGATGTTGAAGTTCCCAAAGATGAGAGGTATAAATT GGGTGTTACTGATTTTGTTCATGCTCTTATGTCTGTTTTG GTTTTCACGGCGATCGCTTTTTCCGATCACCGGATAACTG ACTGTGTTTTTCCTGGACATGAGAAAGCTATGGATGAAGT TATGGAGAGTTTTCCTTTGATGGTTGGGATTGTTTGTAGT GGCTTGTTTCTTGTGTTTCCAAATACTCGTTATGGTATTG GATGCATGGCTACTTAA DMP8-like CDS Sequence (Inducer C) SEQ ID NO: 5 ATGGACACACCAGAAGGAATCGGAATCAAAATCTACGACA CAACCCCACAAGACGACATAGAATCATCCTCACTACCTTA CCACCCTGATCAGCCTCCATCCACGGCAGTTCCGGGACAA GGTCGAAAGCGACGCGCCGTCGCAAAGGGCGTGCAAAAGA CGCTCTCAAAAACATCAATGCTCGCAAATTTTCTCCCAAC GGGAACCCTTCTGACTTTCGAGATGGTTCTTCCGTCAATC TACGGTAACGGCGAGTGTTCCCCTGTTTCAACCACCATGA TGCACGTCTTATTGGGTCTCTGTTCTCTCTCCTGCTTCTT CTTCCATTTCACCGACAGTTTCCGGGGACCGGACGGGAAG GTGTATTATGGGTTTGTTACCACTAAGGGTTTGGCTGTGT TTAAGCCTGGATTGGATGTTGAAGTTCCCAAAGATGAGAG GTATAAATTGGGTGTTACTGATTTTGTTCATGCTCTTATG TCTGTTTTGGTTTTCACGGCGATCGCTTTTTCCGATCACC GGATAACTGACTGTGTTTTTCCTGGACATGAGAAAGCTAT GGATGAAGTTATGGAGAGTTTTCCTTTGATGGTTGGGATT GTTTGTAGTGGCTTGTTTCTTGTGTTTCCAAATACTCGTT ATGGTATTGGATGCATGGCTACTTAA