Fatty acid desaturases from primula
11041148 · 2021-06-22
Assignee
Inventors
- Virginia Ursin (Pawcatuck, CT, US)
- Byron Froman (Davis, CA)
- Jennifer Simmons (Woodland, CA, US)
- Thomas J. LaRosa (Fenton, MO, US)
- Fenggao DONG (Chesterfield, MO, US)
- Steven Screen (St. Louis, MO, US)
Cpc classification
C12N15/8247
CHEMISTRY; METALLURGY
C12P7/6427
CHEMISTRY; METALLURGY
International classification
C12P7/64
CHEMISTRY; METALLURGY
Abstract
The invention relates generally to methods and compositions concerning desaturase enzymes that modulate the number and location of double bonds in long chain poly-unsaturated fatty acids (LC-PUFA's). In particular, the invention relates to methods and compositions for improving omega-3 fatty acid profiles in plant products and parts using desaturase enzymes and nucleic acids encoding for such enzymes. In particular embodiments, the desaturase enzymes are Primula Δ6-desaturases. Also provided are improved soybean oil compositions having SDA and a beneficial overall content of omega-3 fatty acids relative to omega-6 fatty acids.
Claims
1. An endogenous soybean seed oil comprising ALA (alpha-linolenic acid), SDA (stearidonic acid), and GLA (gamma-linolenic acid), wherein the ratio of SDA/GLA in said endogenous soybean seed oil is at least about 2.0.
2. The endogenous soybean seed oil of claim 1 wherein said SDA/GLA ratio is at least about 2.5.
3. The endogenous soybean seed oil of claim 2 wherein said SDA/GLA ratio is at least about 3.0.
4. The endogenous soybean seed oil of claim 1 wherein said oil comprises a SDA/ALA ratio that is at least about 0.5.
5. The endogenous soybean seed oil of claim 4 wherein said-ratio of SDA/ALA is at least about 1.0.
6. The endogenous soybean seed oil of claim 5 wherein said ratio of SDA/ALA is at least about 1.5.
7. The endogenous soybean seed oil of claim 5 wherein said ratio of SDA/ALA is less than about 1.8.
8. The endogenous soybean seed oil of claim 1 wherein said endogenous soybean seed oil comprises an SDA content of about 5% to about 50% and a linoleic acid content of less than about 20%.
9. The endogenous soybean seed oil of claim 1 wherein said endogenous soybean seed oil further comprises an excipient.
Description
BRIEF DESCRIPTION OF THE FIGURES
(1) The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present invention. The invention may be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein.
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
DETAILED DESCRIPTION OF THE INVENTION
(15) The invention overcomes the limitations of the prior art by providing methods and compositions for creation of plants with improved PUFA content. The modification of fatty acid content of an organism such as a plant presents many advantages, including improved nutrition and health benefits. Modification of fatty acid content can be used to achieve beneficial levels or profiles of desired PUFA's in plants, plant parts, and plant products, including plant seed oils. For example, when the desired PUFA's are produced in the seed tissue of a plant, the oil may be isolated from the seeds typically resulting in an oil high in desired PUFAs or an oil having a desired fatty acid content or profile, which may in turn be used to provide beneficial characteristics in food stuffs and other products. The invention in particular embodiments provides endogenous soybean oil having SDA while also containing a beneficial oleic acid content.
(16) Various aspects of the invention include methods and compositions for modification of PUFA content of a cell, for example, modification of the PUFA content of a plant cell(s). Compositions related to the invention include novel isolated polynucleotide sequences, polynucleotide constructs and plants and/or plant parts transformed by polynucleotides of the invention. The isolated polynucleotide may encode Primula fatty acid desaturases and, in particular, may encode a Primula Δ6-desaturase. Host cells may be manipulated to express a polynucleotide encoding a desaturase polypeptide(s) which catalyze desaturation of a fatty acid(s).
(17) Some aspects of the invention include desaturase polypeptides and polynucleotides encoding the same. Various embodiments of the invention may use combinations of desaturase polynucleotides and the encoded polypeptides that typically depend upon the host cell, the availability of substrate(s), and the desired end product(s). “Desaturase” refers to a polypeptide that can desaturate or catalyze formation of a double bond between consecutive carbons of one or more fatty acids to produce a mono- or poly-unsaturated fatty acid or a precursor thereof. Of particular interest are polypeptides that can catalyze the conversion of oleic acid to LA, LA to ALA, or ALA to SDA, which includes enzymes which desaturate at the 12, 15, or 6 positions. The term “polypeptide” refers to any chain of amino acids, regardless of length or post-translational modification (e.g., glycosylation or phosphorylation). Considerations for choosing a specific polypeptide having desaturase activity include, but are not limited to, the pH optimum of the polypeptide, whether the polypeptide is a rate limiting enzyme or a component thereof, whether the desaturase used is essential for synthesis of a desired PUFA, and/or whether a co-factor is required by the polypeptide. The expressed polypeptide preferably has characteristics that are compatible with the biochemical environment of its location in the host cell. For example, the polypeptide may have to compete for substrate(s).
(18) Analyses of the K.sub.m and specific activity of a polypeptide in question may be considered in determining the suitability of a given polypeptide for modifying PUFA(s) production, level, or profile in a given host cell. The polypeptide used in a particular situation is one which typically can function under the conditions present in the intended host cell, but otherwise may be any desaturase polypeptide having a desired characteristic or being capable of modifying the relative production, level or profile of a desired PUFA(s) or any other desired characteristics as discussed herein. The substrate(s) for the expressed enzyme may be produced by the host cell or may be exogenously supplied. To achieve expression, the polypeptide(s) of the instant invention are encoded by polynucleotides as described below.
(19) The inventors have isolated and produced enzymes from Primula that exhibit Δ6-desaturase activity. The sequences encoding the Δ6-desaturase may be expressed in transgenic plants, microorganisms or animals to effect greater synthesis of SDA. Other polynucleotides which are substantially identical to the Δ6-desaturase polynucleotides provided herein, or which encode polypeptides which are substantially identical to the Δ6-desaturase polypeptides, also can be used. “Substantially identical” refers to an amino acid sequence or nucleic acid sequence exhibiting in order of increasing preference at least 90%, 95%, 98 or 99% identity to the Δ6-desaturase polypeptide sequence in SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:22, SEQ ID NO:24, SEQ ID NO:26, SEQ ID NO:46 or SEQ ID NO:48 or sequences encoding these polypeptides. Polypeptide or polynucleotide comparisons may be carried out using sequence analysis software, for example, the Sequence Analysis software package of the GCG Wisconsin Package (Accelrys, San Diego, Calif.), MEGAlign (DNAStar, Inc., 1228 S. Park St., Madison, Wis. 53715), and MacVector (Oxford Molecular Group, 2105 S. Bascom Avenue, Suite 200, Campbell, Calif. 95008). Such software matches similar sequences by assigning degrees of similarity or identity.
(20) Encompassed by the present invention are related desaturases, including variants of the disclosed Δ6-desaturases naturally occurring within the same or different species of Primula. Related desaturases can be identified by their ability to function substantially the same as the disclosed desaturases; that is, having Δ6-desaturase activity. Related desaturases also can be identified by screening sequence databases for sequences homologous to the disclosed desaturases, by hybridization of a probe based on the disclosed desaturases to a library constructed from the source organism, or by RT-PCR using mRNA from the source organism and primers based on the disclosed desaturases. The invention therefore provides nucleic acids hybridizing under stringent conditions to a desaturase coding sequences described herein. One of skill in the art understands that conditions may be rendered less stringent by increasing salt concentration and decreasing temperature. Thus, hybridization conditions can be readily manipulated, and thus will generally be a method of choice depending on the desired results. An example of high stringency conditions is 5×SSC, 50% formamide and 42° C. By conducting a wash under such conditions, for example, for 10 minutes, those sequences not hybridizing to a particular target sequence under these conditions can be removed.
(21) In another aspect of the invention, vectors containing a nucleic acid, or fragment thereof, containing a promoter, a Δ6-desaturase coding sequence and a termination region may be transferred into an organism in which the promoter and termination regions are functional. Accordingly, organisms producing recombinant Δ6-desaturase are provided by this invention. Yet another aspect of this invention provides isolated Δ6-desaturase, which can be purified from the recombinant organisms by standard methods of protein purification. (For example, see Ausubel et al., 1994).
(22) Various aspects of the invention include nucleic acid sequences that encode desaturases, described herein. Nucleic acids may be isolated from Primula including SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:25, SEQ ID NO:45 or SEQ ID NO:47 and the like. A cloning strategy based on oligonucleotide primers designed to amplify sequences identified as potential fatty acid desaturases, based on BLAST searches of genomic DNA databases, may be used to sequence individual clones. These clones may then be functionally characterized.
(23) Nucleic acid constructs may be provided that integrate into the genome of a host cell or are autonomously replicated (e.g., episomally replicated) in the host cell. For production of ALA and/or SDA, the expression cassettes (i.e., a polynucleotide encoding a protein that is operatively linked to nucleic acid sequence(s) that directs the expression of the polynucleotide) generally used include an expression cassette which provides for expression of a polynucleotide encoding a Δ6-desaturase. In certain embodiments a host cell may have wild type oleic acid content.
(24) Methods and compositions for the construction of expression vectors, when taken in light of the teachings provided herein, for expression of Primula desaturase enzymes will be apparent to one of ordinary skill in the art. Expression vectors, as described herein, are DNA or RNA molecules engineered for controlled expression of a desired polynucleotide, e.g., the Δ6-desaturase-encoding polynucleotide. Examples of vectors include plasmids, bacteriophages, cosmids or viruses. Shuttle vectors, e.g. (Wolk et al. 1984; Bustos et al., 1991) are also contemplated in accordance with the present invention. Reviews of vectors and methods of preparing and using them can be found in Sambrook et al. (2001); Goeddel (1990); and Perbal (1988). Sequence elements capable of effecting expression of a polynucleotide include promoters, enhancer elements, upstream activating sequences, transcription termination signals and polyadenylation sites.
(25) Polynucleotides encoding desaturases may be placed under transcriptional control of a strong promoter. In some cases this leads to an increase in the amount of desaturase enzyme expressed and concomitantly an increase in the fatty acid produced as a result of the reaction catalyzed by the enzyme. There are a wide variety of plant promoter sequences which may be used to drive tissue-specific expression of polynucleotides encoding desaturases in transgenic plants. Indeed, in particular embodiments of the invention, the promoter used is a seed specific promoter. Examples of such promoters include the 5′ regulatory regions from such genes as napin (Kridl et al., Seed Sci. Res. 1:209:219, 1991), phaseolin (Bustos, et al., Plant Cell, 1(9):839-853, 1989), soybean trypsin inhibitor (Riggs, et al., Plant Cell 1(6):609-621, 1989), ACP (Baerson et al., Plant Mol. Biol., 22(2):255-267, 1993), stearoyl-ACP desaturase (Slocombe et al., Plant Physiol. 104(4):167-176, 1994), soybean a′ subunit of β-conglycinin (P-Gm7S, see for example, Chen et al., Proc. Natl. Acad. Sci. 83:8560-8564, 1986), Vicia faba USP (P-Vf.Usp, see for example, SEQ ID NO:1, 2, and 3, U.S. patent application Ser. No. 10/429,516), the globulin promoter (see for example Belanger and Kriz, Genet. 129: 863-872 (1991), soybean alpha subunit of β-conglycinin (7S alpha) (U.S. patent application Ser. No. 10/235,618, incorporated by reference) and Zea mays L3 oleosin promoter (P-Zm.L3, see, for example, Hong et al., Plant Mol. Biol., 34(3):549-555, 1997). Also included are the zeins, which are a group of storage proteins found in corn endosperm. Genomic clones for zein genes have been isolated (Pedersen et al., Cell 29:1015-1026 (1982), and Russell et al., Transgenic Res. 6(2):157-168) and the promoters from these clones, including the 15 kD, 16 kD, 19 kD, 22 kD, 27 kD and genes, could also be used.
(26) The ordinarily skilled artisan can determine vectors and regulatory elements (including operably linked promoters and coding regions) suitable for expression in a particular host cell. “Operably linked” in this context means that the promoter and terminator sequences effectively function to regulate transcription. As a further example, a vector appropriate for expression of Δ6-desaturase in transgenic plants can comprise a seed-specific promoter sequence derived from helianthinin, napin, or glycinin operably linked to the Δ6-desaturase coding region and further operably linked to a seed storage protein termination signal or the nopaline synthase termination signal. As a still further example, a vector for use in expression of Δ6-desaturase in plants can comprise a constitutive promoter or a tissue specific promoter operably linked to the Δ6-desaturase coding region and further operably linked to a constitutive or tissue specific terminator or the nopaline synthase termination signal.
(27) Modifications of the nucleotide sequences or regulatory elements disclosed herein which maintain the functions contemplated herein are within the scope of this invention. Such modifications include insertions, substitutions and deletions, and specifically substitutions which reflect the degeneracy of the genetic code.
(28) Standard techniques for the construction of such recombinant vectors are well-known to those of ordinary skill in the art and can be found in references such as Sambrook et al. (2001), or any of the myriad of laboratory manuals on recombinant DNA technology that are widely available. A variety of strategies are available for ligating fragments of DNA, the choice of which depends on the nature of the termini of the DNA fragments. It is further contemplated in accordance with the present invention to include in a nucleic acid vector other nucleotide sequence elements which facilitate cloning, expression or processing, for example sequences encoding signal peptides, a sequence encoding KDEL, which is required for retention of proteins in the endoplasmic reticulum or sequences encoding transit peptides which direct Δ6-desaturase to the chloroplast. Such sequences are known to one of ordinary skill in the art. An optimized transit peptide is described, for example, by Van den Broeck et al. (1985). Prokaryotic and eukaryotic signal sequences are disclosed, for example, by Michaelis et al. (1982).
(29) Polynucleotides encoding desired desaturases can be identified in a variety of ways. As an example, a source of the desired desaturase, for example genomic or cDNA libraries from Primula, is screened with detectable enzymatically- or chemically-synthesized probes, which can be made from DNA, RNA, or non-naturally occurring nucleotides, or mixtures thereof. Probes may be enzymatically synthesized from polynucleotides of known desaturases for normal or reduced-stringency hybridization methods. Oligonucleotide probes also can be used to screen sources and can be based on sequences of known desaturases, including sequences conserved among known desaturases, or on peptide sequences obtained from the desired purified protein. Oligonucleotide probes based on amino acid sequences can be degenerate to encompass the degeneracy of the genetic code, or can be biased in favor of the preferred codons of the source organism. Oligonucleotides also can be used as primers for PCR from reverse transcribed mRNA from a known or suspected source; the PCR product can be the full length cDNA or can be used to generate a probe to obtain the desired full length cDNA. Alternatively, a desired protein can be entirely sequenced and total synthesis of a DNA encoding that polypeptide performed.
(30) Once the desired genomic or cDNA has been isolated, it can be sequenced by known methods. It is recognized in the art that such methods are subject to errors, such that multiple sequencing of the same region is routine and is still expected to lead to measurable rates of mistakes in the resulting deduced sequence, particularly in regions having repeated domains, extensive secondary structure, or unusual base compositions, such as regions with high GC base content. When discrepancies arise, resequencing can be done and can employ special methods. Special methods can include altering sequencing conditions by using: different temperatures; different enzymes; proteins which alter the ability of oligonucleotides to form higher order structures; altered nucleotides such as ITP or methylated dGTP; different gel compositions, for example adding formamide; different primers or primers located at different distances from the problem region; or different templates such as single stranded DNAs. Sequencing of mRNA also can be employed.
(31) Some or all of the coding sequence for a polypeptide having desaturase activity may be from a natural source. In some situations, however, it is desirable to modify all or a portion of the codons, for example, to enhance expression, by employing host preferred codons. Host-preferred codons can be determined from the codons of highest frequency in the proteins expressed in the largest amount in a particular host species and/or tissue of interest. Thus, the coding sequence for a polypeptide having desaturase activity can be synthesized in whole or in part. All or portions of the DNA also can be synthesized to remove any destabilizing sequences or regions of secondary structure which would be present in the transcribed mRNA. All or portions of the DNA also can be synthesized to alter the base composition to one more preferable in the desired host cell. Methods for synthesizing sequences and bringing sequences together are well established in the literature. In vitro mutagenesis and selection, site-directed mutagenesis, or other means can be employed to obtain mutations of naturally-occurring desaturase genes to produce a polypeptide having desaturase activity in vivo with more desirable physical and kinetic parameters for function in the host cell, such as a longer half-life or a higher rate of production of a desired polyunsaturated fatty acid.
(32) Once the polynucleotide encoding a desaturase polypeptide has been obtained, it is placed in a vector capable of replication in a host cell, or is propagated in vitro by means of techniques such as PCR or long PCR. Replicating vectors can include plasmids, phage, viruses, cosmids and the like. Desirable vectors include those useful for mutagenesis of the gene of interest or for expression of the gene of interest in host cells. The technique of long PCR has made in vitro propagation of large constructs possible, so that modifications to the gene of interest, such as mutagenesis or addition of expression signals, and propagation of the resulting constructs can occur entirely in vitro without the use of a replicating vector or a host cell.
(33) For expression of a desaturase polypeptide, functional transcriptional and translational initiation and termination regions are operably linked to the polynucleotide encoding the desaturase polypeptide. Expression of the polypeptide coding region can take place in vitro or in a host cell. Transcriptional and translational initiation and termination regions are derived from a variety of nonexclusive sources, including the polynucleotide to be expressed, genes known or suspected to be capable of expression in the desired system, expression vectors, chemical synthesis, or from an endogenous locus in a host cell.
(34) Expression in a host cell can be accomplished in a transient or stable fashion. Transient expression can occur from introduced constructs which contain expression signals functional in the host cell, but which constructs do not replicate and rarely integrate in the host cell, or where the host cell is not proliferating. Transient expression also can be accomplished by inducing the activity of a regulatable promoter operably linked to the gene of interest, although such inducible systems frequently exhibit a low basal level of expression. Stable expression can be achieved by introduction of a construct that can integrate into the host genome or that autonomously replicates in the host cell. Stable expression of the gene of interest can be selected for through the use of a selectable marker located on or transfected with the expression construct, followed by selection for cells expressing the marker. When stable expression results from integration, integration of constructs can occur randomly within the host genome or can be targeted through the use of constructs containing regions of homology with the host genome sufficient to target recombination with the host locus. Where constructs are targeted to an endogenous locus, all or some of the transcriptional and translational regulatory regions can be provided by the endogenous locus.
(35) When increased expression of the desaturase polypeptide in the source organism is desired, several methods can be employed. Additional genes encoding the desaturase polypeptide can be introduced into the host organism. Expression from the native desaturase locus also can be increased through homologous recombination, for example by inserting a stronger promoter into the host genome to cause increased expression, by removing destabilizing sequences from either the mRNA or the encoded protein by deleting that information from the host genome, or by adding stabilizing sequences to the mRNA (U.S. Pat. No. 4,910,141).
(36) It is contemplated that more than one polynucleotide encoding a desaturase or a polynucleotide encoding more than one desaturase may be introduced and propagated in a host cell through the use of episomal or integrated expression vectors. Where two or more genes are expressed from separate replicating vectors, it is desirable that each vector has a different means of replication. Each introduced construct, whether integrated or not, should have a different means of selection and should lack homology to the other constructs to maintain stable expression and prevent reassortment of elements among constructs. Judicious choices of regulatory regions, selection means and method of propagation of the introduced construct can be experimentally determined so that all introduced polynucleotides are expressed at the necessary levels to provide for synthesis of the desired products.
(37) When necessary for transformation, the Δ6-desaturase coding sequences of the present invention can be inserted into a plant transformation vector, e.g. the binary vector described by Bevan (1984). Plant transformation vectors can be derived by modifying the natural gene transfer system of Agrobacterium tumefaciens. The natural system comprises large Ti (tumor-inducing)-plasmids containing a large segment, known as T-DNA, which is transferred to transformed plants. Another segment of the Ti plasmid, the vir region, is responsible for T-DNA transfer. The T-DNA region is bordered by terminal repeats. In the modified binary vectors the tumor-inducing genes have been deleted and the functions of the vir region are utilized to transfer foreign DNA bordered by the T-DNA border sequences. The T-region also contains a selectable marker for antibiotic resistance, and a multiple cloning site for inserting sequences for transfer. Such engineered strains are known as “disarmed” A. tumefaciens strains, and allow the efficient transformation of sequences bordered by the T-region into the nuclear genomes of plants.
(38) The subject invention finds many applications. Probes based on the polynucleotides of the present invention may find use in methods for isolating related molecules or in methods to detect organisms expressing desaturases. When used as probes, the polynucleotides or oligonucleotides must be detectable. This is usually accomplished by attaching a label either at an internal site, for example via incorporation of a modified residue, or at the 5′ or 3′ terminus. Such labels can be directly detectable, can bind to a secondary molecule that is detectably labeled, or can bind to an unlabelled secondary molecule and a detectably labeled tertiary molecule; this process can be extended as long as is practical to achieve a satisfactorily detectable signal without unacceptable levels of background signal. Secondary, tertiary, or bridging systems can include use of antibodies directed against any other molecule, including labels or other antibodies, or can involve any molecules which bind to each other, for example a biotin-streptavidin/avidin system. Detectable labels typically include radioactive isotopes, molecules which chemically or enzymatically produce or alter light, enzymes which produce detectable reaction products, magnetic molecules, fluorescent molecules or molecules whose fluorescence or light-emitting characteristics change upon binding. Examples of labeling methods can be found in U.S. Pat. No. 5,011,770. Alternatively, the binding of target molecules can be directly detected by measuring the change in heat of solution on binding of probe to target via isothermal titration calorimetry, or by coating the probe or target on a surface and detecting the change in scattering of light from the surface produced by binding of target or probe, respectively, as may be done with the BIAcore system.
(39) Constructs comprising the gene of interest may be introduced into a host cell by standard techniques. For convenience, a host cell which has been manipulated by any method to take up a DNA sequence or construct will be referred to as “transformed” or “recombinant” herein. The subject host will have at least have one copy of the expression construct and may have two or more, for example, depending upon whether the gene is integrated into the genome, amplified, or is present on an extrachromosomal element having multiple copy numbers.
(40) The transformed host cell can be identified by selection for a marker contained on the introduced construct. Alternatively, a separate marker construct may be introduced with the desired construct, as many transformation techniques introduce many DNA molecules into host cells. Typically, transformed hosts are selected for their ability to grow on selective media. Selective media may incorporate an antibiotic or lack a factor necessary for growth of the untransformed host, such as a nutrient or growth factor. An introduced marker gene therefore may confer antibiotic resistance, or encode an essential growth factor or enzyme, and permit growth on selective media when expressed in the transformed host. Selection of a transformed host can also occur when the expressed marker protein can be detected, either directly or indirectly. The marker protein may be expressed alone or as a fusion to another protein. The marker protein can be detected by its enzymatic activity; for example, beta-galactosidase can convert the substrate X-gal to a colored product, and luciferase can convert luciferin to a light-emitting product. The marker protein can be detected by its light-producing or modifying characteristics; for example, the green fluorescent protein of Aequorea victoria fluoresces when illuminated with blue light. Antibodies can be used to detect the marker protein or a molecular tag on, for example, a protein of interest. Cells expressing the marker protein or tag can be selected, for example, visually, or by techniques such as FACS or panning using antibodies. Desirably, resistance to kanamycin and the amino glycoside G418 are of interest, as well as ability to grow on media lacking uracil, leucine, lysine or tryptophan.
(41) Of particular interest is the Δ6-desaturase-mediated production of PUFA's in eukaryotic host cells. Eukaryotic cells include plant cells, such as those from oil-producing crop plants, and other cells amenable to genetic manipulation including fungal cells. The cells may be cultured or formed as part or all of a host organism including a plant. In a preferred embodiment, the host is a plant cell which produces and/or can assimilate exogenously supplied substrate(s) for a Δ6-desaturase, and preferably produces large amounts of one or more of the substrates.
(42) The transformed host cell is grown under appropriate conditions adapted for a desired end result. For host cells grown in culture, the conditions are typically optimized to produce the greatest or most economical yield of PUFA's, which relates to the selected desaturase activity. Media conditions which may be optimized include: carbon source, nitrogen source, addition of substrate, final concentration of added substrate, form of substrate added, aerobic or anaerobic growth, growth temperature, inducing agent, induction temperature, growth phase at induction, growth phase at harvest, pH, density, and maintenance of selection.
(43) Another aspect of the present invention provides transgenic plants or progeny of plants containing the isolated DNA of the invention. Both monocotyledonous and dicotyledonous plants are contemplated. Plant cells are transformed with an isolated DNA encoding Δ6-desaturase by any plant transformation method. The transformed plant cell, often in a callus culture or leaf disk, is regenerated into a complete transgenic plant by methods well-known to one of ordinary skill in the art (e.g. Horsch et al., 1985). In one embodiment, the transgenic plant is selected from the group consisting of Arabidopsis thaliana, canola, soy, soybean, rapeseed, sunflower, cotton, cocoa, peanut, safflower, coconut, flax, oil palm, oilseed Brassica napus, corn, jojoba, Chinese tallow tree, tobacco, fruit plants, citrus plants or plants producing nuts and berries. Since progeny of transformed plants inherit the polynucleotide encoding Δ6-desaturase, seeds or cuttings from transformed plants may be used to maintain the transgenic plant line.
(44) The present invention further provides a method for providing transgenic plants with an increased content of ALA and/or SDA. This method includes, for example, introducing DNA encoding Δ6-desaturase into plant cells which lack or have low levels SDA but contain ALA, and regenerating plants with increased SDA content from the transgenic cells. In certain embodiments of the invention, a DNA encoding a Δ15- and/or Δ12-desaturase may also be introduced into the plant cells. Such plants may or may not also comprise endogenous Δ12- and/or Δ15-desaturase activity. In certain embodiments, modified commercially grown crop plants are contemplated as the transgenic organism, including, but not limited to, Arabidopsis thaliana, canola, soy, soybean, rapeseed, sunflower, cotton, cocoa, peanut, safflower, coconut, flax, oil palm, oilseed Brassica napus, corn, jojoba, Chinese tallow tree, tobacco, fruit plants, citrus plants or plants producing nuts and berries.
(45) The present invention further provides a method for providing transgenic plants which may contain elevated levels of ALA and/or SDA, wherein said elevated levels are greater than levels found in non-transformed plants. Expression vectors comprising DNA encoding a Δ6-desaturase, and/or a Δ12-desaturase and/or a Δ15-desaturase, can be constructed by methods of recombinant technology known to one of ordinary skill in the art (Sambrook et al., 2001). In particular, commercially grown crop plants are contemplated as the transgenic organism, including, but not limited to, Arabidopsis thaliana, canola, soy, soybean, rapeseed, sunflower, cotton, cocoa, peanut, safflower, coconut, flax, oil palm, oilseed Brassica napus, and corn.
(46) For dietary supplementation, the purified PUFAs, transformed plants or plant parts, or derivatives thereof, may be incorporated into cooking oils, fats or margarines formulated so that in normal use the recipient would receive the desired amount. The PUFAs may also be incorporated into infant formulas, nutritional supplements or other food products, and may find use as anti-inflammatory or cholesterol lowering agents.
(47) As used herein, “edible composition” is defined as compositions which may be ingested by a mammal such as foodstuffs, nutritional substances and pharmaceutical compositions. As used herein “foodstuffs” refer to substances that can be used or prepared for use as food for a mammal and include substances that may be used in the preparation of food (such as frying oils) or food additives. For example, foodstuffs include animals used for human consumption or any product therefrom, such as, for example, eggs. Typical foodstuffs include but are not limited to beverages, (e.g., soft drinks, carbonated beverages, ready to mix beverages), infused foods (e.g. fruits and vegetables), sauces, condiments, salad dressings, fruit juices, syrups, desserts (e.g., puddings, gelatin, icings and fillings, baked goods and frozen desserts such as ice creams and sherbets), soft frozen products (e.g., soft frozen creams, soft frozen ice creams and yogurts, soft frozen toppings such as dairy or non-dairy whipped toppings), oils and emulsified products (e.g., shortening, margarine, mayonnaise, butter, cooking oil, and salad dressings) and intermediate moisture foods (e.g., rice and dog foods).
(48) Furthermore, edible compositions described herein can also be ingested as an additive or supplement contained in foods and drinks. These can be formulated together with a nutritional substance such as various vitamins and minerals and incorporated into substantially liquid compositions such as nutrient drinks, soymilks and soups; substantially solid compositions; and gelatins or used in the form of a powder to be incorporated into various foods. The content of the effective ingredient in such a functional or health food can be similar to the dose contained in a typical pharmaceutical agent.
(49) The purified PUFAs, transformed plants or plant parts may also be incorporated into animal, particularly livestock, feed. In this way, the animals themselves may benefit from a PUFA rich diet, while human consumers of food products produced from such livestock may benefit as well. It is expected in certain embodiments that SDA will be converted to EPA in animals and thus such animals may benefit from an increase in EPA by consumption of SDA.
(50) For pharmaceutical use (human or veterinary), the compositions may generally be administered orally but can be administered by any route by which they may be successfully absorbed, e.g., parenterally (i.e. subcutaneously, intramuscularly or intravenously), rectally, vaginally or topically, for example, as a skin ointment or lotion. The PUFAs transformed plants or plant parts of the present invention may be administered alone or in combination with a pharmaceutically acceptable carrier or excipient. Where available, gelatin capsules are the preferred form of oral administration. Dietary supplementation as set forth above can also provide an oral route of administration. The unsaturated acids of the present invention may be administered in conjugated forms, or as salts, esters, amides or prodrugs of the fatty acids. Any pharmaceutically acceptable salt is encompassed by the present invention; especially preferred are the sodium, potassium or lithium salts. Also encompassed are the N-alkylpolyhydroxamine salts, such as N-methyl glucamine, found in PCT publication WO 96/33155. The preferred esters are the ethyl esters. As solid salts, the PUFAs also can be administered in tablet form. For intravenous administration, the PUFAs or derivatives thereof may be incorporated into commercial formulations such as Intralipids.
(51) If desired, the regions of a desaturase polypeptide important for desaturase activity can be determined through routine mutagenesis followed by expression of the resulting mutant polypeptides and determination of their activities. Mutants may include substitutions, deletions, insertions and point mutations, or combinations thereof. Substitutions may be made on the basis of conserved hydrophobicity or hydrophilicity (Kyte and Doolittle, 1982), or on the basis of the ability to assume similar polypeptide secondary structure (Chou and Fasman, 1978). A typical functional analysis begins with deletion mutagenesis to determine the N- and C-terminal limits of the protein necessary for function, and then internal deletions, insertions or point mutants are made to further determine regions necessary for function. Other techniques such as cassette mutagenesis or total synthesis also can be used. Deletion mutagenesis is accomplished, for example, by using exonucleases to sequentially remove the 5′ or 3′ coding regions. Kits are available for such techniques. After deletion, the coding region is completed by ligating oligonucleotides containing start or stop codons to the deleted coding region after 5′ or 3′ deletion, respectively. Alternatively, oligonucleotides encoding start or stop codons are inserted into the coding region by a variety of methods including site-directed mutagenesis, mutagenic PCR or by ligation onto DNA digested at existing restriction sites.
(52) Internal deletions can similarly be made through a variety of methods including the use of existing restriction sites in the DNA, by use of mutagenic primers via site directed mutagenesis or mutagenic PCR. Insertions are made through methods such as linker-scanning mutagenesis, site-directed mutagenesis or mutagenic PCR. Point mutations are made through techniques such as site-directed mutagenesis or mutagenic PCR. Chemical mutagenesis may also be used for identifying regions of a desaturase polypeptide important for activity. Such structure-function analysis can determine which regions may be deleted, which regions tolerate insertions, and which point mutations allow the mutant protein to function in substantially the same way as the native desaturase. All such mutant proteins and nucleotide sequences encoding them are within the scope of the present invention.
(53) As described herein above, certain embodiments of the current invention concern plant transformation constructs. For example, one aspect of the current invention is a plant transformation vector comprising one or more desaturase gene(s) or cDNA(s). Exemplary coding sequences for use with the invention include Primula juliae Δ6-desaturase (SEQ ID NOs:2-3). In certain embodiments, antisense desaturase sequences can also be employed with the invention. Exemplary desaturase encoding nucleic acids include at least 20, 40, 80, 120, 300 and up to the full length of the nucleic acid sequences of SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:25, SEQ ID NO:45 or SEQ ID NO:47. In certain aspects, a nucleic acid may encode 1, 2, 3, 4, or more desaturase enzymes. In particular embodiments, a nucleic acid may encode a Δ6- and a Δ15-desaturase.
(54) Vectors used for plant transformation may include, for example, plasmids, cosmids, YACs (yeast artificial chromosomes), BACs (bacterial artificial chromosomes) or any other suitable cloning system, as well as fragments of DNA therefrom. Thus when the term “vector” or “expression vector” is used, all of the foregoing types of vectors, as well as nucleic acid sequences isolated therefrom, are included. It is contemplated that utilization of cloning systems with large insert capacities will allow introduction of large DNA sequences comprising more than one selected gene. In accordance with the invention, this could be used to introduce various desaturase encoding nucleic acids. Introduction of such sequences may be facilitated by use of bacterial or yeast artificial chromosomes (BACs or YACs, respectively), or even plant artificial chromosomes. For example, the use of BACs for Agrobacterium-mediated transformation was disclosed by Hamilton et al. (1996).
(55) Particularly useful for transformation are expression cassettes which have been isolated from such vectors. DNA segments used for transforming plant cells will, of course, generally comprise the cDNA, gene or genes which one desires to introduce into and have expressed in the host cells. These DNA segments can further include structures such as promoters, enhancers, polylinkers, or even regulatory genes as desired. The DNA segment or gene chosen for cellular introduction will often encode a protein which will be expressed in the resultant recombinant cells resulting in a screenable or selectable trait and/or which will impart an improved phenotype to the resulting transgenic plant. However, this may not always be the case, and the present invention also encompasses transgenic plants incorporating non-expressed transgenes. Preferred components likely to be included with vectors used in the current invention are as follows.
(56) In one embodiment the instant invention utilizes certain promoters. Examples of such promoters that may be used with the instant invention include, but are not limited to, the 35S CaMV (cauliflower mosaic virus), 34S FMV (figwort mosaic virus) (see, e.g., U.S. Pat. No. 5,378,619, the contents of which are herein incorporated in their entirety), Napin (from Brassica), 7S (from soybean), Globulin and Lec (from corn). The napin promoter and promoters, which are regulated during plant seed maturation, are of particular interest for use with the instant invention. All such promoter and transcriptional regulatory elements, singly or in combination, are contemplated for use in the present replicable expression vectors and are known to one of ordinary skill in the art.
(57) The DNA sequence between the transcription initiation site and the start of the coding sequence, i.e., the untranslated leader sequence, can also influence gene expression. One may thus wish to employ a particular leader sequence with a transformation construct of the invention. Preferred leader sequences are contemplated to include those which comprise sequences predicted to direct optimum expression of the attached gene, i.e., to include a preferred consensus leader sequence which may increase or maintain mRNA stability and prevent inappropriate initiation of translation. The choice of such sequences will be known to those of skill in the art in light of the present disclosure. Sequences that are derived from genes that are highly expressed in plants will typically be preferred.
(58) Transformation constructs prepared in accordance with the invention will typically include a 3′ end DNA sequence that acts as a signal to terminate transcription and allow for the poly-adenylation of the mRNA produced by coding sequences operably linked to a desaturase gene (e.g., cDNA). In one embodiment of the invention, the native terminator of a desaturase gene is used. Alternatively, a heterologous 3′ end may enhance the expression of desaturase coding regions. Examples of terminators deemed to be useful include those from the nopaline synthase gene of Agrobacterium tumefaciens (nos 3′ end) (Bevan et al., 1983), the terminator for the T7 transcript from the octopine synthase gene of Agrobacterium tumefaciens, the 3′ end of the protease inhibitor I or II genes from potato or tomato and the CaMV 35S terminator (tm13′). Regulatory elements such as an Adh intron (Callis et al., 1987), sucrose synthase intron (Vasil et al., 1989) or TMV omega element (Gallie et al., 1989), may further be included where desired.
(59) By employing a selectable or screenable marker protein, one can provide or enhance the ability to identify transformants. “Marker genes” are genes that impart a distinct phenotype to cells expressing the marker protein and thus allow such transformed cells to be distinguished from cells that do not have the marker. Such genes may encode either a selectable or screenable marker, depending on whether the marker confers a trait which one can “select” for by chemical means, i.e., through the use of a selective agent (e.g., a herbicide, antibiotic, or the like), or whether it is simply a trait that one can identify through observation or testing, i.e., by “screening” (e.g., the green fluorescent protein). Of course, many examples of suitable marker proteins are known to the art and can be employed in the practice of the invention.
(60) Suitable methods for transformation of plant or other cells for use with the current invention are believed to include virtually any method by which DNA can be introduced into a cell, such as by direct delivery of DNA such as by PEG-mediated transformation of protoplasts (Omirulleh et al., 1993), by desiccation/inhibition-mediated DNA uptake (Potrykus et al., 1985), by electroporation (U.S. Pat. No. 5,384,253, specifically incorporated herein by reference in its entirety), by agitation with silicon carbide fibers (Kaeppler et al., 1990; U.S. Pat. No. 5,302,523, specifically incorporated herein by reference in its entirety; and U.S. Pat. No. 5,464,765, specifically incorporated herein by reference in its entirety), by Agrobacterium-mediated transformation (U.S. Pat. Nos. 5,591,616 and 5,563,055; both specifically incorporated herein by reference) and by acceleration of DNA coated particles (U.S. Pat. Nos. 5,550,318; 5,538,877; and 5,538,880; each specifically incorporated herein by reference in its entirety), etc. Through the application of techniques such as these, the cells of virtually any plant species may be stably transformed, and these cells developed into transgenic plants.
(61) After effecting delivery of exogenous DNA to recipient cells, the next steps generally concern identifying the transformed cells for further culturing and plant regeneration. In order to improve the ability to identify transformants, one may desire to employ a selectable or screenable marker gene with a transformation vector prepared in accordance with the invention. In this case, one would then generally assay the potentially transformed cell population by exposing the cells to a selective agent or agents, or one would screen the cells for the desired marker gene trait.
(62) Cells that survive the exposure to the selective agent, or cells that have been scored positive in a screening assay, may be cultured in media that supports regeneration of plants. In an exemplary embodiment, MS and N6 media may be modified by including further substances such as growth regulators. One such growth regulator is dicamba or 2,4-D. However, other growth regulators may be employed, including NAA, NAA+2,4-D or picloram. Media improvement in these and like ways has been found to facilitate the growth of cells at specific developmental stages. Tissue may be maintained on a basic media with growth regulators until sufficient tissue is available to begin plant regeneration efforts, or following repeated rounds of manual selection, until the morphology of the tissue is suitable for regeneration, typically at least 2 weeks, then transferred to media conducive to maturation of embryoids. Cultures are transferred every 2 weeks on this medium. Shoot development will signal the time to transfer to medium lacking growth regulators.
(63) To confirm the presence of the exogenous DNA or “transgene(s)” in the regenerating plants, a variety of assays may be performed. Such assays include, for example, “molecular biological” assays, such as Southern and Northern blotting and PCR™; “biochemical” assays, such as detecting the presence of a protein product, e.g., by immunological means (ELISAs and Western blots) or by enzymatic function; plant part assays, such as leaf or root assays; and also, by analyzing the phenotype of the whole regenerated plant.
(64) In addition to direct transformation of a particular plant genotype with a construct prepared according to the current invention, transgenic plants may be made by crossing a plant having a selected DNA of the invention to a second plant lacking the DNA. Plant breeding techniques may also be used to introduce a multiple desaturases, for example Δ6, Δ12, and/or Δ15-desaturase(s) into a single plant. In this manner, Δ6-desaturase can be effectively up-regulated. By creating plants homozygous for a Δ6-desaturase activity and/or other desaturase activity (e.g., Δ12- and/or Δ15-desaturase activity) beneficial metabolites can be increased in the plant.
(65) As set forth above, a selected desaturase gene can be introduced into a particular plant variety by crossing, without the need for ever directly transforming a plant of that given variety. Therefore, the current invention not only encompasses a plant directly transformed or regenerated from cells which have been transformed in accordance with the current invention, but also the progeny of such plants. As used herein the term “progeny” denotes the offspring of any generation of a parent plant prepared in accordance with the instant invention, wherein the progeny comprises a selected DNA construct prepared in accordance with the invention. “Crossing” a plant to provide a plant line having one or more added transgenes or alleles relative to a starting plant line, as disclosed herein, is defined as the techniques that result in a particular sequence being introduced into a plant line by crossing a starting line with a donor plant line that comprises a transgene or allele of the invention. To achieve this one could, for example, perform the following steps: (a) plant seeds of the first (starting line) and second (donor plant line that comprises a desired transgene or allele) parent plants; (b) grow the seeds of the first and second parent plants into plants that bear flowers; (c) pollinate a flower from the first parent plant with pollen from the second parent plant; and (d) harvest seeds produced on the parent plant bearing the fertilized flower.
(66) Backcrossing is herein defined as the process including the steps of: (a) crossing a plant of a first genotype containing a desired gene, DNA sequence or element to a plant of a second genotype lacking said desired gene, DNA sequence or element; (b) selecting one or more progeny plant containing the desired gene, DNA sequence or element; (c) crossing the progeny plant to a plant of the second genotype; and (d) repeating steps (b) and (c) for the purpose of transferring a desired DNA sequence from a plant of a first genotype to a plant of a second genotype.
(67) Introgression of a DNA element into a plant genotype is defined as the result of the process of backcross conversion. A plant genotype into which a DNA sequence has been introgressed may be referred to as a backcross converted genotype, line, inbred, or hybrid. Similarly a plant genotype lacking the desired DNA sequence may be referred to as an unconverted genotype, line, inbred, or hybrid.
EXAMPLES
(68) The following examples are included to illustrate embodiments of the invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples that follow represent techniques discovered by the inventor to function well in the practice of the invention. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the concept, spirit and scope of the invention. More specifically, it will be apparent that certain agents which are both chemically and physiologically related may be substituted for the agents described herein while the same or similar results would be achieved. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the invention as defined by the appended claims.
Example 1
Cloning of Primula juliae Δ6 Desaturase Sequences
(69) Cloning of the Primula juliae Δ6 desaturase (PjD6D) was achieved by PCR amplification of a partial internal genomic DNA region using degenerate oligonucleotides, followed by bi-directional genomic walking. Total genomic DNA was isolated from P. juliae (Collector's Nursery, Battleground Wash.) using the DNeasy Plant Mini Kit (Qiagen, Valencia, Calif.), following the manufacturer's procedure. Initially, a 552 bp fragment corresponding to positions 687 to 1238 of SEQ ID NO:1 was isolated using degenerate oligonucleotides BO-1 For and BO-2 Rev as described by Garcia-Maroto et al. (2002). The fragment was cloned into pCR®4-TOPO® (Invitrogen, Carlsbad, Calif.) to yield the vector pMON83955 and the insert was sequenced. Primer sequences BO-1 For and BO-2 Rev were as follows:
(70) TABLE-US-00001 (SEQ ID NO: 6) BO-1 For: 5′-ATMAGYATYGGTTGGTGGAARTGG-3′ (SEQ ID NO: 7) BO-2 Rev: 5′-AATCCACCRTGRAACCARTCCAT-3′
(71) To determine the genomic flanking sequence of the insert of pMON83955, a Universal Genome Walker Kit™ (BD Biosciences, Palo Alto, Calif.) was utilized, following the manufacture's procedure. Four P. juliae genomic libraries were generated by digesting the DNA with four restriction enzymes: EcoRV, PvuII, StuI, and DraI. After a purification step, the digestions were ligated to an adapter provided in the kit. The procedure then involved two PCR reactions, each with a gene-specific primer and an adapter-primer. The secondary PCR reaction used a dilution of the primary PCR reaction products as a template. For the 5′ direction, primers PD6D R8 and PD6D R2 were used for the primary and secondary PCR reactions, respectively. For the 3′ direction, primers PD6D F8 and PD6D F3 were used for the primary and secondary PCR reactions, respectively. The primer sequences are given below:
(72) TABLE-US-00002 (SEQ ID NO: 8) PD6D R8: 5′-CACACATGACCGGATAAAACGACCAGT-3′ (SEQ ID NO: 9) PD6D R2: 5′-GGGAATGTACTGGAGGTCAGGGTCGTA-3′ (SEQ ID NO: 10) PD6D F8: 5′-CGTGCAGTTCAGCTTGAACCATTTCTC-3′ (SEQ ID NO: 11) PD6D F3: 5′-TGCAGGGACACTCAACATATCGTGCCC-3′
(73) Genome walking in the 5′ direction yielded a 574 bp fragment from the EcoRV library. This product was cloned into pCR®4-TOPO® (Invitrogen) giving pMON83956, and the insert was sequenced. The resulting sequence did not contain a start codon of the putative delta 6 desaturase gene and thus another set of PCR reactions was performed using gene specific primers designed to walk in the 5′ direction from the pMON83956 insert. The primers used for the second genome walking set in the 5′ direction were PD6D R15 and PD6D R14 for the primary and secondary PCR reactions, respectively. The sequences are given below:
(74) TABLE-US-00003 (SEQ ID NO: 12) PD6D R15: 5′-GTAGGTTGGTGGAGAAGGGAGGGAGGA-3′ (SEQ ID NO: 13) PD6D R14: 5′-GGAAGGGGGATGGTAAGCGAGGAAAGC-3′
(75) A product of 328 bp in length from the StuI library was cloned into pCR®4-TOPO® (Invitrogen) giving pMON83958 and the insert was sequenced. This insert contained 2 potential start codons, 44 bases apart. The first start codon corresponds to position 87 and the second to position 135 of SEQ ID NO:1. Genome walking in the 3′ direction resulted in a 773 bp fragment from the DraI library. This product was cloned into pCR®4-TOPO®, giving pMON83957. The insert was sequenced and found to contain 292 bp of the coding region for the putative delta 6 desaturase gene, followed by a stop codon at position 1473 with respect to SEQ ID NO:1.
(76) The inserts of pMON83955, pMON83956, pMON83957, and pMON83958 were aligned to form a composite sequence, SEQ ID NO:1. Three primers were designed to PCR amplify 2 different lengths of coding sequence from P. juliae genomic DNA, reflecting the two start codons found in pMON83958. The longer of the two sequences, PjD6D-1, was amplified using forward primer Pj D6D F2 and reverse primer Pj D6D R1. The shorter of the two, PjD6D-2, was amplified using forward primer Pj D6D F1 and reverse primer Pj D6D R1. The two putative delta 6 desaturase coding sequences were each then ligated into the yeast expression vector pYES2.1-TOPO. Upon sequencing, the plasmid containing PjD6D-1 was designated pMON83950 (SEQ ID NO:3) and the plasmid containing PjD6D-2 was designated pMON67011 (SEQ ID NO:2). The primer sequences are given below:
(77) TABLE-US-00004 Pj D6D F2: (SEQ ID NO: 14) 5′-GTCGACATGGAAAACACATTTTCACCACCACCT-3′ Pj D6D F1: (SEQ ID NO: 15) 5′-GTCGACATGACTAAGACCATTTACATAACCAGC-3′ Pj D6D R1: (SEQ ID NO: 16) 5′-CCTGCAGGTCACCCGACATTTTTAACAGCCTCCC-3′
(78) The two PjΔ6 desaturase clones, PjD6D-2 and PjD6D-1, encode potential polypeptides of 446 amino acids and 462 amino acids, given in SEQ ID NO:4 and SEQ ID NO:5, respectively. The initial MET site of the shorter peptide sequence (PjD6D-2) is located 16 amino acids downstream from the first MET site of the longer sequence (PjD6D-1). 3′ of the second MET, the sequences are identical. These sequences have high similarity to other plant Δ 6 desaturases (
Example 2
Yeast Transformation and Expression
(79) Constructs pMON83950 (
(80) Lipids were extracted from lyophilized yeast pellets by adding 0.1 mL toluene and incubating over night at room temperature. Extracted lipids were converted to fatty acid methyl esters (FAMEs) in situ by addition of 0.5 mL 0.6N sodium methoxide in methanol and incubating for 45 min. The FAMEs were extracted by addition of 0.8 mL 10% (w/v) NaCl and 0.15 mL of heptane. The heptane layer containing FAMEs was removed and used directly for gas chromatography (GC). The FAMEs were identified on a Hewlett-Packard 5890 II Plus GC (Hewlett-Packard, Palo Alto, Calif.) equipped with a flame-ionization detector and a capillary column (omegawax 250; 30m×0.25 mm i.d.×0.25 μm; Supelco, Bellefonte, Pa.). A 100:1 split ratio was used for injections. The injector was maintained at 250° C. and the flame ionization detector was maintained at 270° C. The column temperature was maintained at 180° C. for 1.5 min following injection, increased to 240° C. at 40° C./min, and held at 245° C. for 3.38 min.
(81) Table 1 shows the fatty acid composition for yeast expressing P. juliae clones pMON67011 (PjD6D-2), pMON83950 (PjD6D-1) or Mortierella alpina Δ6 desaturase, pMON77205. Expected products for Δ6 desaturation of LA and ALA were observed for both P. juliae clones (Table 1, GLA and SDA, respectively), demonstrating that the clones contained in pMON67011 and pMON83950 are Δ6 desaturases. The substrate selectivity was determined by feeding equal quantities of LA and ALA. M. alpina is a filamentous fungus that accumulates high levels of the n-6 fatty acid arachidonic acid and was expected to have a Δ6 desaturase with an n-6 selectivity. Table 2 shows the n-3:n-6 substrate selectivities of the P. juliae and M. alpina Δ6 desaturases. An n-3:n-6 selectivity of ˜0.8 was observed for the M. alpina Δ6 desaturase. An n-3:n-6 selectivity of ˜1.5-1.9 was observed for both P. juliae Δ6 desaturase clones.
(82) TABLE-US-00005 TABLE 1 Comparison of fatty acid composition of yeast expressing different Δ6 desaturases. Vector Gene FA in medium LA* GLA* ALA* SDA* pMON67011 P. juliae D6D-2 — 2.0 0.0 0.0 0.0 pMON67011 P. juliae D6D-2 — 2.5 0.0 0.1 0.0 pMON67011 P. juliae D6D-2 LA 25.7 14.0 0.0 0.0 pMON67011 P. juliae D6D-2 LA 28.4 16.8 0.1 0.0 pMON67011 P. juliae D6D-2 ALA 0.3 0.1 24.4 16.8 pMON67011 P. juliae D6D-2 ALA 0.3 0.1 30.6 19.0 pMON67011 P. juliae D6D-2 LA + ALA 22.7 6.0 18.0 8.5 pMON67011 P. juliae D6D-2 LA + ALA 24.3 5.8 20.4 8.9 pMON83950 P. juliae D6D-1 — 2.3 0.0 0.3 0.0 pMON83950 P. juliae D6D-1 — 2.3 0.0 0.2 0.0 pMON83950 P. juliae D6D-1 LA 26.3 15.0 0.0 0.0 pMON83950 P. juliae D6D-1 LA 23.5 16.6 0.0 0.0 pMON83950 P. juliae D6D-1 ALA 0.6 0.2 37.3 17.5 pMON83950 P. juliae D6D-1 ALA 0.7 0.1 33.9 17.4 pMON83950 P. juliae D6D-1 LA + ALA 18.8 4.3 17.1 9.4 pMON83950 P. juliae D6D-1 LA + ALA 16.9 4.8 15.7 9.8 pMON77205 M. alpina D6D — 1.7 0.0 0.2 0.0 pMON77205 M. alpina D6D — 1.0 0.0 0.0 0.0 pMON77205 M. alpina D6D LA 56.8 6.0 0.0 0.0 pMON77205 M. alpina D6D LA 25.4 4.6 0.2 0.0 pMON77205 M. alpina D6D ALA 0.5 0.0 69.2 2.6 pMON77205 M. alpina D6D ALA 0.9 0.0 23.0 5.0 pMON77205 M. alpina D6D LA + ALA 34.8 1.3 39.7 1.1 pMON77205 M. alpina D6D LA + ALA 18.7 2.8 18.4 2.2 *Reported as a % of the total for all analytes included in the GC-FID chromatogram, including but not shown (16:0, 16:1, 18:0, 20:0, 20:1, 20:2, 22:0, 22:1, 22:2
(83) TABLE-US-00006 TABLE 2 Comparison of n-3:n-6 substrate selectivities for P. juliae and M. alpina Δ6 desaturases. FA in % conv % conv Ratio Vector Gene medium GLA* SDA* n-3:n-6** pMON67011 P. juliae D6D-2 LA + 21.0 32.1 1.53 ALA pMON67011 P. juliae D6D-2 LA + 19.2 30.3 1.58 ALA pMON83950 P. juliae D6D-1 LA + 18.7 35.4 1.89 ALA pMON83950 P. juliae D6D-1 LA + 22.2 38.4 1.73 ALA pMON77205 M. alpina D6D LA + 3.6 2.8 0.78 ALA pMON77205 M. alpina D6D LA + 12.8 10.5 0.82 ALA *The percentage conversion to GLA was calculated by dividing the value for GLA (Table 1) by the sum of the values for LA and GLA (Table 1). The same calculation was made for SDA using the sum of ALA and SDA (Table 1). **The n-3:n-6 ratio was calculated by dividing the % conv. SDA by % conv. GLA.
Example 3
Plant Transformation and Expression of Primula juliae Δ6-Desaturase
(84) The activity of the P. juliae Δ6-desaturase was evaluated in soybean by combining it with a Δ15-desaturase from either Neurospora crassa (NcD15D), pMON77245 (
(85) Expression of the PjD6D-2 coding sequence was measured by determining the fatty acid composition of immature (approximately 30 days after flowering) R1 transgenic soybean seeds, including both homozygotes and heterozygotes, by gas chromatography of lipid methyl ester derivatives (PCT US03/16144, filed May 21, 2003, the entire disclosure of which is specifically incorporated herein by reference). The levels of PA (palmitic acid, 16:0), SA (stearic acid, 18:0), OA, LA, GLA, ALA, and SDA are expressed as a percentage of the total weight of measured fatty acids and are shown in Tables 3 and 4 below. The non-transgenic control line was A3525. Whenever possible, five individual seeds were analyzed from each event.
(86) Individual seed from a majority of the pMON77245 transgenic events were found to accumulate measurable amounts of SDA. In all cases, the levels of SDA were greater than those of GLA, with an average SDA:GLA ratio for each event ranging from 2:1 to a high of 8:1. The highest single seed value was observed from event GM_A38083, which contained 32.0% SDA and 2.6% GLA, with a SDA:GLA ratio of 12:1. Of the 12 events shown below, 9 had SDA values>10% in at least one seed out of five. As SDA values increased, the levels of PA, SA and OA did not vary significantly from control levels; however, there is a strong negative correlation for LA. In seeds that accumulated SDA, the levels of GLA remains low, between 2.3 to 5.5%. The ALA levels increased along the SDA levels.
(87) TABLE-US-00007 TABLE 3 Relative Area Percent Results (Approx. wt percent) from single pMON77245-transformed R1 seeds pMON77245 Fatty Acid (percent wt) Pedigree PA SA OA LA GLA ALA SDA A3525 11.47 5.21 16.5 56.75 0 9.15 0 A3525 11.66 4.53 18.54 54.9 0 9.51 0 A3525 11.8 5.42 16.66 56.04 0 9.14 0 A3525 11.41 4.91 17.64 56 0 9.08 0 A3525 11.56 4.36 17.86 56.55 0 8.77 0 GM_A38005 12.57 4.19 18.45 53.99 0 10.8 0 GM_A38005 13.73 4.77 19.32 52.42 0 9.76 0 GM_A38005 14.81 4.74 19.09 36.84 5.23 10.3 8.98 GM_A38005 13.4 4.71 18.34 53.26 0 10.29 0 GM_A38005 13.21 4.38 19.97 52.19 0 10.25 0 GM_A38005 13.08 4.78 17.99 53.56 0 10.59 0 GM_A38013 12.91 4.45 19.72 40.8 4.57 9.56 7.99 GM_A38013 12.45 4.38 18.9 55.04 0 9.23 0 GM_A38013 13.04 4.68 17.38 40.36 4.66 10.27 9.61 GM_A38013 13.26 4.34 17.14 40.03 4.6 10.17 10.46 GM_A38013 11.67 4.26 22.5 44.26 3.3 8.95 5.05 GM_A38021 12.95 4.33 19.39 53.48 0 9.85 0 GM_A38021 13.07 4.87 18.12 54.1 0 9.84 0 GM_A38021 13.14 4.27 22.76 34.62 2.3 13.7 9.2 GM_A38021 12.98 4.08 21.58 39.6 1.6 13.7 6.45 GM_A38021 13.21 4.34 17.24 29.03 1.78 19.07 15.31 GM_A38043 13.1 4.26 19.58 52.44 0 10.62 0 GM_A38043 13.09 4.3 20.01 52.83 0 9.77 0 GM_A38043 14.01 4.35 22.05 29.98 4.39 12.18 13.05 GM_A38043 13.32 4.26 19.41 51.85 0 11.16 0 GM_A38043 12.8 4.34 19.81 53 0 10.05 0 GM_A38048 13.44 5.5 18.01 44.46 2.28 10.7 5.61 GM_A38048 13.43 4.8 18.57 44.25 2.34 10.93 5.68 GM_A38048 13.14 4.47 18.88 44.97 2.33 10.78 5.44 GM_A38048 12.98 4.89 17.79 44.92 2.43 11.23 5.76 GM_A38048 13.3 4.56 17.95 35.88 3.41 13.15 11.75 GM_A38060 12.73 4.94 17.37 43.16 4.01 10.4 7.39 GM_A38060 12.85 5.19 15.27 35.1 5.32 11.88 14.39 GM_A38060 12.73 4.99 16.41 43.44 3.95 10.25 8.23 GM_A38060 13.06 5.34 16.06 42.75 4.04 10.32 8.43 GM_A38060 12.85 5.25 16.45 42.68 4.01 10.39 8.36 GM_A38064 13.32 5 18.8 42 3.86 10.16 6.87 GM_A38064 13.07 4.72 18.97 42.1 3.59 9.95 7.6 GM_A38064 13.45 4.84 19.7 41.67 3.8 9.92 6.62 GM_A38064 12.66 4.61 19.09 43.21 3.52 9.85 7.05 GM_A38064 13.03 4.73 19.58 36.38 4.94 11.28 10.06 GM_A38069 12.9 4.71 21.24 41.12 2.64 11.43 5.97 GM_A38069 12.74 4.76 20.35 51.21 0 10.94 0 GM_A38069 12.93 4.77 20.5 51.27 0 10.53 0 GM_A38069 13.18 4.69 18.85 38.76 3.3 12.34 8.87 GM_A38069 13.08 4.79 19.16 52.08 0 10.89 0 GM_A38083 13.33 5.28 21.73 27.31 2.48 15.28 13.35 GM_A38083 12.8 4.96 16.85 11.52 2.64 18.11 32.02 GM_A38083 12.32 5.07 22.23 13.59 2.52 17.46 25.56 GM_A38083 13.22 4.26 20.83 15.89 3.81 14.69 26.12 GM_A38083 13.74 4.61 17.03 20.93 4.84 13.82 23.91 GM_A38084 12.9 4.04 22.66 41.63 3.37 9.07 5.28 GM_A38084 13.38 3.94 28.07 25.81 4.9 11.37 11.42 GM_A38084 13.92 3.75 31.36 32.26 2.89 9.23 5.51 GM_A38084 14.42 4.12 27.17 33.26 3.28 11.57 5.77 GM_A38084 12.74 3.95 22.59 40.82 3.3 9.68 5.91 GM_A38089 13.05 4.48 22.37 42.63 2.55 9.3 4.59 GM_A38089 13.15 4.63 18.82 53.48 0 9.03 0 GM_A38089 12.67 4.41 20.59 51.87 0 9.42 0.07 GM_A38089 12.64 4.29 20.56 52.58 0 8.96 0 GM_A38089 12.72 4.57 21.81 50.79 0 9.16 0 GM_A38094 12.62 4.57 18.97 52.96 0 9.9 0.11 GM_A38094 13.3 5.08 17.08 34.49 5.35 11.39 12.35 GM_A38094 13.08 4.52 18.38 38.95 5.41 9.88 8.82 GM_A38094 13.41 5 17.27 38.5 5.49 10.26 9.1 GM_A38094 12.58 4.46 20.06 40.28 4.88 9.5 7.25
(88) Individual seed from the pMON77247 transgenic events accumulated similar amounts of SDA as compared to pMON77245, with the exception of event GM_A38083 that accumulated significantly higher levels of SDA. The levels of PA, SA, OA, and LA were similar to the control levels shown in Table 3. Generally, the levels of SDA were greater than those of GLA with an average SDA:GLA ratio for each event ranging from 1:1 to 1.6:1, which was less than that observed for pMON77245.
(89) TABLE-US-00008 TABLE 4 Relative Area Percent Results (Approx. wt percent) from single pMON77247 R1 seeds pMON77247 Fatty Acid (percent wt) Pedigree PA SA OA LA GLA ALA SDA GM_A38909 12.18 4.19 20.66 44.94 3.52 8.65 4.87 GM_A38909 12.25 3.84 22.37 44.89 2.95 8.22 4.46 GM_A38909 12.06 4.67 22.95 43.37 3.31 8.32 4.86 GM_A38909 12.64 4.63 17.61 45.99 3.66 9.01 5.44 GM_A38909 12.28 4.2 19.42 46.1 3.1 9.01 4.82 GM_A38941 13.95 4.87 18.03 40.2 7.08 7.87 6.92 GM_A38941 13.76 4.38 19.72 33.62 8.94 8.57 9.95 GM_A38941 13.15 4.91 17.89 52.06 0.75 9.52 0.8 GM_A38941 12.73 4.27 22.23 42.14 4.98 7.44 5.15 GM_A38941 12.73 4.34 19.37 52.34 0.36 9.53 0.37 GM_A38946 13.02 4.68 17.4 44.66 4.54 8.83 5.89 GM_A38946 13.17 4.42 17.35 43.71 5.01 8.91 6.49 GM_A38946 13.63 4.24 18.96 38.16 6.36 8.89 8.75 GM_A38946 13.32 4.6 17.76 43.37 4.8 8.94 6.2 GM_A38946 13.32 4.5 18.07 43.24 4.71 8.95 6.23 GM_A38977 13.43 5.18 21.3 40.54 4.43 8.51 5.62 GM_A38977 13.6 4.92 21.44 40.95 4.26 8.41 5.42 GM_A38977 13.17 4.23 21.61 38.02 5.45 8.38 8.07 GM_A38977 13.06 4.97 21.93 37.82 5.75 8.63 6.86 GM_A38977 13.33 4.5 22.96 37.43 5.54 8.42 6.76 GM_A39047 13.22 4.21 20.95 31.88 7.8 9.01 11.72 GM_A39047 13.34 4.47 19.14 31.1 7.54 9.9 13.35 GM_A39047 13.79 4.32 18.82 32.97 8.26 9.07 11.68 GM_A39047 13.16 4.38 19.34 29.61 7.94 9.97 14.44 GM_A39047 12.65 4.25 17.48 50.71 1.49 9.92 2.45
Example 4
Activity of the Primula juliae Δ6-Desaturase in Combination with the Neurospora crassa Δ15-Desaturase in Canola
(90) The activity of the Primula juliae Δ6-desaturase in combination with Neurospora crassa Δ15-desaturase was evaluated by transforming canola with the MON82822 (
(91) The pMON82822 vector was constructed by first digesting pMON77214 (PCT US03/16144) with PmeI and BamHI (filled-in) and ligating the resulting native NcD15D napin cassette into the EcoRV site of the 2T binary vector pMON71801 to generate pMON82820. Next, pMON82819 was digested with NotI, the ends were filled in and the resulting PjD6D-2 napin expression cassette was ligated into the filled-in AscI site of pMON82820 to generate pMON82822.
(92) A second vector, pMON82821, was also constructed containing the codon-optimized NcD15D (SEQ ID NO:17) and PjD6D-2 pMON82821 by first digesting pMON67011 with SalI and Sse8387I and ligating the resulting PjD6D-2 fragment into the SalI and XhoI (filled-in) sites of the napin expression cassette in pMON82800 giving pMON82819. The napin cassette containing a codon-optimized NcD15D was constructed by digesting pMON67024 with PmeI and BamHI (filled-in) and ligating the resulting fragment into an EcoRV-digested 2T binary vector, pMON71801, giving pMON82801. Finally, pMON82819 was digested with NotI, filled-in and the resulting PjD6D-2 napin expression cassette was ligated into the filled in NotI site of pMON82801 giving pMON82821.
(93) pMON82822 was transformed into canola (Brassica napus) using a modification of the protocol described by Radke et al., (Plant Cell Reports 11:499-505, 1992). Briefly canola seed of the cultivar ‘Ebony’ (Monsanto Canada, Inc., Winnipeg, Canada) were disinfected and germinated in vitro as described in Radke et al., 1992. Precocultivation with tobacco feeder plates, explant preparation and inoculation of explants with Agrobacterium tumefaciens strain ABI (Koncz and Schell, Mol Gen Genet. 204:383-396 (1986)) containing the desired vector were as described with the Agrobacterium being maintained in LB media (solid or liquid) containing 75 mg/l spectinomycin, 25 mg/l chloramphenicol and 50 mg/l kanamycin. For plant transformation including callus induction, shoot regeneration, maturation and rooting, glyphosate selection was used rather than the kanamycin selection as described in Radke et al., 1992. Specifically, the B5-1 callus induction medium was supplemented with 500 mg/l carbenicillin and 50 mg/l Timentin (Duchefa Biochemie BV) to inhibit the Agrobacterium growth and kanamycin was omitted from the media. B5BZ shoot regeneration medium contained, in addition, 500 mg/l carbenicillin, 50 mg/l Timentin and 45 mg/l glyphosate with explants being transferred to fresh medium every two weeks.
(94) Glyphosate selected shoots were transferred to hormone-free B5-0 shoot maturation medium containing 300 mg/l carbenicillin and 45 mg/l glyphosate for two weeks and finally shoots were transferred to B5 root induction medium containing 45 mg/l glyphosate. Rooted green plantlets were transplanted to potting soil and acclimated to green house conditions. Plants were maintained in a greenhouse under standard conditions. The fatty acid composition of mature seed was determined by GC analysis of methyl ester derived lipids as done above for soybean transformants. The GC analysis of canola seed from plants transformed with pMON82822 yielded 199 events with SDA levels ranging from 0.12 to 4.49% (weight %, 100 seed pool).
Example 5
Construction and Transformation of PjD6D Expression Vectors for Soy, Corn and Canola
(95) The expression of the PjD6D sequences alone is evaluated in planta for canola, corn and soybean under the expression a seed-specific promoter. A soybean expression vector is constructed by digesting pMON77243 with Not I, and ligating the resulting fragment containing PjD6D-2 into the Not I site of the binary vector pMON17227. A canola expression vector is constructed by digesting pMON83950 with SalI and Sse8387I (made blunt) and ligating the resulting fragment, which contains the coding region of PjD6D-1 into the SalI and XhoI (filled-in) sites of the seed-specific napin expression cassette vector pMON82800. The resulting plasmid is then digested with Not I followed by ligating the resulting napin-PjD6D-1 expression cassette into the Not I site of the binary vector pMON17227. A corn expression vector is constructed by digesting pMON83950 with Sal I (filled-in) and Sse83872I (made blunt) and ligating the resulting PjD6D-1 fragment into the SfiI (made blunt) site of the globulin expression cassette in pMON71084. The resulting vector is then digested with PmeI and HindIII and the expression cassette is then ligated into the HpaI and HindIII sites of the binary vector pMON30167.
(96) The activity of the P. juliae Δ6-desaturase in corn is evaluated in combination with a Neurospora crassa Δ15-desaturase codon-optimized for corn (NcD15Dnno) (SEQ ID NO:20). The vector pMON67011 is digested with SalI and Sse8387I (made blunt) and the resulting PjD6D-2 fragment is ligated into the SfiI (fill-in) site of the globulin expression cassette in pMON71084 to give pMON82823. Next, pMON82806 (PCT US03/16144) is digested with PmeI and HindIII and the resulting globulin NcD15Dnno cassette is ligated into the NotI (fill-in) and HindIII sites of the 1T binary vector pMON30167 to give pMON82824. Finally the globulin PjD6D-2 cassette is combined with globulin NcD15Dnno by digesting pMON82823 with PmeI and HindIII and ligating the resulting fragment into the SmaI and HindIII sites of pMON82824 giving pMON82825. The resulting vector is introduced into maize via Agrobacterium tumefaciens-mediated transformation as known to one of skill in the art, e.g., U.S. Pat. No. 6,603,061.
Example 6
Cloning of Primula waltonii and Primula alpicola Δ6 Desaturase Sequences
(97) Cloning of the Primula waltonii Δ6 desaturase (PwD6D) and P. alpicola Δ6 desaturase (PaD6D) genes was achieved by PCR amplification of a partial internal genomic DNA region using degenerate oligonucleotides, followed by bi-directional genomic walking. Total genomic DNA was isolated from P. waltonii and P. alpicola (Collector's Nursery) using the DNeasy Plant Mini Kit (Qiagen), following the manufacturer's procedure. Two fragments were isolated from the P. alpicola genomic DNA using the degenerate oligonucleotides BO-1 For and BO-2 Rev as described by Garcia-Maroto et al. 2002:
(98) TABLE-US-00009 (SEQ ID NO: 6) BO-1 For: 5′-ATMAGYATYGGTTGGTGGAARTGG-3′ (SEQ ID NO: 7) BO-2 Rev: 5′-AATCCACCRTGRAACCARTCCAT-3′
(99) The first P. alpicola fragment was 550 bp in length and corresponded to positions 553 to 1103 of SEQ ID NO:21. This fragment was cloned into pCR®4-TOPO® (Invitrogen) to yield the vector pMON83977 (no intron). The second P. alpicola fragment was 550 bp in length and corresponded to positions 763 to 1313 of SEQ ID NO:23. This fragment was cloned into pCR®4-TOPO® (Invitrogen) to yield the vector pMON83975 (contains intron). One fragment was obtained from P. waltonii that was 550 bp in length and corresponded to positions 763 to 1313 of SEQ ID NO:25. This fragment was cloned into pCR®4-TOPO® (Invitrogen) to yield the vector pMON83976. The polypeptide sequences encoded by SEQ ID NOs:21, 23 and 25 are given in SEQ ID NOs:22, 24 and 26, respectively.
(100) To determine the genomic flanking sequences of the pMON83975, pMON83976, and pMON83977 inserts, a Universal Genome Walker Kit™ (BD Biosciences) was utilized, following the manufacture's procedure. Four genomic libraries for each Primula species were generated by digesting the DNA with four restriction enzymes: EcoRV, PvuII, StuI, and DraI. After a purification step, the digestions were ligated to an adapter provided in the kit. The procedure then involved two PCR reactions, each with a gene-specific primer and an adapter-primer. The secondary PCR reaction used a dilution of the primary PCR reaction products as a template.
(101) A. pMON83975 (PaD6D-2)
(102) For the 5′ direction, primers PD6D R7 and PD6D R1 were used for the primary and secondary PCR reactions, respectively. For the 3′ direction, primers PD6D F7 and PD6D F1 were used for the primary and secondary PCR reactions, respectively. The primer sequences are given below:
(103) TABLE-US-00010 (SEQ ID NO: 27) PD6D R7: 5′-CACACATGACCGGATAAAACGTCCAGT-3′ (SEQ ID NO: 28) PD6D R1: 5′-AGGGATATACTGGAGGTCGGGGTCGTA-3′ (SEQ ID NO: 29) PD6D F7: 5′-GAGCTATTCCGTTACGGGGATACAACA-3′ (SEQ ID NO: 30) PD6D F1: 5′-TGCAGGGACACTTAACATATCGTGCCC-3′
(104) Genome walking in the 5′ direction yielded a 751 bp fragment from the EcoRV library. This product was cloned into pCR®4-TOPO® (Invitrogen) giving pMON83978, and the insert was sequenced. The resulting sequence did not contain a start codon of the putative delta 6 desaturase gene and thus another set of PCR reactions was performed using gene specific primers designed to walk in the 5′ direction from the pMON83978 insert. The primers used for the second genome walking set in the 5′ direction were PD6D R17 and PD6D R16 for the primary and secondary PCR reactions, respectively. The sequences are given below:
(105) TABLE-US-00011 (SEQ ID NO: 31) PD6D R17: 5′-GTGAAAGTTGTTGAGGAGGGATCGGTA-3′ (SEQ ID NO: 32) PD6D R16: 5′-GTGGAAGGAGGATGGTAAGCGAGGAAA-3′
(106) A product of 473 bp in length from the PvuII library was cloned into pCR®4-TOPO® giving pMON83980 and the insert was sequenced. This insert contained a start codon corresponding to position 1 of SEQ ID NO:23. Genome walking in the 3′ direction resulted in a 942 bp fragment from the DraI library. This product was cloned into pCR®4-TOPO®, giving pMON83979. The insert was sequenced and found to contain 294 bp of the coding region for the putative delta 6 desaturase gene, followed by a stop codon at position 1549 with respect to SEQ ID NO:23.
(107) The inserts of pMON83975, pMON83978, pMON83980 and pMON83979 were aligned to form a composite sequence of a putative Δ6 desaturase gene for P. alpicola giving PaD6D-2, SEQ ID NO:23. Two primers were designed to PCR amplify the complete open reading frame from P. alpicola genomic DNA. The primer sequences are given below:
(108) TABLE-US-00012 Pa D6D F1: (SEQ ID NO: 33) 5′-GTCGACATGGCTAACAAATCTCAAACAGGTTAC-3′ Pa D6D R1: (SEQ ID NO: 34) 5′-CCTGCAGGTCACCCGAGAGTTTTAACAGCCTCC-3″
The PCR amplified fragment (SEQ ID NO:23) was then ligated into the yeast expression vector pYES2.1-TOPO giving the vector pMON83968.
(109) B. pMON83976 (PwD6D)
(110) A putative Δ6 desaturase was PCR amplified from P. waltonii genomic DNA using the primers Pa D6D F1 (SEQ ID NO:33) and Pa D6D R1 (SEQ ID NO:34) shown above. The PCR amplified fragment (SEQ ID NO:25) was then ligated into the yeast expression vector pYES2.1-TOPO giving the vector pMON83967.
(111) C. pMON83977 (PaD6D-1)
(112) For the 5′ direction, primers PD6D R9 and PD6D R4 were used for the primary and secondary PCR reactions, respectively. For the 3′ direction, primers PD6D F9 and PD6D F4 were used for the primary and secondary PCR reactions, respectively. The primer sequences are given below:
(113) TABLE-US-00013 (SEQ ID NO: 35) PD6D R9: 5′-CACACATTACCGGATAAAACGTCCAGT-3′ (SEQ ID NO: 36) PD6D R4: 5′-AGGAATATACTGGAGGTCTGGGTCGTA-3′ (SEQ ID NO: 37) PD6D F9: 5′-ATTTTTCTTCGGACGTATACATGGGCC-3′ (SEQ ID NO: 38) PD6D F4: 5′-TTCGGGGACACTGAACATATCGTGCCC-3′
(114) Genome walking in the 5′ direction yielded a 979 bp fragment from the StuI library. This product was cloned into pCR®4-TOPO® (Invitrogen) giving pMON83981, and the insert was sequenced. The resulting sequence contained the start codon of the putative delta 6 desaturase at position 1 with respect to SEQ ID NO:21. Genome walking in the 3′ direction resulted in a 1028 bp fragment from the DraI library. This product was cloned into pCR®4-TOPO® (Invitrogen), giving pMON83982. The insert was sequenced and found to contain 295 bp of the coding region for the putative delta 6 desaturase gene, followed by a stop codon at position 1339 with respect to SEQ ID NO:21.
(115) The inserts of pMON83977, pMON83981 and pMON83982 were aligned to form a composite sequence of a second putative Δ6 desaturase gene for P. alpicola giving PaD6D-1, SEQ ID NO:21. Two primers were designed to PCR amplify the complete open reading frame from P. alpicola genomic DNA. The primer sequences are given below.
(116) TABLE-US-00014 Pf D6D-F2: (SEQ ID NO: 39) 5′-GTCGACATGGCCAACACTAGTTACATTTCCAGCT-3′ Pf D6D-R2: (SEQ ID NO: 40) 5′-GATATCACCCCAGAGTGTTAACAGCTTCCCAG-3′
(117) The PCR amplified fragment was then ligated into the yeast expression vector pYES2.1-TOPO giving the vector pMON67026 (SEQ ID NO 21).
(118) Alignment of PaD6D-2 and PwD6D (also abbreviated PRIwaD6D) with other characterized plant Δ6 desaturase genes revealed that these two genes contained a single intron corresponding to positions 476 to 676 in SEQ ID NO:23 and positions 476 to 651 in SEQ ID NO:25. This has been observed in Δ6 desaturases from Primula and Echium species (Sayanova et al., 2003, Garcia-Maroto et al., 2002).
(119) The three Δ6 desaturase clones encode potential polypeptides of 446 amino acids for PaD6D-1 (SEQ ID NO:22), 449 amino acids for PaD6D-2 (SEQ ID NO: 24) and 449 amino acids for PwD6D (SEQ ID NO: 26). These sequences have high similarity to other plant Δ6 desaturases (
Example 7
Cloning Additional Primula Δ6 Desaturase Sequences
(120) Genomic DNA was isolated from P. farinosa and P. florindae using a Sarkosyl/CTAB lysis system. Five grams of tissue from each species was ground in a mortar and pestle with liquid nitrogen until ground into a fine powder. The powdered tissue was then resuspended in lysis buffer (140 mM sorbitol, 220 mM Tris-HCl, pH 8.0, 22 mM ethylenediaminetetraacetic acid (EDTA), 800 mM sodium chloride (NaCl), 1% N-laurylsarcosine and 0.8% hexadecyltrimethyl ammonium bromide (CTAB)) and incubated for 1 hour at 65° C. with gentle inversion every 10 minutes. After incubation, 10 ml of chloroform was added to the lysis suspension and incubated at room temperature with gentle rocking for 20 minutes. The lysis suspension was centrifuged for 10 minutes at 12,000×g. The aqueous layer was transferred to a clean tube and the nucleic acid precipitated with 0.6% isopropanol. The nucleic acid pellet was resuspended in 4 ml of a solution containing 10 mM Tris-HCl, pH 8.0, 1 mM EDTA, 1 M NaCl and 20 mg Proteinase K. The resuspended nucleic acid was then incubated for 2 hours at 63° C. The Proteinase K was then heat inactivated by incubation at 75° C. for 20 minutes. RNase (2.5 μg) was added to the solution and incubated at 37° C. for 1 hour. The solution was extracted with an equal volume of phenol:chloroform:isoamylalcohol (25:24:1) 2 times. The purified genomic DNA was then ethanol precipitated.
(121) Approximately, 3 μg of genomic DNA was digested in separate reactions with the restriction endonucleases, EcoRI, HindIII, KpnI, SalI and XhoI. After digestion, each reaction was purified using a QIAquick® PCR Purification Kit (Qiagen, Valencia, Calif.), following the manufacturer's protocol. The digested genomic DNA was eluted from the purification columns using 100 μl of elution buffer supplied in the kit. Ligation favoring intramolecular interactions was performed in a 200 μl volume using 20 μl of the eluted digested genomic DNA in a PEG-free ligation reaction with 800 units of ligase (M0202L) (New England Biolabs, Beverly Mass.) overnight at 16° C., followed by heat inactivation at 75° C. for 10 minutes. After ligation, the reaction was again purified using a QIAquick® PCR Purification Kit. Inverse PCR was performed using 6-20 ng of purified ligated DNA and from 10-20 pg of primer and the Expand Long Template PCR System (Roche Applied Science, Indianapolis, Ind.). Primers are shown in Table 5 and were designed using a combination of available sequence data and data covering the desaturase domain. Thermal cycle conditions consisted of an initial incubation at 94° C. for 2 minutes; 10 cycles of 94° C. for 20 seconds, 52° C. for 30 seconds and 68° C. for 8 minutes; followed by 25 cycles of 94° C. for 30 seconds, 52° C. for 30 seconds and 68° C. for 8 minutes plus 10 seconds per cycle. After cycling was complete, a further incubation at 68° C. for 7 minutes was performed. Inverse PCR library products visible after agarose electrophoresis were cloned into either pCR®2.1-TOPO or pCR®4Blunt-TOPO (Invitrogen) following the manufacturer's protocol. The following inverse library fragments (with approximate size) were cloned: P. farinosa-EcoRI (6 kb) and P. florindae-HindIII (3 kb). The DNA sequencing was performed on an Applied Biosystems 3730×1 DNA Analyzer, using Big Dye® Terminator v3.0.
(122) TABLE-US-00015 TABLE 5 Primers and fragments used in inverse PCR deter- mination of the 5′ and 3′ regions of the delta 6 desaturase genes. SEQ ID Species Primer Sequence NO: P. Pf1107F1 TGGAGGTCTGGGTCGTAATC 41 farinosa Pf1107R1 CTTCGGACGTATACATGGGC 42 P. Pf1113-1F2 TCGTAATCCAGGCTATTGCA 43 florindae Pf1113-1R2 TTTTCTTCGGACGTCCATGT 44
(123) Putative sequences were aligned with public data to determine the approximate region of the open reading frame (ORF) covered for each gene. Primers to amplify the ORF of each gene were designed based upon the aligned inverse PCR data. Proofreading polymerases were used to amplify the putative delta 6 genes to insure fidelity of the final product. The primers used in the final cloning of the putative delta 6 desaturase genes are shown in Table 6. The products were cloned into either pUC19 or pCR®4Blunt-TOPO (Invitrogen). DNA sequencing was performed on an Applied Biosystems 3730×1 DNA Analyzer, using Big Dye® Terminator v3.0. Two putative delta 6 desaturase genes were cloned: P. farinosa (PfaD6D) (pMON84809) (SEQ ID NO:45) and P. florindae (PflD6D) (pMON84810) (SEQ ID NO:47).
(124) TABLE-US-00016 TABLE 6 Primers used to amplify delta 6 desaturase genes. Primer Sequence SEQ ID NO: Pfarinosa754F GACGATTTTTGAGTGAGAGTTAATTTGAGTCAATAATA 49 Pfarinosa2447R CGACATCATAGACAATCATCAAGACACCGT 50 PflorindaestartF ATACCCCCTCAAAACACCCCCAAAT 51 PflorindaestopR CTCAATATCACCCGAGAGTTTTAACAGCCT 52
(125) Two primers were designed to amplify the complete PfaD6D open reading frame from pMON84809. The resulting fragment was ligated into the yeast expression vector pYES2.1-TOPO giving pMON67065. The two primers are given below.
(126) TABLE-US-00017 (SEQ ID NO: 53) Pfar F1: 5′-GTCGACAACAATGTCCAACACATATCCACCAAATC-3′ (SEQ ID NO: 54) Pfar R1: 5′-CCTGCAGGTCACCCCAGAGTGTTAACAGCTTC-3′
(127) Two primers were designed to amplify the complete PflD6D gene containing two exons and one intron from pMON84810. The resulting fragment was ligated into vector pYES2.1-TOPO giving pMON67067. The two primers are given below.
(128) TABLE-US-00018 (SEQ ID NO: 55) Pw F1: 5′-GTCGACATGGCTAACAAATCTCAAAC-3′ (SEQ ID NO: 56) Pw R2: 5′-CCTGCAGGTCACCCGAGAGT-3′
(129) The two Δ6 desaturase clones encode potential polypeptides of 454 amino acids for PfaD6D (SEQ ID NO:46) and 449 amino acids for PflD6D (SEQ ID NO:48). These sequences have high similarity to other plant Δ6 desaturases (
Example 8
Intron Removal
(130) Alignment of the three Primula clones PaD6D-2 (SEQ ID NO:22), PwD6D (SEQ ID NO:25), and PflD6D (SEQ ID NO:47) revealed extensive similarity between the DNA sequences. PaD6D-2 had approximately 97% identity to PwD6D and approximately 98% identity to PflD6D. PwD6D had approximately 98% identity to PflD6D. A 2-step PCR procedure was utilized to remove the intron region from each gene. Briefly, the procedure entails the amplification of the two exons in separate PCRs, followed by a second round of PCR amplification to combine the two exons together. The same set of primers was used for each gene amplification because of the extensive similarity between the three Δ6 desaturase genes.
(131) Two sets of primers were designed to amplify exon1 from the PwD6D insert in pMON83967. The size of the amplified product was 475 bp and corresponded to exon 1 of PwD6D. The two primers are given below.
(132) TABLE-US-00019 Pw F1: (SEQ ID NO: 55) 5′-GTCGACATGGCTAACAAATCTCAAAC-3′ Pw R1: (SEQ ID NO: 57) 5′-GTAATGCCCAGAGTCGTGACCTATCCATCCGCACTGGATCC-3′
(133) Exon 2 was PCR amplified from pMON83967 using the primer sequences shown below. The size of the amplified product was 875 bp.
(134) TABLE-US-00020 Pw F2: (SEQ ID NO: 58) 5′-GATCCAGTGCGGATGGATAGGTCACGACTCTGGGCATTACCG-3′ Pw R2: (SEQ ID NO: 56) 5′-CCTGCAGGTCACCCGAGAGT-3′
(135) The amplified exon1 and exon2 products were then combined together with the primers Pw F1 and Pw R2 to PCR amplify the complete ORF minus the original intron. The resulting 1350 bp fragment was ligated into the yeast expression vector pYES2.1-TOPO giving pMON67062.
(136) The removal of the intron region from PaD6D-2 in pMON83968 and PflD6D in pMON84810 was done utilizing the same procedure as described above for PwD6D. The sizes of the exons were the same as that of PwD6D. The resulting 1350 bp combined exon fragments were ligated into the yeast expression vector pYES2.1-TOPO giving pMON67063 for PaD6D-2 and pMON67064 for PflD6D.
Example 9
Yeast Transformation and Expression
(137) Constructs pMON83950 (
(138) FAMEs were prepared from lyophilized yeast pellets by transmethylation with 0.5 mL 5% (v/v) H.sub.2SO.sub.4 in methanol containing 0.075 mg/mL 2,6-Di-tert-butyl-4-methoxyphenol for 90 min at 90° C. The FAMEs were extracted by addition of 0.9 mL 10% (w/v) NaCl and 0.3 mL of heptane. The heptane layer containing FAMEs was removed and used directly for GC as described in Example 2.
(139) The results shown in Table 7 demonstrate that P. juliae clones pMON67011 and pMON83950, P. alpicola clones pMON67026 and pMON67063, P. waltonii clone pMON67062, P. florindae clone pMON67064, and P. farinosa clone pMON67065 exhibit Δ6 desaturase activity in a yeast expression system. The data in Table 8 demonstrate that each Primula clone encodes a protein with selectivity for either n-3 or n-6 substrate fatty acids.
(140) TABLE-US-00021 TABLE 7 Δ6 desaturase activity of Primula clones in a yeast expression system. Vector Gene FA in medium LA* GLA* ALA* SDA* LacZ-1 LacZ — 0.0 0.0 0.0 0.0 LacZ-2 LacZ — 0.0 0.0 0.0 0.0 LacZ-3 LacZ — 0.0 0.0 0.0 0.0 LacZ-1 LacZ LA + ALA 23.5 0.0 20.6 0.0 LacZ-2 LacZ LA + ALA 20.3 0.0 16.6 0.0 LacZ-3 LacZ LA + ALA 29.1 0.0 28.0 0.0 pMON67011 P. juliae D6D-2 — 0.0 0.0 0.0 0.0 pMON67011 P. juliae D6D-2 — 0.0 0.0 0.0 0.0 pMON67011 P. juliae D6D-2 — 0.2 0.0 0.0 0.0 pMON67011 P. juliae D6D-2 LA + ALA 18.7 6.5 12.2 8.4 pMON67011 P. juliae D6D-2 LA + ALA 14.7 5.4 9.6 7.6 pMON67011 P. juliae D6D-2 LA + ALA 18.6 5.1 14.6 8.8 pMON67026 P. alpicola D6D1 — 0.0 0.0 0.0 0.0 pMON67026 P. alpicola D6D-1 — 0.0 0.0 0.0 0.0 pMON67026 P. alpicola D6D-1 — 0.0 0.0 0.0 0.0 pMON67026 P. alpicola D6D-1 LA + ALA 23.0 3.6 21.8 1.5 pMON67026 P. alpicola D6D-1 LA + ALA 19.1 3.7 17.9 1.5 pMON67026 P. alpicola D6D-1 LA + ALA 22.6 3.1 24.1 1.5 pMON83950 P. juliae D6D-1 — 0.0 0.0 0.0 0.0 pMON83950 P. juliae D6D-1 — 0.0 0.0 0.0 0.0 pMON83950 P. juliae D6D-1 — 0.0 0.0 0.0 0.0 pMON83950 P. juliae D6D-1 LA + ALA 21.2 4.0 14.9 6.7 pMON83950 P. juliae D6D-1 LA + ALA 13.9 4.2 8.8 6.0 pMON83950 P. juliae D6D-1 LA + ALA 21.7 4.3 16.8 8.3 pMON67062 P. waltonii D6D — 0.0 0.0 0.0 0.0 pMON67062 P. waltonii D6D — 0.0 0.0 0.0 0.0 pMON67062 P. waltonii D6D — 0.0 0.0 0.0 0.0 pMON67062 P. waltonii D6D LA + ALA 17.5 5.7 12.1 7.1 pMON67062 P. waltonii D6D LA + ALA 12.8 4.8 8.6 6.0 pMON67062 P. waltonii D6D LA + ALA 20.9 5.2 16.8 8.4 pMON67063 P. alpicola D6D-2 — 0.0 0.0 0.0 0.0 pMON67063 P. alpicola D6D-2 — 0.0 0.0 0.0 0.0 pMON67063 P. alpicola D6D-2 — 0.0 0.0 0.0 0.0 pMON67063 P. alpicola D6D-2 LA + ALA 19.9 3.7 13.4 6.7 pMON67063 P. alpicola D6D-2 LA + ALA 16.0 3.6 9.5 5.6 pMON67063 P. alpicola D6D2- LA + ALA 19.8 3.6 14.9 7.8 pMON67064 P. florindae D6D — 0.0 0.0 0.0 0.0 pMON67064 P. florindae D6D — 0.0 0.0 0.0 0.0 pMON67064 P. florindae D6D — 0.0 0.0 0.0 0.0 pMON67064 P. florindae D6D LA + ALA 17.4 5.6 12.0 6.9 pMON67064 P. florindae D6D LA + ALA 12.8 4.8 8.3 5.9 pMON67064 P. florindae D6D LA + ALA 17.1 4.5 14.6 8.3 pMON67065 P. farinosa D6D — 0.0 0.0 0.0 0.0 pMON67065 P. farinosa D6D — 0.0 0.0 0.0 0.0 pMON67065 P. farinosa D6D — 0.0 0.0 0.0 0.0 pMON67065 P. farinosa D6D LA + ALA 22.1 0.9 19.7 0.3 pMON67065 P. farinosa D6D LA + ALA 28.8 0.8 27.5 0.2 pMON67065 P. farinosa D6D LA + ALA 21.1 0.8 22.7 0.3 *Reported as a % of the total for all analytes included in the GC-FID chromatogram, including (16:0, 16:1, 18:0, 20:0, 20:1, 20:2, 22:0, 22:1, 22:2)
(141) TABLE-US-00022 TABLE 8 Comparison of n-3:n-6 substrate selectivities for Primula Δ6 desaturases. % conv. % conv Ratio Sample Vector Gene GLA* SDA* n-3:n-6 1 LacZ-1 LacZ 0.00 0.00 0.00 2 LacZ-2 LacZ 0.00 0.00 0.00 3 LacZ-3 LacZ 0.00 0.00 0.00 4 pMON67011 P. juliae D6D-2 25.75 40.64 1.58 5 pMON67011 P. juliae D6D-2 26.98 44.07 1.63 6 pMON67011 P. juliae D6D-2 21.64 37.78 1.75 7 pMON67026 P. alpicola D6D-1 13.60 6.39 0.47 8 pMON67026 P. alpicola D6D-1 16.06 7.83 0.49 9 pMON67026 P. alpicola D6D-1 12.12 5.83 0.48 10 pMON83950 P. juliae D6D-1 15.82 31.14 1.97 11 pMON83950 P. juliae D6D-1 23.23 40.72 1.75 12 pMON83950 P. juliae D6D-1 16.58 32.92 1.99 13 pMON67062 P. waltonii D6D 24.46 36.80 1.50 14 pMON67062 P. waltonii D6D 27.05 41.15 1.52 15 pMON67062 P. waltonii D6D 19.77 33.41 1.69 16 pMON67063 P. alpicola D6D-2 15.74 33.48 2.13 17 pMON67063 P. alpicola D6D-2 18.53 36.82 1.99 18 pMON67063 P. alpicola D6D-2 15.37 34.39 2.24 19 pMON67064 P. florindae D6D 24.34 36.72 1.51 20 pMON67064 P. florindae D6D 27.29 41.56 1.52 21 pMON67064 P. florindae D6D 20.96 36.13 1.72 22 pMON67065 P. farinosa D6D 4.07 1.25 0.31 23 pMON67065 P. farinosa D6D 2.77 0.79 0.29 24 pMON67065 P. farinosa D6D 3.70 1.09 0.29 *The percentage conversion to GLA was calculated by dividing the value for GLA (Table 1) by the sum of the values for LA and GLA (Table 1). The same calculation was made for SDA using the sum of ALA and SDA (Table 1). **The n-3:n-6 ratio was calculated by dividing the % conv. SDA by % conv. GLA.
Example 10
Arabidopsis Cloning, Transformation and Expression
(142) After confirming activity of the Primula Δ6 desaturases in yeast, the genes were then cloned into pMON73273 (a binary vector containing the constitutive 35S CaMV promoter) for expression in Arabidopsis thaliana to determine activity in planta. PwD6D and PaD6D-2 were cloned with introns intact. The following vectors were transformed into Arabidopsis: pMON83961 (MaD6D) (
(143) Arabidopsis plants were grown by sowing seeds onto 4 inch pots containing reverse osmosis water (ROW) saturated MetroMix 200 (The Scotts Company, Columbus, Ohio). The plants were vernalized by placing the pots in a covered flat, in a growth chamber at 4-7° C., 8 hours light/day for 4-7 days. The flats were transferred to a growth chamber at 22° C., 55% relative humidity, and 16 hours light/day at an average intensity of 160-200 μEinstein/s/m.sup.2. The cover was lifted and slid back 1 inch after germination, and then was removed when the true leaves had formed. The plants were bottom watered, as needed, with ROW until 2-3 weeks after germination. Plants were then bottom watered, as needed, with Plantex 15-15-18 solution (Plantex Corporation Ottawa, Canada) at 50 ppm N.sub.2. Pots were thinned so that 1 plant remained per pot at 2-3 weeks after germination. Once the plants began to bolt, the primary inflorescence was trimmed to encourage the growth of axillary bolts.
(144) Transgenic Arabidopsis thaliana plants were obtained as described by Bent et al., Science, 265:1856-1860, 1994 or Bechtold et al., C. R. Acad. Sci, Life Sciences, 316:1194-1199, 1993. Cultures of Agrobacterium tumefaciens strain ABI containing one of the transformation vectors pMON69804, pMON69812, or pMON69815 were grown overnight in LB (10% bacto-tryptone, 5% yeast extract, and 10% NaCl with kanamycin (75 mg/L), chloramphenicol (25 mg/L), and spectinomycin (100 mg/L)). The bacterial culture was centrifuged and resuspended in 5% sucrose+0.05% Silwet-77 solution. The aerial portions of whole Arabidopsis thaliana Columbia plants (at about 5-7 weeks of age) were immersed in the resulting solution for 2-3 seconds. The excess solution was removed by blotting the plants on paper towels. The dipped plants were placed on their side in a covered flat and transferred to a growth chamber at 19° C. After 16 to 24 hours the dome was removed and the plants were set upright. When plants had reached maturity, water was withheld for 2-7 days prior to seed harvest. Harvested seed was passed through a stainless steel mesh screen (40 holes/inch) to remove debris.
(145) The harvested seeds described above were sown onto flats containing ROW saturated MetroMix 200 (The Scotts Company). The plants were vernalized and germinated as described above. After true leaves had emerged, the seedlings were sprayed with Roundup to select for transformed plants.
(146) The fatty acid composition of mature seed (R2) was determined by GC analysis of methyl ester derived lipids as done above for soybean seed. Values for pooled seed from each transgenic event are shown in Table 9. The n-3 or n-6 substrate selectivities that were observed in the yeast assays were confirmed in planta.
(147) TABLE-US-00023 TABLE 9 Fatty Acid Analysis of Arabidopsis Seed Gene Pedigree Construct PA SA OA LA GLA ALA SDA MaD6D At_S54435:@ pMON83961 7.47 3.73 14.18 26.31 2.3 17.3 0.72 MaD6D At_S54436:@ pMON83961 7.44 3.91 14.72 25.51 1.72 18.57 0.44 MaD6D At_S54437:@ pMON83961 7.65 3.72 14.51 28.49 0.37 17.97 0 MaD6D At_S54438:@ pMON83961 7.65 3.53 13.55 25.48 2.09 19.18 0.87 MaD6D At_S54439:@ pMON83961 7.7 3.51 13.69 27.81 1.63 17.07 0.45 MaD6D At_S54440:@ pMON83961 7.38 3.55 14.42 25.95 1.6 18.26 0.53 MaD6D At_S54441:@ pMON83961 7.24 3.54 13.53 24.24 4.4 17.68 1.52 MaD6D At_S54442:@ pMON83961 7.29 3.6 14.7 25.31 3.58 16.45 0.98 MaD6D At_S54443:@ pMON83961 7.01 3.61 14.46 27.25 0.44 18.49 0 MaD6D At_S54444:@ pMON83961 7.68 3.75 14.34 27.89 1.19 17.95 0.05 PjD6D-1 At_S54446:@ pMON83962 7.5 3.34 13.52 25.05 2.06 13.81 5.93 PjD6D-1 At_S54447:@ pMON83962 7.29 3.15 14.03 26.18 1.64 14 5.25 PjD6D-1 At_S54448:@ pMON83962 7.2 3.08 13.37 27.24 0.49 17 2.72 PjD6D-1 At_S54449:@ pMON83962 7.24 3.17 14.28 27.52 0.46 16.65 2.44 PjD6D-1 At_S54450:@ pMON83962 7.24 3.18 13.38 26.3 1.32 15.16 4.92 PjD6D-1 At_S54451:@ pMON83962 7.53 3.04 14.49 28.01 1.8 13.03 4.79 PjD6D-1 At_S54452:@ pMON83962 7.59 3.44 13.16 25.54 1.72 13.3 6.69 PjD6D-1 At_S54453:@ pMON83962 7.22 3.21 14.05 26.72 1.14 14.35 4.48 PjD6D-1 At_S54454:@ pMON83962 6.98 3.23 13.48 25.12 2.27 12.62 6.55 PjD6D-1 At_S54455:@ pMON83962 7.34 3.18 14.63 27.07 0.16 18.57 1.1 PjD6D-1 At_S54456:@ pMON83962 7.26 3.44 15.8 27.83 0.5 15.81 2.45 PjD6D-1 At_S54457:@ pMON83962 7.41 3.11 14.03 27.39 1.92 12.97 4.95 PjD6D-1 At_S54458:@ pMON83962 7.2 3.26 13.38 26.18 1.31 14.54 5.1 PjD6D-1 At_S54459:@ pMON83962 7.23 3.16 13.25 26.38 1.32 15.07 4.46 PjD6D-1 At_S54460:@ pMON83962 7.21 3.19 13.48 26.35 1.32 14.36 5.16 PjD6D-1 At_S54461:@ pMON83962 7.18 3.34 13.5 26.64 0.79 15.65 3.96 PjD6D-1 At_S54462:@ pMON83962 7.11 3.15 13.88 27.28 1.12 15.02 3.84 PjD6D-1 At_S54463:@ pMON83962 7.4 3.19 13.37 26.35 0.61 17.58 2.93 PjD6D-1 At_S54464:@ pMON83962 7.57 3.34 13.72 26.12 1.24 15.26 4.69 PaD6D-2 At_S54466:@ pMON83963 7.25 3.18 14.44 26.54 1.46 14.44 4.45 PaD6D-2 At_S54467:@ pMON83963 7.28 3.07 14.66 27.82 0.31 17.25 1.59 PaD6D-2 At_S54468:@ pMON83963 7.34 3.22 15.05 26.37 2.01 13.14 4.86 PaD6D-2 At_S54469:@ pMON83963 6.91 2.94 14.35 26.77 1.32 14.33 4.38 PaD6D-2 At_S54470:@ pMON83963 7.36 3.26 13.31 27.8 1.36 13.39 4.52 PaD6D-2 At_S54471:@ pMON83963 7.14 3.07 14.38 25.73 3.26 11.32 6.18 PaD6D-2 At_S54472:@ pMON83963 7.67 3.28 14.01 27.82 0 19.54 0.3 PaD6D-2 At_S54473:@ pMON83963 7.48 3.27 13.95 26.26 2.12 13.24 5.57 PaD6D-2 At_S54474:@ pMON83963 7.22 3.01 14.95 27.87 1.02 14.5 3.48 PaD6D-2 At_S54475:@ pMON83963 7.44 3.07 13.33 26.46 1.58 14.27 5.24 PaD6D-2 At_S54476:@ pMON83963 7.35 3.17 14.22 27.48 0.8 15.51 3.25 PaD6D-2 At_S54477:@ pMON83963 8.01 2.7 15.85 30.18 0 16.8 0 PaD6D-2 At_S54478:@ pMON83963 7.45 3.05 13.47 27.48 0.13 19.53 0.84 PaD6D-2 At_S54479:@ pMON83963 7.14 2.99 15.32 27.71 0.24 17.74 0.9 PaD6D-2 At_S54480:@ pMON83963 7.37 3.1 14.8 27.87 0.07 18.64 0.45 PaD6D-2 At_S54481:@ pMON83963 7.39 3.2 13.49 27.32 0.1 19.9 0.6 PaD6D-2 At_S54482:@ pMON83963 7.29 3.1 13.72 27.63 0.25 17.96 1.63 PaD6D-2 At_S54483:@ pMON83963 7.04 2.97 15.2 28.08 0 18.71 0.1 PaD6D-2 At_S54484:@ pMON83963 7.09 2.89 14.89 28.18 0.05 19.73 0 PaD6D-2 At_S54485:@ pMON83963 7.17 2.93 15.33 27.21 1.52 13.48 4.57 PjD6D-2 At_S54487:@ pMON83964 7.18 3.06 14.91 27.66 0.79 15.58 3 PjD6D-2 At_S54488:@ pMON83964 7.36 3.09 14.13 27.75 1.34 14.21 4.15 PjD6D-2 At_S54489:@ pMON83964 7.48 2.9 13.86 27.52 0.6 16.94 2.95 PjD6D-2 At_S54490:@ pMON83964 7.39 3.08 14.12 27.93 0.63 16.23 2.88 PjD6D-2 At_S54491:@ pMON83964 7.35 3.05 15.03 28.07 0 19.04 0.16 PjD6D-2 At_S54492:@ pMON83964 7.59 3.07 14.84 27.99 0 19.18 0.33 PjD6D-2 At_S54493:@ pMON83964 7.36 2.97 13.57 28.18 0.68 16.38 2.96 PjD6D-2 At_S54494:@ pMON83964 7.39 3.03 13.37 27.5 0.98 15.71 3.96 PjD6D-2 At_S54495:@ pMON83964 7.46 2.98 13.59 26.97 1.02 16.11 3.83 PjD6D-2 At_S54496:@ pMON83964 7.65 3.02 14.54 27.83 0.35 17.43 1.87 PjD6D-2 At_S54497:@ pMON83964 7.62 2.94 13.64 28.44 0.89 15.27 3.61 PjD6D-2 At_S54498:@ pMON83964 7.55 3.06 14.06 27.53 1.01 14.89 4.37 PjD6D-2 At_S54499:@ pMON83964 7.19 3.12 14.62 26.77 1.55 13.28 5.14 PjD6D-2 At_S54500:@ pMON83964 7.42 2.9 13.83 27.84 0.39 17.55 2.3 PjD6D-2 At_S54501:@ pMON83964 7.51 3.09 14.23 28.21 0 19.5 0.1 PjD6D-2 At_S54502:@ pMON83964 7.41 3 13.56 27.41 0.81 16.36 3.33 PjD6D-2 At_S54503:@ pMON83964 7.33 2.95 13.46 26.74 1.09 15.92 4.28 PaD6D-1 At_S54505:@ pMON83965 7.24 2.97 14.25 27.24 0.96 19.3 0.21 PaD6D-1 At_S54506:@ pMON83965 7.37 3.12 14.25 26.81 1.26 19.08 0.24 PaD6D-1 At_S54507:@ pMON83965 7.48 3.03 15.61 26.86 0.52 18.75 0.09 PaD6D-1 At_S54508:@ pMON83965 7.61 3.07 13.41 25.28 2.2 19.67 0.51 PaD6D-1 At_S54509:@ pMON83965 7.33 3.24 14.21 25.71 2.32 18.64 0.48 PaD6D-1 At_S54510:@ pMON83965 7.66 3.09 15.86 24.84 1.1 18.88 0.23 PaD6D-1 At_S54511:@ pMON83965 7.55 3.08 15.2 25.25 0.94 19.36 0.21 PaD6D-1 At_S54512:@ pMON83965 7.43 3.16 13.51 26 1.37 19.63 0.29 PaD6D-1 At_S54513:@ pMON83965 8.11 3.3 14.94 24.33 0.45 20.26 0.12 PaD6D-1 At_S54514:@ pMON83965 7.35 3.14 14.18 26.35 1.36 19.27 0.36 PaD6D-1 At_S54515:@ pMON83965 7.52 2.95 12.14 26.65 0.63 22.45 0.21 PaD6D-1 At_S54516:@ pMON83965 7.86 3.29 15.13 23.72 0.74 20.03 0.21 PaD6D-1 At_S54517:@ pMON83965 7.2 3.49 15.25 27.77 0.26 18.14 0 PaD6D-1 At_S54518:@ pMON83965 7.17 2.81 15.7 23.13 0.06 20.4 0 PaD6D-1 At_S54519:@ pMON83965 6.9 3.07 15.34 26.65 0.14 19.19 0 PaD6D-1 At_S54520:@ pMON83965 8.64 3.7 15.97 20.96 0.97 18.39 0.28 PaD6D-1 At_S54521:@ pMON83965 7.2 3.19 13.39 26.03 1.63 19.36 0.32 PaD6D-1 At_S54522:@ pMON83965 8.77 3.69 15.83 20.94 0 18.92 0 PaD6D-1 At_S54523:@ pMON83965 7.43 3.33 14.1 26.94 0.23 19.93 0 PwD6D At_S54524:@ pMON83966 7.37 3.17 15.27 25.68 2.72 13.22 4.36 PwD6D At_S54525:@ pMON83966 7.15 3.38 14.38 25.61 2.86 12.9 4.82 PwD6D At_S54526:@ pMON83966 6.87 3.6 14.68 27.25 0.23 17.54 1.19 PwD6D At_S54527:@ pMON83966 7.01 3.45 15.06 26.18 1.43 14.72 3.88 PwD6D At_S54528:@ pMON83966 7.21 3.04 14.6 27.87 0.11 18.52 0.65 PwD6D At_S54530:@ pMON83966 7.59 3.17 15.34 21.81 0.77 17.64 2.92 PwD6D At_S54531:@ pMON83966 7.4 3.58 14.39 26.71 0.4 17.68 1.74 PwD6D At_S54532:@ pMON83966 6.28 3.44 14.76 24.09 2.51 12.87 6.1 PwD6D At_S54533:@ pMON83966 7.01 3.48 14.15 25.54 2.01 12.98 5.54 PwD6D At_S54534:@ pMON83966 7.35 3.35 14.6 26.37 2.25 13.61 4.32 PwD6D At_S54535:@ pMON83966 7.24 3.56 14.59 27.04 0.45 17.02 2.17 PwD6D At_S54536:@ pMON83966 7.22 3.54 13.14 25.92 1.49 15.35 4.53 PwD6D At_S54537:@ pMON83966 7.18 3.6 13.51 26.27 1.61 15.03 4.02 PwD6D At_S54538:@ pMON83966 7.75 3.29 13.57 25.43 2.33 13.96 5.35 PwD6D At_S54539:@ pMON83966 7.15 3.13 14.86 26.63 0.16 18.99 0.35 PwD6D At_S54540:@ pMON83966 7.66 3.28 14.22 26.2 0.97 16.45 3.24 PwD6D At_S54541:@ pMON83966 7.39 2.98 13.83 27.29 0 20.28 0 PwD6D At_S54542:@ pMON83966 7.39 3.32 14.71 26.08 1.56 14 4.18 control At_S54543:@ pMON26140 6.82 3.04 14.82 25.91 0 20.07 0 control At_S54544:@ pMON26140 7.49 3.23 13.69 27.33 0 19.77 0 control At_S54545:@ pMON26140 7.32 3.23 15.05 27.47 0 18.6 0 control At_S54546:@ pMON26140 7.52 3.3 13.73 27.15 0 19.86 0 control At_S54547:@ pMON26140 7.44 3.21 14.21 27.43 0 19.36 0 control At_S54548:@ pMON26140 7.39 3.25 14.1 27.05 0 19.59 0 control At_S54549:@ pMON26140 7.71 3.28 13.61 27.98 0 20 0 control At_S54550:@ pMON26140 7.62 3.24 13.58 28.28 0 18.83 0 control At_S54551:@ pMON26140 7.52 3.18 14.73 27.27 0 19.78 0 control At_S54552:@ pMON26140 7.44 3.21 14.95 27.69 0 18.43 0 control At_S54553:@ pMON26140 7.72 3.26 13.74 27.2 0 19.94 0 control At_S54554:@ pMON26140 7.3 3.11 15.09 27.73 0 18.75 0 control At_S54555:@ pMON26140 7.44 2.99 14.51 29.21 0 18.34 0 control At_S54556:@ pMON26140 7.52 3.19 15.22 27.24 0 18.92 0 control At_S54557:@ pMON26140 7.49 3.07 14.6 28.87 0 18.17 0 control At_S54558:@ pMON26140 7.45 3.11 14.72 27.88 0 18.88 0 control At_S54559:@ pMON26140 7.63 3.26 14.39 27.12 0 19.57 0 control At_S54560:@ pMON26140 7.74 3.15 13.17 28.5 0 19.61 0 control At_S54561:@ pMON26140 7.39 3.15 14.34 27.06 0 19.42 0 control At_S54562:@ pMON26140 7.25 3.12 15.78 27.96 0 17.93 0 control At_S54563:@ pMON26140 7.59 3.24 14.32 27.2 0 19.54 0 control At_S54564:@ pMON26140 6.73 2.82 16.17 26.66 0 18.63 0 control At_S54565:@ pMON26140 7.2 3 15.14 27.78 0 18.66 0 control At_S54566:@ pMON26140 7.33 3.16 14.6 27.28 0 19.26 0
Example 10
Canola Transformation and Expression
(148) The vectors pMON83961, pMON83962, pMON83963, and pMON83964 described in Example 9 were also transformed into Canola according to the methods in Example 4. pMON70500 was included as a negative control. The fatty acid composition of leaves was determined by GC analysis of methyl ester derived lipids. The data is shown in Table 10. Again the substrate selectivities observed in yeast and Arabidopsis were confirmed.
(149) TABLE-US-00024 TABLE 10 Fatty Acid Analysis of Canola Leaf Tissue Event Construct PA SA OA LA GLA ALA SDA BN_G8912 pMON70500 11.64 0.63 0.39 10.68 0 53.2 0 BN_G8913 pMON70500 12.31 0.79 0.57 11.93 0 53.87 0 BN_G8914 pMON70500 16.59 1.72 2.09 20.81 0 47.72 0 BN_G8915 pMON70500 11.74 0.82 0.27 7.86 0 58.66 0 BN_G8918 pMON70500 10.14 0.59 0.35 11.18 0 52.94 0 BN_G8919 pMON70500 10.47 0.75 0.43 13.63 0 50.63 0 BN_G8925 pMON70500 11.3 0.72 0.51 13.69 0 50.95 0 BN_G8926 pMON70500 11.61 0.84 0.77 15.8 0 49.08 0 BN_G8928 pMON70500 10.93 0.69 0.63 16.22 0 49.41 0 BN_G8929 pMON70500 15.53 2.06 2.18 13.04 0 47.53 0 BN_G9007 pMON83961 14.54 1.83 2.23 11.27 3.3 46.08 1.5 BN_G9008 pMON83961 16.91 2.38 1.41 10.26 3.81 46.21 2.01 BN_G9009 pMON83961 17.11 1.86 3.04 16.21 0.48 47.15 0.23 BN_G9011 pMON83961 18.45 2.27 3.2 19.45 7.25 37.69 1.95 BN_G9013 pMON83961 17.95 2.39 2.66 20.5 1.29 44.84 0.37 BN_G9014 pMON83961 16.65 1.94 1.83 12 4.73 42.26 2.79 BN_G9033 pMON83962 16.89 2.23 1.16 16.35 0 50.45 2.52 BN_G9034 pMON83962 15.83 2.16 1.64 15.89 0 50.66 1.11 BN_G9035 pMON83962 16.36 3.18 2.74 23 0 40.73 3.14 BN_G9036 pMON83962 17.01 2.65 2.4 21.09 0.37 41.23 5.12 BN_G9037 pMON83962 16.08 2.64 1.82 17.68 0.17 44.39 3.29 BN_G8828 pMON83963 13.18 1.32 2.58 14 0.15 47.07 4.1 BN_G8829 pMON83963 11.56 1.34 1.42 12.07 0.66 37.31 7.55 BN_G8830 pMON83963 12.49 1.37 1.31 12.24 0.31 41.45 5.87 BN_G9020 pMON83963 16.66 2.54 4.3 23.54 1.42 41.6 0 BN_G9021 pMON83963 16.72 1.91 2.01 14.58 0 47.55 1.36 BN_G9024 pMON83964 18.32 2.63 2.14 25.17 0.63 37.29 5.34 BN_G9025 pMON83964 18.41 2.42 3.16 26.57 0 39.23 0.51 BN_G9026 pMON83964 12.23 1.53 1.8 15.08 0.14 42.48 2.99
(150) All of the compositions and methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure. While the compositions and methods of this invention have been described in terms of preferred embodiments, it will be apparent to those of skill in the art that variations may be applied to the compositions and methods and in the steps or in the sequence of steps of the method described herein without departing from the concept, spirit and scope of the invention. More specifically, it will be apparent that certain agents which are both chemically and physiologically related may be substituted for the agents described herein while the same or similar results would be achieved. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the invention as defined by the appended claims.
REFERENCES
(151) The references listed below are incorporated herein by reference to the extent that they supplement, explain, provide a background for, or teach methodology, techniques, and/or compositions employed herein. U.S. Pat. No. 4,826,877 U.S. Pat. No. 4,910,141 U.S. Pat. No. 5,011,770 U.S. Pat. No. 5,158,975 U.S. Pat. No. 5,302,523 U.S. Pat. No. 5,378,619 U.S. Pat. No. 5,384,253 U.S. Pat. No. 5,464,765 U.S. Pat. No. 5,538,877 U.S. Pat. No. 5,538,880 U.S. Pat. No. 5,550,318 U.S. Pat. No. 5,563,055 U.S. Pat. No. 5,591,616 U.S. Pat. No. 5,952,544 U.S. Pat. No. 6,603,061 Ausubel et al., In: Current Protocols in Molecular Biology, Green Publishing Assoc., NY, 1994. Baerson et al., Plant Mol. Biol., 22(2):255-267, 1993. Bevan et al., Nucleic Acids Res., 11(2):369-385, 1983. Bevan, Nucleic Acids Res., 12:8111, 1984. Bustos et al., J. Bacteriol., 174:7525-7533, 1991. Bustos, et al., Plant Cell, 1(9):839-853, 1989. Callis et al., Genes Dev., 1:1183-1200, 1987. Chen et al., Proc. Natl. Acad. Sci. USA, 83:8560-8564, 1986. Chou and Fasman, Adv. Enzymol., 47:45-148, 1978. de Deckerer, Eur. J. Clin. Nutr., 52:749, 1998. Garcia-Maroto et al., Lipids, 37 (4), 2002 Gelvin et al., In: Plant Molecular Biology Manual, 1990. Goeddel, In: Methods in Enzymology, Perbal (Ed.), Academic Press, John Wiley and Sones, 185, 1988. Hamilton et al., Proc. Natl. Acad. Sci. USA, 93(18):9975-9979, 1996. Hong et al., Plant Mol. Biol., 34(3):549-555, 1997. Horrobin et al., Am. J. Clin. Nutr., 57(Suppl):7325-7375, 1993. Horsch et al., Science, 227:1229, 1985. Huang, Biochem. Biophys. Acta, 1082:319, 1991. James et al., Semin. Arthritis Rheum., 28:85, 2000. Kaeppler et al., Plant Cell Reports, 9:415-418, 1990. Koncz and Schell, Mol. Gen. Genet., 204:383-396, 1986. Kridl et al., Seed Sci. Res., 1:209:219, 1991. Kyte and Doolittle, J. Mol. Biol., 157:105-132, 1982. Manzioris et al., Am. J. Clin. Nutr., 59:1304, 1994. Michaelis et al., Ann. Rev. Microbiol., 36:425, 1982. Napier et al., Biochem. J., 328, 717-720, 1997. Napier et al., Prostaglandins Leukot. Essent. Fatty Acids, 68 (2), 135-143, 2003. Naylor et al., Nature, 405:1017, 2000. Omirulleh et al., Plant Mol. Biol., 21(3):415-28, 1993. PCT Appl. US03/16144 PCT Appl. WO 96/33155 PCT Appl. WO 03/06870 Pedersen et al., Cell, 29:1015-1026, 1982. Potrykus et al., Mol. Gen. Genet., 199(2):169-77, 1985. Potrykus et al., Mol. Gen. Genet., 199:183-188, 1985. Radke et al., Plant Cell Reports, 11:499-505, 1992. Reed et al., Plant Physiol., 122:715-720, 2000. Riggs, et al., Plant Cell, 1(6):609-621, 1989. Russell et al., Transgenic Res., 6(2):157-168 Sambrook et al., In: Molecular cloning, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 2001. Sayanova et al., FEBS Let., 542:100-104, 2003. Sayanova et al., Plant Physiol., 121, 641-646, 1999. Shanklin et al., Biochemistry 33, 12787-12794, 1994. Simopoulos et al., Am. Coll. Nutr., 18:487, 1999. Slocombe et al., Plant Physiol., 104(4):167-176, 1994. Sperling and Heinz, Eur. J. Lipid Sci. Technolo., 103, 158-180, 2001. Van den Broeck et al., Nature, 313:358, 1985. Vasil et al., Plant Physiol., 91:1575-1579, 1989. Wolk et al., Proc. Natl. Acad. Sci. USA, 1561-1565, 1984. Yamazaki et al., Biochem. Biophys. Acta, 1123:18, 19992.