CROSSLINKED POROUS PROTEIN CRYSTALS WITH GUEST BARCODE DNA
20230399637 · 2023-12-14
Inventors
- Christopher D. Snow (Fort Collins, CO)
- Julius D. STUART (Eaton, CO, US)
- Rebekah C. KADING (Fort Collins, CO, US)
- Lyndsey I. GRAY (Fort Collins, CO, US)
- Daniel A. HARTMAN (Ithaca, NY, US)
Cpc classification
C12N15/1068
CHEMISTRY; METALLURGY
International classification
Abstract
The present disclosure relates to data storage systems and methods of making thereof. Aspects of the disclosure further relate to engineered porous protein crystals that bind and adsorb guest information storage mediums such as DNA.
Claims
1.-19. (canceled)
20. A tracking system for organisms, the tracking system comprising a synthetic library encoded with unique barcode DNA sequences, and a crosslinked porous protein crystal, wherein the synthetic library is stored in the crosslinked porous protein crystal.
21. The tracking system according to claim 20, wherein the synthetic library comprises a synthetic next-generation sequencing (NGS) library.
22. The tracking system according to claim 20, wherein the synthetic library comprises at least one modular barcode library.
23. The tracking system according to claim 20, wherein the at least one modular barcode library comprises at least four oligonucleotide blocks, wherein an oligonucleotide block comprises a DNA overhang complementary to an adjacent oligonucleotide block.
24. The tracking system according to claim 20, wherein the at least one modular DNA barcode comprises about 5 base pairs (bp) to about 300 bp.
25. The tracking system according to claim 20, wherein the at least one modular barcode library comprises about 50 to about 500 unique barcode sequences.
26. The tracking system according to claim 20, wherein the organism is an insect.
27. The tracking system according to claim 26, wherein at least one insect is marked with unique barcode DNA after ingestion of the crosslinked porous protein crystal comprising the synthetic library.
28. The tracking system according to claim 27, wherein the crosslinked porous protein crystal comprising the synthetic library is ingested by the at least one insect when the insect is a larva, pupa, adult, or any combination thereof.
29. The tracking system according to claim 20, wherein the synthetic library is recovered from the crosslinked porous protein crystal with less than 10% degradation.
30. The tracking system according to claim 20, wherein the synthetic library recovered from the crosslinked porous protein crystal is subjected to PCR, qPCR, ddPCR, rtPCR, next-generation sequencing, or any combination thereof to determine the unique barcode DNA for the organism.
31. The tracking system according to claim 20, wherein the synthetic library comprises about 10 million to about 200 million reads of the unique barcode DNA.
32. A method of marking an organism, said method comprising the steps of: providing a tracking system comprising i) a synthetic library encoded with unique barcode DNA sequences and ii) a crosslinked porous protein crystal for ingestion by the organism, wherein the synthetic library is stored in the crosslinked porous protein crystal, and marking the organism with at least one unique barcode DNA via ingestion of the crosslinked porous protein crystal by the organism.
33. The method of claim 32, wherein the synthetic library comprises at least one modular barcode library.
34. The method of claim 32, wherein the organism is an insect.
35. The method of claim 34, wherein the insect is a larva, pupa, adult, or any combination thereof.
36. The method of claim 34, wherein the insect is a mosquito.
37. The method of claim 32 further comprising a step of recovering at least one unique barcode DNA from the organism.
38. The method of claim 37, wherein the unique barcode DNA is subjected to PCR, qPCR, ddPCR, rtPCR, next-generation sequencing, or any combination thereof.
39. The method of claim 37, wherein the unique barcode DNA comprises about 5 base pairs (bp) to about 300 bp.
Description
BRIEF DESCRIPTION OF THE FIGURES
[0026] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
[0027] The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present disclosure, which can be better understood by reference to the drawing in combination with the detailed description of specific embodiments presented herein.
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
DETAILED DESCRIPTION OF THE INVENTION
[0052] The present disclosure may be understood by reference to the following detailed description, taken in conjunction with the drawings as described above.
[0053] The growing demand for data storage has driven the need for research into alternative materials for information storage mediums. Several inherent properties of DNA contribute to it serving as an information storage medium including, but not limited to, high encoded information density, stability and virtually guaranteed access to the requisite machinery for writing and reading DNA. However, DNA by itself is sensitive to degradation by agents such as nucleases ubiquitous in the environment. If protected within tough protected carrier particles that were ultimately biodegradable, DNA could become the barcode material of choice.
[0054] The present disclosure is based in part on the discovery that highly porous, cross-linked protein crystals can be used for storing and protecting barcode DNA. Disclosed herein are data showing that using protein crystals as part of a data storage system protected barcode DNA from degradation. Data storage systems of the present disclosure comprise a modular DNA library encompassing interchangeable ‘blocks’ with multiple variants for increasing the number of barcode sequences possible from a handful (e.g., at least about 4 to at least about 30) of oligonucleotides. DNA barcode-loaded protein crystals disclosed herein may possess an elevated resistance against degradation, allowing for use in marking organisms (e.g., insects). Accordingly, the present disclosure provides data storage systems and methods of making thereof, as well as DNA barcode-loaded protein crystals and methods of making thereof.
I. Definitions
[0055] As used herein, the terms “about” and “approximately” designate that a value is within a statistically meaningful range. Such a range can be typically within 20%, more typically still within 10%, and even more typically within 5% of a given value or range. The allowable variation encompassed by the terms “about” and “approximately” depends on the particular system under study and can be readily appreciated by one of ordinary skill in the art.
[0056] When introducing elements of the present disclosure or the preferred embodiments(s) thereof, the articles “a,” “an,” “the,” and “said” are intended to mean that there are one or more of the elements. The terms “comprising,” “including,” and “having” are intended to be inclusive and mean that there may be additional elements other than the listed elements.
[0057] The term “conjugate,” as used herein refers to guest molecules that are entrapped, non-covalently bound, or covalently bound to a porous protein crystal.
[0058] “Nucleic acid sequence”, as used herein, refers to a polymer of nucleotides in which the 3′ position of one nucleotide sugar is linked to the 5′ position of the next by a phosphodiester bridge. In a linear nucleic acid strand, one end typically has a free 5′ phosphate group, the other a free 3′ hydroxyl group. Nucleic acid sequences may be used herein to refer to oligonucleotides, or polynucleotides, and fragments or portions thereof, and to DNA or RNA of genomic or synthetic origin that may be single- or double-stranded and represent the sense or antisense strand. A nucleic acid sequence can refer to a succession of bases signified by a series of a set of five different letters corresponding to a DNA (using GACT) or an RNA (GACU) molecule.
II. Data Storage Systems
[0059] A data storage system refers to any medium capable of recording and/or preserving digital information for ongoing or future operations. For example, a digital data storage system can encode text, photos, or any other kind of information as a series of 0s and 1s. In some embodiments, a data storage system herein may be a biological data storage system. In some embodiments, a data storage system herein may be a biological data storage system wherein the medium may be a synthetic nucleotide sequence. In some embodiments, a data storage system herein may be a biological data storage system wherein the medium may be DNA. Without being bound by theory, a biological data storage system of the present disclosure may record text, photos, or any other kind of information in a DNA medium wherein the information encoded in the DNA uses the four nucleotides that make up the genetic code: A, T, G, and C. For example, G and C could be used to represent 0 while A and T represent 1.
[0060] In some embodiments, a data storage system herein may comprise an information storage medium in a protective material. In some embodiments, a data storage system herein may comprise an information storage medium in an engineered host porous protein crystal. In some embodiments, a data storage system herein may comprise a biological medium in an engineered host porous protein crystal. In some embodiments, a data storage system herein may comprise a synthetic nucleotide sequence as a medium in an engineered host porous protein crystal. In some embodiments, a data storage system herein may comprise DNA as a medium in an engineered host porous protein crystal.
[0061] In some embodiments, a data storage system herein may comprise a synthetic nucleotide sequence as a medium in an engineered host porous protein crystal wherein the synthetic nucleotide sequence can be extracted from the engineered host porous protein crystal. In some embodiments, a data storage system herein may comprise DNA as a medium in an engineered host porous protein crystal wherein the DNA can be extracted from the engineered host porous protein crystal.
[0062] In some embodiments, a data storage system herein may comprise an engineered host porous protein crystal and at least one guest molecule, wherein the at least one guest molecule comprises at least one guest information storage medium and is adsorbed within the engineered host porous protein crystal. In some embodiments, a data storage system herein may comprise an engineered host porous protein crystal and at least one guest synthetic nucleotide sequence, wherein the at least one guest synthetic nucleotide sequence can serve as an information storage medium and can be adsorbed within the engineered host porous protein crystal. In some embodiments, a data storage system herein may comprise an engineered host porous protein crystal and at least one guest DNA, wherein the at least one guest DNA can serve as an information storage medium and can be adsorbed within the engineered host porous protein crystal.
III. Engineered Host Porous Protein Crystal
[0063] In some embodiments, the present disclosure provides data storage system comprising at least an engineered host porous protein crystal. The terms “engineered host porous protein crystal” and “porous protein crystals” are used interchangeably throughout the present disclosure. In accordance with some embodiments herein, the present disclosure provides porous protein crystals. Some embodiments of the present disclosure provide a 3-dimensional porous protein crystal. In accordance with these embodiments, a porous protein crystal herein may comprise at least one protein monomer that assembles to form multiple unit cells, with each unit cell capable of hosting at least one guest molecule.
(a) Protein Identity
[0064] In certain embodiments, a porous protein crystal comprises a protein. Proteins that are able to crystalize into a protein scaffold with an appropriate pore size are known by those of skill in the art. A person skilled in the art would be able to inspect the known crystal packing arrangement for proteins deposited in the Research Collaboratory for Structural Bioinformatics Protein Data Bank (RCSB PDB) (See, e.g., Berman et al. Nucleic Acids Research, 2000; 28(1):235-242, herein incorporated by reference in its entirety). A person skilled in the art could then select a protein crystal known to crystallize into a protein scaffold with an appropriate pore size.
[0065] In some embodiments, the protein may be the NHR2 domain of the fusion protein AML1-ETO from Homo sapiens, chloramphenicol phosphotransferase from Streptomyces venezuelae, gastric lipase from Homo sapiens, a Bro1 domain containing protein Brox from Homo sapiens, a putative cell adhesion protein (BACOVA_04980) from Bacteroides ovatus, glycoprotein 1 b from Homo sapiens, an arginine decarboxylase SpeA from Campylobacter jejuni, a cystathionine beta-synthase from Homo sapiens, a (+)-bornyl diphosphate synthase from Salvia officinalis, a measles virus hemagglutinin bound to its cellular receptor SLAM (form 1) from Saguinus oedipus, an invertase 2 from Saccharomyces cerevisiae, a putative periplasmic YCEI-like protein from Campylobacter jejuni, an atrial natriuretic peptide clearance receptor from Homo sapiens, a catalytic domain of transaminase PigE from Serratia sp. fs14, a putative glycosidase from Thermotoga maritima, a sorting nexin 10 from Homo sapiens, photosystem I from Synechococcus elongatus, lysostaphin from Staphylococcus simulans, Pyk2 (proline-rich tyrosine kinase 2) in complex with paxillin from Gallus gallus, an Insulin degrading enzyme from Homo sapiens, an artocarpin from Artocarpus integer, a neuropilin-1 extracellular domains from Mus musculus, a tryptophanyl-tRNA synthetase from Saccharomyces cerevisiae, DNA topoisomerase II from Escherichia coli, a V delta 1 T Cell Receptor in complex with antigen-presenting glycoprotein CD1d from Homo sapiens, a Mus musculus antibody-bound Homo sapiens Prolactin receptor, a fructose 1-6-bisphosphate aldolase from Homo sapiens, a core fragment from unphosphorylated STAT3 (signal transducer and activator of transcription 3) from Mus musculus, a fusion glycoprotein FO from Human metapneumovirus and neutralizing antibody DS7 from Homo sapiens, a growth-arrest-specific protein 6 precursor and tyrosine-protein kinase receptor UFO from Homo sapiens, a Sas-6 cartwheel hub from Leishmania major, a neuraminidase from Influenza a virus, a molybdopterin-guanine dinucleotide biosynthesis protein B from Escherichia coli, an apical membrane antigen AMA1 and putative Rhoptry neck protein 2 from Eimeria tenella, a complex between NADPH-cytochrome P450 reductase and heme oxygenase 1 from Rattus norvegicus, a proprotein convertase subtilisin/kexin type 9 in complex with low-density lipoprotein receptor from Homo sapiens, a major tropism determinant P1 in complex with pertactin extracellular domain from Bordetella bronchiseptica and Bordetella virus bpp1.
[0066] In some embodiments, the protein may be a constituent of the following Protein Data Bank entries: 3FOQ, 4JOL, 409X, 1QHN, 1R5U, 1S49, 3S4Z, 3AL8, 2BDM, 3C3E, 3EN1, 1 IVI, 1 MHP, 3RIP, 1 EA0, 4FHM, 3GB8, 1HLG, 4O5I, 3R9M, 3ZXU, 3ABS, 1S4F, 3UF1, 1V3D, 1WCM, 4CNI, 3Q17, 3RZI, 2BE5, 1GWB, 4MNA, 3NZP, 1OGP, 3FCU, 3K7A, 4L3V, 1N21, 4U7P, 3ALZ, 1RLR, 4EQV, 2FGS, 1JDN, 4MQ9, 4 PPM, 3QZ2, 3WOD, 2AAM, 4AY5, 4IWO, 3K1F, 4PZG, 3PCQ, 2QUK, 3RJ1, 3W3A, 3ALW, 4AY6, 4LXC, 405J, 4R32, 2WBY, 1ZBU, 3A5C, 4J23, 4AVT, 1TYE, 1VBP, 4GZ9, 4WJW, 4C8Q, 2YHB, 3DQQ, 3KT8, 1 D6M, 4MNG, 2TMA, 4I18, 1QO5, 3CWG, 4DAG, 3D38, 2C5D, 4CKP, 3CL2, 1P9N, 4YIZ, 3WKT, 3P5C, and 2IOU.
[0067] In some embodiments, the protein may be a YCEI protein from Campylobacter jejuni, a pyridine nucleotide-disulfide family oxidoreductase from Enterococcus faecalis, a major tropism determinant P1 in complex with pertactin extracellular domain from Bordetella bronchiseptica and Bordetella virus bpp1, a putative cell adhesion protein (BACOVA_04980) from Bacteroides ovatus, Pyk2 (proline-rich tyrosine kinase 2) in complex with paxillin from Gallus gallus, and the NHR2 domain of the fusion protein AML1-ETO from Homo sapiens.
(b) Protein Crystallization
[0068] In certain embodiments, the protein is crystallized to form a porous protein crystal. The porous protein crystal comprises multiple unit cells.
[0069] In general, the protein may be crystallized using standard techniques in the field. Further, the method can and will vary depending on the identity of the protein. Suitable methods include, without limit, vapor diffusion, sitting drop, hanging drop, counter-diffusion, batch, microbatch, microdialysis, free-interface diffusion, and seeding (See, e.g., Weber, Methods Enzymology, 1997; 276:13-22, herein incorporated by reference in its entirety).
[0070] Briefly, protein crystallization is influenced by purities and concentrations of the protein, the types and concentrations of protein crystallization agents, pH conditions, temperature conditions, etc. Therefore, protein crystallization conditions are determined according to a combination of these parameters. Specifically, screening of protein crystallization conditions refers to selecting, from the multiple combinations of the parameters above, the combination of parameters suitable for crystallization of a target protein. Protein crystallization conditions are reported for structures present in the PDB. Thus, a person skilled in the art would be able to recapitulate known protein crystal forms by conducting crystallization experiments that emulate the published conditions.
(c) Protein Crystal Pore Diameter
[0071] In certain embodiments, the porous protein crystal comprises a plurality of pores or solvent channels. These pores or solvent channels allow for entry of the guest molecule into the porous protein crystal. Once the guest molecule has entered the porous protein crystal it may then bind to at least one binding site within the pore of the porous protein crystal. The pores should be an appropriate size to allow entry of the guest molecule.
[0072] In some embodiments, the porous protein crystal may have a pore diameter of from about 3 nm to about 50 nm. In some embodiments, the pore diameter may be about 3 nm, about 4 nm, about 5 nm, about 6 nm, about 7 nm, about 8 nm, about 9 nm, about 10 nm, about 15 nm, about 20 nm, about 25 nm, about 30 nm, about 35 nm, about 40 nm, about 45 nm, or about 50 nm. In additional embodiments, the pore diameter may be equal to or greater than about 4 nm, equal to or greater than about 5 nm, equal to or greater than about 6 nm, equal to or greater than about 7 nm, equal to or greater than about 8 nm, equal to or greater than about 9 nm, equal to or greater than about 10 nm, equal to or greater than about 11 nm, equal to or greater than about 12 nm, equal to or greater than 13 nm, equal to or greater than about 14 nm, equal to or greater than about 15 nm, equal to or greater than about 16 nm, equal to or greater than about 17 nm, equal to or greater than about 18 nm, equal to or greater than about 19 nm, equal to or greater than about 20 nm, equal to or greater than about 21 nm, equal to or greater than about 22 nm, equal to or greater than about 23 nm, equal to or greater than about 24 nm, equal to or greater than about 25 nm, equal to or greater than about 26 nm, equal to or greater than about 27 nm, equal to or greater than about 28 nm, equal to or greater than about 29 nm, or equal to or greater than about 30 nm.
[0073] In some embodiments, the plurality of pores may have an average diameter of from about 3 nm to about 50 nm. In some embodiments, the plurality of pores may have an average diameter of about 3 nm, about 4 nm, about 5 nm, about 6 nm, about 7 nm, about 8 nm, about 9 nm, about 10 nm, about 15 nm, about 20 nm, about 25 nm, about 30 nm, about 35 nm, about 40 nm, about 45 nm, or about 50 nm. In additional embodiments, the plurality of pores may have an average diameter equal to or greater than about 4 nm, equal to or greater than about 5 nm, equal to or greater than about 6 nm, equal to or greater than about 7 nm, equal to or greater than about 8 nm, equal to or greater than about 9 nm, equal to or greater than about 10 nm, equal to or greater than about 11 nm, equal to or greater than about 12 nm, equal to or greater than 13 nm, equal to or greater than about 14 nm, equal to or greater than about 15 nm, equal to or greater than about 16 nm, equal to or greater than about 17 nm, equal to or greater than about 18 nm, equal to or greater than about 19 nm, equal to or greater than about 20 nm, equal to or greater than about 21 nm, equal to or greater than about 22 nm, equal to or greater than about 23 nm, equal to or greater than about 24 nm, equal to or greater than about 25 nm, equal to or greater than about 26 nm, equal to or greater than about 27 nm, equal to or greater than about 28 nm, equal to or greater than about 29 nm, or equal to or greater than about 30 nm.
(d) Protein Binding Site
[0074] In certain embodiments, the porous protein crystal comprises at least one binding site within a pore to allow at least one guest molecule to bind. In certain embodiments, the porous protein crystal comprises at least one binding site within a pore to allow at least one guest molecule to bind and be adsorbed within an engineered host porous protein crystal disclosed herein. In an embodiment, the at least one binding site may be an amino acid, a chemically modified amino acid, a proximal collection of amino acids, a peptide sequence, or combinations thereof.
[0075] In some embodiments, the protein binding site may be designed so the binding between it and the guest molecule is reversible. In other words, the guest molecule may be released from the binding site. Release from the binding site may result when the porous protein crystal guest molecule conjugate is exposed to a specific condition (e.g., solvent, temperature, light, electric field, magnetic field, etc.). By way of a non-limiting example, the guest molecule may be a nanoparticle that may be released from the porous protein crystal by exposure to a solvent, which breaks the specific porous protein/nanoparticle interaction.
[0076] (i) Naturally Occurring Amino Acids
[0077] In some embodiments, the at least one binding site may be an amino acid. In some embodiments, the amino acid may be histidine and cysteine. Other canonical amino acids may be selectively modified by a variety of reagents. Examples of modifying agents are provided in Hermanson, G. T. Bioconjugate Techniques. (Academic Press, 2013), herein incorporated by reference in its entirety. The at least one binding site may be engineered or modified (e.g., substitution mutation) to be at a specific location within the pore to direct the guest molecule to occupy a specific location with the pore.
[0078] (ii) Non-Canonical Amino Acids
[0079] In some embodiments, the at least one binding site may be a non-canonical amino acid. In some embodiments, the non-canonical amino acids would be capable of “click chemistry.” Suitable non-canonical amino acids may comprise, but are not limited to, akynes, azides, or tetrazines.
[0080] (iii) Chemically Modified Amino Acids
[0081] In some embodiments, the at least one binding site may be a chemically modified amino acid. Suitable amino acids for chemical modification may include cysteine, lysine, histidine, tyrosine, serine, arginine, aspartic acid, glutamic acid, and tryptophan. In some embodiments, the amino acid may be modified by a modifying agent.
[0082] Suitable modifying agents may include, without limit, Ellman's reagent (i.e., 5,5′-Disulfanediylbis(2-nitrobenzoic acid)), tetrathionate, selenocystine, hydroxymercuribenzoate (MBO), monobromobimane (mBBr), dibromobimane (dBBr), dibromomaleimide (dBM), N-substituted dibromomaleimides (R-dBM, wherein R may be any functionalization of the dibromomaleimide), p-toluenesulfonyl chloride (TosCl), succinimidyl iodoacetate (SIA), N-succinimidyl S-acetylthioacetate (SATA), (succinimidyl 3-(2-pyridyldithio)propionate (SPDP), N-α-maleimidoacet-oxysuccinimide ester (AMAS), or 1-Ethyl-3-[3-dimethylaminopropyl] carbodiimide hydrochloride (EDC). Additional modifying agents are provided in Hermanson, G. T. Bioconjugate Techniques. (Academic Press, 2013), herein incorporated by reference in its entirety.
[0083] (iv) Peptide Sequence
[0084] In some embodiments, the at least one binding site may be a peptide sequence with known affinity for another biological polymer. In some embodiments, the peptide sequence may comprise one portion of a split protein, one member of an oligomeric complex, a sequence with binding affinity for DNA, or a sequence with a binding affinity for a nanoparticle.
[0085] In some embodiments, the at least one binding site may be a metal-affinity peptide sequence. In an exemplary embodiment, the metal-affinity peptide sequence may be a histidine tag. In an additional exemplary embodiment, the histidine tag may be a C-terminal histidine tag or an N-terminal histidine tag. In some embodiments, the histidine tag may comprise from 2 histidine residues to about 10 histidine residues. In an exemplary embodiment, the histidine tag may comprise 6 histidine residues.
[0086] In some embodiments, the metal-affinity peptide sequence may bind a metal ion. Suitable metal ions include, without limit, Ni, Cu, Zu, Fe, and Co. In an exemplary embodiment, the metal ion may be Ni. In another exemplary embodiment, the metal ion may be Zn.
[0087] (v) Location of the Binding Site
[0088] In some embodiments, the position of the at least one binding site within the porous protein crystal pore can and will vary depending on the desired location of the at least one guest molecule within the porous protein crystal pore. A person skilled in the art would be able to select the appropriate location of the at least one binding site within the porous protein crystal pore to direct the at least one guest molecule to be at a specific location within the porous protein crystal pore.
(e) Protein Stability
[0089] In some embodiments, the porous protein crystal may be stabilized by forming covalent bonds, non-covalent bonds, or combinations thereof between amino acids present in adjacent monomers. A stabilized porous protein crystal will be more stable than an un-stabilized porous protein crystal if transferred to solution conditions that differ from the crystal growth mother liquor. In some embodiments, a stabilized protein crystal grown in high salt conditions, may persist when transferred to low salt conditions. Some benefits associated with increased stability include, but are not limited to, allowing for a high quality of diffraction, providing macroscopic crystal stability, and rendering the porous protein crystal competent for guest loading and release.
[0090] (i) Covalent Bonds
[0091] In some embodiments, covalent bonds may be formed by reacting amino acids present in adjacent monomers with a crosslinking agent. In some embodiments, covalent bonds may be formed by reacting homogenous or heterogeneous amino acids present in adjacent monomers with a crosslinking agent. In some embodiments, covalent bonds may be formed between two sulfhydryl containing amino acids. In some embodiments, covalent bonds may be formed between two amine containing amino acids. In some embodiments, covalent bonds may be formed between an amine containing amino acid and a sulfhydryl containing amino acid. In some embodiments, covalent bonds may be formed between an amine containing amino acid and a carboxylate containing amino acid.
[0092] Suitable crosslinking agents may include, without limit, aldehydes, bis-NHS esters, bis-imidoesters, bis-maleimides, bis-haloalkyls, or carbodiimide reactive compounds; and combinations thereof.
[0093] Suitable aldehyde crosslinking agents may include, without limit, glutaraldehyde, formaldehyde, glyoxal, and combinations thereof.
[0094] Suitable NHS ester crosslinking agents will include 2 or more NHS ester groups, separated by linkers that may include 1-13 atoms, which may include, without limit, N,N′-Disuccinimidyl carbonate; N,N′-Disuccinimidyl oxalate; sulfodisuccinimidyl tartrate (Sulfo-DST); 3,3′-dithiobis[sulfosuccinimidylpropionate](DTSSP); bis(sulfosuccinimidyl)suberate (BS3); ethylene glycol bis[sulfosuccinimidylsuccinate] (Sulfo-EGS); and combinations thereof.
[0095] Suitable bis-imidoesters crosslinking agents may include, without limit, dithiobispropionimidate (DTBP), dimethyl adipimidate (DMA), and combinations thereof.
[0096] Suitable bis-maleimide crosslinking agents may include, without limit, 1,4-bismaleimidobutane; 1,8-bismaleimido-diethyleneglycol; 1,11-bismaleimido-triethyleneglycol; bismaleimidohexane; bismaleimidoethane; dithiobismaleimidoethane; and combinations thereof.
[0097] Suitable bis-haloalkyl crosslinking agents may include, without limit, dibromobimane; dibromomaleimide; N-substituted dibromomaleimides; dibromoxylene; phosgene; dichloroethane; and combinations thereof.
[0098] Suitable carbodiimide crosslinking agents may include, without limit, 1-Ethyl-3-[3-dimethylaminopropyl] carbodiimide hydrochloride (EDC); N′,N′-dicyclohexyl carbodiimide (DCC); N,N′-diisopropylcarbodiimide (DIC); and combinations thereof.
[0099] In some embodiments, the crosslinking agent may be 1-Ethyl-3-[3-dimethylaminopropyl] carbodiimide hydrochloride (EDC); formaldehyde; formaldehyde and urea; formaldehyde and guanidinium hydrochloride; glyoxal; glyoxal and dimethylamine borane (DMAB); glutaraldehyde; glutaraldehyde and dimethylamine borane complex; 1-Ethyl-3-[3-dimethylaminopropyl] carbodiimide hydrochloride (EDC); 1-Ethyl-3-[3-dimethylaminopropyl] carbodiimide hydrochloride (EDC) and imidazole; 1-Ethyl-3-[3-dimethylaminopropyl] carbodiimide hydrochloride (EDC) and sulfo N-hydroxysulfosuccinimide (sulfo-NHS); 1-Ethyl-3-[3-dimethylaminopropyl] carbodiimide hydrochloride (EDC), sodium malonate, and hydroxysulfosuccinimide (sulfo-NHS).
[0100] In some embodiments, the crosslinking agent may be contacted with the porous protein crystal from about 5 minutes to about 24 hours. In some embodiments, the crosslinking agents may be contacted with the porous protein crystal for about 5 minutes, about 10 minutes, about 20 minutes, about 30 minutes, about 40 minutes, about 50 minutes, about 60 minutes, 1.5 hours, about 2 hours, about 2.5 hours, about 3 hours, about 3.5 hours, about 4 hours, about 4.5 hours, or about 5 hours, about 5.5 hours, about 6 hours, about 6.5 hours, about 7 hours, about 7.5 hours, about 8.5 hours, about 9 hours, about 9.5 hours, about 10 hours, about 10.5 hours, about 11 hours, about 12 hours, about 12.5 hours, about 13 hours, about 13.5 hours, about 14 hours, about 14.5 hours, about 15 hours, about 15.5 hours, about 16 hours, about 16.5 hours, about 17 hours, about 17.5 hours, about 18 hours, about 18.5 hours, about 19 hours, about 19.5 hours, about 20 hours, about 20.5 hours, about 21 hours, about 21.5 hours, about 22 hours, about 22.5 hours, about 23 hours, about 23.5 hours, or about 24 hours.
[0101] In some embodiments, the crosslinking agent may be contacted with the porous protein crystal from about 5 minutes to about 24 hours. In some embodiments, the crosslinking agents are contacted with the porous protein crystal about 5 minutes, about 10 minutes, about 20 minutes, about 30 minutes, about 40 minutes, about 50 minutes, about 60 minutes, 1.5 hours, about 2 hours, about 2.5 hours, about 3 hours, about 3.5 hours, about 4 hours, about 4.5 hours, about 5 hours, about 5.5 hours, about 6 hours, about 6.5 hours, about 7 hours, about 7.5 hours, about 8 hours, about 8.5 hours, about 9 hours, about 9.5 hours, about 10 hours, about 11 hours, about 12 hours, about 13 hours, about 14 hours, about 15 hours, about 16 hours, about 17 hours, about 18 hours, about 19 hours, about 20 hours, about 21 hours, about 22 hours, about 23 hours, or about 24 hours.
[0102] In some embodiments, the crosslinking may be reversible. In other embodiments the crosslinking may be irreversible.
[0103] The amount of crosslinking agent may and will depend upon the concentration of the porous protein crystal and the identity of the protein. A person of ordinary skill in the art would be able to select the appropriate amount and concentration of the crosslinking agent to produce a crosslinked porous protein crystal.
[0104] (ii) Non-Covalent Bonds
[0105] In some embodiments, non-covalent bonds may be formed between amino acids present in adjacent monomers. In some embodiments, the non-covalent bonds include electrostatic and hydrophobic interactions.
[0106] In some embodiments, electrostatic interactions may be between charged amino acids. In a further embodiment, electrostatic interactions may be between positively and negatively charged amino acids. Charged amino acids include aspartic acid, glutamic acid, lysine, arginine, and histidine. A person skilled in the art would be able to estimate the charge of the aforementioned amino acids based on the pH of the solvent or buffer.
[0107] In some embodiments, hydrophobic interactions may be between at least two hydrophobic amino acids. Hydrophobic amino acids include alanine, isoleucine, leucine, phenylalanine, valine, proline, and glycine.
IV. Guest Molecule
[0108] In some embodiments, the present disclosure provides data storage system comprising at least one guest molecule. Some embodiments of the present disclosure provide at least one guest molecule that may bind to at least one binding side in the porous protein crystal pore. Some embodiments of the present disclosure provide at least one guest molecule that may be adsorbed within the engineered host porous protein crystal.
[0109] In some embodiments, a guest molecule herein may be a guest information storage medium. As used herein, a guest information storage medium may comprise a nanoparticle, a macromolecule, or a combination thereof suitable for the recording of information in the nanoparticle, the macromolecule, or the combination thereof.
[0110] In some embodiments, the at least one guest information storage medium may comprise a nanoparticle. Suitable nanoparticles may include transition metals, noble metals, or lanthanides. In some embodiments, the nanoparticle may have a diameter of about 3 nm to about 40 nm (e.g., about 3 nm, about 4 nm, about 5 nm, about 6 nm, about 7 nm, about 8 nm, about 9 nm, about 10 nm, about 15 nm, about 20 nm, about 25 nm, about 30 nm, about 35 nm, about 40 nm). In some embodiments, the nanoparticle may comprise more than about 25 metal atoms. In some embodiments, the nanoparticle may comprise about 25 metal atoms to about 400 metal atoms (e.g., about 25, about 30, about 35, about 40, about 45, about 50, about 55, about 60, about 65, about 70, about 75, about 80, about 85, about 90, about 95, about 100, about 125, about 150, about 175, about 200, about 225, about 250, about 275, about 300, about 325, about 350, about 375, about 400 metal atoms).
[0111] In some embodiments, the at least one guest information storage medium may comprise a macromolecule. In some embodiments, the at least one guest information storage medium may comprise synthetic and/or biological polymers. In some embodiments, the polymers may be ordered or disordered. In some embodiments, the polymers may be homogeneous or heterogeneous.
[0112] In some embodiments, the at least one guest information storage medium may comprise a biomacromolecule. Suitable biomacromolecules may include, without limit, an oligonucleotide (e.g., DNA or RNA) sequence, a polypeptide, a polysaccharide, or a polyphenol. In some embodiments, the at least one guest information storage medium may comprise at least one guest synthetic nucleic acid sequence. In some embodiments, the at least one guest information storage medium may comprise at least one guest DNA. In some embodiments, the guest DNA may comprise at least one abiotic DNA sequence. As used herein, abiotic DNA refers to synthesized DNA. It is understood herein that abiotic DNA does not include DNA extracted from non-engineered systems. In some embodiments, abiotic DNA herein is chemically synthesized DNA. In some embodiments, abiotic DNA herein is enzymatically synthesized DNA. In some embodiments, the guest DNA may comprise at least one engineered DNA sequence. In some embodiments, the guest DNA may be at least about 1 bp, at least about 4 bp, at least about 8 bp, or at least about 10 bp. In some embodiments, the guest DNA may be about 1 bp to about 300 bp. In some embodiments, the guest DNA may be about 1 bp to about 300 bps, about 2 bp to about 275 bps, about 3 bp to about 250 bps, about 4 bp to about 225 bps, about 5 bp to about 200 bps, about 6 bp to about 175 bps, about 7 bp to about 150 bps, or about 8 bp to about 125 bps.
[0113] In some embodiments, the guest molecule may comprise a synthetic barcode sequence. In some embodiments, the synthetic barcode sequence may be at least about 1 bp, at least about 4 bp, at least about 8 bp, or at least about 10 bp. In some embodiments, a synthetic barcode sequence may be about 1 bp to about 300 bp. In some embodiments, a synthetic barcode sequence may be about 1 bp to about 300 bps, about 2 bp to about 275 bps, about 3 bp to about 250 bps, about 4 bp to about 225 bps, about 5 bp to about 200 bps, about 6 bp to about 175 bps, about 7 bp to about 150 bps, or about 8 bp to about 125 bps.
[0114] In some embodiments, a synthetic barcode sequence comprises at least one oligonucleotide. In some embodiments, at least two oligonucleotides can be used to generate an oligonucleotide block. In accordance with some embodiments, an oligonucleotide block comprises a DNA overhang complementary to an adjacent oligonucleotide block. In some embodiments, at least about two oligonucleotides may be used to generate an oligonucleotide block. In some embodiments, about two oligonucleotides to about 12 oligonucleotides (e.g., about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12) can be used to generate an oligonucleotide block. In some embodiments, about four oligonucleotides can be used to generate an oligonucleotide block. In some embodiments, sequence specificity of each barcode may be achieved by the unique nucleotide sequence within each oligonucleotide block.
[0115] In some embodiments, a synthetic barcode sequence may further comprise at least one probe for detection. Non-limiting examples of detectable probes suitable for use herein can include a fluorophore (e.g., Texas red, Alexa 488), fluorescein, FAM, or any combination thereof.
[0116] In some embodiments, the guest molecule may comprise at least one modular barcode library. In accordance with these embodiments, a modular barcode library comprises at least one oligonucleotide block. In some embodiments, a modular barcode library may comprise at least about one, at least about two, or at least about four oligonucleotide blocks. In some embodiments, a modular barcode library may comprise about one oligonucleotide block to about 1000 oligonucleotide blocks, about one oligonucleotide block to about 500 oligonucleotide blocks, about one oligonucleotide block to about 100 oligonucleotide blocks, or about one oligonucleotide block to about 10 oligonucleotide blocks. In some embodiments, a modular barcode library may comprise about one oligonucleotide block, about two oligonucleotide blocks, about three oligonucleotide blocks, about four oligonucleotide blocks, about five oligonucleotide blocks, about six oligonucleotide blocks, about seven oligonucleotide blocks, about eight oligonucleotide blocks, about nine oligonucleotide blocks, or about ten oligonucleotide blocks.
[0117] In some embodiments, a modular barcode library may comprise an oligonucleotide block having a DNA overhang complementary to an adjacent oligonucleotide block. In some embodiments, oligonucleotide blocks comprising a modular barcode library herein may be arranged in tandem based on the presence of a DNA overhang complementary to an adjacent oligonucleotide block. In some embodiments, a modular barcode library may be formed by mixing two or more oligonucleotide blocks. In some embodiments, a modular barcode library may be formed by mixing equimolar amounts of oligonucleotide blocks. In some embodiments, a modular barcode library may be formed by mixing four oligonucleotide blocks. In some embodiments, a modular barcode library may be formed by subjecting the mixture of oligonucleotide blocks to heating, annealing, and/or ligation. One of skill in the art can appreciate that the parameters (e.g., duration, temperature, etc) of heating, annealing, and/or ligation depends on the nature and quantity of the oligonucleotide blocks used herein and can require optimization.
[0118] In some embodiments, a modular barcode library herein may comprise at least about 1 bp, at least about 2 bp, at least about 4 bp, or at least about 8 bp. In some embodiments, a modular barcode library herein may comprise about 1 bp to about 500 bp, about 2 bp to about 400 bp, or about 5 bp to about 300 bp. In some embodiments, a modular barcode library herein may comprise about 1 bp to about 300 bps, about 2 bp to about 275 bps, about 3 bp to about 250 bps, about 4 bp to about 225 bps, about 5 bp to about 200 bps, about 6 bp to about 175 bps, about 7 bp to about 150 bps, or about 8 bp to about 125 bps.
[0119] In some embodiments, a modular barcode library herein may comprise at least about 10 unique barcode sequences, at least about 25 unique barcode sequences, or at least about 50 unique barcode sequences. In some embodiments, a modular barcode library herein may comprise about 1 to about 5000 unique barcode sequences, about 15 to about 4000 unique barcode sequences, about 10 to about 3000 unique barcode sequences, about 20 to about 2000 unique barcode sequences, about 30 to about 2000 unique barcode sequences, about 40 to about 1000 unique barcode sequences, or about 50 to about 500 unique barcode sequences.
[0120] In some embodiments, a guest molecule herein can be recovered from the engineered host porous protein crystal. In some embodiments, a guest DNA herein can be recovered from the engineered host porous protein crystal after incubating the crystal in a mixture comprising dNTPs, ATP, or a combination thereof. In some embodiments, the incubation period may be about 1 minute, about 5 minutes, about 10 minutes, about 20 minutes, about 30 minutes, about 40 minutes, about 50 minutes, about 1 hour, about 1.5 hours, about 2 hours, about 2.5 hours, about 3 hours, about 3.5 hours, about 4 hours, about 4.5 hours, about 5 hours, about 5.5 hours, about 6 hours, about 6.5 hours, about 7 hours, about 7.5 hours, about 8.5 hours, about 9 hours, about 9.5 hours, about 10 hours, about 10.5 hours, about 11 hours, about 12 hours, about 12.5 hours, about 13 hours, about 13.5 hours, about 14 hours, about 14.5 hours, about 15 hours, about 15.5 hours, about 16 hours, about 16.5 hours, about 17 hours, about 17.5 hours, about 18 hours, about 18.5 hours, about 19 hours, about 19.5 hours, about 20 hours, about 20.5 hours, about 21 hours, about 21.5 hours, about 22 hours, about 22.5 hours, about 23 hours, about 23.5 hours, about 24 hours, about 24.5 hours, about 25 hours, about 25.5 hours, about 26 hours, about 26.5 hours, about 27 hours, about 28.5 hours, about 29 hours, about 29.5 hours, about 30 hours, about 30.5 hours, about 31 hours, about 31.5 hours, about 32 hours, about 32.5 hours, about 33 hours, about 33.5 hours, about 34 hours, about 34.5 hours, about 35 hours, about 35.5 hours, about 36 hours, about 36.5 hours, about 37 hours, about 37.5 hours, about 38 hours, about 38.5 hours, about 39 hours, about 39.5 hours, about 40 hours, about 40.5 hours, about 41 hours, about 41.5 hour, about 42 hours, about 42.5 hours, about 43 hours, about 43.5 hours, about 44 hours, about 44.5 hours, about 45 hours, about 45.5 hours, about 46 hours, about 46.5 hours, about 47 hours, about 47.5 hours, or about 48 hours. In some embodiments, the amount of guest DNA incubated with a mixture comprising dNTPs, ATP, or a combination thereof may and will depend on the identity of the porous protein crystal and the at least one guest molecule. In some embodiments, the guest DNA herein recovered from the engineered host porous protein crystal comprises at least one synthetic barcode sequence. In some embodiments, the guest DNA herein recovered from the engineered host porous protein crystal may be subjected to any suitable method known in the art to read the least one synthetic barcode sequence encoded in the guest DNA. In some embodiments, the guest DNA herein recovered from the engineered host porous protein crystal may be subjected to PCR, qPCR, ddPCR, rtPCR, next-generation sequencing, or any combination thereof to detect the information encoded in the least one synthetic barcode sequence of the guest DNA. In some embodiments, guest DNA may be recovered from the crosslinked porous protein crystal with less than about 10% degradation, less than about 25% degradation, less than about 50% degradation, or less than about 75% degradation. In some embodiments, guest DNA may be recovered from the crosslinked porous protein crystal with about 1% to about 10% degradation, about 1% to about 25% degradation, about 1% to about 50% degradation, or about 1% to about 75% degradation. In some embodiments, guest DNA may be recovered from the crosslinked porous protein crystal with about 1%, about 2%, about 3%, about 4%, about 5%, about 6%, about 7%, about 8%, about 9%, or about 10% degradation. In some embodiments, guest DNA may be recovered from the crosslinked porous protein crystal without degradation.
[0121] In some embodiments, the at least one guest information storage medium herein may comprise a synthetic library. In accordance with these embodiments, a synthetic library may comprise at least one modular barcode library. In some embodiments, a synthetic library herein may comprise at least about one modular barcode library, at least about 5 modular barcode libraries, at least about 10 modular barcode libraries, at least about 25 modular barcode libraries, at least about 50 modular barcode libraries, at least about 75 modular barcode libraries, at least about 100 modular barcode libraries, at least about 125 modular barcode libraries, at least about 150 modular barcode libraries, at least about 175 modular barcode libraries, at least about 200 modular barcode libraries, at least about 225 modular barcode libraries, at least about 250 modular barcode libraries, at least about 275 modular barcode libraries, or at least about 300 modular barcode libraries. In some embodiments, a synthetic library herein may comprise about one modular barcode library to about 1000 modular barcode libraries, about 10 modular barcode libraries to about 900 modular barcode libraries, about 20 modular barcode libraries to about 800 modular barcode libraries, about 30 modular barcode libraries to about 700 modular barcode libraries, about 40 modular barcode libraries to about 600 modular barcode libraries, or about 50 modular barcode libraries to about 500 modular barcode libraries. In some embodiments, a synthetic library herein may be a synthetic next-generation sequencing (NGS) library. In some embodiments, modular barcode libraries may be modified in manner suitable for formation of a synthetic NGS library. In accordance with these embodiments, modular barcode libraries may be modified to include a Source Tag, a Trap Tag sequence, or a combination thereof.
[0122] In some embodiments, a synthetic library herein may comprise at least 100 reads of unique barcode DNA. In some embodiments, a synthetic library herein may comprise about 100 reads to about 500 million reads, about 500 reads to about 400 million reads, about 1000 reads to about 300 million reads, or about 1 million reads to about 200 million reads of unique barcode DNA. In some embodiments, a synthetic library herein may comprise about 10 million to about 200 million reads (e.g., about 10 million reads, about 15 million reads, about 20 million reads, about 25 million reads, about 30 million reads, about 35 million reads, about 40 million reads, about 45 million reads, about 50 million reads, about 55 million reads, about 60 million reads, about 65 million reads, about 70 million reads, about 75 million reads, about 80 million reads, about 85 million reads, about 90 million reads, about 95 million reads, about 100 million reads, about 110 million reads, about 120 million reads, about 130 million reads, about 140 million reads, about 150 million reads, about 160 million reads, about 170 million reads, about 180 million reads, about 190 million reads, about 200 million reads) of unique barcode DNA.
[0123] In some embodiments, a synthetic library herein may be recovered from the crosslinked porous protein crystal with less than about 10% degradation, less than about 25% degradation, less than about 50% degradation, or less than about 75% degradation. In some embodiments, a synthetic library herein may be recovered from the crosslinked porous protein crystal with about 1% to about 10% degradation, about 1% to about 25% degradation, about 1% to about 50% degradation, or about 1% to about 75% degradation. In some embodiments, a synthetic library herein may be recovered from the crosslinked porous protein crystal with about 1%, about 2%, about 3%, about 4%, about 5%, about 6%, about 7%, about 8%, about 9%, or about 10% degradation. In some embodiments, a synthetic library herein may be recovered from the crosslinked porous protein crystal without degradation.
V. Methods of Making Data Storage Systems
[0124] In certain embodiments, the present disclosure provides methods of making the data storage systems disclosed herein. Some embodiments of the present disclosure encompass methods of making data storage systems herein wherein the methods may comprise preparing a porous protein crystal guest molecule conjugate. The method may comprise: (a) crystallizing a protein in appropriate crystal growth conditions to produce a porous protein crystal; (b) reacting the porous protein crystal with a crosslinking agent to produce a crosslinked porous protein crystal, wherein the crosslinking agent crosslinks adjacent monomers of the porous protein crystal; and (c) incubating the crosslinked porous protein crystal with at least one guest molecule to produce a porous protein crystal guest molecule conjugate.
[0125] In some embodiments, methods of making data storage systems herein may comprise preparing an engineered host porous protein crystal. In some embodiments, methods of making data storage systems herein may comprise crystallizing a protein to produce a porous protein crystal. In some embodiments, the protein may be crystallized according to the methods disclosed herein. In some embodiments, the crystallization protocol may make use of crystal seeds to enhance crystal growth. In some additional embodiments, the crystallization protocol may make use of crystal seeds that are stabilized by crosslinking according to methods disclosed herein.
[0126] In some embodiments, methods of making data storage systems herein may comprise crosslinking a porous protein crystal herein. In accordance with these embodiments, methods herein may comprise reacting the porous protein crystal with a crosslinking agent to produce a crosslinked porous protein crystal. In further embodiments, the crosslinking agent crosslinks adjacent monomers of the porous protein crystal. In some embodiments, the crosslinking agent may be as described herein.
[0127] In some embodiments, the present disclosure provides methods for preparing a porous protein crystal guest molecule conjugate for use in the data storage systems herein. The methods may comprise: obtaining a porous protein crystal, wherein the porous protein crystal has been reacted with a crosslinking agent to produce a crosslinked porous protein crystal and the crosslinking agent crosslinks adjacent monomers of the porous protein crystal; and incubating the crosslinked porous protein crystal with at least one guest molecule to produce a porous protein crystal guest molecule conjugate.
[0128] In some embodiments, methods of making data storage systems herein may comprise forming a porous protein crystal guest molecule conjugate. In accordance with these embodiments, methods herein may comprise incubating a crosslinked porous protein crystal with at least one guest molecule to produce a porous protein crystal guest molecule conjugate. In some embodiments, the at least one guest molecule may be any of those disclosed herein. In some embodiments, at least one guest molecule herein may be incubated with at least one porous protein crystal herein to produce a porous protein crystal guest molecule conjugate from about 1 minutes to about 48 hours. In some embodiments, the incubation period may be about 1 minute, about 5 minutes, about 10 minutes, about 20 minutes, about 30 minutes, about 40 minutes, about 50 minutes, about 1 hour, about 1.5 hours, about 2 hours, about 2.5 hours, about 3 hours, about 3.5 hours, about 4 hours, about 4.5 hours, about 5 hours, about 5.5 hours, about 6 hours, about 6.5 hours, about 7 hours, about 7.5 hours, about 8.5 hours, about 9 hours, about 9.5 hours, about 10 hours, about 10.5 hours, about 11 hours, about 12 hours, about 12.5 hours, about 13 hours, about 13.5 hours, about 14 hours, about 14.5 hours, about 15 hours, about 15.5 hours, about 16 hours, about 16.5 hours, about 17 hours, about 17.5 hours, about 18 hours, about 18.5 hours, about 19 hours, about 19.5 hours, about 20 hours, about 20.5 hours, about 21 hours, about 21.5 hours, about 22 hours, about 22.5 hours, about 23 hours, about 23.5 hours, about 24 hours, about 24.5 hours, about 25 hours, about 25.5 hours, about 26 hours, about 26.5 hours, about 27 hours, about 28.5 hours, about 29 hours, about 29.5 hours, about 30 hours, about 30.5 hours, about 31 hours, about 31.5 hours, about 32 hours, about 32.5 hours, about 33 hours, about 33.5 hours, about 34 hours, about 34.5 hours, about 35 hours, about 35.5 hours, about 36 hours, about 36.5 hours, about 37 hours, about 37.5 hours, about 38 hours, about 38.5 hours, about 39 hours, about 39.5 hours, about 40 hours, about 40.5 hours, about 41 hours, about 41.5 hour, about 42 hours, about 42.5 hours, about 43 hours, about 43.5 hours, about 44 hours, about 44.5 hours, about 45 hours, about 45.5 hours, about 46 hours, about 46.5 hours, about 47 hours, about 47.5 hours, or about 48 hours. In some embodiments, the amount of the at least one guest molecule incubated with the at least one protein scaffold to produce a porous protein crystal guest molecule conjugate may and will depend on the identity of the porous protein crystal and the at least one guest molecule.
[0129] In some embodiments, the present disclosure provides methods for preparing a guest molecule for use in the data storage systems herein. In some embodiments, a guest molecule for use in the methods herein comprises at least one guest information storage medium.
[0130] In some embodiments, a guest molecule for use in the methods herein comprises at least one modular barcode library. In some embodiments, methods of generating modular barcode library may comprise constructing at least about two, at least about four, at least about six, at least about eight, at least about 10 oligonucleotide blocks from a pool of oligonucleotides disclosed herein. In some embodiments, methods of generating modular barcode library may comprise constructing about two to about 10, or about four to about eight oligonucleotide blocks from a pool of oligonucleotides disclosed herein. In some embodiments, methods of generating modular barcode library may comprise constructing about four oligonucleotide blocks from a pool of oligonucleotides disclosed herein. In some embodiments, oligonucleotide blocks are mixed together before subjecting the mixture to heating, followed by annealing, and then ligation. In some embodiments, about two to about 10 oligonucleotide blocks are mixed together before subjecting the mixture to heating, followed by annealing, and then ligation. In some embodiments, about four oligonucleotide blocks are mixed together before subjecting the mixture to heating, followed by annealing, and then ligation. Duration of heating, annealing, and ligation will depend on the oligonucleotide block mixture. Temperatures and temperature ranges at which heating, annealing, and ligation are performed will depend on the oligonucleotide block mixture.
[0131] In some embodiments, methods herein may further comprise reversing the binding of the guest molecule to the porous protein crystal. In some embodiments, guest molecules bound to the porous protein crystal may be released using acidic or basic solutions. In some embodiments, guest molecules bound to the porous protein crystal may be released from the porous protein crystal guest molecule conjugate using reducing conditions. In some embodiments, guest DNA bound to the porous protein crystal may be released by incubating the porous protein crystal guest molecule conjugate in a mixture of dNTPs, ATP, or any combination thereof. In some embodiments, guest DNA released from the porous protein crystal guest molecule conjugate may be recovered using PCR, qPCR, next-generation sequencing, or any combination thereof.
VI. Methods of Use
[0132] In some embodiments, the present disclosure provides methods of use for data storage systems disclosed herein. In some embodiments, data storage systems disclosed herein may be used as a tracking system for at least one organism. For example, the crosslinked porous protein crystal comprising a synthetic library as presently disclosed herein may mark the at least one organism. Non-limiting examples of organisms suitable for the methods herein can include algae, bacteria, plants, insects, fish, amphibians, reptiles, birds, and mammals.
[0133] In some embodiments, data storage systems disclosed herein may be used as a tracking system for insects. In some embodiments, data storage systems disclosed herein may be used as a tracking system for Mosquitoes (family Culicidae); Horse flies and deer flies (family Tabanidae); Stable flies, house flies, and horn flies (family Muscidae); Sand flies (family Psychodidae); Black flies (family Simuliidae); Biting midges (family Ceratopogonidae); Bees, wasps, ants (order Hymenoptera); Butterflies and moths (order Lepidoptera); Beetles (order Coleoptera); Grasshoppers and katydids (order Orthoptera); True bugs (orders Hemiptera and Homoptera); Ticks (families Ixodidae and Argasidae); and the like. In some embodiments, data storage systems disclosed herein may be used as a tracking system for an organism that has been infected by an insect. In some embodiments, data storage systems disclosed herein may be used as a tracking system for an organism that has been bitten by an insect.
[0134] In some embodiments, data storage systems herein may be used as a tracking system wherein the organism ingests a crosslinked porous protein crystal comprising a synthetic library herein. In some embodiments, organisms may be fed a crosslinked porous protein crystal comprising a synthetic library herein ad libitum. In some embodiments, an insect may ingest a crosslinked porous protein crystal comprising a synthetic library herein. In some embodiments, an insect may ingest a crosslinked porous protein crystal comprising a synthetic library herein when the insect can be a larva, pupa, adult, or any combination thereof.
[0135] In some embodiments, data storage systems disclosed herein may be used as a tracking system for an organism that has been infected by an insect wherein the organism may be a mammal. In some embodiments, data storage systems disclosed herein may be used as a tracking system for an organism that has been infected by an insect wherein the organism may be a companion animal, such as but not limited to a cat, a dog, and the like. In some embodiments, data storage systems disclosed herein may be used as a tracking system for an organism that has been infected by an insect wherein the organism may be livestock, such as but not limited to a cow, a horse, a mule, a pig, a camel, a goat, and the like. In some embodiments, data storage systems disclosed herein may be used as a tracking system for an organism that has been infected by an insect wherein the organism may be a human.
VII. Kits
[0136] In some embodiments, the present disclosure also provides kits for binding at least one guest molecule to a porous crystal protein. A kit may comprise, for example, a porous protein crystal that has been stabilized. The porous protein crystal may have a plurality of crystal pores with an average diameter of from about 3 nm to about 50 nm. The kit may further comprise a guest molecule. In other embodiments, the kit may further comprise materials and/or reagents for synthesizing a guest molecule herein. In other embodiments, the kit may further comprise materials and/or reagents for modifying a guest molecule so that it binds to the porous protein crystal. The kit may further comprise additional materials and/or reagents for incubating a guest molecule with the porous crystal protein. The kit may further comprise additional materials and/or reagents for reversing the binding of the guest molecule to the porous protein crystal.
[0137] In some embodiments, kits herein may comprise one or more buffers, oligonucleotides, and the like for use in preparing any of the data systems disclosed herein. In some embodiments, kits herein may comprise one or more materials and/or reagents for preparing barcode sequences as disclosed herein. In some embodiments, kits herein may comprise one or more materials and/or reagents for preparing oligonucleotide blocks as disclosed herein. In some embodiments, kits may comprise one or more materials and/or reagents for preparing synthetic libraries (e.g., NGS libraries) comprising barcode sequences as disclosed herein.
[0138] In accordance with these embodiments, kits may also provide a mixture of dNTPs, ATP, or any combination thereof for release of guest molecule (e.g., guest DNA, synthetic libraries, synthetic NGS libraries) from the porous crystal proteins herein.
[0139] In some embodiments, kits herein may comprise at one or more materials and/or reagents for applying the tracking systems herein to the organism of interest. In some embodiments, kits herein may comprise at one or more materials and/or reagents for using tracking systems herein after applying to the organism of interest.
EXAMPLES
[0140] The following examples are included to demonstrate various embodiments of the present disclosure. It should be appreciated by those of skill in the art that the techniques disclosed in the examples that follow represent techniques discovered by the inventors to function well in the practice of the invention, and thus can be considered to constitute preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.
Example 1. CJ Crystal Production
[0141] In accordance with the present disclosure, Campylobacter jejuni (CJ) protein crystals were prepared. Porous materials, such as zeolites, are essential components within mass transport-mediated industrial processes, including catalysis, separation and adsorption. Possessing a unique, periodic topology, known with atomic resolution, porous protein crystals presented as novel candidate materials for further study of the present disclosure.
[0142] The porous protein crystals used in the exemplary methods herein were composed of a modified, periplasmic isoprenoid-binding protein derived from Campylobacter jejuni (Protein Data Bank ID: 2fgs), referred to as CJ, shown in
[0143] Crystal cross-linking was performed by first transferring crystals to a wash solution (4.2 M trimethylamine N-oxide (TMAO), pH 7.5) for approximately 1 hour to remove excess protein. Then, crystals were transferred to the cross-linking solution containing 40 mg/mL 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride and 50 mM imidazole in 4.2 M TMAO, pH 7.5 in a covered well for 2 hours. Crystals were next transferred to a 50 mM borate buffer, pH 10 quenching solution for 1 hour. Crystals were washed and stored in 4.2 M TMAO, pH 7.5. As shown in
Example 2. DNA Loading of CJ Crystals
[0144] In accordance with the present disclosure, DNA was loaded into the CJ crystals prepared as described herein. Intra-crystal guest loading occurred primarily through the axial pores, allowing for adequate representation using a modified one-dimensional pore model (
[0145] Separately a CJ crystal was placed in 100 μL of 1 ng/μL FAM labeled 125mer (5′-AGGCGACTCGACGGTCTTACGCGTTACGTATGATATGCATCACCACC ATCACCAATAACCAACACCTAAATTTAACATCCGAGAATTATGGAGCACGCTAGCG TACGCTACGGTCCTAACGCGC-3′ SEQ ID NO: 1) in TE, pH 8.0 and sealed overnight in a glass well plate. The crystal was then transferred to 100 μL fresh TE buffer to remove unbound guest for 1 hour. Following washing, the loaded crystal was transferred to 50 μL TE buffer on a glass slide and imaged under 488 nm light as described above to detect guest adsorption (
[0146] The confocal loading dataset for the FAM labeled 8mer single-stranded DNA guest (
[0147] Confocal images of the 125mer loaded crystal (
Example 3. Crystal Adsorbed DNA Recovery
[0148] In accordance with the present disclosure, the crystal adsorbed DNA was recovered with PCR. In brief, A CJ crystal was placed in 100 μL of 1 ng/μL 125mer (SEQ ID NO: 1) in TE, pH 8.0 and sealed in a glass well overnight. Following guest loading, the crystal was washed in 100 μL of TE to remove unbound 125mer in solution. The crystal was then transferred to 100 μL of a 10 mM dNTP mixture and sealed in a glass well overnight to trigger release of crystal-adsorbed 125mer into the surrounding solution. Following dNTP incubation, 1 μL of the solution was used as the template for PCR to test for recovery of crystal-adsorbed guest with the following primers: Forward: 5′-TAGGCGACTCGACGGTCTTACGCGTTACGT-3′(SEQ ID NO: 2); Reverse: 5′-GCGCGTTAGGACCGTAGCGTACGCTAGCGT-3′ (SEQ ID NO: 3). Reaction conditions were: 1 cycle of 95° C. for 3.00 minutes and 40 cycles of 95° C. for 15 seconds followed by 72° C. for 30 seconds. PCR was performed using Q5 High-Fidelity Polymerase (New England Biolabs). Following PCR, the products were examined for the 125mer amplified template using agarose gel electrophoresis.
[0149] Agarose gel electrophoresis was used to assess recovery of previously crystal bound 125mer guest. As shown in the gel image (
Example 4. Validation on ATP Flushed Crystals
[0150] In accordance with the present disclosure, ATP flushed crystals were validated in vitro using qPCR. To prepare crystals for qPCR, 4 CJ crystals (200 μm diameter) were immersed in 18 μL of approximately 30 ng/μL of a 125 base pair double-stranded DNA oligonucleotide (125mer, SEQ ID NO: 1) and sealed in a glass well plate for approximately 12 hours, followed by washing with loading buffer (10 mM HEPES, 50 mM MgCl2, 10% glycerol, pH 8.0) to remove unbound 125mer. Crystals were then immersed in 18 μL of 20 mM ATP and an aliquot of the solution was stored. The 125mer loaded crystal/ATP solution was sealed in a glass well plate for approximately 12 hours. Following the 12-hour incubation, an additional aliquot of the solution was stored to compare solution 125mer concentration pre- and post-ATP incubation via qPCR with primers having the sequences of SEQ ID NOs: 2 and 3.
[0151] To confirm ATP incubation is promoting crystal release of guest DNA, qPCR was performed on samples of the solution DNA pre- and post-ATP incubation. The results (
[0152] In sum, the present disclosure demonstrated a greater characterization of guest DNA adsorption-coupled diffusion within host porous protein crystals. The loading of guest DNA occurred primarily along the axial nanopores and the rate of intra-crystal guest diffusion changed overtime due to transport hindrances created from adsorbed guest molecules. Examples herein showed that a mixture of dNTPs, or ATP, could be used to trigger the release of crystal-adsorbed DNA, allowing for recovery using PCR or qPCR. Given the robust crystal scaffold following cross-linking, applications may include, but are not limited to, employing protein crystals to house and protect DNA laden with information as a novel tracking material (e.g., a DNA barcode library).
Example 5. Constructing a DNA Barcode Library
[0153] The growing demand for data storage is expected to surpass the world's estimated silicone supply with the next few decades. Several inherent properties of DNA contribute to it serving as an information storage medium including high encoded information density, stability and virtually guaranteed access to the requisite machinery for writing and reading DNA.
[0154] The goal of the present disclosure was aimed, not only at encoding arbitrary data in DNA, but to also push the limit of economic DNA barcoding by maximizing the number of DNA barcodes (arbitrary groups of unique DNA sequences) possible for marking objects/organisms while minimizing synthesis and sequencing costs. Herein, the present disclosure demonstrated (1) construction of a modular DNA library comprising interchangeable ‘blocks’ (
[0155]
[0156]
[0157]
Example 6. Marking Organisms with Unique Barcodes
[0158] West Nile Virus (WNV) is a mosquito-borne disease capable of causing severe illness. Increased surveillance into WNV-spreading mosquitoes, such as Culex tarsalis, can inform public health personnel on areas of high mosquito productivity and the dynamics of arbovirus circulation, allowing targeted control interventions.
[0159] Currently, one of the most standard and comprehensive tools entomologists use to measure these parameters in nature is mark-release-recapture (MRR) studies. By marking a subsample of mosquitoes in the environment and monitoring their recapture rates and distances from release site, MRR offers a standard approach to gathering this epidemiologically significant information on mosquito behavior and ecology directly from field populations. Despite their utility, mosquito MRR studies represent a research area that has posed significant challenges to entomologists for decades. For mosquito dispersal studies, topical fluorescent powders and paints, ingestible dyes, or larval habitat marking with rubidium, or stable isotopes, are typically used. Despite being the most popular and cheapest option, fluorescent powders are difficult to use for large numbers of mosquitoes, they have limited surface stability on the mosquito, and they can introduce biases by negatively affecting mosquito behavior and survivorship. Mosquitoes reared from larval habitats enriched in stable isotopes or rubidium can be detected via mass spectrometry or x-ray fluorescence spectrophotometry, respectively. Nevertheless, these methods only provide a handful of distinguishable markers, and detection via mass spectrometry is expensive and training intensive. To overcome these challenges, the present disclosure developed a new class of MRR markers based on synthetic DNA barcodes. Specifically, the present disclosure designed a synthetic next-generation sequencing (NGS) library encoded with information (barcode DNA) as an insect tracking approach. The library was stored and protected throughout tracking experiments within crosslinked porous protein crystals. Under the disclosed strategies, mosquito larvae were marked with unique barcodes upon ingestion of these microcrystals.
[0160] Hexagonal protein crystals composed of an isoprenoid binding protein derived from Campylobacter jejuni were prepared according the methods disclosed herein. The resulting protein crystals comprised of an array of nanopores that were 13 nm in diameter, allowing for inward diffusion and adsorption of DNA barcodes to nanopore walls.
[0161] To evaluate the performance of DNA barcode loaded protein crystals as a novel mosquito tracking material, crystal-loaded barcodes, ˜200 bp, were incubated for 24-hours with mosquito homogenate. To test for library recovery, samples of each solution post-incubation were used as the template for PCR and analyzed via agarose gel electrophoresis. As a field component to mimic realistic environmental conditions, mosquitoes were trapped at designated field sites containing water-filled tubs spiked with barcode loaded crystals. Barcode detection from collected field samples was performed using quantitative PCR (qPCR). Barcode positive field samples were prepared for NGS by 2 rounds of overhang PCR to append illumina adapters. Lastly, the modular barcodes were constructed out of smaller double-stranded ‘blocks’ containing single-stranded overhangs for annealing in the targeted linear order. The modular library was designed using python, scored with the nucleic acid secondary structure prediction program NUPACK (See Zadeh, et al., J Comput Chem, 32:170-173, 2011, the disclosure of which is incorporated herein in its entirety) and validated using NGS.
[0162] Barcode DNA in solution with mosquito homogenate was not recovered using PCR (
[0163] NGS coverage results for a single modular barcode, shown in
[0164] Barcode was amplified from adult male mosquitoes reared on (fed) barcode-laden microcrystals as larvae. qPCR amplification plots showed barcode amplification from mosquito samples between 24-32 cycles (
[0165] In sum, DNA barcode loaded protein crystals possessed an elevated resistance against degradation despite incubation in mosquito homogenate. DNA barcodes from loaded crystals previously ingested by mosquito larvae did not influence survival and were detectable using both qPCR and NGS. The modular barcode design and validation demonstrated that DNA barcodes can be assembled from smaller ‘blocks’ allowing for numerous distinct barcode generation by incorporating ‘block’ variants containing unique internal sequences. Importantly, the utilization of a modular barcode design and NGS platform for analysis permits the simultaneous detection of multiple barcodes from each field-collected mosquito pool, which is not a capability of current technologies.
Example 7. Barcode Recovery and Validation
[0166] In accordance with the present disclosure, mosquito larvae were marked with unique barcodes upon ingestion of these microcrystals as disclosed herein. Mosquitoes that were exposed to CJ crystal loaded with a synthetic barcode sequence were then subjected to homogenization and DNA extraction. Two primers were selected to amplify an 84-nt segment of synthetic barcode in qPCR experiments with these samples. Samples included three mosquitoes that were reared on (fed) barcode-laden microcrystals as larvae and from which barcode was detected in the emerged adult mosquitoes (SR1-3), three pools of wild-caught mosquitoes that colonized a crystal-spiked tub in the field and were later captured as adults in a CDC light trap (FR1-3), and three wild-caught mosquitoes that colonized crystal-spiked tubs placed in the field as larvae and were reared to adults in the laboratory (LR1-3). The positive control was naked barcode. The negative control was PCR master mix with no template added. The qPCR melt curves (
[0167] To further verify that the qPCR signal was coming from authentic barcode, we proceeded to check the size of the PCR amplicon using gel electrophoresis (
[0168] To verify even further that the recovered samples contain authentic barcode sequences, and that the side product that contributes to the qPCR signal arises from the synthetic barcode, next-generation sequencing (NGS) was used. Specifically, the larger band was extracted from the electrophoresis gel, added flanking adaptors for NGS using additional rounds of PCR, and proceeded with NGS.
[0169] As shown in an analysis of 1 million aligned reads (
Example 8. Modular Barcodes Synthesis and Validation
[0170] Modular barcodes were synthesized by mixing, annealing and ligating 8 single-stranded oligonucleotides to form the core barcode (
[0171] Modular Barcodes were subjected to experimental validation. In brief, all 32 oligos corresponding to the 4 variants for each of the 4 blocks were purchased from Integrated DNA Technologies (Coralville, Iowa) with 6 oligos containing a 5′ phosphate. Each oligo was resuspended to a stock concentration of 100 μM in duplex buffer (100 mM Potassium Acetate, 30 mM HEPES, pH 7.5). A 0.02 pmol/μL working solution was made from each stock solution using duplex buffer. From each of the 8 working solutions corresponding to a single modular barcode sequence, 2 μL was transferred to a 0.2 mL PCR tube and mixed. The mixture was then heated to 94° C. for 4 minutes using a heat block, followed by gradual cooling for 1 hr by turning off the heat block. Following annealing, 2 μL T4 DNA Ligase Buffer (NEB) and 1 μL T4 DNA Ligase (NEB) were added to the annealed mixture followed by incubation at room temperature for 10 minutes. The ligation reaction was heat inactivated by 10-minute incubation at 65° C. The inactivate ligation mixture was used as the template for overhang PCR with the following reaction conditions: 1 cycle of 98° C. for 45 seconds, 30 cycles of 98° C. for 30 seconds, 61° C. for 30 seconds, 72° C. for 30 seconds, and 1 cycle of 72° C. for 1 minute. Overhang PCR was used with the following primer sequences: fwd 5′-ACACTCTTTCCCTACACGACGCTCTTCCGATCTCCAGTCCTCAACAAGCTG-3′ (SEQ ID NO: 4); rev 5′-GTTGAAGCCGGTTACCAC-3′ (SEQ ID NO: 5). Three additional rounds of overhang PCR were performed with the following primer sets: #1, fwd: 5′-ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3′ (SEQ ID NO: 6); #1 rev 5′-TTCTGGGTTCCTCATCGCNNNNNNNNGTTGAAGCCGGTTACCAC-3′ (SEQ ID NO: 7); #2, fwd: 5′-ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3′ (SEQ ID NO: 8); #2 rev: 5′-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTTCTGGGTTCCTCATCGC-3′ (SEQ ID NO: 9); #3, fwd: 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGAT CT-3′ (SEQ ID NO: 10); #3 rev: 5′-CAAGCAGAAGACGGCATACGAGATNNNNNNNNNNATATTCACGTGACTGGAGTTC AGACGTGTGCTCTTCCGATCT-3′ (SEQ ID NO: 11). All PCR was performed using the same thermocycling conditions as described above. Following amplification, PCR cleanup was performed using KAPA Pure Beads (Roche). Size selection for the 262 bp barcode library was performed using Monarch DNA Gel Extraction Kit (New England Biolabs). The library was quantified using Qubit lx dsDNA HS Assay Kit (ThermoFisher) and diluted to 20 nM for sequencing sample prep. Paired end 2×150 cycle sequencing was run on an illumina NovaSEQ 6000 (Genomics and Microarray Core, University of Colorado Anschutz Medical Campus). The ea-utils package was used for initial sample processing including adapter trimming and read joining. FastQC was used to check overall quality of joined reads and to determine total read count of detected barcode (Babraham Bioinformatics). Additional scripts written in python were used for subsequent analysis and visualization of barcode recovery in read data.
[0172] Nearly all 256 modular barcode variants (234) were detected simultaneously in the first 1 million aligned reads out of 80 million reads via NGS in relatively similar proportions (