Novel method for identifying deltaT-cell (or gammaT-cell) receptor chains or parts thereof that mediate an anti-tumour or an anti-infective response

20210177901 · 2021-06-17

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention relates to a method for identifying δT-cell (or γT-cell) receptors chains or parts thereof that mediate an anti-tumor or anti-infection response by identifying amino acid sequences comprising δT-cells (or γT-cell) receptors chains or parts thereof that are shared between different donors.

Claims

1. Method for identifying δT-cell or γT-cell receptors chains or parts thereof that mediate an anti-tumor or anti-infection response comprising the steps of: a) providing amino acid sequences obtained from a donor, comprising δT-cell or γT-cell receptor chains or parts thereof each of said receptor chains or parts thereof comprising a CDR3 region; b) identifying amino acid sequences comprising δT-cell or γT-cell receptors chains or parts thereof obtained in step a) that are shared between different donors; c) confirming the anti-tumor or anti-infection response of the δT-cell or γT-cell receptors chains or parts thereof identified in step b) by assessing the anti-tumor or anti-infectious response of a T-cell expressing a nucleic acid molecule encoding the amino acid sequence provided in step a).

2. Method according to claim 1, wherein in step a): a. the donors are human beings, b. at least 2 different donors are used, c. at least one donors, preferably all donors are healthy and/or d. at least one donor is diseased.

3-54. (canceled)

55. A method of treating a disease in a subject in need thereof comprising administering an engineered primary αβ-T cell, wherein said cell comprises a nucleic acid molecule encoding an exogenous γT-cell receptor chain or part thereof comprising a CDR3 region, wherein said nucleic acid molecule is represented by: a) a nucleotide sequence that comprises at least 90% identity with any one of SEQ ID NO: 41, 43, 45, 47, 49, 77, 79, 81, or 93, or; b) a nucleotide sequence that comprises at least 90% identity with any one of SEQ ID 53, 55, 57, 59, 61, 83, 85, 87, or 95, or; c) a nucleotide sequence that encodes an amino acid sequence that comprises at least 90% identity or similarity with any one of SEQ ID NO: 30, 32, 34, 36, 38, 71, 73, 75, or 91, or; d) a nucleotide sequence that encodes an amino acid sequence that comprises at least 90% identity or similarity with any one of SEQ ID NO: 19, 20, 21, 27, 39, 65, 67, 69, or 89.

56. The method of claim 55, wherein the cell comprises an exogenous γT-cell receptor chain represented by an amino acid sequence that comprises at least 90% identity or similarity with any one of SEQ ID NO: 30, 32, 34, 36, 38, 71, 73, 75, or 91.

57. The method of claim 55, wherein the cell comprises a part of an exogenous γT-cell receptor chain comprising a CDR3 region that comprises at least 90% identity or similarity with any one of SEQ ID NO: 19, 20, 21, 27, 39, 65, 67, 69, or 89.

58. The method of claim 55, wherein the subject in need thereof is a human being.

59. The method of claim 55, wherein the disease is a cancer or an infection.

60. The method of claim 59, wherein the disease is a cancer, and wherein said cancer is a solid cancer or a hematological cancer.

61. The method of claim 60, wherein the cancer is leukemia or breast cancer.

62. The method of claim 61, wherein the breast cancer is triple negative breast cancer.

63. The method of claim 59, wherein the disease is an infection caused by a virus, a bacterium, or a fungus.

64. A method of treating a disease in a subject in need thereof comprising administering an engineered primary αβ-T cell, wherein said cell comprises an nucleic acid molecule encoding an exogenous δT-cell receptor chain or part thereof comprising a CDR3 region, wherein said nucleic acid molecule is represented by: a) a nucleotide sequence that comprises at least 90% identity with any one of SEQ ID NO: 26, 42, 44, 46, 48, 76, 78, 80, or 82, or; b) a nucleotide sequence that comprises at least 90% identity with any one of SEQ ID NO: 52, 54, 56, 58, 60, 82, 84, 86, or 94, or; c) a nucleotide sequence that encodes an amino acid sequence that comprises at least 90% identity or similarity with any one of SEQ ID NO: 29, 31, 33, 35, 37, 70, 72, 74, or 90, or; d) a nucleotide sequence that encodes an amino acid sequence that comprises at least 90% identity or similarity with any one of SEQ ID NO: 22, 23, 24, 25, 28, 40, 66, 68, or 88.

65. The method of claim 64, wherein the cell comprises an exogenous δT-cell receptor chain represented by an amino acid sequence that comprises at least 90% identity or similarity with any one of SEQ ID NO: 29, 31, 33, 35, 37, 70, 72, 74, or 90.

66. The method of claim 64, wherein the cell comprises a part of an exogenous δT-cell receptor chain comprising a CDR3 region that comprises at least 90% identity or similarity with any one of SEQ ID NO: 22, 23, 24, 25, 28, 40, 66, 68, or 88.

67. The method of claim 64, wherein the subject in need thereof is a human being.

68. The method of claim 64, wherein the disease is a cancer or an infection.

69. The method of claim 68, wherein the disease is a cancer, and wherein said cancer is a solid cancer or a hematological cancer.

70. The method of claim 69, wherein the cancer is leukemia or breast cancer.

71. The method of claim 70, wherein the breast cancer is triple negative breast cancer.

72. The method of claim 68, wherein the disease is an infection caused by a virus, a bacterium, or a fungus.

73. A method of treating a disease in a subject in need thereof comprising administering an engineered primary αβ-T cell, wherein said cell comprises a nucleic acid molecule encoding an exogenous γT-cell receptor chain or part thereof comprising a CDR3 region, wherein said nucleic acid molecule is represented by: a) a nucleotide sequence that comprises at least 90% identity with any one of SEQ ID NO: 41, 43, 45, 47, 49, 77, 79, 81, or 93, or; b) a nucleotide sequence that comprises at least 90% identity with any one of SEQ ID 53, 55, 57, 59, 61, 83, 85, 87, or 95, or; c) a nucleotide sequence that encodes an amino acid sequence that comprises at least 90% identity or similarity with any one of SEQ ID NO: 30, 32, 34, 36, 38, 71, 73, 75, or 91, or; d) a nucleotide sequence that encodes an amino acid sequence that comprises at least 90% identity or similarity with any one of SEQ ID NO: 19, 20, 21, 27, 39, 65, 67, 69, or 89, and; wherein said cell comprises an nucleic acid molecule encoding an exogenous δT-cell receptor chain or part thereof comprising a CDR3 region, wherein said nucleic acid molecule is represented by: e) a nucleotide sequence that comprises at least 90% identity with any one of SEQ ID NO: 26, 42, 44, 46, 48, 76, 78, 80, or 82, or; f) a nucleotide sequence that comprises at least 90% identity with any one of SEQ ID NO: 52, 54, 56, 58, 60, 82, 84, 86, or 94, or; g) a nucleotide sequence that encodes an amino acid sequence that comprises at least 90% identity or similarity with any one of SEQ ID NO: 29, 31, 33, 35, 37, 70, 72, 74, or 90, or; h) a nucleotide sequence that encodes an amino acid sequence that comprises at least 90% identity or similarity with any one of SEQ ID NO: 22, 23, 24, 25, 28, 40, 66, 68, or 88.

74. The method of claim 73, wherein the cell comprises an exogenous γT-cell receptor chain represented by an amino acid sequence that comprises at least 90% identity or similarity with any one of SEQ ID NO: 30, 32, 34, 36, 38, 71, 73, 75, or 91, and an exogenous δT-cell receptor chain represented by an amino acid sequence that comprises at least 90% identity or similarity with any one of SEQ ID NO: 29, 31, 33, 35, 37, 70, 72, 74, or 90.

75. The method of claim 73, wherein the cell comprises a part of a γT-cell receptor chain comprising a CDR3 region that comprises at least 90% identity or similarity with any one of SEQ ID NO: 19, 20, 21, 27, 39, 65, 67, 69, or 89, and a part of a δT-cell receptor chain comprising a CDR3 region that comprises at least 90% identity or similarity with any one of SEQ ID NO: 22, 23, 24, 25, 28, 40, 66, 68, or 88.

76. The method of claim 73, wherein the subject in need thereof is a human being.

77. The method of claim 73, wherein the disease is a cancer or an infection.

78. The method of claim 77, wherein the disease is a cancer, and wherein said cancer is a solid cancer or a hematological cancer.

79. The method of claim 78, wherein the cancer is leukemia or breast cancer.

80. The method of claim 79, wherein the breast cancer is triple negative breast cancer.

81. The method of claim 77, wherein the disease is an infection caused by a virus, a bacterium, or a fungus.

Description

DESCRIPTION OF THE FIGURES

[0005] FIG. 1. Correction of unique clones for overlapping unique molecular identifiers (UMI's). Ratio between percentage of overlapping unique clones versus percentage of overlapping UMI's based on three healthy donors (HD 18 19 20) is shown.

[0006] FIG. 2. Frequency of overlapping clones when corrected for UMI's and size of repertoire. Ratio between percentage of overlapping unique clones versus percentage of overlapping UMI's divided by the average repertoire size is shown on a logarithmic scale. Data are based on three healthy donors (HD18 19 20).

[0007] FIG. 3. Comparison of NGS sequencing results (amino acids) of the δTCR chains from 4 different donors and the 7.sup.th “virtual” donor as indicated in a Venn diagram. Healthy donor 18, 19, 20, the “combined donor” (HD 11, 12, 15), and the 7.sup.th virtual donor are depicted.

[0008] FIG. 4A, 4B(i)-4B(iii), 4C(i)-4C(ii), 4D. The γδTCR FE11 critically depends on the CD8 co-receptor for tumour recognition. (FIG. 4A) γδT cell clone FE11 was generated by limiting dilution. To assess tumour reactivity, FE11 cells were incubated with Daudi, SW480 or EBV-LCL tumour targets in the presence of control antibody or antibodies blocking CD8α or CD8β. IFNγ secretion was measured by ELISPOT. Healthy PBMCs served as negative control targets. (FIGS. 4B(i), 4B(ii) and 4B(iii)) The TCR γ and δ chains of clone FE11 were sequenced and retrovirally transduced into αβT cells (FIG. 4B(i) left panel; δTCR expression on mock-transduced (light curve) and γδTCR-transduced T cells is indicated). Transfer of γδTCR-mediated tumour-reactivity was tested by co-incubating γδTCR- or mock-transduced T cells (FIG. 4B(ii)), with indicated target cells in an IFNγ ELISPOT (FIG. 4B(iii), right panel). (FIGS. 4C(i) and 4C(ii)) CD4+ and CD8+αβT cells transduced with the FE11 γδTCR were sorted and co-cultured with indicated target cells. T cell activation was assessed by IFNγ ELISPOT. (FIG. 4C(i), mock tranduced; FIG. 4C(ii), FE11 transduced). (FIG. 4D) CD4+ and CD8+αβT cells expressing the FE11 γδTCR were co-incubated with SW480 target cells as in (FIG. 4C(i) and 4C(ii)) but now in the presence of a control antibody or blocking antibodies against CD8α or CD8β. Data are representative of three (FIGS. 4A, 4D), two (FIG. 4B(i)-4B(iii)), and five (FIG. 4C(i)-4C(ii)) separate experiments. Error bars represent S.E.M. (*P<0.01; ***P<0.001).

[0009] FIG. 5A-5E. Overview of shared TCRδ and TCRβ sequences. (FIG. 5A) Overview of shared TCRδ sequences found within healthy donors (dataset 1). The included sequences in the healthy donors all had a clonal frequency >0.1%. On the horizontal axis the number of shared sequences between donors. On the vertical axis the percentage of shared sequences of the total of sequences of those two donors. (FIG. 5B) Overview of shared TCRβ sequences found within healthy donors. On the horizontal axis the number of shared sequences between donors. On the vertical axis the percentage of shared sequences of the total of sequences of those two donors. (FIG. 5C) Overview of shared Vδ2 sequences between the different datasets. On the horizontal axis the number of shared sequences between donors. (FIG. 5D) Overview of shared Vδ1 sequences between the different datasets. On the horizontal axis the number of shared sequences between donors. (FIG. 5E) Overview of shared Vδ3 sequences between the different datasets. On the horizontal axis the number of shared sequences between donor.

[0010] FIG. 6. Vδ gene distribution. The majority of the identified TCRδ sequences by NGS in the periphal blood are of Vδ2 γδ T cells. The frequencies and median of the Vδ gene distribution in 14 healthy donors are shown.

[0011] FIG. 7A-7B. Activated γδ T cells are in contact with the apoptotic tumors positive cells. (FIG. 7A) Double Immunohistochemistry using TCRγ antibody and cleaved caspase 3 (Areas with double positive T cells are indicated with a circle). T in these images indicates tumor tissue (FIG. 7B) Analyses of γδ TILs in TNBC froze section with CD69 as activation marker. Arrow show positive cells, nuclei are stained with DAPI blue.

[0012] FIG. 8A(i)-8A(ii), 8B(i)-8B(ii). Shared TCRδ and TCRγ sequences from γδ TIL. Overview of shared (FIG. 8A(i)-8A(ii)) TCRδ and (FIG. 8B(i)-8B(ii)) TCRγ sequences found in tumor samples of patients with triple negative breast cancer. On the right (FIG. 8A(ii) or FIG. 8B (ii)), the total identified sequences and the unique sequences per patients are shown. On the left (FIG. 8A(i) or FIG. 8B(i)), the overlap between patients is represented by the numbers in the table.

[0013] FIG. 9A-9B. Improved anti-tumor activity of TEG001 when compared to a bulk population of Vγ9Vδ2 T cells. A panel of tumor cell lines (FIG. 9A) or primary AML tumor samples (FIG. 9B) was incubated with TEG001 or with a bulk population of primary γδ T cells with or without 10 μM pamidronate (PAM) for 20 h and IFNγ secretion was measured by ELISPOT. IFNγ spots per 15.000 T cells is shown as mean of triplicates (+SD). Statistical significances were calculated by two-way anova; *p<0.05; **p<0.01; ***p<0.001.

[0014] FIG. 10A-10B. γδ T cell clones and TEGs with shared γ or δ TCR chains. (FIG. 10A) Vδ1 clones isolated from the peripheral repertoire and TEGs engineered with shared S TCR chains show reactivity against different tumor cell lines. Vδ2.sup.negγδ T cell clones of a healthy donor were tested against a broad panel of tumor cell lines by an ELISPOT assay. The reactivity of Fe11 in TEG (TEG-011) format was measured by ELISA. {circumflex over ( )} Indicates shared Vdelta1 chain with D13 and D19. (FIG. 10B) TEG's engineered with shared γ or δ TCR chains isolated from γδ TILs show reactivity against tumor cell lines. Reactivity towards tumor cell lines of γδ TIL TCRs in TEG format as measured was measured by ELISPOT. $ Indicates shared Vγ4 sequence published by Lafarge et al. (51). % Indicates shared Vδ5 sequence within γδ TILs and also published by Lafarge et al (51), & Indicates γ TCR chains sequence published by Uldirch et al. (32). ! Indicates shared Vγ8 sequence. § Indicates shared Vγ2 sequence. ¶ Indicates shared Vγ4 sequence 0 Indicates shared Vδ1 within γδ TILs.

[0015] FIG. 11A-11B. Inhibition of tumor growth and increased overall survival in TEG001 treated tumor bearing mice. NSG mice were treated with TEG001 (n=17) or Mock cells (TEG-LM1, n=7) at day 7 and day 14 after tumor engraftment. (FIG. 11A) Bioluminescence Imaging was used to monitor tumor growth every 7 days. Data represent mean of all mice per group (+/−SEM). (FIG. 11B) Overall survival of treated mice was monitored until the end of the experiment and is presented in the right panel. Statistical significances were calculated by log-rank (Mantel-Cox) test; ****p<0.0001.

[0016] FIG. 12. Tetramer staining of TEG-AU2.3 (CD1d-specific) and TEG-B9.

DESCRIPTION OF THE INVENTION

[0017] Method

[0018] In a first aspect the invention provides a method for identifying δT-cell receptors chains or parts thereof that mediate an anti-tumour or anti-infection response comprising the steps of:

[0019] a) providing amino acid sequences obtained from a donor, comprising δT-cell receptor chains or parts thereof each of said receptor chains or parts thereof comprising a CDR3 region;

[0020] b) identifying amino acid sequences comprising δT-cell receptors chains or parts thereof obtained in step a) that are shared between different donors;

[0021] c) confirming the anti-tumour or anti-infection response of the δT-cell receptors chains or parts thereof identified in step b) by assessing the anti-tumour or anti-infection response of a T cell expressing a nucleic acid molecule encoding the amino acid sequence provided in step a).

[0022] In a second aspect the invention provides a method for identifying γT-cell receptors chains or parts thereof that mediate an anti-tumour or anti-infection response comprising the steps of:

[0023] a) providing amino acid sequences obtained from a donor, comprising γT-cell receptor chains or parts thereof each of said receptor chains or parts thereof comprising a CDR3 region;

[0024] b) identifying amino acid sequences comprising γT-cell receptors chains or parts thereof obtained in step a) that are shared between different donors;

[0025] c) confirming the anti-tumour or anti-infection response of the γT-cell receptors chains or parts thereof identified in step b) by assessing the anti-tumour or anti-infection response of a T cell expressing a nucleic acid molecule encoding the amino acid sequence provided in step a).

[0026] Unless otherwise indicated herein, the explanation provided for each feature of the method of the first aspect below also holds for each feature of the method of the second aspect; the only difference being that the method of the second aspect deals with the identification of γT-cell receptor chains or parts thereof whereas the method of the first aspect deals with the identification of δT-cell receptor chains or parts thereof.

[0027] Step a of the Method of the First and Second Aspects

[0028] Step a) comprises the provision of the amino acid sequences from a donor, comprising δT-cell (or γT-cell for the method of the second aspect) receptor chains or parts thereof comprising a CDR3 region. In a first place, T cells or T lymphocytes should be first isolated.

[0029] T cells, or T lymphocytes, belong to a group of white blood cells named lymphocytes, which play a role in cell-mediated immunity. T cells originate from hematopoietic stem cells in the bone marrow, mature in the thymus (that is where the T is derived from), and gain their full function in peripheral lymphoid tissues. During T-cell development, CD4.sup.−CD8.sup.−T-cells (negative for both the CD4 and CD8 co-receptor) are committed either to an αβ or γδ fate as a result of an initial β or δ TCR gene rearrangement. Cells that undergo early β chain rearrangement express a pre-TCR structure composed of a complete β chain and a pre-TCRα chain on the cell surface. Such cells switch to a CD4.sup.+CD8.sup.+ state, rearrange the TCRα chain locus, and express a mature αβTCR on the surface. CD4.sup.−CD8.sup.− T cells that successfully complete the 7 gene rearrangement before the β gene rearrangement express a functional 7δTCR and remain CD4.sup.−CD8.sup.−. (Claudio Tripodo et al. Gamma delta T cell lymphomas Nature Reviews Clinical Oncology 6, 707-717 (December 2009)). The T cell receptor associates with the CD3 protein complex. Mature T cells, i.e. expressing a αβTCR or a γδ TCR, express the T cell receptor complex on the cell surface. The γδT-cells, which constitute about 1-5% of the total population of T cells, can be divided in further subpopulations. A subpopulation of γδT-cells constitutes γ9δ2T-cells, which express a γ9δ2TCR. Within the extracellular domain of a T cell receptor three complementarity determining regions (CDR1, CDR2, CDR3) are located. These regions are in general the most variable domains and contribute significantly to the diversity among TCRs. CDR regions are composed during the development of a T-cell where so-called Variable-(V), Diverse-(D), and Joining-(J)-gene segments are randomly combined to generate diverse TCRs. Of the three CDR regions CDR3, for both αβ T-cells and γδ T-cells, is the most variable one, and is therefore the key player in antigen/ligand recognition.

[0030] αβT cells may be defined with respect to function as T lymphocytes that express an αβTCR, which recognize peptides bound to MHC molecules (major histocompatibility complex), which are expressed on the surface of various cells. MHC molecules present peptides derived from the proteins of a cell. When for example a cell is infected with a virus, the MHC will present viral peptides, and the interaction between the αβTCR on the T cell and the MHC-complex on the target cell (i.e. the virus infected cell) activates specific types of T-cells which initiate and immune responses to eliminate the infected cell. Hence, αβT cells may be functionally defined as being cells capable of recognizing peptides bound to MHC molecules. αβT cells may be selected from peripheral blood for example via the CD3 antigen as described below and in the examples, as the large majority of T cells have the αβTCR. αβT cells may also be selected with an antibody specific for the αβTCR, such as described below. From such selected cells, the nucleic acid (or amino acid) sequence corresponding to the αT-cell receptor chain and the βT-cell receptor chain may be determined by sequencing, preferably as carried out in the experimental part. Hence, αβT-cells may also be defined as being cells comprising a nucleic acid (or amino acid) sequence corresponding to the αT-cell receptor chain and/or the βT-cell receptor chain.

[0031] γδT-cells may be functionally defined in that they are specifically and rapidly activated by e.g. a set of non-peptidic phosphorylated isoprenoid precursors, collectively named phosphoantigens or stress signals medicated by non classical HLA molecules like CD1. Phosphoantigens are produced by virtually all living cells, though the levels are usually very low in healthy cells, and increased in transformed/malignant cells or cells infected with e.g. Mycobacterium tuberculosis, which deliver a derivate of phosphoantigens. The most common phosphoantigen found in human cells (including cancer cells) is isopentenyl pyrophosphate (IPP) and its isomer dimethylallyl pyrophosphate (DMAPP). Activation of γδT-cells comprises clonal expansion, cytoxic activity and expression and release of cytokines. γδT-cells are also defined by expression of the γδ T cell receptor. For example, cells may be selected using an antibody specific for the γδ T cell receptor such as described below. From such selected cells, the nucleic acid (or amino acid sequence) sequence corresponding to the γT-cell receptor chain and/or the δT-cell receptor chain may be determined by sequencing, preferably as carried out in the experimental part. Hence, γδT-cells may also be defined as being cells naturally comprising a nucleic acid (or amino acid) sequence corresponding to a γT-cell receptor chain and/or a δT-cell receptor chain.

[0032] The person skilled in the art is well capable of selecting and/or identifying cell populations characterized by expression of an antigen or receptor on the surface of the cell such as described throughout herein. It is understood that with regard to expression on the surface of cells, such as CD3, CD4, CD8, αβTCR, and γδ TCR, this is typically done in a population of cells of which a portion of cells have a much higher level of expression of the antigen when compared to cells having a lower level of expression.

[0033] Hence, the terms positive or negative are to be understood as being relative, i.e. positive cells have a much higher expression level as compared to cells being negative. Cells being negative in this sense may thus still have an expression level which may be detected.

[0034] Expression on the surface of cells may be analyzed using Fluorescence Activated Cell Sorting (FACS), and many specific antibodies are commercially available, e.g. such as for CD3, CD4, CD8, αβTCR, and γδTCR that are suitable for such FACS analysis, such as described in the examples and as available. γδTCR may be γ9δ2TCR. As an example, αβ T cells can also be defined and selected as being positive for αβTCR in FACS. The same holds for γδ T cells. Antibodies suitable for FACS or similar separation techniques (such as e.g. antibodies conjugated to magnetic beads) are widely available. Conditions are selected, such as provided by the antibody manufacturer that allows the selection of negative and/or positive cells. Examples of antibodies that may be suitable for selection of γδ-T cells, or engineered γδT cells or 1982 T cells or engineered γ9δ2 T cells such as available from BD Pharmingen (BD, 1 Becton Drive, Franklin Lakes, N.J. USA) are Vγ9-PE (clone B3, #555733), Vδ2-FITC (clone B6, #555738), γδTCR-APC (clone B1, #555718) or such as available from Beckman Coulter is pan-γδ TCR-PE (clone IMMU510, #IM 1418U) Similarly, suitable antibodies for αβ-T cell selection, such as anti-CD3 antibodies may be such as available from BD Pharmingen is CD3-FITC (#345763) or such as anti-αβPTCR antibodies such as available from Beckman Coulter is pan-αβTCR-PE (#A39499) or pan-αβTCR-PC5 (#A39500). An alternative antibody that binds to the human endogenous αβT cell receptor is available commercially from Miltenyi (Miltenyi Biotec GmbH, Friedrich-Ebert-StraBe 68, 51429 Bergisch Gladbach, Germany). This antibody is from cell clone BW242/412 which is of the mouse isotype IgG2b. A FITC labeled BW242/412 antibody is available from Miltenyi under order no. 130-098-688. The BW242/412 cell clone and the antibody expressed by BW242/412 is described in detail i.a. EP0403156B1 which is herein incorporated by reference.

[0035] Accordingly, in the method of the invention, first T-cells are provided. The T-cells may be primary cells, for example from a subject, such as described in the examples for a human subject. The T-cells may be αβ or γδ T-cells derived from a human subject. Alternatively, the T-cells may be T cell lines, such as SupT-1, Jurkat, or Raji cells or any other widely available cell line. Any cell type, being a primary cell or any other cell line will suffice, as long as the cell population, or a substantial part thereof, expresses the T-cell receptor, i.e. such as being positive for the αβT-cell or the γδ TCR receptor in a FACS sorting or the like as described above, such a cell population may be contemplated. Also, any cell or cell population may be contemplated that, when provided with a γδ TCR according to the invention is capable of forming a functional TCR complex and exerting e.g. a functional cytoxic response and/or cytokine production. The cell that is provided may also be a progenitor cell, preferably a blood progenitor cell such as a thymocyte or a blood stem cell, which after it has been provided with the right stimuli can develop into T cells.

[0036] Preferably, T cells provided express or are able to express a γδ TCR. T cells may have been transduced to express a γδ TCR or already express a γTCR and have been transduced to express a δTCR (or respectively already express a δTCR and have been transduced to express a γTCR), comprising the nucleic acid sequences encoding the sequence obtained in step a). All theoretical combinations of a γ with a δ chain of the TCR is encompassed. In an embodiment, the γδTCR is γ9δ2TCR. In another embodiment the γδTCR is γ5δ1TCR. In another embodiment, the γδTCR is γ8δ5TCR. In another embodiment, the γδTCR is γ4δ5TCR. In another embodiment, the γδTCR is γ2δ1TCR. In another embodiment the γδTCR is γ8δ1TCR.

[0037] Step a) comprising “providing amino acid sequences obtained from a donor, comprising δT-cell receptor chains or parts thereof each of said receptor chains or parts thereof comprising a CDR3 region” may be replaced by “obtaining from a plurality of donors, δT-cell receptor chains, γT-cell receptor chains or parts thereof, said receptor chains or parts thereof comprising a CDR3 region, and determining amino acid sequences of said receptors chains or parts thereof or nucleic acid sequences encoding the same”.

[0038] In step a) at least two different donors are used. This is important in the method of the invention as one wishes to identify δTCR (or γTCR) chains or part thereof that are shared by different donors. A preferred δTCR chain is a 62 TCR chain. Another preferred δTCR chain is a 61 TCR chain. Another preferred δTCR chain is a 63 TCR chain. Another preferred δTCR chain is a 64 TCR chain. Another preferred δTCR chain is a 65 TCR chain. A preferred γTCR chain is a γ2TCR chain. Another preferred γTCR chain is a γ4TCR chain. Another preferred γTCR chain is a γ5TCR chain. Another preferred γTCR chain is a γδTCR chain. Another preferred γTCR chain is a γ9TCR chain.

[0039] In an embodiment, a γδTCR is a γ9δ2TCR. In another embodiment the γδTCR is γ5δ1TCR. In another embodiment the γδTCR is γ9δ4TCR. In another embodiment the γδTCR is γ4δ5TCR. In another embodiment the γδTCR is γ8δ5TCR. In another embodiment the γδTCR is γ2δ1TCR. In another embodiment the γδTCR is γ8δ1TCR. In another embodiment the γδTCR is 743TCR.

[0040] The number of different donors used may be as high as possible. At least 2 different donors are used. However it is preferred that 3, 4, 5, 6, 7, 8, 9, 10 or more different donors are used.

[0041] In an embodiment, at least one of the donors may be healthy. However, it is also encompassed that all donors are healthy.

[0042] In another embodiment, at least one of the donors may be diseased. However, it is also encompassed that all donors are diseased or elite controller of a disease. It means that a donor could be nor healthy nor diseased but got a cancer or an infection and was able to control it. The TCR's of such a “controlled” infection are of particular interest.

[0043] A disease in this context may be cancer or any infection. Infection include infections immediate by viruses bacteria and fungi such as the Hepatitis virus, the Herpes Viruses (CMV, EBV, and more) or a Mycobacterium.

[0044] In another embodiment, it is also envisaged to have part of the donors being healthy and the remaining part of the donors being diseased.

[0045] A donor is preferably a human being.

[0046] Accordingly in a preferred embodiment of the step a) of the method of the invention: [0047] a. the donors are human beings, [0048] b. at least 2 different donors are used, [0049] c. at least one donor, preferably all donors are healthy and/or [0050] d. at least one donor is diseased.

[0051] Step b of the method of the first and second aspects Step b) comprises the identification of amino acid sequences comprising δT-cells (or γT-cells) receptors chains or parts thereof obtained in step a) that are shared between different donors.

[0052] Such amino acid sequences are preferably defined by InMunoGeneTics information system (http://www.imgt.org/IMGTScientificChart/Nomenclature/IMGT-FRCDRdefinition.html).

[0053] It is to be understood that the expression “δT-cell receptors chains or parts thereof that are shared between different donors” means that it is not per se the whole “δT-cell receptors chains” that are shared or are identical between different donors. Part of such chain may be shared or may be identical between different donors. In theory each part of a δT-cell receptor may be shared between donors. The same holds for “γT-cell receptors chains or parts thereof that are shared between different donors”.

[0054] It is also encompassed that the parts that are shared may not be identical but comprises conservative substitutions of a given amino acid. A list of amino acids that are considered to be a conservative substitution of another amino acid is provided in the general part of the description dedicated to the definitions under identity/similarity. In an embodiment said shared part is comprised within a CDR3 region of a δT-cell (or 1-cell) receptor chain or comprises a CDR3 region of a δT-cell (or γT-cell) receptor chain or consists of a δT-cell (or γT-cell) receptor chain. In another embodiment, said shared part is from 3 to 53 amino acids or from 5 and 40 or from 10 and 30. More preferably said shared part is comprised within a CDR3 region of a δT-cell (or γT-cell) receptor chain and is from 3 to 53 amino acids.

[0055] It is clear that the number of donors sharing a δT-cell (or γT-cell) receptor chain or part thereof depends on the number of donors used in step a). In a preferred embodiment, the sequences identified are shared between at least 2, 3, 4, 5 different donors.

[0056] Step c of the Method of the First and Second Aspects

[0057] Step c) comprises the confirmation or the validation of sequences identified as shared in step b). In order to validate the biological relevance of such sequence, the anti-tumour or anti-infection response of a T-cell expressing a defined nucleic acid molecule encoding an amino acid sequence as provided in step a) is determined. The T-cell may already express a δT-cell (or γT-cell) receptor chain identified as shared in step b). It is clear that even if step b) has led to the identification of a part of a δT-cell (or γT-cell) receptor chain being shared, in order to assess the biological relevance of the corresponding δT-cell (or γT-cell) receptor chain, a T cell is transduced with the corresponding δT-cell (or γT-cell) receptor chain comprising the part identified in step b). In an embodiment, an anti-tumour or anti-infection response of such sequence is assessed in a T-cell that does not endogenously express a gamma or delta chain of the TCR. Such a cell may be an αβ-T cell or a NK cell.

[0058] The nucleic acid sequences encoding the δT-, preferably the δ2-T cell receptor chain may be introduced into T-cells to provide an engineered T-cell as explained in the general part of the description dedicated to the definitions.

[0059] Alternatively in the method of the second aspect, the nucleic acid sequences encoding the γT-, preferably the γ9-T cell receptor chain may be introduced into T-cells to provide an engineered T-cell as explained in the general part of the description dedicated to the definitions.

[0060] It is clear to a skilled person that the T cells used should also express a γT cell receptor chain in order to assess the biological relevance of a δT cell receptor chain. In other words a γδTCR is preferably expressed in said T cells, the δTCR being the one identified in the method of the invention as being shared between different donors.

[0061] In the method of the second aspect, it is also clear to a skilled person that the T cells used should also express a δT cell receptor chain in order to assess the biological relevance of a γT cell receptor chain. In other words a γδTCR is preferably expressed in said T cells, the TCR being the one identified in the method of the invention as being shared between different donors.

[0062] In a preferred embodiment, the nucleic acid molecule encoding the δT-cell (or γT-cell) receptor chain or part thereof is provided in an expression vector or in a retroviral or lentiviral vector in a T cell. This has been extensively explained in the general part of the description dedicated to the definitions.

[0063] T cells may be expanded before or after the transfer of the nucleic acids encoding the δT- and/or γT-cell receptor chain. Preferably, the expansion is after the transfer such that the amount of nucleic acids that needs to be transferred is as low as possible. This expansion of T cells may be performed by stimulation with anti-CD3/CD28 Dynabeads in the presence of IL-2. The expanded cells comprising the engineered γδ T-cell receptor, may be selected e.g. via a selectable marker and may be further selected for the presence of the CD4 antigen and the CD8 antigen, e.g. using the MACS separating system as described in the examples. The engineered T-cells may be subsequently further expanded using the REP protocol as described by Riddel and Greenberg, 1990 J Immunol Methods. 128(2): 189-201, which is incorporated herein by reference, or using similar further expansion methods thereto. Briefly, the expansion method involves using antibodies directed against T cell activation molecules, such as TCR, CD3 and CD28 and/or feeder cells and/or stimulating cytokines.

[0064] The anti-tumour response of the provided T-cell expressing a δT-cell (or γT-cell) receptor chain may be assessed using any technique known to the skilled person. A δT-cell receptor chain may be a δ2-T cell receptor chain. A γT-cell receptor chain may be a γ9-T cell receptor chain.

[0065] In one embodiment, the step of determining an anti-tumour response or reactivity comprises contacting the T cells with tumour cells. The step of determining anti-tumour reactivity may include any assay in which an anti-tumour effect may be determined, such as having an effect on tumour cell division rate, i.e. the speed with which the tumour cells divide, cell death, binding to the tumour cells, induction of the production of a cytokine such as IFN, IL-2 or TNFα.

[0066] Tumour cells may be any kind of tumour cells. For example, primary tumour cells from a patient. The tumour cells may be tumour cells from cell lines, such as the cell lines listed in the examples named Daudi, RPMI8226/S, OPM2, LME1, K562, Saos2, MZ1851 RC, SCC9, Fadu, MDA-MB231, MCF7, BT549, SW480, which are well known in the art. Tumour cell lines may easily be obtained from the American Type Culture Collection (ATCC, Manassas, Va.) and the like.

[0067] In a preferred embodiment, determining the anti-tumour responses includes contacting the T cell expressing a defined nucleic acid molecule encoding an amino acid comprising a δT-cell (or γT-cell) receptor chain identified as shared in step b) with a tumour cell and measuring its ability to lyse the tumour cell and/or induce the production of a cytokine such as IFN-7, IL-2 or TNFα. This contacting, culturing or incubation step may have a duration from 10 hours to 1, 2, 3, 4, 5 days. The ability to lyse the tumour cells include providing a fixed amount of tumour cells with which T cell expressing a defined nucleic acid molecule encoding an amino acid comprising a δT-cell (or γT-cell) receptor chain identified as shared in step b), is contacted and after an incubation period the number of viable tumour cells is counted.

[0068] An anti-tumour response may have been identified or determined when the number of viable tumor cells at the end of the incubation step is less than 90%, less than 80%, less than 70%, less than 60%, less than 50%, less than 40%, less than 30%, less than 20%, less than 10% of the number of initial tumour cells at the onset of the incubation step.

[0069] Alternatively, an anti-tumour response may have been identified or determined when the number of viable tumour cells at the end of the incubation step with the engineered T cells is lower than the number of tumour cells at the end of a similar incubation step with control T cells not engineered with sequences identified as shared. Lower in this context may mean at least 10% lower, at least 20% lower, at least 30% lower, at least 40% lower, at least 50% lower, at least 60% lower, at least 70% lower, at least 80% lower, at least 90% lower.

[0070] In addition or as alternative to the counting of the number of viable tumour cells at the end of the incubation step, one may also perform a .sup.51Chromium-release assay which is known to the skilled person. The amount of .sup.51Chromium release is a measure of the number of cells that have been lysed.

[0071] Similarly, the production of a cytokine such as IFN-7, IL-2 or TNFα or the secretion or the expression of activation markers may also be determined, e.g. via antibody staining, ELISA and/or quantitative PCR for the expressed mRNA. Assays for determining the production of a cytokine such as IFN-7, IL-2 or TNFα are commercially widely available. When the production of a cytokine such as IL-2, TNFα or IFNγ is detected at the end of the contacting step, the T cell expressing a defined nucleic acid molecule encoding an amino acid comprising a δT-cell (or γT-cell) receptor chain identified as shared in step b) is said to exhibit an anti-tumour response. Alternatively and preferably, when the amount of IFNγ, IL-2 or TNFα produced at the end of the contacting step with engineered T cells is higher (preferably at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100% or more) than the amount of IFNγ IL-2 or TNFα produced when tumour cells are contacted with control T cells, the T cells is said to exhibit an anti-tumour response. Control T cells do not express a defined nucleic acid molecule encoding an amino acid comprising a δT-cell (or γT-cell) receptor chain identified as shared in step b).

[0072] An anti-tumour response may also be determined by assessing the binding of the engineered T cells to the tumour cell at the end of the incubation step. When binding of the T cell expressing a defined nucleic acid molecule encoding an amino acid comprising a δT-cell (or γT-cell) receptor chain identified as shared in step b) to the tumour cell is detected at the end of the contacting step, the T cell expressing a defined nucleic acid molecule encoding an amino acid comprising a δT-cell (or γT-cell) receptor chain identified as shared in step b) is said to exhibit an anti-tumour response. Alternatively and preferably, when the binding of the T cell expressing a defined nucleic acid molecule encoding an amino acid comprising a δT-cell (or γT-cell) receptor chain identified as shared in step b) at the end of the contacting step is higher (preferably at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100% or more) than the binding of control T cells (see earlier definition) to the same tumour cell, the T cells is said to exhibit an anti-tumour response.

[0073] The contacting step may be carried out in the presence of a phosphoantigen, such as pamidronate.

[0074] In a preferred method the step of confirming the anti-tumour response comprises contacting the T cell expressing a defined nucleic acid molecule encoding an amino acid comprising a δT-cell (or γT-cell) receptor chain identified as shared in step b) with a tumour cell and measuring its ability to lyse the tumour cell and/or induce a cytokine such as IFN-7, IL-2 or TNFα.

[0075] In a preferred embodiment, determining the anti-infection responses includes contacting the T cell expressing a defined nucleic acid molecule encoding an amino acid comprising a δT-cell (or γT-cell) receptor chain identified as shared in step b) with the infectious agent or cells comprising the infectious agent and measuring its ability to kill the infectious agent or cells comprising the infectious agent and/or induce the production of a cytokine such as IFN-7, IL-2 or TNFα. This contacting, culturing or incubation step may have a duration from 10 hours to 1, 2, 3, 4, 5 days. The ability to kill the infectious agent or cells comprising the infectious agent includes providing a fixed amount of infectious agent or cells comprising the infectious agent or inducing indirectly an expression of a natural danger signal at the cell surface by the infectious agent with which the T-cell expressing a γTCR as explained earlier herein (or a T cell expressing a defined nucleic acid molecule encoding an amino acid comprising a δT-cell (or γT-cell) receptor chain identified as shared in step b)), is contacted and after an incubation period the number of alive infectious agent or cells comprising the infectious agent is counted.

[0076] An anti-infectious response may have been identified or determined when the number of infectious agent or cells comprising the infectious agent at the end of the incubation step is less than 90%, less than 80%, less than 70%, less than 60%, less than 50%, less than 40%, less than 30%, less than 20%, less than 10% of the number of initial infectious agent or cells comprising the infectious agent at the onset of the incubation step.

[0077] Alternatively, an anti-infectious response may have been identified or determined when the number of viable infectious agent or cells comprising the infectious agent at the end of the incubation step with the T cells is lower than the number of infectious agent or cells comprising the infectious agent at the end of a similar incubation step with control T cells (earlier defined herein). Lower in this context may mean at least 10% lower, at least 20% lower, at least 30% lower, at least 40% lower, at least 50% lower, at least 60% lower, at least 70% lower, at least 80% lower, at least 90% lower.

[0078] In a preferred method the step of confirming the anti-infectious response comprises contacting the T cell expressing a defined nucleic acid molecule encoding an amino acid comprising a δT-cell (or γT-cell) receptor chain identified as shared in step b) with an infectious agent or cells comprising the infectious agent and measuring its ability to kill the infectious agent or cells comprising the infectious agent and/or induce a cytokine such as IFN-7, IL-2 or TNFα.

[0079] δT-Cell Receptor Chain or a Part Thereof in General

[0080] Provided in certain aspects described herein are polypeptides comprising a δT-cell receptor chain or a variant or functional portion thereof. In a further aspect the invention provides a δT-cell receptor chain or a part thereof, comprising a CDR3 region, and which δT-cell receptor chain or part thereof is represented by an amino acid sequence as defined in step 1 c) of the method of the invention and which is obtainable by the method of the first aspect. Each of these δT-cell receptor chain or part thereof is represented by an amino acid sequence that could be identified using a SEQ ID NO. In an embodiment, a δT-cell receptor chain is a 82T-cell receptor chain. In another embodiment, a δT-cell receptor chain is a δ1T-cell receptor chain or a 84T-cell receptor chain.

[0081] γT-Cell Receptor Chain or a Part Thereof in General

[0082] Provided in certain aspects described herein are polypeptides comprising a γT-cell receptor chain or a variant or functional portion thereof. In a further aspect the invention provides a γT-cell receptor chain or a part thereof, comprising a CDR3 region, and which γT-cell receptor chain or part thereof is represented by an amino acid sequence as defined in step 1 c) of the method of the invention and which is obtainable by the method of the first aspect. Each of these γT-cell receptor chain or part thereof is represented by an amino acid sequence that could be identified using a SEQ ID NO. In an embodiment, a γT-cell receptor chain is a γ9T-cell receptor chain or a γ5T-cell receptor chain.

[0083] Each of the δT-cell receptor chain or part thereof comprising a CDR3 region identified herein may also be represented by its coding nucleic acid sequence instead of its amino acid sequence. Therefore the invention also relates to a nucleic acid molecule encoding said receptor chain or part thereof. The same holds for each of the γT-cell receptor chain or part thereof comprising a CDR3 region identified herein. The same also holds for the TCR identified herein: it can be identified by the receptor chains it expresses or by the nucleic acid molecules encoding these chains it comprises. The same also holds for the T cell expressing said TCR: the T cell can be defined by reference to the receptor chains or parts thereof it expresses or by the nucleic acid molecules encoding these chains or parts thereof it comprises.

[0084] Preferred δT-Cell or 1T-Cell Receptor Chain or a Part Thereof

[0085] Provided in certain aspects described herein are polypeptides comprising a δT-cell receptor CDR or a variant or functional portion thereof.

[0086] In another preferred embodiment, there is provided a δT-cell receptor chain or part thereof comprising a CDR3 region, said δT-cell receptor chain or part thereof being represented by an amino acid sequence, said amino acid sequence comprising at least 60% sequence identity or similarity with amino acid sequence SEQ ID NO: 7 and/or 17 and/or 96.

[0087] In another preferred embodiment, there is provided a nucleic acid molecule represented by a nucleotide sequence comprising a nucleotide sequence that has at least 60% sequence identity with SEQ ID NO: 50 and/or 62 and/or a nucleotide sequence that encodes an amino acid sequence that has at least 60% amino acid identity or similarity with an amino acid sequence encoded by a nucleotide sequence SEQ ID NO: 50 and/or 62.

[0088] Preferably, the identity is of at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100%.

[0089] Each of these preferred δT-cell or γT-cell receptor chains or parts thereof defined above by sequence identity and as encompassed by the invention are preferably considered to be able to exhibit an anti-tumour or anti-infective activity as assessed in step c) of the method of the invention.

[0090] Provided in certain aspects described herein are polypeptides comprising a γT-cell receptor CDR or a variant or functional portion thereof. There is also provided a γT-cell receptor chain or part thereof comprising a CDR3 region, said γT-cell receptor chain or part thereof being represented by an amino acid sequence, said amino acid sequence comprising at least 60% sequence identity or similarity with amino acid sequence SEQ ID NO: 10, 18, 64 and/or 97.

[0091] In another preferred embodiment, there is provided a nucleic acid molecule represented by a nucleotide sequence comprising a nucleotide sequence that has at least 60% sequence identity with SEQ ID NO: 51 and/or 63 and/or a nucleotide sequence that encodes an amino acid sequence that has at least 60% amino acid identity or similarity with an amino acid sequence encoded by a nucleotide sequence SEQ ID NO: 51 and/or 63.

[0092] Preferably, the identity is of at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100%.

[0093] In another preferred embodiment, there is provided a γT-cell receptor chain or part thereof comprising a CDR3 region, said γT-cell receptor chain or part thereof being represented by an amino acid sequence, said amino acid sequence comprising at least 60% sequence identity or similarity with amino acid sequence SEQ ID NO:18 Preferably, the identity is of at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100%.

[0094] In another preferred embodiment, there is provided a γT-cell receptor chain or part thereof comprising a CDR3 region, said γT-cell receptor chain or part thereof being represented by an amino acid sequence, said amino acid sequence comprising at least 60% sequence identity or similarity with amino acid sequence SEQ ID NO: 19 and/or 30.

[0095] In another preferred embodiment, there is provided a nucleic acid molecule represented by a nucleotide sequence comprising a nucleotide sequence that has at least 60% sequence identity with SEQ ID NO: 41 and/or 53 and/or a nucleotide sequence that encodes an amino acid sequence that has at least 60% amino acid identity or similarity with an amino acid sequence encoded by a nucleotide sequence SEQ ID NO: 41 and/or 53.

[0096] Preferably, the identity is of at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100%.

[0097] In another preferred embodiment, there is provided a γT-cell receptor chain or part thereof comprising a CDR3 region, said T-cell receptor chain or part thereof being represented by an amino acid sequence, said amino acid sequence comprising at least 60% sequence identity or similarity with amino acid sequence SEQ ID NO: 20 and/or 32.

[0098] In another preferred embodiment, there is provided a nucleic acid molecule represented by a nucleotide sequence comprising a nucleotide sequence that has at least 60% sequence identity with SEQ ID NO: 43 and/or 55 and/or a nucleotide sequence that encodes an amino acid sequence that has at least 60% amino acid identity or similarity with an amino acid sequence encoded by a nucleotide sequence SEQ ID NO: 43 and/or 55.

[0099] Preferably, the identity is of at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100%.

[0100] In another preferred embodiment, there is provided a γT-cell receptor chain or part thereof comprising a CDR3 region, said T-cell receptor chain or part thereof being represented by an amino acid sequence, said amino acid sequence comprising at least 60% sequence identity or similarity with amino acid sequence SEQ ID NO: 21 and/or 34.

[0101] In another preferred embodiment, there is provided a nucleic acid molecule represented by a nucleotide sequence comprising a nucleotide sequence that has at least 60% sequence identity with SEQ ID NO: 45 and/or 57 and/or a nucleotide sequence that encodes an amino acid sequence that has at least 60% amino acid identity or similarity with an amino acid sequence encoded by a nucleotide sequence SEQ ID NO: 45 and/or 57.

[0102] Preferably, the identity is of at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100%.

[0103] In another preferred embodiment, there is provided a δT-cell receptor chain or part thereof comprising a CDR3 region, said δT-cell receptor chain or part thereof being represented by an amino acid sequence, said amino acid sequence comprising at least 60% sequence identity or similarity with amino acid sequence SEQ ID NO: 40 and/or 70.

[0104] In another preferred embodiment, there is provided a nucleic acid molecule represented by a nucleotide sequence comprising a nucleotide sequence that has at least 60% sequence identity with SEQ ID NO: 76 and/or 82 and/or a nucleotide sequence that encodes an amino acid sequence that has at least 60% amino acid identity or similarity with an amino acid sequence encoded by a nucleotide sequence SEQ ID NO: 76 and/or 82.

[0105] Preferably, the identity is of at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100%.

[0106] In another preferred embodiment, there is provided a γT-cell receptor chain or part thereof comprising a CDR3 region, said γT-cell receptor chain or part thereof being represented by an amino acid sequence, said amino acid sequence comprising at least 60% sequence identity or similarity with amino acid sequence SEQ ID NO: 65 and/or 71.

[0107] In another preferred embodiment, there is provided a nucleic acid molecule represented by a nucleotide sequence comprising a nucleotide sequence that has at least 60% sequence identity with SEQ ID NO: 77 and/or 83 and/or a nucleotide sequence that encodes an amino acid sequence that has at least 60% amino acid identity or similarity with an amino acid sequence encoded by a nucleotide sequence SEQ ID NO: 77 and/or 83.

[0108] Preferably, the identity is of at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100%.

[0109] In another preferred embodiment, there is provided a δT-cell receptor chain or part thereof comprising a CDR3 region, said δT-cell receptor chain or part thereof being represented by an amino acid sequence, said amino acid sequence comprising at least 60% sequence identity or similarity with amino acid sequence SEQ ID NO: 66 and/or 72.

[0110] In another preferred embodiment, there is provided a nucleic acid molecule represented by a nucleotide sequence comprising a nucleotide sequence that has at least 60% sequence identity with SEQ ID NO: 78 and/or 84 and/or a nucleotide sequence that encodes an amino acid sequence that has at least 60% amino acid identity or similarity with an amino acid sequence encoded by a nucleotide sequence SEQ ID NO: 78 and/or 84.

[0111] Preferably, the identity is of at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100%.

[0112] In another preferred embodiment, there is provided a γT-cell receptor chain or part thereof comprising a CDR3 region, said γT-cell receptor chain or part thereof being represented by an amino acid sequence, said amino acid sequence comprising at least 60% sequence identity or similarity with amino acid sequence SEQ ID NO: 67 and/or 73.

[0113] In another preferred embodiment, there is provided a nucleic acid molecule represented by a nucleotide sequence comprising a nucleotide sequence that has at least 60% sequence identity with SEQ ID NO:79 and/or 85 and/or a nucleotide sequence that encodes an amino acid sequence that has at least 60% amino acid identity or similarity with an amino acid sequence encoded by a nucleotide sequence SEQ ID NO: 79 and/or 85.

[0114] Preferably, the identity is of at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100%.

[0115] In another preferred embodiment, there is provided a δT-cell receptor chain or part thereof comprising a CDR3 region, said δT-cell receptor chain or part thereof being represented by an amino acid sequence, said amino acid sequence comprising at least 60% sequence identity or similarity with amino acid sequence SEQ ID NO: 68 and/or 74.

[0116] In another preferred embodiment, there is provided a nucleic acid molecule represented by a nucleotide sequence comprising a nucleotide sequence that has at least 60% sequence identity with SEQ ID NO: 80 and/or 86 and/or a nucleotide sequence that encodes an amino acid sequence that has at least 60% amino acid identity or similarity with an amino acid sequence encoded by a nucleotide sequence SEQ ID NO: 80 and/or 86.

[0117] Preferably, the identity is of at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100%.

[0118] In another preferred embodiment, there is provided a γT-cell receptor chain or part thereof comprising a CDR3 region, said γT-cell receptor chain or part thereof being represented by an amino acid sequence, said amino acid sequence comprising at least 60% sequence identity or similarity with amino acid sequence SEQ ID NO: 69 and/or 75.

[0119] In another preferred embodiment, there is provided a nucleic acid molecule represented by a nucleotide sequence comprising a nucleotide sequence that has at least 60% sequence identity with SEQ ID NO: 81 and/or 87 and/or a nucleotide sequence that encodes an amino acid sequence that has at least 60% amino acid identity or similarity with an amino acid sequence encoded by a nucleotide sequence SEQ ID NO: 81 and/or 87.

[0120] Preferably, the identity is of at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100%.

[0121] In another preferred embodiment, there is provided a γT-cell receptor chain or part thereof comprising a CDR3 region, said T-cell receptor chain or part thereof being represented by an amino acid sequence, said amino acid sequence comprising at least 60% sequence identity or similarity with amino acid sequence SEQ ID NO: 89 and/or 91.

[0122] In another preferred embodiment, there is provided a nucleic acid molecule represented by a nucleotide sequence comprising a nucleotide sequence that has at least 60% sequence identity with SEQ ID NO: 93 and/or 95 and/or a nucleotide sequence that encodes an amino acid sequence that has at least 60% amino acid identity or similarity with an amino acid sequence encoded by a nucleotide sequence SEQ ID NO: 93 and/or 95.

[0123] Preferably, the identity is of at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100%.

[0124] Each of these preferred δT-cell receptor chains or parts thereof defined above by sequence identity and as encompassed by the invention are preferably considered to be able to exhibit an anti-tumour or anti-infective activity when expressed in a T cell already expressing a γT-cell receptor as assessed in step c) of the method of the invention. The same holds for preferred γT-cell receptor chains or parts thereof defined above by sequence identity, the T cell already expressing a δT cell receptor.

[0125] Further Aspects Linked to the Use of a δT-Cell (or γT-Cell) Receptor Chain or a Part Thereof

[0126] In this part, all aspects described below applied for any δT-cell (or γT-cell) receptor chain or variant or part thereof obtainable by the present invention, and especially for the preferred δT cell (or γT-cell) receptor chain or variant or part thereof identified above.

[0127] In an embodiment, a variant or part of a δT-cell (or γT-cell) receptor chain described herein is a soluble polypeptide. Such a soluble polypeptide may also be called a binding unit. Such a soluble polypeptide can include various forms to binding entities such as a TCR, antibody, scFv, BCR, or any combination thereof. In some cases, at least a portion of a TCR, such as a Vγ9Vδ2 or Vγ5Vδ1 or Vγ4Vδ5 or Vγ8Vδ5 or Vγ2Vδ1 or Vγ8Vδ1 can be generated and utilized in a pharmaceutical composition as described herein. For example, TCR-antibody chimeras can be generated and tested before arriving at a desired chimera. For example, γδ-variable domains can replace heavy and light chain variable domains of an antibody. In addition to enhanced binding, an Fc domain of an antibody can mediate cytotoxicity through Fcγ-receptor positive immune cells and/or a complementary system. In some cases, TCR-antibody chimeras can be generated using HEK293 cells and subsequently purified using protein A affinity chromatography followed by size exclusion chromatography. A proper folding of chimeras can be probed using conformational-specific antibodies that can target γ and δ variable domains. Chimeras can be used in antibody dependent cell mediated cytotoxicity (ADCC) and complement dependent cytotoxicity (CDC) assays to determine functional efficacy. After performing in vitro assays, functional efficacy of TCR-antibody chimeras can be tested in vitro and/or in vivo.

[0128] In a further aspect, the invention also relates to a conjugate comprising (a part of) the δT-cell (or γT-cell) receptor chain as defined above which is linked to an agent. The type of agent used depends from the type of applications envisaged. Such conjugates may be linked to substrates (e.g. chemicals, nanoparticles) and may be used e.g. to deliver chemotherapy to a target of interest. In addition, in diagnostics expression of defined ligands may be tested by taking advantage of the soluble TCRs linked to fluorochromes which are then used as staining tool or for the biochemical isolation of the ligand.

[0129] In a further aspect, the invention relates to a nucleic acid construct comprising the δT-cell (and/or γT-cell) receptor chain or a part thereof represented by an amino acid sequence as identified in step c) of the method of the invention, preferably the δT-cell (and/or T-cell) receptor chain or part thereof identified in the part entitled “Preferred δT-cell (or γT-cell) receptor chain or a part thereof”.

[0130] In an aspect, there is therefore provided a γδTCR comprising: [0131] a δT-cell receptor chain or part thereof comprising a CDR3 region, said δT-cell receptor chain or part thereof and [0132] a γT-cell receptor chain or part thereof comprising a CDR3 region, said T-cell receptor chain or part thereof, each having been identified by a method as disclosed herein.

[0133] In another preferred embodiment, there is therefore provided a γδTCR comprising: [0134] a δT-cell receptor chain or part thereof comprising a CDR3 region, said δT-cell receptor chain or part thereof being represented by an amino acid sequence, said amino acid sequence comprising at least 60% sequence identity or similarity with amino acid sequence SEQ ID NO: 7 and/or 17 and/or 96, and preferably [0135] a γT-cell receptor chain or part thereof comprising a CDR3 region, said γT-cell receptor chain or part thereof being represented by an amino acid sequence, said amino acid sequence comprising at least 60% sequence identity or similarity with amino acid sequence SEQ ID NO: 10, 18 64 and/or 97.

[0136] In another preferred embodiment, there is provided a nucleic acid molecule encoding a γδ TCR, said nucleic acid molecule being represented by a nucleotide sequence comprising: [0137] a nucleotide sequence that has at least 60% sequence identity with SEQ ID NO: 50 and/or 62 and/or a nucleotide sequence that encodes an amino acid sequence that has at least 60% amino acid identity or similarity with an amino acid sequence encoded by a nucleotide sequence SEQ ID NO: 50 and/or 62, and preferably [0138] a nucleotide sequence that has at least 60% sequence identity with SEQ ID NO: 51 and/or 63 and/or a nucleotide sequence that encodes an amino acid sequence that has at least 60% amino acid identity or similarity with an amino acid sequence encoded by a nucleotide sequence SEQ ID NO: 51 and/or 63.

[0139] Preferably, the identity is of at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100%.

[0140] In another preferred embodiment, there is therefore provided a γδTCR comprising: [0141] a δT-cell receptor chain or part thereof comprising a CDR3 region, said δT-cell receptor chain or part thereof being represented by an amino acid sequence, said amino acid sequence comprising at least 60% sequence identity or similarity with amino acid sequence SEQ ID NO:22 and/or 35, and preferably [0142] a γT-cell receptor chain or part thereof comprising a CDR3 region, said γT-cell receptor chain or part thereof being represented by an amino acid sequence, said amino acid sequence comprising at least 60% sequence identity or similarity with amino acid sequence SEQ ID NO:39 and/or 36.

[0143] In another preferred embodiment, there is provided a nucleic acid molecule encoding a γδ TCR, said nucleic acid molecule being represented by a nucleotide sequence comprising: [0144] a nucleotide sequence that has at least 60% sequence identity with SEQ ID NO: 46 and/or 58 and/or a nucleotide sequence that encodes an amino acid sequence that has at least 60% amino acid identity or similarity with an amino acid sequence encoded by a nucleotide sequence SEQ ID NO:46 and/or 58, and preferably [0145] a nucleotide sequence that has at least 60% sequence identity with SEQ ID NO: 47 and/or 59 and/or a nucleotide sequence that encodes an amino acid sequence that has at least 60% amino acid identity or similarity with an amino acid sequence encoded by a nucleotide sequence SEQ ID NO: 47 and/or 59.

[0146] Preferably, the identity is of at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100%.

[0147] In another preferred embodiment, there is therefore provided a γδTCR comprising: [0148] a δT-cell receptor chain or part thereof comprising a CDR3 region, said δT-cell receptor chain or part thereof being represented by an amino acid sequence, said amino acid sequence comprising at least 60% sequence identity or similarity with amino acid sequence SEQ ID NO: 23 and/or 29 and preferably [0149] a γT-cell receptor chain or part thereof comprising a CDR3 region, said γT-cell receptor chain or part thereof being represented by an amino acid sequence, said amino acid sequence comprising at least 60% sequence identity or similarity with amino acid sequence SEQ ID NO: 19 and/or 30.

[0150] In another preferred embodiment, there is provided a nucleic acid molecule encoding a γδ TCR, said nucleic acid molecule being represented by a nucleotide sequence comprising: [0151] a nucleotide sequence that has at least 60% sequence identity with SEQ ID NO: 26 and/or 52 and/or a nucleotide sequence that encodes an amino acid sequence that has at least 60% amino acid identity or similarity with an amino acid sequence encoded by a nucleotide sequence SEQ ID NO: 26 and/or 52, and preferably [0152] a nucleotide sequence that has at least 60% sequence identity with SEQ ID NO: 41 and/or 53 and/or a nucleotide sequence that encodes an amino acid sequence that has at least 60% amino acid identity or similarity with an amino acid sequence encoded by a nucleotide sequence SEQ ID NO: 41 and/or 53.

[0153] Preferably, the identity is of at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100%.

[0154] In another preferred embodiment, there is therefore provided a γδTCR comprising: [0155] a δT-cell receptor chain or part thereof comprising a CDR3 region, said δT-cell receptor chain or part thereof being represented by an amino acid sequence, said amino acid sequence comprising at least 60% sequence identity or similarity with amino acid sequence SEQ ID NO: 24 and/or 31, and preferably [0156] a γT-cell receptor chain or part thereof comprising a CDR3 region, said γT-cell receptor chain or part thereof being represented by an amino acid sequence, said amino acid sequence comprising at least 60% sequence identity or similarity with amino acid sequence SEQ ID NO: 20 and/or 32.

[0157] In another preferred embodiment, there is provided a nucleic acid molecule encoding a γδ TCR, said nucleic acid molecule being represented by a nucleotide sequence comprising: [0158] a nucleotide sequence that has at least 60% sequence identity with SEQ ID NO: 42 and/or 54 and/or a nucleotide sequence that encodes an amino acid sequence that has at least 60% amino acid identity or similarity with an amino acid sequence encoded by a nucleotide sequence SEQ ID NO:42 and/or 54, and preferably [0159] a nucleotide sequence that has at least 60% sequence identity with SEQ ID NO: 43 and/or 55 and/or a nucleotide sequence that encodes an amino acid sequence that has at least 60% amino acid identity or similarity with an amino acid sequence encoded by a nucleotide sequence SEQ ID NO: 43 and/or 55.

[0160] Preferably, the identity is of at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100%.

[0161] In another preferred embodiment, there is therefore provided a γδTCR comprising: [0162] a δT-cell receptor chain or part thereof comprising a CDR3 region, said δT-cell receptor chain or part thereof being represented by an amino acid sequence, said amino acid sequence comprising at least 60% sequence identity or similarity with amino acid sequence SEQ ID NO: 25 and/or 33 and preferably [0163] a γT-cell receptor chain or part thereof comprising a CDR3 region, said γT-cell receptor chain or part thereof being represented by an amino acid sequence, said amino acid sequence comprising at least 60% sequence identity or similarity with amino acid sequence SEQ ID NO: 21 and/or 34

[0164] In another preferred embodiment, there is provided a nucleic acid molecule encoding a γδ TCR, said nucleic acid molecule being represented by a nucleotide sequence comprising: [0165] a nucleotide sequence that has at least 60% sequence identity with SEQ ID NO: 44 and/or 56 and/or a nucleotide sequence that encodes an amino acid sequence that has at least 60% amino acid identity or similarity with an amino acid sequence encoded by a nucleotide sequence SEQ ID NO: 44 and/or 56, and preferably [0166] a nucleotide sequence that has at least 60% sequence identity with SEQ ID NO: 45 and/or 57 and/or a nucleotide sequence that encodes an amino acid sequence that has at least 60% amino acid identity or similarity with an amino acid sequence encoded by a nucleotide sequence SEQ ID NO: 45 and/or 57.

[0167] Preferably, the identity is of at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100%.

[0168] In another preferred embodiment, there is therefore provided a γδTCR comprising: [0169] a δT-cell receptor chain or part thereof comprising a CDR3 region, said δT-cell receptor chain or part thereof being represented by an amino acid sequence, said amino acid sequence comprising at least 60% sequence identity or similarity with amino acid sequence SEQ ID NO:28 and/or 37, and preferably [0170] a γT-cell receptor chain or part thereof comprising a CDR3 region, said γT-cell receptor chain or part thereof being represented by an amino acid sequence, said amino acid sequence comprising at least 60% sequence identity or similarity with amino acid sequence SEQ ID NO:27 and/or 38

[0171] In another preferred embodiment, there is provided a nucleic acid molecule encoding a γδ TCR, said nucleic acid molecule being represented by a nucleotide sequence comprising: [0172] a nucleotide sequence that has at least 60% sequence identity with SEQ ID NO: 48 and/or 60 and/or a nucleotide sequence that encodes an amino acid sequence that has at least 60% amino acid identity or similarity with an amino acid sequence encoded by a nucleotide sequence SEQ ID NO: 48 and/or 60, and preferably [0173] a nucleotide sequence that has at least 60% sequence identity with SEQ ID NO: 49 and/or 61 and/or a nucleotide sequence that encodes an amino acid sequence that has at least 60% amino acid identity or similarity with an amino acid sequence encoded by a nucleotide sequence SEQ ID NO: 49 and/or 61.

[0174] Preferably, the identity is of at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100%.

[0175] In another preferred embodiment, there is therefore provided a γδTCR comprising: [0176] a δT-cell receptor chain or part thereof comprising a CDR3 region, said δT-cell receptor chain or part thereof being represented by an amino acid sequence, said amino acid sequence comprising at least 60% sequence identity or similarity with amino acid sequence SEQ ID NO:40 and/or 70, and preferably [0177] a γT-cell receptor chain or part thereof comprising a CDR3 region, said γT-cell receptor chain or part thereof being represented by an amino acid sequence, said amino acid sequence comprising at least 60% sequence identity or similarity with amino acid sequence SEQ ID NO:65 and/or 71.

[0178] In another preferred embodiment, there is provided a nucleic acid molecule encoding a γδ TCR, said nucleic acid molecule being represented by a nucleotide sequence comprising: [0179] a nucleotide sequence that has at least 60% sequence identity with SEQ ID NO: 76 and/or 82 and/or a nucleotide sequence that encodes an amino acid sequence that has at least 60% amino acid identity or similarity with an amino acid sequence encoded by a nucleotide sequence SEQ ID NO: 76 and/or 82, and preferably [0180] a nucleotide sequence that has at least 60% sequence identity with SEQ ID NO: 77 and/or 83 and/or a nucleotide sequence that encodes an amino acid sequence that has at least 60% amino acid identity or similarity with an amino acid sequence encoded by a nucleotide sequence SEQ ID NO: 77 and/or 83.

[0181] Preferably, the identity is of at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100%.

[0182] In another preferred embodiment, there is therefore provided a γδTCR comprising: [0183] a δT-cell receptor chain or part thereof comprising a CDR3 region, said δT-cell receptor chain or part thereof being represented by an amino acid sequence, said amino acid sequence comprising at least 60% sequence identity or similarity with amino acid sequence SEQ ID NO:66 and/or 72, and preferably [0184] a γT-cell receptor chain or part thereof comprising a CDR3 region, said γT-cell receptor chain or part thereof being represented by an amino acid sequence, said amino acid sequence comprising at least 60% sequence identity or similarity with amino acid sequence SEQ ID NO:67 and/or 73.

[0185] In another preferred embodiment, there is provided a nucleic acid molecule encoding a γδ TCR, said nucleic acid molecule being represented by a nucleotide sequence comprising: [0186] a nucleotide sequence that has at least 60% sequence identity with SEQ ID NO: 78 and/or 84 and/or a nucleotide sequence that encodes an amino acid sequence that has at least 60% amino acid identity or similarity with an amino acid sequence encoded by a nucleotide sequence SEQ ID NO: 78 and/or 84, and preferably [0187] a nucleotide sequence that has at least 60% sequence identity with SEQ ID NO: 79 and/or 85 and/or a nucleotide sequence that encodes an amino acid sequence that has at least 60% amino acid identity or similarity with an amino acid sequence encoded by a nucleotide sequence SEQ ID NO: 79 and/or 85.

[0188] Preferably, the identity is of at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100%.

[0189] In another preferred embodiment, there is therefore provided a γδTCR comprising: [0190] a δT-cell receptor chain or part thereof comprising a CDR3 region, said δT-cell receptor chain or part thereof being represented by an amino acid sequence, said amino acid sequence comprising at least 60% sequence identity or similarity with amino acid sequence SEQ ID NO:68 and/or 74, and preferably [0191] a γT-cell receptor chain or part thereof comprising a CDR3 region, said γT-cell receptor chain or part thereof being represented by an amino acid sequence, said amino acid sequence comprising at least 60% sequence identity or similarity with amino acid sequence SEQ ID NO:69 and/or 75.

[0192] In another preferred embodiment, there is provided a nucleic acid molecule encoding a γδ TCR, said nucleic acid molecule being represented by a nucleotide sequence comprising: [0193] a nucleotide sequence that has at least 60% sequence identity with SEQ ID NO: 80 and/or 86 and/or a nucleotide sequence that encodes an amino acid sequence that has at least 60% amino acid identity or similarity with an amino acid sequence encoded by a nucleotide sequence SEQ ID NO:80 and/or 86, and preferably [0194] a nucleotide sequence that has at least 60% sequence identity with SEQ ID NO: 81 and/or 87 and/or a nucleotide sequence that encodes an amino acid sequence that has at least 60% amino acid identity or similarity with an amino acid sequence encoded by a nucleotide sequence SEQ ID NO: 81 and/or 87.

[0195] Preferably, the identity is of at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100%.

[0196] In another preferred embodiment, there is therefore provided a γδTCR comprising: [0197] a δT-cell receptor chain or part thereof comprising a CDR3 region, said δT-cell receptor chain or part thereof being represented by an amino acid sequence, said amino acid sequence comprising at least 60% sequence identity or similarity with amino acid sequence SEQ ID NO:88 and/or 90, and preferably [0198] a γT-cell receptor chain or part thereof comprising a CDR3 region, said γT-cell receptor chain or part thereof being represented by an amino acid sequence, said amino acid sequence comprising at least 60% sequence identity or similarity with amino acid sequence SEQ ID NO:89 and/or 91.

[0199] In another preferred embodiment, there is provided a nucleic acid molecule encoding a γδ TCR, said nucleic acid molecule being represented by a nucleotide sequence comprising: [0200] a nucleotide sequence that has at least 60% sequence identity with SEQ ID NO: 92 and/or 94 and/or a nucleotide sequence that encodes an amino acid sequence that has at least 60% amino acid identity or similarity with an amino acid sequence encoded by a nucleotide sequence SEQ ID NO:92 and/or 94, and preferably [0201] a nucleotide sequence that has at least 60% sequence identity with SEQ ID NO: 93 and/or 95 and/or a nucleotide sequence that encodes an amino acid sequence that has at least 60% amino acid identity or similarity with an amino acid sequence encoded by a nucleotide sequence SEQ ID NO: 93 and/or 95.

[0202] Preferably, the identity is of at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100%.

[0203] In a further aspect, the invention further relates to a vector comprising the nucleic acid construct defined above. A preferred vector is a retroviral vector or a lentiviral vector.

[0204] In a further aspect, the invention provides a cell comprising the nucleic acid construct or the vector as defined above. This cell is preferably a T cell.

[0205] A preferred T cell expresses a δT-cell (or γT-cell) receptor chain or a part thereof identified in the part entitled “Preferred δT-cell (or γT-cell) receptor chain or a part thereof”.

[0206] The general part of the description dedicated to the definitions provides detailed explanation as to nucleic acid molecules and polypeptide encompassed by the invention, nucleic construct, viral vector and cells comprising said construct or vector.

[0207] Each of the δT-cell (or γT-cell) receptor chain or part thereof isolated using the method of the invention is expected to be biologically relevant for designing a medicament for preventing, treating, regressing, curing and/or delaying cancer or an infection since each of these chain or part thereof exhibits an anti-tumour or an anti-infectious activity (step c of the methods of the invention).

[0208] A δT-cell (or γT-cell) receptor chain, or a part thereof, a conjugate, a nucleic acid construct, a vector, a cell all as defined earlier herein are preferably for use as a medicament. In an embodiment, a δT-cell receptor chain is a δ2T-cell, a δ1T-cell, δ5T-cell, or a δ4T-cell receptor chain. In an embodiment, a γT-cell receptor chain is a γ9T-cell, γδT-cell, γ4T-cell receptor chain or a γ5T-cell receptor chain. The medicament is preferably for the prevention, suppression, treatment of cancer or an infection. Accordingly the invention also relates to a composition, preferably a pharmaceutical composition comprising a δT-cell (or γT-cell) receptor chain, or a part thereof, a conjugate, a nucleic acid construct, a vector, a cell all as defined earlier herein.

[0209] In a further aspect, the invention relates to a method for preventing, treating, regressing, curing and/or delaying cancer or an infection in a subject wherein a δT-cell (or γT-cell) receptor chain, or a part thereof, a conjugate, a nucleic acid construct, a vector, a cell all as defined earlier herein are administered to said subject. A preferred subject is a human being.

[0210] In a further aspect, the invention relates to a use of a δT-cell (or γT-cell) receptor chain, or a part thereof, a conjugate, a nucleic acid construct, a vector, a cell all as defined earlier herein for the manufacture of a medicament for preventing, treating, regressing, curing and/or delaying cancer or an infection in a subject. A preferred subject is a human being.

[0211] A preferred T cell used as a medicament as explained is preferably a T cell expressing: [0212] a δT-cell receptor chain or part thereof comprising a CDR3 region, said δT-cell receptor chain or part thereof being represented by an amino acid sequence, said amino acid sequence comprising at least 60% sequence identity or similarity with amino acid sequence SEQ ID NO: 7 and/or 17 and/or 96, and preferably [0213] a γT-cell receptor chain or part thereof comprising a CDR3 region, said γT-cell receptor chain or part thereof being represented by an amino acid sequence, said amino acid sequence comprising at least 60% sequence identity or similarity with amino acid sequence SEQ ID NO: 10, 18, 64 and/or 97.

[0214] Another preferred T cell used as a medicament comprises a nucleic acid molecule encoding a γδ TCR, said nucleic acid molecule being represented by a nucleotide sequence comprising: [0215] a nucleotide sequence that has at least 60% sequence identity with SEQ ID NO: 50 and/or 62 and/or a nucleotide sequence that encodes an amino acid sequence that has at least 60% amino acid identity or similarity with an amino acid sequence encoded by a nucleotide sequence SEQ ID NO: 50 and/or 62, and preferably [0216] a nucleotide sequence that has at least 60% sequence identity with SEQ ID NO: 51 and/or 63 and/or a nucleotide sequence that encodes an amino acid sequence that has at least 60% amino acid identity or similarity with an amino acid sequence encoded by a nucleotide sequence SEQ ID NO: 51 and/or 63.

[0217] Preferably, the identity is of at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100%.

[0218] Another preferred T cell used as a medicament as explained is preferably a T cell expressing: [0219] a δT-cell receptor chain or part thereof comprising a CDR3 region, said δT-cell receptor chain or part thereof being represented by an amino acid sequence, said amino acid sequence comprising at least 60% sequence identity or similarity with amino acid sequence SEQ ID NO:22 and/or 35, and preferably [0220] a γT-cell receptor chain or part thereof comprising a CDR3 region, said γT-cell receptor chain or part thereof being represented by an amino acid sequence, said amino acid sequence comprising at least 60% sequence identity or similarity with amino acid sequence SEQ ID NO:39 and/or 36.

[0221] Another preferred T cell used as a medicament comprises a nucleic acid molecule encoding a γδ TCR, said nucleic acid molecule being represented by a nucleotide sequence comprising: [0222] a nucleotide sequence that has at least 60% sequence identity with SEQ ID NO: 46 and/or 58 and/or a nucleotide sequence that encodes an amino acid sequence that has at least 60% amino acid identity or similarity with an amino acid sequence encoded by a nucleotide sequence SEQ ID NO: 46 and/or 58, and preferably [0223] a nucleotide sequence that has at least 60% sequence identity with SEQ ID NO: 47 and/or 59 and/or a nucleotide sequence that encodes an amino acid sequence that has at least 60% amino acid identity or similarity with an amino acid sequence encoded by a nucleotide sequence SEQ ID NO: 47 and/or 59.

[0224] Preferably, the identity is of at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100%.

[0225] Another preferred T cell used as a medicament as explained is preferably a T cell expressing: [0226] a δT-cell receptor chain or part thereof comprising a CDR3 region, said δT-cell receptor chain or part thereof being represented by an amino acid sequence, said amino acid sequence comprising at least 60% sequence identity or similarity with amino acid sequence SEQ ID NO: 23 and/or 29, and preferably [0227] a γT-cell receptor chain or part thereof comprising a CDR3 region, said γT-cell receptor chain or part thereof being represented by an amino acid sequence, said amino acid sequence comprising at least 60% sequence identity or similarity with amino acid sequence SEQ ID NO: 19 and/or 30.

[0228] Another preferred T cell used as a medicament comprises a nucleic acid molecule encoding a γδ TCR, said nucleic acid molecule being represented by a nucleotide sequence comprising: [0229] a nucleotide sequence that has at least 60% sequence identity with SEQ ID NO: 26 and/or 52 and/or a nucleotide sequence that encodes an amino acid sequence that has at least 60% amino acid identity or similarity with an amino acid sequence encoded by a nucleotide sequence SEQ ID NO: 26 and/or 52, and preferably [0230] a nucleotide sequence that has at least 60% sequence identity with SEQ ID NO: 41 and/or 53 and/or a nucleotide sequence that encodes an amino acid sequence that has at least 60% amino acid identity or similarity with an amino acid sequence encoded by a nucleotide sequence SEQ ID NO: 41 and/or 53.

[0231] Preferably, the identity is of at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100%.

[0232] Another preferred T cell used as a medicament as explained is preferably a T cell expressing: [0233] a δT-cell receptor chain or part thereof comprising a CDR3 region, said δT-cell receptor chain or part thereof being represented by an amino acid sequence, said amino acid sequence comprising at least 60% sequence identity or similarity with amino acid sequence SEQ ID NO: 24 and/or 31, and preferably [0234] a γT-cell receptor chain or part thereof comprising a CDR3 region, said γT-cell receptor chain or part thereof being represented by an amino acid sequence, said amino acid sequence comprising at least 60% sequence identity or similarity with amino acid sequence SEQ ID NO: 20 and/or 32.

[0235] Another preferred T cell used as a medicament comprises a nucleic acid molecule encoding a γδ TCR, said nucleic acid molecule being represented by a nucleotide sequence comprising: [0236] a nucleotide sequence that has at least 60% sequence identity with SEQ ID NO: 42 and/or 54 and/or a nucleotide sequence that encodes an amino acid sequence that has at least 60% amino acid identity or similarity with an amino acid sequence encoded by a nucleotide sequence SEQ ID NO: 42 and/or 54, and preferably [0237] a nucleotide sequence that has at least 60% sequence identity with SEQ ID NO: 43 and/or 55 and/or a nucleotide sequence that encodes an amino acid sequence that has at least 60% amino acid identity or similarity with an amino acid sequence encoded by a nucleotide sequence SEQ ID NO: 43 and/or 55.

[0238] Preferably, the identity is of at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100%.

[0239] Another preferred T cell used as a medicament as explained is preferably a T cell expressing: [0240] a δT-cell receptor chain or part thereof comprising a CDR3 region, said δT-cell receptor chain or part thereof being represented by an amino acid sequence, said amino acid sequence comprising at least 60% sequence identity or similarity with amino acid sequence SEQ ID NO: 25 and/or 33 and preferably [0241] a γT-cell receptor chain or part thereof comprising a CDR3 region, said γT-cell receptor chain or part thereof being represented by an amino acid sequence, said amino acid sequence comprising at least 60% sequence identity or similarity with amino acid sequence SEQ ID NO: 21 and/or 34.

[0242] Another preferred T cell used as a medicament comprises a nucleic acid molecule encoding a γδ TCR, said nucleic acid molecule being represented by a nucleotide sequence comprising: [0243] a nucleotide sequence that has at least 60% sequence identity with SEQ ID NO: 44 and/or 56 and/or a nucleotide sequence that encodes an amino acid sequence that has at least 60% amino acid identity or similarity with an amino acid sequence encoded by a nucleotide sequence SEQ ID NO: 44 and/or 56, and preferably [0244] a nucleotide sequence that has at least 60% sequence identity with SEQ ID NO: 45 and/or 57 and/or a nucleotide sequence that encodes an amino acid sequence that has at least 60% amino acid identity or similarity with an amino acid sequence encoded by a nucleotide sequence SEQ ID NO: 45 and/or 57.

[0245] Preferably, the identity is of at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100%.

[0246] Another preferred T cell used as a medicament as explained is preferably a T cell expressing: [0247] a δT-cell receptor chain or part thereof comprising a CDR3 region, said δT-cell receptor chain or part thereof being represented by an amino acid sequence, said amino acid sequence comprising at least 60% sequence identity or similarity with amino acid sequence SEQ ID NO:28 and/or 37 and preferably [0248] a γT-cell receptor chain or part thereof comprising a CDR3 region, said γT-cell receptor chain or part thereof being represented by an amino acid sequence, said amino acid sequence comprising at least 60% sequence identity or similarity with amino acid sequence SEQ ID NO:28 and/or 38.

[0249] Another preferred T cell used as a medicament comprises a nucleic acid molecule encoding a γδ TCR, said nucleic acid molecule being represented by a nucleotide sequence comprising: [0250] a nucleotide sequence that has at least 60% sequence identity with SEQ ID NO: 48 and/or 60 and/or a nucleotide sequence that encodes an amino acid sequence that has at least 60% amino acid identity or similarity with an amino acid sequence encoded by a nucleotide sequence SEQ ID NO: 48 and/or 60, and preferably [0251] a nucleotide sequence that has at least 60% sequence identity with SEQ ID NO: 49 and/or 61 and/or a nucleotide sequence that encodes an amino acid sequence that has at least 60% amino acid identity or similarity with an amino acid sequence encoded by a nucleotide sequence SEQ ID NO: 49 and/or 61.

[0252] Preferably, the identity is of at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100%. [0253] Another preferred T cell used as a medicament as explained is preferably a T cell expressing: [0254] a δT-cell receptor chain or part thereof comprising a CDR3 region, said δT-cell receptor chain or part thereof being represented by an amino acid sequence, said amino acid sequence comprising at least 60% sequence identity or similarity with amino acid sequence SEQ ID NO:40 and/or 70 and preferably [0255] a γT-cell receptor chain or part thereof comprising a CDR3 region, said γT-cell receptor chain or part thereof being represented by an amino acid sequence, said amino acid sequence comprising at least 60% sequence identity or similarity with amino acid sequence SEQ ID NO:65 and/or 71.

[0256] Another preferred T cell used as a medicament comprises a nucleic acid molecule encoding a γδ TCR, said nucleic acid molecule being represented by a nucleotide sequence comprising: [0257] a nucleotide sequence that has at least 60% sequence identity with SEQ ID NO: 76 and/or 82 and/or a nucleotide sequence that encodes an amino acid sequence that has at least 60% amino acid identity or similarity with an amino acid sequence encoded by a nucleotide sequence SEQ ID NO: 76 and/or 82, and preferably [0258] a nucleotide sequence that has at least 60% sequence identity with SEQ ID NO: 77 and/or 83 and/or a nucleotide sequence that encodes an amino acid sequence that has at least 60% amino acid identity or similarity with an amino acid sequence encoded by a nucleotide sequence SEQ ID NO: 77 and/or 83.

[0259] Preferably, the identity is of at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100%. [0260] Another preferred T cell used as a medicament as explained is preferably a T cell expressing: [0261] a δT-cell receptor chain or part thereof comprising a CDR3 region, said δT-cell receptor chain or part thereof being represented by an amino acid sequence, said amino acid sequence comprising at least 60% sequence identity or similarity with amino acid sequence SEQ ID NO:66 and/or 72 and preferably [0262] a γT-cell receptor chain or part thereof comprising a CDR3 region, said γT-cell receptor chain or part thereof being represented by an amino acid sequence, said amino acid sequence comprising at least 60% sequence identity or similarity with amino acid sequence SEQ ID NO:67 and/or 73.

[0263] Another preferred T cell used as a medicament comprises a nucleic acid molecule encoding a γδTCR, said nucleic acid molecule being represented by a nucleotide sequence comprising: [0264] a nucleotide sequence that has at least 60% sequence identity with SEQ ID NO: 78 and/or 84 and/or a nucleotide sequence that encodes an amino acid sequence that has at least 60% amino acid identity or similarity with an amino acid sequence encoded by a nucleotide sequence SEQ ID NO: 78 and/or 84, and preferably [0265] a nucleotide sequence that has at least 60% sequence identity with SEQ ID NO: 79 and/or 85 and/or a nucleotide sequence that encodes an amino acid sequence that has at least 60% amino acid identity or similarity with an amino acid sequence encoded by a nucleotide sequence SEQ ID NO: 79 and/or 85.

[0266] Preferably, the identity is of at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100%. [0267] Another preferred T cell used as a medicament as explained is preferably a T cell expressing: [0268] a δT-cell receptor chain or part thereof comprising a CDR3 region, said δT-cell receptor chain or part thereof being represented by an amino acid sequence, said amino acid sequence comprising at least 60% sequence identity or similarity with amino acid sequence SEQ ID NO:68 and/or 74 and preferably [0269] a γT-cell receptor chain or part thereof comprising a CDR3 region, said γT-cell receptor chain or part thereof being represented by an amino acid sequence, said amino acid sequence comprising at least 60% sequence identity or similarity with amino acid sequence SEQ ID NO:69 and/or 75.

[0270] Another preferred T cell used as a medicament comprises a nucleic acid molecule encoding a γδ TCR, said nucleic acid molecule being represented by a nucleotide sequence comprising: [0271] a nucleotide sequence that has at least 60% sequence identity with SEQ ID NO: 80 and/or 86 and/or a nucleotide sequence that encodes an amino acid sequence that has at least 60% amino acid identity or similarity with an amino acid sequence encoded by a nucleotide sequence SEQ ID NO: 80 and/or 86, and preferably [0272] a nucleotide sequence that has at least 60% sequence identity with SEQ ID NO: 81 and/or 87 and/or a nucleotide sequence that encodes an amino acid sequence that has at least 60% amino acid identity or similarity with an amino acid sequence encoded by a nucleotide sequence SEQ ID NO: 81 and/or 87.

[0273] Preferably, the identity is of at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100%. [0274] Another preferred T cell used as a medicament as explained is preferably a T cell expressing: [0275] a δT-cell receptor chain or part thereof comprising a CDR3 region, said δT-cell receptor chain or part thereof being represented by an amino acid sequence, said amino acid sequence comprising at least 60% sequence identity or similarity with amino acid sequence SEQ ID NO:88 and/or 90 and preferably [0276] a γT-cell receptor chain or part thereof comprising a CDR3 region, said γT-cell receptor chain or part thereof being represented by an amino acid sequence, said amino acid sequence comprising at least 60% sequence identity or similarity with amino acid sequence SEQ ID NO:89 and/or 91.

[0277] Another preferred T cell used as a medicament comprises a nucleic acid molecule encoding a γδ TCR, said nucleic acid molecule being represented by a nucleotide sequence comprising: [0278] a nucleotide sequence that has at least 60% sequence identity with SEQ ID NO: 92 and/or 94 and/or a nucleotide sequence that encodes an amino acid sequence that has at least 60% amino acid identity or similarity with an amino acid sequence encoded by a nucleotide sequence SEQ ID NO: 92 and/or 94, and preferably [0279] a nucleotide sequence that has at least 60% sequence identity with SEQ ID NO: 93 and/or 95 and/or a nucleotide sequence that encodes an amino acid sequence that has at least 60% amino acid identity or similarity with an amino acid sequence encoded by a nucleotide sequence SEQ ID NO: 93 and/or 95.

[0280] Preferably, the identity is of at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100%.

[0281] In the general part dedicated to definitions, more detailed information is provided as to the formulation of a pharmaceutical composition. The way the δT-cell (or γT-cell) receptor chain or part thereof or nucleic acid construct or viral vector or cells may be administered to a subject in a method of treatment or in a pharmaceutical use of each of these compounds has already been defined herein in the context of the method of the first aspect (see step c) and in the general part of the description dedicated to the definitions.

[0282] General Part Dedicated to Definitions

[0283] Polypeptide/Nucleic Acid

[0284] In the context of the invention, a polypeptide is represented by an amino acid sequence. Preferred polypeptides are δT-cell (or γT-cell) receptor chains or parts thereof which mediates an anti-tumour response as explained herein.

[0285] In the context of the invention, a nucleic acid molecule as a nucleic acid molecule encoding such a δT-cell (or γT-cell) receptor chain or part thereof is represented by a nucleic acid or nucleotide sequence which encodes such a polypeptide. A nucleic acid molecule may comprise a regulatory region.

[0286] It is to be understood that each nucleic acid molecule or polypeptide or construct as identified herein by a given Sequence Identity Number (SEQ ID NO) is not limited to this specific sequence as disclosed. Throughout this application, each time one refers to a specific nucleotide sequence SEQ ID NO (take SEQ ID NO: X as example) encoding a given polypeptide, one may replace it by: [0287] i. a nucleotide sequence comprising a nucleotide sequence that has at least 60% sequence identity or similarity with SEQ ID NO: X; [0288] ii. a nucleotide sequences the complementary strand of which hybridizes to a nucleic acid molecule of sequence of (i); [0289] iii. a nucleotide sequence the sequence of which differs from the sequence of a nucleic acid molecule of (i) or (ii) due to the degeneracy of the genetic code; or, [0290] iv. a nucleotide sequence that encodes an amino acid sequence that has at least 60% amino acid identity or similarity with an amino acid sequence encoded by a nucleotide sequence SEQ ID NO: X.

[0291] Throughout this application, each time one refers to a specific amino acid sequence SEQ ID NO (take SEQ ID NO: Y as example), one may replace it by: a polypeptide comprising an amino acid sequence that has at least 60% sequence identity or similarity with amino acid sequence SEQ ID NO: Y.

[0292] Each nucleotide sequence or amino acid sequence described herein by virtue of its identity or similarity percentage (at least 60%) with a given nucleotide sequence or amino acid sequence respectively has in a further preferred embodiment an identity or a similarity of at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or more identity or similarity with the given nucleotide or amino acid sequence respectively. In a preferred embodiment, sequence identity or similarity is determined by comparing the whole length of the sequences as identified herein. Unless otherwise indicated herein, identity or similarity with a given SEQ ID NO means identity or similarity based on the full length of said sequence (i.e. over its whole length or as a whole).

[0293] Sequence Identity

[0294] “Sequence identity” is herein defined as a relationship between two or more amino acid (polypeptide or protein) sequences or two or more nucleic acid (polynucleotide) sequences, as determined by comparing the sequences. The identity between two amino acid or two nucleic acid sequences is preferably defined by assessing their identity within a whole SEQ ID NO as identified herein or part thereof. Part thereof may mean at least 50% of the length of the SEQ ID NO, or at least 60%, or at least 70%, or at least 80%, or at least 90%.

[0295] In the art, “identity” also means the degree of sequence relatedness between amino acid or nucleic acid sequences, as the case may be, as determined by the match between strings of such sequences. “Similarity” between two amino acid sequences is determined by comparing the amino acid sequence and its conserved amino acid substitutes of one polypeptide to the sequence of a second polypeptide. “Identity” and “similarity” can be readily calculated by known methods, including but not limited to those described in (Computational Molecular Biology, Lesk, A. M., ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects, Smith, D. W., ed., Academic Press, New York, 1993; Computer Analysis of Sequence Data, Part I, Griffin, A. M., and Griffin, H. G., eds., Humana Press, New Jersey, 1994; Sequence Analysis in Molecular Biology, von Heine, G., Academic Press, 1987; and Sequence Analysis Primer, Gribskov, M. and Devereux, J., eds., M Stockton Press, New York, 1991; and Carillo, H., and Lipman, D., SIAM J. Applied Math., 48:1073 (1988).

[0296] Preferred methods to determine identity are designed to give the largest match between the sequences tested. Methods to determine identity and similarity are codified in publicly available computer programs. Preferred computer program methods to determine identity and similarity between two sequences include e.g. the GCG program package (Devereux, J., et al., Nucleic Acids Research 12 (1): 387 (1984)), BestFit, BLASTP, BLASTN, and FASTA (Altschul, S. F. et al., J. Mol. Biol. 215:403-410 (1990). The BLAST X program is publicly available from NCBI and other sources (BLAST Manual, Altschul, S., et al., NCBI NLM NIH Bethesda, Md. 20894; Altschul, S., et al., J. Mol. Biol. 215:403-410 (1990). The well-known Smith Waterman algorithm may also be used to determine identity.

[0297] Preferred parameters for polypeptide sequence comparison include the following: Algorithm: Needleman and Wunsch, J. Mol. Biol. 48:443-453 (1970); Comparison matrix: BLOSSUM62 from Hentikoff and Hentikoff, Proc. Natl. Acad. Sci. USA. 89:10915-10919 (1992); Gap Penalty: 12; and Gap Length Penalty: 4. A program useful with these parameters is publicly available as the “Ogap” program from Genetics Computer Group, located in Madison, Wis. The aforementioned parameters are the default parameters for amino acid comparisons (along with no penalty for end gaps).

[0298] Preferred parameters for nucleic acid comparison include the following: Algorithm: Needleman and Wunsch, J. Mol. Biol. 48:443-453 (1970); Comparison matrix: matches=+10, mismatch=0; Gap Penalty: 50; Gap Length Penalty: 3. Available as the Gap program from Genetics Computer Group, located in Madison, Wis. Given above are the default parameters for nucleic acid comparisons.

[0299] Optionally, in determining the degree of amino acid similarity, the skilled person may also take into account so-called “conservative” amino acid substitutions, as will be clear to the skilled person. Conservative amino acid substitutions refer to the interchangeability of residues having similar side chains. For example, a group of amino acids having aliphatic side chains is glycine, alanine, valine, leucine, and isoleucine; a group of amino acids having aliphatic-hydroxyl side chains is serine and threonine; a group of amino acids having amide-containing side chains is asparagine and glutamine; a group of amino acids having aromatic side chains is phenylalanine, tyrosine, and tryptophan; a group of amino acids having basic side chains is lysine, arginine, and histidine; and a group of amino acids having sulphur-containing side chains is cysteine and methionine. Preferred conservative amino acids substitution groups are: valine-leucine-isoleucine, phenylalanine-tyrosine, lysine-arginine, alanine-valine, and asparagine-glutamine. Substitutional variants of the amino acid sequence disclosed herein are those in which at least one residue in the disclosed sequences has been removed and a different residue inserted in its place. Preferably, the amino acid change is conservative. Preferred conservative substitutions for each of the naturally occurring amino acids are as follows: Ala to Ser; Arg to Lys; Asn to Gln or His; Asp to Glu; Cys to Ser or Ala; Gln to Asn; Glu to Asp; Gly to Pro; His to Asn or Gln; Ile to Leu or Val; Leu to Ile or Val; Lys to Arg, Gln or Glu; Met to Leu or Ile; Phe to Met, Leu or Tyr; Ser to Thr; Thr to Ser; Trp to Tyr; Tyr to Trp or Phe; and Val to Ile or Leu.

[0300] Conjugate

[0301] A polypeptide comprising a δT-cell (or γT-cell) receptor chain or part thereof which mediates an anti-tumour response as explained herein may be coupled or linked to an agent to form a conjugate. The agent may be selected from the group consisting of a diagnostic agent, a therapeutic agent, an anti-cancer agent, a chemical, a nanoparticle, a chemotherapeutic agent or a fluorochrome.

[0302] Gene or Coding Sequence

[0303] “Gene” or “coding sequence” or “nucleic acid” or “nucleic” refers to a DNA or RNA region (the transcribed region) which “encodes” a particular polypeptide such as a δT-cell receptor. A coding sequence is transcribed (DNA) and translated (RNA) into a polypeptide when placed under the control of an appropriate regulatory region, such as a promoter. A gene may comprise several operably linked fragments, such as a promoter, a 5′ leader sequence, an intron, a coding sequence and a 3′nontranslated sequence, comprising a polyadenylation site or a signal sequence. A chimeric or recombinant gene (such as the one encoding a δTCR or γTCR chain comprising the polypeptide as identified herein and operably linked to a promoter) is a gene not normally found in nature, such as a gene in which for example the promoter is not associated in nature with part or all of the transcribed DNA region. “Expression of a gene” refers to the process wherein a gene is transcribed into an RNA and/or translated into an active protein.

[0304] Promoter

[0305] As used herein, the term “promoter” refers to a nucleic acid fragment that functions to control the transcription of one or more genes (or coding sequence), located upstream with respect to the direction of transcription of the transcription initiation site of the gene, and is structurally identified by the presence of a binding site for DNA-dependent RNA polymerase, transcription initiation sites and any other DNA sequences, including, but not limited to transcription factor binding sites, repressor and activator protein binding sites, and any other sequences of nucleotides known to one of skill in the art to act directly or indirectly to regulate the amount of transcription from the promoter. A “constitutive” promoter is a promoter that is active under most physiological and developmental conditions. An “inducible” promoter is a promoter that is regulated depending on physiological or developmental conditions. A “tissue specific” promoter is preferentially active in specific types of differentiated cells/tissues, such as preferably a T cell.

[0306] Operably Linked

[0307] “Operably linked” is defined herein as a configuration in which a control sequence such as a promoter sequence or regulating sequence is appropriately placed at a position relative to the nucleotide sequence of interest, preferably coding for a δTCR (or a γTCR) chain comprising the polypeptide as identified such that the promoter or control or regulating sequence directs or affects the transcription and/or production or expression of the nucleotide sequence of interest, preferably encoding a δTCR (or γTCR) chain comprising the polypeptide as identified in a cell and/or in a subject. For instance, a promoter is operably linked to a coding sequence if the promoter is able to initiate or regulate the transcription or expression of a coding sequence, in which case the coding sequence should be understood as being “under the control of” the promoter.

[0308] Viral Expression Construct

[0309] An expression construct carries a genome that is able to stabilize and remain episomal in a cell. Within the context of the invention, a cell may mean to encompass a cell used to make the construct or a cell wherein the construct will be administered. Alternatively a construct is capable of integrating into a cell's genome, e.g. through homologous recombination or otherwise. A particularly preferred expression construct is one wherein a nucleotide sequence encoding a δTCR (or TCR) chain or part thereof is operably linked to a promoter as defined herein wherein said promoter is capable of directing expression of said nucleotide sequence (i.e. coding sequence) in a cell. Such a preferred expression construct is said to comprise an expression cassette. An expression cassette as used herein comprises or consists of a nucleotide sequence encoding a δTCR (or γTCR) chain or part thereof. A viral expression construct is an expression construct which is intended to be used in gene therapy. It is designed to comprise part of a viral genome as later defined herein.

[0310] Expression constructs disclosed herein could be prepared using recombinant techniques in which nucleotide sequences encoding said δTCR (or TCR) chain or part thereof are expressed in a suitable cell, e.g. cultured cells or cells of a multicellular organism, such as described in Ausubel et al., “Current Protocols in Molecular Biology”, Greene Publishing and Wiley-Interscience, New York (1987) and in Sambrook and Russell (2001, supra); both of which are incorporated herein by reference in their entirety. Also see, Kunkel (1985) Proc. Natl. Acad. Sci. 82:488 (describing site directed mutagenesis) and Roberts et al. (1987) Nature 328:731-734 or Wells, J. A., et al. (1985) Gene 34: 315 (describing cassette mutagenesis).

[0311] Typically, a nucleic acid or nucleotide sequence encoding a δTCR (or TTCR) chain is used in an expression construct or expression vector. The phrase “expression vector” generally refers to a nucleotide sequence that is capable of effecting expression of a gene in a host compatible with such sequences. These expression vectors typically include at least suitable promoter sequences and optionally, transcription termination signals. An additional factor necessary or helpful in effecting expression can also be used as described herein. A nucleic acid or DNA or nucleotide sequence encoding a δTCR (or γTCR) chain is incorporated into a DNA construct capable of introduction into and expression in an in vitro cell culture. Specifically, a DNA construct is suitable for replication in a prokaryotic host, such as bacteria, e.g., E. coli, or can be introduced into a cultured mammalian, plant, insect, (e.g., Sf9), yeast, fungi or other eukaryotic cell lines.

[0312] A DNA construct prepared for introduction into a particular host may include a replication system recognized by the host, an intended DNA segment encoding a desired polypeptide, and transcriptional and translational initiation and termination regulatory sequences operably linked to the polypeptide-encoding segment. The term “operably linked” has already been defined herein. For example, a promoter or enhancer is operably linked to a coding sequence if it stimulates the transcription of the sequence. DNA for a signal sequence is operably linked to DNA encoding a polypeptide if it is expressed as a preprotein that participates in the secretion of a polypeptide. Generally, a DNA sequence that is operably linked are contiguous, and, in the case of a signal sequence, both contiguous and in reading frame. However, enhancers need not be contiguous with a coding sequence whose transcription they control. Linking is accomplished by ligation at convenient restriction sites or at adapters or linkers inserted in lieu thereof, or by gene synthesis.

[0313] The selection of an appropriate promoter sequence generally depends upon the host cell selected for the expression of a DNA segment. Examples of suitable promoter sequences include prokaryotic, and eukaryotic promoters well known in the art (see, e.g. Sambrook and Russell, 2001, supra). A transcriptional regulatory sequence typically includes a heterologous enhancer or promoter that is recognised by the host. The selection of an appropriate promoter depends upon the host, but promoters such as the trp, lac and phage promoters, tRNA promoters and glycolytic enzyme promoters are known and available (see, e.g. Sambrook and Russell, 2001, supra). An expression vector includes the replication system and transcriptional and translational regulatory sequences together with the insertion site for the polypeptide encoding segment can be employed. In most cases, the replication system is only functional in the cell that is used to make the vector (bacterial cell as E. coli). Most plasmids and vectors do not replicate in the cells infected with the vector. Examples of workable combinations of cell lines and expression vectors are described in Sambrook and Russell (2001, supra) and in Metzger et al. (1988) Nature 334: 31-36. For example, suitable expression vectors can be expressed in, yeast, e.g. S. cerevisiae, e.g., insect cells, e.g., Sf9 cells, mammalian cells, e.g., CHO cells and bacterial cells, e.g., E. coli. A cell may thus be a prokaryotic or eukaryotic host cell. A cell may be a cell that is suitable for culture in liquid or on solid media.

[0314] Alternatively, a host cell is a cell that is part of a multicellular organism such as a transgenic plant or animal.

[0315] Viral Vector

[0316] A viral vector or a gene therapy vector is a vector that comprises a viral expression construct as defined above.

[0317] A viral vector or a gene therapy vector is a vector that is suitable for gene therapy. Vectors that are suitable for gene therapy are described in Anderson 1998, Nature 392: 25-30; Walther and Stein, 2000, Drugs 60: 249-71; Kay et al., 2001, Nat. Med. 7: 33-40; Russell, 2000, J. Gen. Virol. 81: 2573-604; Amado and Chen, 1999, Science 285: 674-6; Federico, 1999, Curr. Opin. Biotechnol. 10: 448-53; Vigna and Naldini, 2000, J. Gene Med. 2: 308-16; Marin et al., 1997, Mol. Med. Today 3: 396-403; Peng and Russell, 1999, Curr. Opin. Biotechnol. 10: 454-7; Sommerfelt, 1999, J. Gen. Virol. 80: 3049-64; Reiser, 2000, Gene Ther. 7: 910-3; and references cited therein.

[0318] A particularly suitable gene therapy vector includes an Adenoviral and Adeno-associated virus (AAV) vector. These vectors infect a wide number of dividing and non-dividing cell types including synovial cells and liver cells. The episomal nature of the adenoviral and AAV vectors after cell entry makes these vectors suited for therapeutic applications. (Russell, 2000, J. Gen. Virol. 81: 2573-2604; Goncalves, 2005, Virol J. 2(1):43) as indicated above. AAV vectors are even more preferred since they are known to result in very stable long term expression of transgene expression (up to 9 years in dog (Niemeyer et al, Blood. 2009 Jan. 22; 113(4):797-806) and 2 years in human (Nathwani et al, N Eng J Med. 2011 Dec. 22; 365(25):2357-65, Simonelli et al, Mol Ther. 2010 March; 18(3):643-50. Epub 2009 Dec. 1.)). Preferred adenoviral vectors are modified to reduce the host response as reviewed by Russell (2000, supra). Method for gene therapy using AAV vectors are described by Wang et al., 2005, J Gene Med. March 9 (Epub ahead of print), Mandel et al., 2004, Curr Opin Mol Ther. 6(5):482-90, and Martin et al., 2004, Eye 18(11):1049-55, Nathwani et al, N Eng J Med. 2011 Dec. 22; 365(25):2357-65, Apparailly et al, Hum Gene Ther. 2005 April; 16(4):426-34.

[0319] Another suitable gene therapy vector includes a retroviral vector. A preferred retroviral vector for application in the present invention is a lentiviral based expression construct. Lentiviral vectors have the ability to infect and to stably integrate into the genome of dividing and non-dividing cells (Amado and Chen, 1999 Science 285: 674-6). Methods for the construction and use of lentiviral based expression constructs are described in U.S. Pat. Nos. 6,165,782, 6,207,455, 6,218,181, 6,277,633 and 6,323,031 and in Federico (1999, Curr Opin Biotechnol 10: 448-53) and Vigna et al. (2000, J Gene Med 2000; 2: 308-16).

[0320] Other suitable gene therapy vectors include a herpes virus vector, a polyoma virus vector or a vaccinia virus vector.

[0321] A gene therapy vector comprises a nucleotide encoding a δTCR chain (or γTCR), whereby each of said nucleotide sequence is operably linked to the appropriate regulatory sequences. Such regulatory sequence will at least comprise a promoter sequence. Suitable promoters for expression of such a nucleotide sequence from gene therapy vectors include e.g. cytomegalovirus (CMV) intermediate early promoter, viral long terminal repeat promoters (LTRs), such as those from murine moloney leukaemia virus (MMLV) rous sarcoma virus, or HTLV-1, the simian virus 40 (SV 40) early promoter and the herpes simplex virus thymidine kinase promoter. Transposon or other non-viral delivery systems may also be used in this context. All systems can be used in vitro or in vivo.

[0322] A gene therapy vector may optionally comprise a further nucleotide sequence coding for a further polypeptide. A further polypeptide may be a (selectable) marker polypeptide that allows for the identification, selection and/or screening for cells containing the expression construct. Suitable marker proteins for this purpose are e.g. the fluorescent protein GFP, and the selectable marker genes HSV thymidine kinase (for selection on HAT medium), bacterial hygromycin B phosphotransferase (for selection on hygromycin B), Tn5 aminoglycoside phosphotransferase (for selection on G418), and dihydrofolate reductase (DHFR) (for selection on methotrexate), CD20. the low affinity nerve growth factor gene. Sources for obtaining these marker genes and methods for their use are provided in Sambrook and Russel (2001) “Molecular Cloning: A Laboratory Manual (3.sup.rd edition), Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, New York.

[0323] A gene therapy vector is preferably formulated in a pharmaceutical composition as defined herein. In this context, a pharmaceutical composition may comprise a suitable pharmaceutical carrier as earlier defined herein.

[0324] Transgene

[0325] A “transgene” is herein defined as a gene or a nucleic acid molecule (i.e. a molecule encoding a δTCR (or a γTCR) chain) that has been newly introduced into a cell, i.e. a gene that may be present but may normally not be expressed or expressed at an insufficient level in a cell. The transgene may comprise sequences that are native to the cell, sequences that naturally do not occur in the cell and it may comprise combinations of both. A transgene may contain sequences coding for a δTCR (or a γTCR) chain and comprising the polypeptide as identified and/or additional proteins as earlier identified herein that may be operably linked to appropriate regulatory sequences for expression of the sequences coding for a δTCR (or a γTCR) chain. Preferably, the transgene is not integrated into the host cell's genome.

[0326] Transduction

[0327] “Transduction” refers to the delivery of a δTCR (or a γTCR) chain or parts thereof into a recipient host cell by a viral vector. For example, transduction of a target cell by a retroviral or lentiviral vector of the invention leads to transfer of the genome contained in that vector into the transduced cell.

[0328] Host Cell/Target Cell

[0329] “Host cell” or “target cell” refers to the cell into which the DNA delivery takes place, such as the T cells of a donor.

[0330] Engineered Cells

[0331] “Engineered cells” refers herein to cells having been engineered, e.g. by the introduction of an exogenous nucleic acid sequence as defined herein. Such a cell has been genetically modified for example by the introduction of for example one or more mutations, insertions and/or deletions in the endogenous gene and/or insertion of a genetic construct in the genome. An engineered cell may refer to a cell in isolation or in culture. Engineered cells may be “transduced cells” wherein the cells have been infected with e.g. a modified virus, for example, a retrovirus may be used, such as described in the examples, but other suitable viruses may also be contemplated such as lentiviruses. Non-viral methods may also be used, such as transfections. Engineered cells may thus also be “stably transfected cells” or “transiently transfected cells”. Transfection refers to non-viral methods to transfer DNA (or RNA) to cells such that a gene is expressed. Transfection methods are widely known in the art, such as calciumphosphate transfection, PEG transfection, and liposomal or lipoplex transfection of nucleic acids. Such a transfection may be transient, but may also be a stable transfection wherein cells can be selected that have the gene construct integrated in their genome. In some cases genetic engineering systems such as CRISPR or Argonaute maybe utilized to design engineered cells that express a polypeptide described herein.

[0332] Pharmaceutical Composition/Method of Treatment

[0333] In therapeutic applications, an effective amount of a δTCR (or γTCR) chain or parts thereof or nucleic acid construct or viral vector or cell expressing these molecules as defined herein is administered to a subject.

[0334] The term “effective amount” as used herein is defined as the amount of the molecules of the present invention that are necessary to result in the desired physiological change in the cell or tissue to which it is administered. The term “therapeutically effective amount” as used herein is defined as the amount of the molecules of the present invention that achieves a desired effect with respect to cancer. In this context, a “desired effect” is synonymous with “an anti-tumour activity” as earlier defined herein. A skilled artisan readily recognizes that in many cases the molecules may not provide a cure but may provide a partial benefit, such as alleviation or improvement of at least one symptom or parameter. In some embodiments, a physiological change having some benefit is also considered therapeutically beneficial. Thus, in some embodiments, an amount of molecules that provides a physiological change is considered an “effective amount” or a “therapeutically effective amount.”

[0335] Pharmaceutical compositions of the present invention comprise an effective amount of one or more molecules (i.e. a polypeptide comprising a δTCR or γTCR chain or variants or parts thereof or nucleic acid construct or viral vector or cell expressing these molecules as defined herein) optionally dissolved or dispersed in a pharmaceutically acceptable carrier. The phrases “pharmaceutical or pharmacologically acceptable” refers to molecular entities and compositions that do not produce or produce acceptable adverse, allergic or other untoward reaction when administered to an animal, such as, for example, a human, as appropriate. Whether certain adverse effects are acceptable is determined based on the severity of the disease. The preparation of a pharmaceutical composition that contains at least one active ingredient will be known to those of skill in the art in light of the present disclosure, as exemplified by Remington's Pharmaceutical Sciences, 18th Ed. Mack Printing Company, 1990, incorporated herein by reference. Moreover, for animal (e.g., human) administration, it will be understood that preparations should meet sterility, pyrogenicity, general safety and purity standards as required by FDA Office of Biological Standards.

[0336] As used herein, “pharmaceutically acceptable carrier” includes any and all solvents, dispersion media, coatings, surfactants, antioxidants, preservatives (e.g., antibacterial agents, antifungal agents), isotonic agents, absorption delaying agents, salts, preservatives, drugs, drug stabilizers, gels, binders, excipients, disintegration agents, lubricants, sweetening agents, flavoring agents, dyes, such like materials and combinations thereof, as would be known to one of ordinary skill in the art (see, for example, Remington's Pharmaceutical Sciences, 18th Ed. Mack Printing Company, 1990, pp. 1289-1329, incorporated herein by reference). Except insofar as any conventional carrier is incompatible with the active ingredient, its use in the therapeutic or pharmaceutical compositions is contemplated. In certain embodiments, a pharmaceutical composition described herein comprising a population of cells described herein, further comprises a suitable amount of an antifungal agent. In some cases, a pharmaceutical composition described herein comprises an antifungal agent in an amount sufficient for the pharmaceutical composition to retain at least 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90% of its desired activity for a period of at least 1 month, 2 months, 3 months, 6 months, 1 year, 1.5 years, 2 years, 2.5 years or 3 years.

[0337] The actual dosage amount of a composition of the present invention administered to an animal or a patient can be determined by physical and physiological factors such as body weight, severity of condition, the type of disease being treated, previous or concurrent therapeutic interventions, idiopathy of the patient and on the route of administration. The practitioner responsible for administration will, in any event, determine the concentration of active ingredient(s) in a composition and appropriate dose(s) for the individual subject.

[0338] T Cell as Pharmaceutical Composition

[0339] Prior to expansion and genetic modification of the T cells of the invention, a source of T cells is obtained from a subject. T cells can be obtained from a number of sources, including PBMCs, bone marrow, lymph node tissue, cord blood, thymus tissue, tissue from a site of infection, ascites, pleural effusion, spleen tissue, and tumors. In certain embodiments of the present invention, T cells can be obtained from a unit of blood collected from a subject using any number of techniques known to the skilled artisan, such as Ficoll™ separation. In one embodiment, cells from the circulating blood of an individual are obtained by apheresis. The apheresis product typically contains lymphocytes, including T cells, monocytes, granulocytes, B cells, other nucleated white blood cells, red blood cells, and platelets. In one embodiment, the cells collected by apheresis may be washed to remove the plasma fraction and to place the cells in an appropriate buffer or media for subsequent processing steps. In a particular embodiment, the engineered cell can be a T cell. The engineered cell can be an effector (T.sub.EFF), effector-memory (T.sub.EM), central-memory (T.sub.CM), T memory stem (T.sub.SCM), naïve (T.sub.N), or CD4+ or CD8+ T cell. The T cells can also be selected from a bulk population, for example, selecting T cells from whole blood. The T cells can also be expanded from a bulk population. The T cells can also be skewed towards particular populations and phenotypes. The engineered cell can also be expanded ex vivo. The engineered cell can be formulated into a pharmaceutical composition. The engineered cell can be formulated into a pharmaceutical composition and used to treat a subject in need thereof as earlier explained herein. The engineered cell can be autologous to a subject in need thereof. The engineered cell can be allogeneic to a subject in need thereof. The engineered cell can also be a good manufacturing practices (GMP) compatible reagent. The engineered cell can be part of a combination therapy to treat a subject in need thereof. The engineered cell can be a human cell. The subject that is being treated can be a human.

[0340] A method of attaining suitable cells can comprise sorting cells. In some cases, a cell can comprise a marker that can be selected for the cell. For example, such marker can comprise GFP, a resistance gene, a cell surface marker, an endogenous tag. Cells can be selected using any endogenous marker. Suitable cells can be selected or sorted using any technology. Such technology can comprise flow cytometry and/or magnetic columns. The selected cells can then be infused into a subject. The selected cells can also be expanded to large numbers. The selected cells can be expanded prior to infusion.

[0341] Vectors can be delivered to cells ex vivo, such as cells explanted from an individual patient (e.g., lymphocytes, T cells, bone marrow aspirates, tissue biopsy), followed by re-implantation of the cells into a patient, usually after selection for cells which have incorporated the vector. Prior to or after selection, the cells can be expanded.

[0342] Ex vivo cell transfection can also be used for diagnostics, research, or for gene therapy (e.g. via re-infusion of the transfected cells into the host organism). In some cases, cells are isolated from the subject organism, transfected with a nucleic acid (e.g., gene or DNA), and re-infused back into the subject organism (e.g. patient). Further, also in vivo cell transfection can be used for gene therapy, in order to reduced immune reactions of the patient.

[0343] In some cases, populations of engineered T cells may be formulated for administration to a subject using techniques known to the skilled artisan. Formulations comprising populations of engineered T cells may include pharmaceutically acceptable excipient(s). Excipients included in the formulations will have different purposes depending, for example, on the subpopulation of T cells used and the mode of administration. Examples of generally used excipients included, without limitation: saline, buffered saline, dextrose, water-for-injection, glycerol, ethanol, and combinations thereof, stabilizing agents, solubilizing agents and surfactants, buffers and preservatives, tonicity agents, bulking agents, and lubricating agents. The formulations comprising populations of engineered T cells will typically have been prepared and cultured in the absence of any non-human components, such as animal serum.

[0344] A formulation may include one population of engineered T cells, or more than one, such as two, three, four, five, six or more population of engineered T cells. The formulations comprising population(s) of engineered T cells may be administered to a subject using modes and techniques known to the skilled artisan. Exemplary modes include, but are not limited to, intravenous injection. Other modes include, without limitation, intratumoral, intradermal, subcutaneous (s.c., s.q., sub-Q, Hypo), intramuscular (i.m.), intraperitoneal (i.p.), intra-arterial, intramedullary, intracardiac, intra-articular (joint), intrasynovial (joint fluid area), intracranial, intraspinal, and intrathecal (spinal fluids). Any known device useful for parenteral injection of infusion of the formulations can be used to effect such administration. The formulations comprising population(s) of engineered T cells that are administered to a subject comprise a number of engineered T cells that is effective for the treatment and/or prophylaxis of the specific indication or disease. Thus, therapeutically-effective populations of engineered T cells are administered to subjects when the methods of the present invention are practiced. In general, formulations are administered that comprise between about 1×10.sup.4 and about 1×10.sup.10 engineered T cells. In most cases, the formulation will comprise between about 1×10.sup.5 and about 1×10.sup.9 engineered T cells, from about 5×10.sup.5 to about 5×10.sup.8 engineered T cells, or from about 1×10.sup.6 to about 1×10.sup.7 engineered T cells. However, the number of engineered T cells administered to a subject will vary between wide limits, depending upon the location, source, identity, extent and severity of the cancer, the age and condition of the individual to be treated etc. A physician will ultimately determine appropriate dosages to be used.

GENERAL

[0345] In this document and in its claims, the verb “to comprise” and its conjugations is used in its non-limiting sense to mean that items following the word are included, but items not specifically mentioned are not excluded. In addition the verb “to consist” may be replaced by “to consist essentially of” meaning that a method as defined herein may comprise additional step(s), respectively component(s) than the ones specifically identified, said additional step(s), respectively component(s) not altering the unique characteristic of the invention. In addition, reference to an element by the indefinite article “a” or “an” does not exclude the possibility that more than one of the element is present, unless the context clearly requires that there be one and only one of the elements. The indefinite article “a” or “an” thus usually means “at least one”.

[0346] The word “about” when used in association with an integer (about 10) preferably means that the value may be the given value of 10 more or less 1 of the value: about 10 preferably means from 9 to 11. The word “about” when used in association with a numerical value (about 10.6) preferably means that the value may be the given value of 10.6 more or less 1% of the value 10.6.

[0347] All patent and literature references cited in the present specification are hereby incorporated by reference in their entirety. The following examples are offered for illustrative purposes only, and are not intended to limit the scope of the present invention in any way.

TABLE-US-00001 TABLE 1 Overview of the sequences of the sequence listing SEQ. Amino acid (aa) ID NO Name or DNA  1 Primer table 1 DNA  2 Primer table 1 DNA  3 Primer table 1 DNA  4 Primer table 1 DNA  5 Primer table 1 DNA  6 Primer table 1 DNA  7 CDR3 VD1 Fe11 aa  8 CDR3 VD2 cl3 aa  9 CD3 VD2 cl5 aa  10 CDR3 VG5 Fe11 aa  11 CDR3 VG cl3 aa  12 CDR3 VG9 cl5 aa  13 TRD cl3 aa  14 TRG cl3 aa  15 TRD cl5 aa  16 TRG cl5 aa  17 TRD Fe11 aa  18 TRG Fe11 aa  19 CDR3 VG4 E113 aa  20 CDR3 VG2 F4 aa  21 CDR3 VG8 Zi11 aa  22 CDR3 VD5 D37 aa  23 CDR3 VD5 E113 aa  24 CDR3 VD1 F4 aa  25 CDR3 VD1 Zi11 aa  26 TRD E113 DNA wild type  27 CDR3 VG4 C132 aa  28 CDR3 VD5 C132 aa  29 TRD E113 aa  30 TRG E113 aa  31 TRD F4 aa  32 TRG F4 aa  33 TRD Zi11 aa  34 TRG Zi11 aa  35 TRD D37 aa  36 TRG D37 aa  37 TRD C132 aa  38 TRG C132 aa  39 CDR3 VG8 D37 aa  40 CDR3 VD3 F2 aa  41 TRG E113 DNA wild type  42 TRD F4 DNA wild type  43 TRG F4 DNA wild type  44 TRD Zi11 DNA wild type  45 TRG Zi11 DNA wild type  46 TRDD37 DNA wild type  47 TRG D37 DNA wild type  48 TRD C132 DNA wild type  49 TRG C132 DNA wild type  50 TRD Fe11 DNA wild type  51 TRG Fe11 DNA wild type  52 TRD E113 DNA codon opt.  53 TRG E113 DNA codon opt.  54 TRD F4 DNA codon opt.  55 TRG F4 DNA codon opt.  56 TRD Zi11 DNA codon opt.  57 TRG Zi11 DNA codon opt.  58 TRD D37 DNA codon opt.  59 TRG D37 DNA codon opt.  60 TRD C132 DNA codon opt.  61 TRG C132 DNA codon opt.  62 TRD Fe11 DNA codon opt.  63 TRG Fe11 DNA codon opt.  64 Longer CDR3 VG5 Fe11 aa  65 CDR3 VG4 F2 Aa  66 CDR3 VD1 Ze11 aa  67 CDR3 VG8 Ze11 aa  68 CDR3 VD5 B23 aa  69 CDR3 VG8 B23 aa  70 TRD F2 aa  71 TRG F2 aa  72 TRD Ze11 aa  73 TRG Ze11 aa  74 TRD B23 aa  75 TRG B23 aa  76 TRD F2 DNA wild type  77 TRG F2 DNA wild type  78 TRD Ze11 DNA wild type  79 TRG Ze11 DNA wild type  80 TRD B23 DNA wild type  81 TRG B23 DNA wild type  82 TRD F2 DNA codon opt.  83 TRG F2 DNA codon opt.  84 TRD Ze11 DNA codon opt.  85 TRG Ze11 DNA codon opt.  86 TRD B23 DNA codon opt.  87 TRG B23 DNA codon opt.  88 CDR3 VD1 B9 aa  89 CDR3 VG5 B9 aa  90 TRD B9 aa  91 TRG B9 aa  92 TRD B9 DNA wild type  93 TRG B9 DNA wild type  94 TRD B9 DNA codon opt.  95 TRG B9 DNA codon opt.  96 TRD FE11 aa without signal pept.  97 TRG FE11 aa without signal pept.  98 TRD clone 3 aa without signal pept.  99 TRG clone 3 aa without signal pept. 100 TRD clone 5 aa without signal pept. 101 TRG clone 5 aa without signal pept.

EXAMPLES

[0348] It is understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application and scope of the appended claims.

[0349] Unless specified, reagents employed in the examples are commercially available or can be prepared using commercially available instrumentation, methods, or reagents known in the art. The examples illustrate various aspects of the invention and practice of the methods of the invention. The examples are not intended to provide an exhaustive description of the many different embodiments of the invention. Thus, although the invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, those of ordinary skill in the art will realize readily that many changes and modifications can be made thereto without departing from the spirit or scope of the appended claims.

Example 1

[0350] Material & Methods

[0351] Frozen PBMC's from healthy donors were thawed and stained with the following antibodies: CD3 (eFluor450 clone okt 3 1:40 eBioscience), αβ TCR (APC clone IP26 1:10, eBioscience), and pan γδ TCR (PE clone IMMU510 1:10 Boeckman Coulter), or with CD3 (PE clone UCHT1 1:20 BD), CD4 (APC clone RPA-T4 1:100 Biolegend), CD8 (PerCP-Cy5.5 clone RPA-T8 1:1000 Biolegend), CD27 (APC eFluor780 clone 0323 1:20 eBioscience), and CD45RA (PB clone HI100 1:50 Biolegend). Samples were sorted with flow cytometry on the ARIAII (BD) in an αβ-fraction (CD3+, αβ+), and a 76-fraction (CD3+, γδ+), or in different subsets of CD4+ and CD4− T cells. RNA was isolated using Qiagen Rneasy Minikit for samples ≥0.5×10.sup.6 cells or Qiagen Rneasy Microkit for samples <0.5×10.sup.6 cells following manufacturer's instructions. Specific cDNA for TRB and TRD was synthesized with Superscript® II Reverse Transcriptase (Thermofisher), using a specific primer at the 3′ constant region of TRB or TRD. A universal template switch adaptor, containing a unique molecular identifier (UMI), was incorporated at the 5′end of the V region to be able to take PCR bias into account during the analysis. An overview of the used primers can be found in Table 1. After cDNA synthesis the cDNA was purified using NucleoSpin® Gel and PCR Clean-UP (Machery-Nagel). cDNA was amplified during with PCR using Q5® High Fidelity DNA polymerase (New England Biolabs). A specific nested primer at the constant region of TRB or TRD, and a step-out primer which anneals to the switch adaptor were used (Table 1). PCR amplification was performed on a T100 Thermal Cycler (Biorad) using the following steps 90 s at 98° C., 35 cycles of 7 s at 98° C., 20 s at 62° C., 50 s at 72° C., followed by 10 m at 72° C. PCR products were purified using NucleoSpin® Gel and PCR Clean-UP (Machery-Nagel). PCR products were analyzed with QIAxcel Advanced System (Qiagen).

[0352] TruSeq Barcode adapters (Illumina) were ligated to the PCR products using the ClaSeek Ligation Mix (Thermo Scientific), according to the recommendations of the manufacturer. Cleanup of the samples was performed with The Agencourt AMPure XP system (Beckman Coulter). Next-generation sequencing was performed on an Illumina MiSeq system 500 (2×250 bp) (Illumina).

[0353] Sequencing data were analyzed with the MiXCR program (Bolotin, et al. (7)). To correct for PCR bias UMI's were extracted from the sequencing data using the MIGEC pipeline (Shugay, et al. (8)) Only sequences with a valid UMI were used for further analyses. To search for shared CDR3 sequence regions within the different donors an interactive webtool was used (http://bioinformatics.psb.ugent.be/webtools/Venn/). Further methods for functional analyses have been described in Sebestyen et al (Cell Rep. 2016, 15: 1973-1985) and Scheper et al (Leukemia, 2013, 27: 1328-1338).

TABLE-US-00002 TABLE 2 Overview primers cDNA synthesis Constant CAGTATCTGGAGTCATTGA region TRB (SEQ ID NO: 1) Constant CTTGGATGACACGAGAT region TRD (SEQ ID NO: 2) Template AAGCAGUGGTAUCAACGCAGAGUNNNNUNNNNUNN switch NNUCTT(rG)4 (SEQ ID NO: 3) adaptor with UMI PCR amplification Nested TGCTTCTGATGGCTCAAACAC (SEQ ID NO: 4) primer constant region TRB Nested AACGGATGGTTTGGTATGAG (SEQ ID NO: 5) primer constant region TRD Step out CACTCTATCCGACAAGCAGTGGTATCAACGCAG primer (SEQ ID NO: 6) (anneals to switch adaptor)

[0354] rG=riboguanosine, necessary for the template switch adaptor to anneal. The backbone of this adaptor is cDNA, but in this part there are four RNA-G's. This template switch adapter is described in U.S. Pat. No. 5,962,272 and in Zhu Y et al (Zhu Y et al 2001, BioTechniques, 30: 892-897).

[0355] Results

[0356] We hypothesized that rapid sequencing of γδTCR chains by next generation sequencing followed by comparison of (dominant) clones between different individuals can be used to rapidly identify functionally relevant clones, which are shared between different individuals. In order to test this hypothesis, we isolated γδT cells from 6 different donors and analyzed the δTCR repertoire by NGS as indicated in material and methods. For further analyses two strategies were used, either the individual analysis of three donors indicated as HD 18, 19, and 20 as well as a pool of three donors, depicted as “combined” (HD11, 12, and 15). In addition, we utilized as hypothetical 7.sup.th donor the randomly collected database of γδTCR chains obtained by single cell cloning and sequencing from many different donors, which are available in the public and our private database. After correction for the percentage of overlapping unique clones for overlapping UMI's a 7-fold higher amount of shared δTCR has been observed when compared to βTCR repertoire (FIG. 1). When further adjusting the corrected ratios for the average size of the found repertoire, the difference between the frequency of observed overlapping clones was even more pronounced with 1-2 log differences more overlapping clones observed for shared δTCR chains (FIG. 2). Thus, although the theoretical δTCR repertoire is substantially bigger than the theoretical βTCR repertoire; we show that the chance of finding an overlapping clone in the δTCR repertoire is 1-2 log-higher than when analyzing a βTCR repertoire. We hypothesized that these shared δTCR chains must provide a specific survival advantage and could be therefore essential in function, such as daily tumor surveillance.

[0357] Comparing δTCR sequences between different NGS-donors results in the identification of a limited number of clones, which have been shared at least between two different donors (FIG. 3 and Table 2 and not shown). In addition, we compared our δTCR sequences from HDs with the 7.sup.th hypothetical donor. Thereby we identified additional 62 negative TCR chain, which is the second most frequent sequence in donor HD19 (Tables 3 and 4) and 62 positive TCR chains, which are shared at least between HD15 and the 7.sup.th hypothetical donor (Table 3). Some of these relevant clones are within the top 30 clones of at least one the healthy donors, indicating the potential biological relevance of these clones. As proof of concept for the functional and potential therapeutic relevance of identified shared δTCR sequences we further searched for described complete γδTCR sequences harboring by us so far identified dominant and shared δTCR sequences. We identified clone FE11 (Table 3), which has been described recently by our group (62 negative δTCR (9), Table 2). Clone Fe11 was the second most prevalent clone in HD19 (Table 4). Screening of tumor cell lines classified this clone as tumor reactive against malignant B cell and solid cancer cell lines ((10) and FIG. 4). In addition we could identify one overlapping 62 positive δTCR sequence as part of the distinct clone 5, and one sequence corresponding to the so called clone 3, which have both also been extensively described by our group (Table 3 and (11)). Clone 5 was found in the top 20 of clones of HD15 (Table 4). This sequence has been reported to be very active against many types of hematological and solid cancer cells ((11, 12) and Table 4).

[0358] In summary, we provide proof of concept that we can down scale a highly diverse immune repertoire to very limited number of sequences, which are tumor reactive and therefore therapeutically relevant. In addition to anti-tumor reactivity identified sequences can also be active highly against infection as evidenced by the identification of shared Vδ2 positive TCR chain sequences. Thus, high throughput sequencing of δTCR chains followed by the comparison of sequences between different donors can be a very powerful tool and result in the rapid identification of γδTCR chains which can be interesting for therapeutic applications.

TABLE-US-00003 TABLE 3 Shared clonotypes Vdelta Previously described Vδ2 negative CALGDSYGGGPLYTDKLIF Vd1 Fe11 (SEQ ID NO: 7) Vδ2 positive CACDLLGYTDKLIF Vd2 C13 (SEQ ID NO: 8) CACDALKRTDTDKLIF Vd2 C15 (SEQ ID NO: 9)

TABLE-US-00004 TABLE 4 Characteristics known clones Clone CDR3 δ chain CDR3 γ chain Fe11 CALGDSYGGGPLYTDKLIF ATWDRPEIYYKKL SEQ ID NO: 7 SEQ ID NO: 10 C13 CACDLLGYTDKLIF CALWEEELGKKIKVF SEQ ID NO: 8 SEQ ID NO: 11 C15 CACDALKRTDTDKLIF CALWEIQELGKKIKMF SEQ ID NO: 9 SEQ ID NO: 12

[0359] Discussion

[0360] Main finding of this study is that by comparing NGS data of Rand δTCR chains from different healthy donors we observe a substantial frequency of shared δTCR chains between different individuals, though the βTCR repertoire is as expected seldomly shared. Data mining of CDR3 regions within identified δTCR sequences and public data bases elucidated further that highly therapeutically interesting receptor chains such as the by us recently described chain of clone 5 from 62-positive 6TCβ chains (11) was found among the dominant top 20 clones of HD15. Moreover, the 62-negative δTCR chain of clone Fe11(9) was the second most prevalent clone in HD19. Main advantage is that such a strategy narrows down very quickly the potential very high diversity of δTCR chains from 10.sup.1 to literally less than 10.sup.2 sequences of therapeutic interest. This has practical and therapeutical consequences as high through put screening of γδTCR chain sequences followed by the identification of shared sequences in healthy and diseased patients can serve as rapid hub for the identification of novel therapeutic tools which can be used for e.g. T cells engineered with defined δTCRs, so called TEGs (13). In addition, repertoire analyses of diseased patients has the power to rapidly identify patients who might benefit from the addition of an immune repertoire with defined δTCR sequences.

TABLE-US-00005 TRD Cl3 Amino acid sequence: SEQ ID NO: 13 m e r i s s l i h l s l f w a g v m s a i e l v p e h q t v p v s i g v p a t l r c s m k g e a i g n y y i n w y r k t q g n t m t f i y r e k d i y g p g f k d n f q g d i d i a k n l a v l k i l a p s e r d e g s y y c a c d l l g y t d k l i f g k g t r v t v e p r s q p h t k p s v f v m k n g t n v a c l v k e f y p k d i r i n l v s s k k i t e f d p a i v i s p s g k y n a v k l g k y e d s n s v t c s v q h d n k t v h s t d f e v k t d s t d h v k p k e t e n t k q p s k s c h k p k a i v h t e k v n m m s l t v l g l r m l f a k t v a v n f l l t a k l f f l TRG Cl3 Amino acid sequence: SEQ ID NO: 14 m v s l l h a s t l a v l g a l c v y g a g h l e q p q i s s t k t l s k t a r l e c v v s g i t i s a t s v y w y r e r p g e v i q f l v s i s y d g t v r k e s g i p s g k f e v d r i p e t s t s t l t i h n v e k q d i a t y y c a l w e e e l g k k i k v f g p g t k l i i t d k q l d a d v s p k p t i f l p s i a e t k l q k a g t y l c l l e k f f p d v i k i h w e e k k s n t i l g s q e g n t m k t n d t y m k f s w l t v p e k s l d k e h r c i v r h e n n k n g v d q e i i f p p i k t d v i t m d p k d n c s k d a n d t l l l q l t n t s a y y m y l l l l l k s v v y f a i i t c c l l r r t a f c c n g e k s TRD Cl5 Amino acid sequence: SEQ ID NO: 15 m e r i s s l i h l s l f w a g v m s a i d l v p e h q t v p v s i g v p a t l r c s m k g e a i g n y y i n w y r k t q g n t m t f i y r e k d i y g p g f k d n f q g d i d i a k n l a v l k i l a p s e r d e g s y y c a c d a l k r t d t d k l i f g k g t r v t v e p r s q p h t k p s v f v m k n g t n v a c l v k e f y p k d i r i n l v s s k k i t e f d p a i v i s p s g k y n a v k l g k y e d s n s v t c s v q h d n k t v h s t d f e v k t d s t d h v k p k e t e n t k q p s k s c h k p k a i v h t e k v n m m s l t v l g l r m l f a k t v a v n f l l t a k l f f l TRG Cl5 Amino acid sequence: SEQ ID NO: 16 m v s l l h a s t l a v l g a l c v y g a g h l e q p q i s s t k t l s k t a r l e c v v s g i t i s a t s v y w y r e r p g e v i q f l v s i s y d g t v r k e s g i p s g k f e v d r i p e t s t s t l t i h n v e k q d i a t y y c a l w e i q e l g k k i k v f g p g t k l i i t d k q l d a d v s p k p t i f l p s i a e t k l q k a g t y l c l l e k f f p d v i k i h w e e k k s n t i l g s q e g n t m k t n d t y m k f s w l t v p e k s l d k e h r c i v r h e n n k n g v d q e i i f p p i k t d v i t m d p k d n c s k d a n d t l l l q l t n t s a y y m y l l l l l k s v v y f a i i t c c l l r r t a f c c n g e k s TRD Fell Amino acid sequence: SEQ ID NO: 17 m v f s s l l c v f v a f s y s g s s v a q k v t q a q s s v s m p v r k a v t l n c l y e t s w w s y y i f w y k q l p s k e m i f l i r q g s d e q n a k s g r y s v n f k k a a k s v a l t i s a l q l e d s a k y f c a l g d s y g g g p l y t d k l i f g k g t r v t v e p r s q p h t k p s v f v m k n g t n v a c l v k e f y p k d i r i n l v s s k k i t e f d p a i v i s p s g k y n a v k l g k y e d s n s v t c s v q h d n k t v h s t d f e v k t d s t d h v k p k e t e n t k q p s k s c h k p k a i v h t e k v n m m s l t v l g l r m l f a k t v a v n f l l t a k l f f l TRG Fell Amino acid sequence: SEQ ID NO: 18 m g w a l l v h a f l s p a s q k s s n l e g g t k s v t r p t r s s a e i t c d l t v i n a f y i h w y l h q e g k a p q r l l y y d v s n s k d v l e s g l s p g k y y t h t p r r w s w i l i l r n l i e n d s g v y y c a t w d r p e i y y k k l f g s g t t l v v t d k q l d a d v s p k p t i f l p s i a e t k l q k a g t y l c l l e k f f p d v i k i h w e e k k s n t i l g s q e g n t m k t n d t y m k f s w l t v p e k s l d k e h r c i v r h e n n k n g v d q e i i f p p i k t d v i t m d p k d n c s k d a n d t l l l q l t n t s a y y m y l l l l l k s v v y f a i i t c c l l r r t a f c c n g e k s

Example 2

[0361] Material & Methods

[0362] Patient, Sample Collection and Cell Lines

[0363] All donor and patient material were collected according to GCP and Helsinki regulations. Peripheral blood mononuclear cell (PBMC) samples from healthy donors and acute myeloid leukemia (AML) patients were from the University Medical Center Utrecht Biobank. The use of the TNBC patient samples was approved by the ethics committee of the University of Freiburg Medical Center. From the archive of the Institute of Clinical Pathology, Freiburg we selected 16 formalin-fixed paraffin-embedded tissue specimens with the diagnosis of “TNBC”. The histopathological diagnosis was performed according to the Union for the International Cancer Control (UICC) criteria. All the tumors were Grade III in the modified Bloom-Richardson classification (Elston). Conforming to the recommendations for the evaluation of TILs (14 15), the H&E stained samples contained at least 50% tumor infiltration. The cohort of 11 tumors (5 medullary breast carcinoma's and 6 invasive ductal carcinoma's) that we studied further was selected on the basis that the correspondent frozen tissue samples were available in the tumor bank of the Comprehensive Cancer Center Freiburg (CCCF). All these samples were classified as basal like subtype according to the expression of CK 5/6 or 14 and EGFR (16). The median age of the patients was 59 years in a range between 43 and 82 years.

[0364] Breast cancer cell lines and frozen tumor material were tested for HCMV using IHC nested PCR according to the protocol previously published by Bender et al (17), and real-time PCR with the Artus® CMV™ PCR kit (Qiagen, Hilden, Germany) in a 7900HT Fast real time PCR cycler (Applied Biosystems, CA, USA) according to the manufacturer instructions.

[0365] Next Generation Sequencing of TCRδ and TCRβ Repertoire

[0366] The protocol is adapted from Mamedov et al with modifications (18). Frozen PBMCs from healthy donors were thawed and stained with the following antibodies: CD3 eFluor 450, TCRαβ APC, and TCRγδ PE monoclonal antibodies (mAb). (Table 6. Samples were sorted on the ARIAII (BD) in an αβ-fraction (CD3.sup.+, αβ.sup.+), and a γδ-fraction (CD3.sup.+, γδ+). RNA was isolated using Qiagen Rneasy Minikit for samples ≥0.5×10.sup.6 cells or Qiagen Rneasy Microkit for samples <0.5×10.sup.6 cells following manufacturer's instructions. Specific cDNA for TCRδ and TCRβ was synthesized with Superscript® II Reverse Transcriptase (Thermofisher), using a specific primer at the 3′ constant region and an universal template switch adaptor was incorporated at the 5′end of the V region. cDNA was purified using NucleoSpin® Gel and PCR Clean-UP (Machery-Nagel) thereafter amplified with a first PCR amplification using Q5® High Fidelity DNA polymerase (New England Biolabs), on a T100 Thermal Cycler (Biorad) using the following steps 90 s at 98° C., 15 cycles of 7 s at 98° C., 20 s at 62° C., 50 s at 72° C., followed by 10 m at 72° C. A specific nested primer at the constant region, and a step-out primer which anneals to the switch adaptor were used (Table 5). PCR products were loaded on a 1.5% agarose gel for size selection of products between 400-600 base pairs. After purification of the gel with NucleoSpin® Gel and PCR Clean-UP (Machery-Nagel), the PCR product was used for a second PCR with a reverse nested primer on the constant region and a forward primer which annealed on the switch adaptor (Table 5), using the following steps: 90 s at 98° C., 20 cycles of 7 s at 98° C., 20 s at 62° C., 50 s at 72° C., followed by 10 m at 72° C. After purification with NucleoSpin® Gel and PCR Clean-UP (Machery-Nagel), the final PCR products were analyzed with QIAxcel Advanced System (Qiagen). Library preparation for NGS was done with NGSgo-LibrX kit with NGSgo-IndX indices from Gendx according to recommendations of the manufacturer. Cleanup of the samples was performed with HighPrep PCR beads from GC Biotech. Next-generation sequencing was performed on an Illumina MiSeq system 500 (2×250 bp) (Illumina). Sequencing data were analyzed with the MiXCR program (Bolotin, et al. (18)) and VDJ-tools for further analyses.

[0367] Immunohistochemistry (IHC) and Image Analysis of TNBC Samples

[0368] Serial FFPE 2 μm sections mounted on Superfrost plus glass slides (R Langenbrink, Germany), were dewaxed and rehydrated. After the proper antigen retrieval in a pressure cooker with citrate buffer (pH 6) and citrate buffer (pH 6.1) (Dako, Hamburg, Gemany), blocking of nonspecific binding was performed using goat serum (5% in PBS). Mouse monoclonal anti-TCRγ-chain mAb and rabbit-anti-human cleaved caspase 3 (cC3) polyclonal antiserum (Table 6) as we previously reported (19). The HCMV detection was performed using the mouse anti-CMV mAb. Alkaline phosphatase-conjugated and Horseradish peroxidase-conjugated detection systems were used to visualize the primary antibodies in a separate or sequential protocols for single or double staining test with red and brown chromogen (DakoREAL™ Alkaline Phosphatase/RED r/m and EnVision™FLEX Systems, Dako, USA). Acidic hematoxylin was used as a counterstain.

[0369] IHC samples were analyzed and tiled scanned using an AxioObserver Z1 with Apotome2 system with an ERc5s digital camera. The initial analysis was performed using the AxioVision 4.8 and ZEN BLUE image software (all from Carl Zeiss MicroImaging, Jena, Germany). Colocalization and quantitate analysis were performed with ImageJ (NIH images, USA) and QuPath (GitHub, San Francisco Calif., USA) software with Bio-Formats, Stack Slicer and Cell counter plugins (20).

[0370] Immunofluorescence Imaging of TNBC Samples

[0371] Sections at 5 m were mounted on Superfrost plus Adhesion glass slides, air-dried for 3 hours and fixed with pre-cooled acetone (−20° C.) for 10 minutes. Samples were rinsed with TBST for 5 minutes (3×) and blocking for nonspecific binding using normal human serum 5% in PBS for 30 min. The samples were incubated with corresponding primary mouse-anti-human mAbs: anti-TCRγ and anti-CD69 mAb or goat-anti-human polyclonal anti-IFN-7 and anti-IL-17 antisera. Fluorescence-conjugated secondary antibodies used to visualized the primary antibodies were rabbit-anti-mouse AlexaFluor 488, donkey-anti-rabbit AlexaFluor 568, donkey-anti-goat AlexaFluor 594, donkey-anti-goat AlexaFluor 647 (Table 6). Samples were mounted using the Prolong® Diamond Antifade medium with DAPI (Thermo Fischer).

[0372] Tissue Immunostaining and Laser Capture Microdissection of TNBC Samples

[0373] Frozen sections (8 m thick) were air dried overnight on MembraneSlide 1.0 PEN™ membrane covered slides (Carl Zeiss, Munich, Germany), fixed in pre-cooled acetone (−20° C.) for 10 min, washed twice with TBST and incubated for 30 min with 5% human serum in PBS. The samples were incubated for 30 min at room temperature with the mouse anti-human TCRγ mAb (Table 6). To detect the primary antibody, a biotinylated anti-mouse secondary antibody with alkaline phosphatase detection system (Dako REAL™ Detection System Alkaline P/RED, rabbit-mouse). Mayer's hematoxylin was used as counterstain. Samples were dried at room temperature for 2 hours, examined under microscopy and stored at 4° C. until processing.

[0374] Laser microdissection was performed using an Axiovert microscope equipped with a PALM MicroBeam system (ZEISS Microscopy, Oberkochen, Germany). Energy parameters of cutting and catapulting were stablished individually for each sample. Only infiltrating single lymphocytes in close contact with cancer cells were selected at 40× magnification and microdissected at 63× magnification. Single cells were catapulted into the cap of an Adhesive Cap 500 Opaque™ 500 μl tube (Carl Zeiss, Göttingen, Germany). To improve isolation, the cap contained 5 μl of 1× Expand High Fidelity PCR buffer w/o MgCl.sub.2 (Roche, Mannheim, Germany). Then, 15 μl of a 1:10 mix containing PCR buffer and Proteinase K (20 mg/ml, PCR grade, Roche, Mannheim, Germany) were added for the digestion. The tubes were incubated with the lid down for 4 h at 56° C., centrifuged for 2 min at 500 rpm and heat inactivated at 95° C. for 10 min. Additional tubes containing only membrane were dissected from each sample and used as negative controls. All PCR tubes were overlaid with mineral oil under a laminar flow hood before adding the PCR master mix.

[0375] Single-Cell PCR of TNBC γδ TILs

[0376] DNA isolation, the first and the second rounds of PCR were performed in different “single-cell rooms” under laminar flow cabinet previously decontaminated with UV lamp, ethanol and DNA Zap (Invitrogen, Bleiswijk, Netherlands). Separate sets of pipettes, consumables and reagents were used for each step and every two weeks all reagents were tested to prevent contamination. Corresponding to the single-cell PCR technique previously described for the analysis of rearranged immunoglobulin genes (21), a multiplex, semi-nested, hot-start PCR was prepared with 15 newly designed primers (Table 7). For the first round, a master mix was prepared with 5 μl dNTP (2 mM), 5 μl 10×PCR buffer (High Fidelity System), 5 μl primer mix (2.5 μM, forward and reverse primers), 3.2 μl 25 M MgCl.sub.2, 6.5 μl H.sub.2O and 15 μl from the DNA digestion. A volume of 0.3 μl Expand High Fidelity enzyme mix (3.5 units/μl) was added after the first denaturation step to a final volume of 40 μl. The cycler program was 95° C. 2 min, 80° C. pause (enzyme added), 72° C. 1 min, 39× (95° C. 50 s, 56° C. 30 s, 72° C. 60 s), 72° C. 5 min and 10° C. pause. For the second round, eight master mixes were prepared to detect TCRγ and δ chains: two mixes for TCRγ (Vγ1-8 and Vγ9) and six for TCRδ (Vδ1, Vδ2, Vδ3, Vδ4, Vδ5 and Vδ6) (Suppl. Table 4) with 2.5 μl dNTP (2 mM), 2.5 μl 10×PCR buffer, 1.25 μl of the respective Vγ and Vδ forward primers, 1.25 μl of the respective joint mix primers, 2 μl 25 mM MgCl.sub.2, 12.2 μl H.sub.2O, 3 μl of first round PCR product and 0.3 μl Expand High Fidelity enzyme mix (3.5 units/μl). The cycler program was 95° C. 5 min, 72° C. 1 min, 35× (95° C. 50 s, 55.5° C. 30 s, 72° C. 1 min), 72° C. 5 min, 15° C. 5 min and 4° C. pause. The PCR products were analyzed by 2% agarose gel electrophoresis and the positive bands were cut under UV light and purified from the gel with the Qiaex II gel extraction kit (Qiagen, Hilden, Germany). The clean DNA was sequenced using the BigDye Terminator 3.1 system (Applied Biosystems, CA, USA), the sequencing reactions consisted of 1 μl BigDye, 3.75 μl 15× sequencing buffer, 0.75 μl forward primer, 3-10 μl template and water to a final volume of 20 μl. The cycler conditions were 96° C. 5 min, 24× (95° C. 15 sec., 50° C. 10 sec., 60° C. 4 min), 10° C. pause. The sequence sample was cleaned using the DyeEx 2.0 Spin Kit (Quiagen) and analyzed on the ABI 3130XL capillary sequencer (Applied Biosystems, Darmstadt, Germany). The sequences we compared and evaluated with the IMGT database (http://www.imgt.org/) and the IgBlast tool (https://www.ncbi.nlm.nih.gov/igblast/)

[0377] Retroviral Expression of Plasmids from TNBC γδ TILs

[0378] Codon optimized DNA coding for the full length γ and δ TCR chains of the tumor infiltrating lymphocytes and for full length EPCR was ordered at Baseclear Inc. The synthetic genes were flanked with a 5′ NcoI and a 3′ BamHI site for subsequent cloning into a pBullet retroviral expression vector. The 7 TCR genes were subcloned into pBullet-IRES-neo and the δ TCR genes as well as EPCR were subcloned into pBullet-IRES-puromycin.

[0379] Transduction of αβ T Cells.

[0380] For the generation of TEGs, PBMCs were transduced defined TCRγ and δ chains as described (22-24). In short, retroviral supernatant was produced by Phoenix-Ampho packaging cells, that were transfected with gag-pol (pHIT60), env (pCOLT-GALV) and pBullet retroviral constructs containing TCRγ or δ, using Fugene HD (Promega). PBMCs preactivated with αCD3 (30 ng/ml) (clone OKT3, Janssen-Cilag) and IL-2 (50 U/ml) were transduced twice with viral supernatant within 48 hours in the presence of 50 U/ml IL-2 and 4 μg/ml polybrene (Sigma-Aldrich). Transduced T cells were expanded by stimulation with αCD3/CD28 Dynabeads (0.5×10.sup.6 beads/10.sup.6 cells) (Invitrogen) and IL-2 (50 U/ml) and selected with 800 μg/ml geneticin (Gibco) and 5 g/ml puromycin (Sigma-Aldrich) for one week. Following transduction, transduced T cells were stimulated biweekly with 1 μg/ml PHA-L (Sigma-Aldrich), 50 U/ml IL-2 (Novartis Pharma), 5 ng/ml IL-15 (R&D Systems), and irradiated allogeneic PBMCs, Daudi and LCL-TM cells. Fresh IL-2 was added twice a week. Transgenic TCR expression was routinely assessed by flow cytometry.

[0381] Functional Assays of Primary Clones and TEG's

[0382] IFNγ ELISPOT was performed as previously described (25, 26). Briefly, 15,000 TCR-transduced or mock-transduced T cells and 50,000 target cells (ratio 0.3:1) were co-cultured for 24 hrs in nitrocellulose-bottomed 96-well plates (Millipore) precoated with anti-IFNγ antibody (clone 1-D1K) (Mabtech). Plates were washed and incubated with a second biotinylated anti-IFNγ antibody (clone 7-B6-1) (Mabtech) followed by streptavidin-HRP (Mabtech). IFNγ spots were visualized with TMB substrate (Sanquin) and the number of spots was quantified using ELISPOT Analysis Software (Aelvis). IFNγ ELISA was performed using ELISA-ready-go! Kit (eBioscience, San Diego, Calif., USA) following manufacturer's instructions. Effector and target cells (E:T 1:1) were incubated for 24 h in the presence of pamidronate when indicated.

[0383] CD1 Tetramer Staining

[0384] CD1c and CD1d tetramers were produced as described before (27). TEGs were stained with anti-γδ TCR-APC antibody (Table 5) and CD1 streptavidin-PE tetramers at a concentration of 50 nM in PBS+0.5% BSA for 30′ at room temperature. After two wash steps the cells were analyzed by flow cytometry on a BD FACSCanto II.

[0385] Mouse model for TEG001

[0386] The NOD.Cg-Prkcd.sup.scid IL2rg.sup.tm1Wj1/SzJ (NSG) mice, originally obtained from JAX (Bar Harbor, Me., USA), were bred and housed in the specific pathogen-free (SPF) breeding unit of the Central Animal Facility of Utrecht University. Experiments were conducted according to Institutional Guidelines after acquiring permission from the local Ethical Committee and in accordance with current Dutch laws on Animal Experimentation. For the experiments mice from 8 to 12 weeks of age were used. At day 0 mice received sublethal total body irradiation (175 cGy) followed by i.v. injection of 5×10.sup.6 OPM2-Luc tumor cells at day 1. Mice were treated with 10.sup.7 TEG001 cells or Mock TCR transduced T cells i.v. at day 7 and 14. Mice received 0.6×10.sup.6 IU of IL-2 in IFA s.c. on day 7 and every 21 days till the end of the experiment. Pamidronate (10 mg/kg body weight) was applied at day 7 i.v. and every 21 days until the end of the experiment. Tumors were visualized in vivo by bioluminescent imaging. Mice were anesthetized by isoflurane before they received an i.p. injection (100 μl) of 25 mg/ml Beetle Luciferin (Promega, Madison Wis.). Bioluminescence images were acquired by using a third generation cooled GaAs intensified charge-coupled device camera, controlled by the Photo Vision software and analyzed with M.sup.3Vision software (all from Photon Imager; Biospace Laboratory, Paris, France).

[0387] Results

[0388] Identification of Shared TCRδ Sequences with Next Generation Sequencing.

[0389] In order to understand the functional implication of shared immune receptors within the TCRδ repertoire we analyzed TCRδ chains from 14 different healthy donors (dataset 1). After sorting γδ T cells by flow cytometry. followed by TCRδ repertoire analyses by NGS, we found 9011 amino acids sequences of the TCRδ CDR3 (CDR36) region. Further analysis on the most abundant sequences per donor, defined as sequences with a clonal frequency of >0.1% (n=1478), showed that 1.8% of sequences where shared between at least two donors. Of these shared sequences one was shared between three different donors (Table 8). Overlap of TCRδ sequences between 2 different donors differed from 0 to 3.9% of the sequences of the 2 donors (FIG. 5A). In contrast in the TCRβ repertoire only 0.7% of sequences were shared. We identified 6 shared sequences, and the overlap between 2 different donors ranged from 0 to 1.9% (FIG. 5B). As expected for peripheral blood repertoires the majority of the identified sequences was Vδ2+(FIG. 6A). In line with this the majority of the shared sequences was also Vδ2. In addition we identified four shared Vδ1 sequences.

[0390] Analyses of TCRδ Repertoires in the Tumor Infiltrating Tissues

[0391] Immune repertoires of γδ T cells in healthy individuals between peripheral blood and tissues differ substantially (28), although it is reported that TCRδ sequences identified in tissue could be traced back in the peripheral blood (28). To analyze whether the same holds true for γδ tumor infiltrating lymphocytes (T6 TILs) we compared the sequences of the peripheral TCRδ repertoire (dataset 1-4) with a fifth dataset consisting of published γδ TIL TCRδ sequences and a publicly available dataset of Li et al. The dataset of Li et al consisted of CDR3 sequences of TILs of various tumors with 1060 complete CDR36 sequences. In line with the assumption that Vδ2.sup.neg γδ T cells are the dominant fraction in tissues, only 19% of TCRδ sequences were classified as Vδ2 TCRδ. The majority of the sequences were of Vδ1 origin, but compared to the healthy repertoires also the Vδ3, Vδ5, Vδ7 and Vδ8 fraction were increased. Although the percentage of Vδ2 TCRδ sequences in tumor tissue is relatively low, still 24 shared Vδ2 sequences could be identified (FIG. 5C). Interestingly, once peripheral T cells have been heavily enriched for Vδ1 γδ T cells before NGS analyses (dataset 3) 10 Vδ1 sequences could be characterized as shared between the peripheral blood and γδ TILs (FIG. 5D). Although these data demonstrate that it is possible to identify shared sequences between γδ TILs and the peripheral blood, it also illustrates the limitation of this method because of the different composition of the TCRδ repertoire between peripheral blood and cancer tissues.

[0392] Single Cell Analyses of γδ TILs in Patients with Triple Negative Breast Cancer

[0393] In order to further analyze in depth γδ TIL receptor sequences between individual cancer patients at the tumor site a previously characterized TNBC cohort was used. T6 TILs in TNBC have been associated with elevated levels of the apoptotic marker cleaved caspase 3 at the tumor site (29). In order to identify γδ TILs with close proximity to apoptotic tumor cells paraffin embedded tissues were co-stained for TCRγδ and cleaved caspase-3 using IHC. γδ TILs were observed at high frequency in all of the examined biopsies and apoptotic tumor cells were in contact with γδ T cells (FIG. 7A). Expression of CD69, as evident by IHC (FIG. 7B), suggested a T cell receptor-mediated activation of γδ TILs. Conflicting roles of γδ TILs have been described such as cancer immune surveillance (30) or tumor promoting properties through IL-17 (31). Therefore, IFNγ and IL-17 expression was further assessed by IHC. Most γδ TILs were IFN.sup.pos and did not substantiality stain for IL-17, suggesting that indeed investigated γδ TILs are activated with a Th1-type and that γδ T cells are an active participant of daily cancer immune surveillance.

[0394] Diversity and Sharing of TCRγ and S Chains Derived from γδ TILs

[0395] Diversity and clonal expansion of γδ TILs in individual TNBC patients was first analyzed by spectratyping of Vγ and Vδ genes. These data confirmed that also tumor infiltrating γδ T cells Vγ and Vδ gene usage is polyclonal in most patients. These data were also confirmed for five of the breast cancer samples by NGS of the delta sequences (dataset 7, FIG. 6B). However, with a mean of 68.9%, the Vδ2 T cell proportion appeared higher in the NGS breast cancer data than observed for other tumor tissues (FIG. 6B). This is most likely due to the strong vascularization of investigated tissues. The Vδ3 and Vδ5 gene were again enriched in tumor tissue, suggesting that these subsets might be functionally important in cancer immune surveillance. Next we searched for public TCRδ sequences in the NGS breast cancer data. 52 Vδ2 sequences were shared with the healthy donor datasets and 3 sequences were shared with the γδ TIL dataset (FIG. 5C). Interestingly, a Vδ3 sequence which was also present in the γδ TIL sequences, was also found within this dataset of breast cancer TILs (FIG. 5E). No further Vδ1 shared sequences were observed (FIG. 5D). In summary, analysis of this rather unique and homogenous cohort indicates that the 76 T cell repertoire in tumor tissue is quite diverse, and that despite some increased frequency for Vδ3 and Vδ5 in our TNBC cohort, but also in a dataset of γδ TILs (32) of Li et al., no substantial clonal expansion can be observed among γδ TILs.

[0396] Next, we aimed to assess whether shared individual 7 or δ TCR chains were involved in a cognate γδ T cell tumor interaction. Therefore, single cells were isolated from frozen TNBC sections using laser microdissection and transferred to a PCR tube to determine the TCR sequence using single cell sequencing. In total, 530 single γδ T cells were isolated from 11 different tumors and 27 paired TCR γ and δ sequences from 9 different patients could be identified. (dataset 6, Table 9). The other single cell sequencing reactions did not result in reliable sequencing data for both the γ and/or δ TCR chain, however we were able to determine 63 additional non-paired γ and 28 additional non-paired δ CDR3 sequences. The single cell sequencing data again confirmed a polyclonal population of tumor infiltrating γδ T cells, within patients some TCRδ and TCRγ sequences were seen multiple times. As expected from our analyses of TILs across many cancer patients, as well as our analysis tumor infiltrating γδ T cells in patients suffering from TNBC. Non-Vγ9 and non-Vδ2 genes, were most prominent in the sequences obtained. The Vδ2 gene was used in 7 out of the 55 TCRδ sequences and the Vγ9 gene in 21 out of the 90 TCRγ sequences. Interestingly, 4 of the 27 clones used an identical Vδ5 sequence paired with a different 7 TCR sequence (Table 9). Additionally, this Vδ5 sequence was also identified in 6 non-paired δ CDR3 sequences (FIG. 8A). This sequence was found in 6 out of 11 patients, which classifies it as a public CDR3 sequence. This particular sequence has also been reported to associate with CMV- and tumor-reactivity (33). However, surprisingly none of the patients that had this particular shared TCRVδ5 sequence were CMV positive. Two Vδ1 sequences were shared between 2 different patients. As additional quality control we could retrieve four of the single cell TRD sequences within NGS dataset from TNBC: three sequences of patient E and one sequence of patient F, indicating that many receptors picked up by single cell sequencing might be of very low frequency and therefore not visible through NGS of TCRδ repertoires.

[0397] The TCRγ chain was more frequently shared between the isolated T cells out of the 90 obtained sequences in total, 10 different sequences were shared amongst the patients. One sequence was shared between 5 patients and was identified in 10 different isolated cells. This sequence was found back in 4 of the 27 paired γδ clones. One other CDR37 sequence was shared between 3 patients and some others were shared between two patients (FIG. 8B). Additionally, there was a T cell that shared the 7 TCR chain reported with a previously identified CD1d-restricted T cell clone (34). In summary, many shared TCRγ chains and V2.sup.neg TCR chains can be found within the local tumor microenvironment, however in contrast to γδ T cell repertoires in the peripheral blood, repertoires are dominated by V2.sup.neg γδ T cells and lack a substantial clonal expansion.

[0398] Functional Assessment of Selected TCRγδ from the Peripheral and Tumor Infiltrating γδ T Cell Repertoire

[0399] In order to test our hypothesis that either shared 7 or shared δ TCR chains from the peripheral and tissue residing immune repertoire functionally contribute to daily cancer immune surveillance, we completed first the corresponding TCRγ for selected shared TCRδ from the peripheral repertoire. This was done by single cell cloning for Vδ2+(23) or Vδ2.sup.ne(25) γδ T cells and we sequenced both, 7 and δ TCR chains. We identified a corresponding 7 chain of the shared Vδ2TCR chain, Clone 5 as reported recently (23). The TCRδ chain of the TCRVγ962 expressing clone 5 was found in healthy donor 11 of dataset 1. This particular combination has been reported to be very active against many types of hematological and solid cancer cells (22, 23). In order to further extend analyses on activity of the TCRγ and δ chains isolated from clone 5 in comparison to bulk γδ T cells a T cells were engineered to express this defined TCRγδ (TEG001) (23, 25, 26). TEG001 showed not only superior activity to different tumor cell lines when compared to bulk γδ T cells (FIG. 9A) but also to a variety of primary AML blasts (FIG. 9B). These data suggest that the TCR Vγ962 utilizing shared TCRδ chains can mediate a high functional activity and functionally outperform most γδ T cells.

[0400] To further functionally characterize shared TCRδ chains from V2.sup.neg T cells from the peripheral repertoire healthy donors, V2.sup.neg γδ T cells were isolated and cloned as reported (25) from an additional healthy donors, tested for reactivity by an IFNγ ELISPOT assay against a defined tumor cell panel, and sequenced for the corresponding γ and δ TCR chain. From the 10 isolated V2.sup.neg γδ T-cell clones, 3 clones showed reactivity against different cancer cell lines (FIG. 10A). Sequencing of all functionally investigated clones identified clone FE11 as a clone, which shares its δ1 TCR chain also with donor 13 and 19 of dataset 1. In order to investigate whether tumor reactivity of FE11 is mediated by the TCRγδ chain only, we introduced γ and δ TCR chains of clone FE11 into a T cells (TEG-011), and tested activity of FE11 against a panel of tumor cell lines by an IFNγ ELISA assay, and confirmed the results as seen with the ELISPOT assay (FIG. 10A). In summary, a variety of V2.sup.neg γδ T-cell clones can be identified from the peripheral blood, which recognize in a complementary way different tumor cell lines. In addition, clone FE11 with a shared TCRδ shows tumor reactivity.

[0401] In order to functionally confirm that also the TCRγδ from γδ TILs have the potential to mediate tumor reactivity and that this reactivity is at least partially mediated by their individual shared TCRγ or δ chains, we generated a series of 15 TEGs by expressing paired γ and δ TCR chains derived from our breast cancer γδ TILs (Table 9). In line with the observed reactivity of Vδ2neg γδ T cell clones from the peripheral blood 5 out of 10 TEGs with shared 7 or δ TCR chains showed complementary reactivity against different types of cancer cell lines. One out of 15 TCRγδs with a shared receptor sequence showed a very broad reactivity, namely TEG-Zi11, while the 5 other clones had a more restricted reactivity against a distinct cancer cell lines within the tested panel (FIG. 10B). Notably, the broadly reactive TCRγδ complex of TEG-Zi11 uses a shared 7 chain with TEG-B23 and TEG-Ze11 which are both unresponsive to tested cancer cell lines, indicating in this case that the unique 6 chain of TEG-Zi11 is required for the tumor-reactivity. In line with this observation, the TCRγδ complex from TEG-F4 which has a restricted reactivity to some tumor cell lines shared its 7 chain with the non-reactive TCR from TEG-E20, and TCRγδ complex from TEG-B9, which shares its γ chain with a previously reported CD1d-reactive TCRγδ (34), did not bind to CD1d tetramer when the reported unique TCRδ chain was not present (FIG. 12). Thus, a shared TCRγ chain can be part of a tumor-reactive γδTCR, but that in itself is not sufficient for reactivity. Vice versa, TEG-C132, TEG-D37, TEG-E113 and TEG-B23, who share the very same 65 chain, were active against different cancer cell lines, namely K562 for TEG-B23, TEG-D37 and TEG-C132, U937 for TEG-B23, TEG-D37 and TEG-E113 (FIG. 10B). Thus, TCRγδ complexes comprised of shared Vδ2 and Vδ2.sup.neg chains have a comprehensive and complementary ability to attack different types of cancer cells and chains comprised of Vδ5 could be in particular important participants in cancer immune surveillance.

[0402] In Vivo Activity of Public TCRδ Chains within the Therapeutic Concept of TEGs

[0403] Engineering immune cells for cancer immune therapy has been recognized as scientific breakthrough (35) and the next generation of chimeric antigen receptors (CARs) is urgently needed to overcome current limitations such as restricted tumor antigen availability (36). TEGs have most recently been appreciated as a new interesting twist on this strategy (36) and therefore we tested whether not only artificial TCRγδ complexes (22, 23) but also natural TCRγδ complexes with partly public δ TCR sequences can be part of the next generation of TEGs. Therefore, TEG001 activity was tested in vivo in a multiple myeloma mouse model utilizing OPM2 as target (22). As negative control TEGs expressing a non-functional TCRγδ chain LM1 (23) were used. TEGs were infused 7 and 14 days after inoculation of OPM2. Treatment with TEG001 lead when compared to TEG-LM1 to a significant inhibition of tumor growth and associated in this treatment model also with a significant prolonged overall survival (FIG. 11), indicating that TCRγδ complexes comprised of partly public TCR chains are a valuable tool for cancer immune therapy with TEGs.

Discussion

[0404] Three types of immune cells undergo somatic DNA recombination during their ontogeny. Numerous functions of two of them, a T cells and B cells, during immune responses have been elucidated to a substantial extent. In contrast, relatively very limited information is available about the repertoire and immunological function of the third type of cells undergoing somatic DNA recombination during their ontogeny, γδ T cells. Here we attempted to illuminate this unknown territory by analyzing the γδ TCR repertoires using combined high-throughput next generation and single-cell sequencing techniques and found evidence of the involvement of public Vδ2.sup.+ and V2.sup.neg TCR chains in cancer immune surveillance.

[0405] While public βTCR chains have been reported to be mainly involved in infection and allo-reactivity, our data suggest that public 7 and δ TCR pairs are an important pillar of daily cancer immune surveillance. Shared Vδ2 TCRs from the peripheral blood have the ability to mediate highest functional activity against various tumor types and can even outperform tumor reactivity of polyclonal γδ T cells, as shown in the in vitro experiments with TEG001. In addition also V2.sup.neg TCRs can mediate strong anti-tumor reactivity against a set of different tumor cells, thus seem to cover surveillance against a variety of solid and hematological malignancies. However, in depth analyses of 6 TILs indicate that γδ TILs with potentially tumor reactive γδ TCR lack substantial clonal proliferation within tumor tissues. In addition, to this basic biological observation which indicates that public 7 and δ TCR chains are an important but also vulnerable part of early cancer immune surveillance, identified receptors are a valuable tool for novel therapeutic compounds like TEGs.

[0406] Although clonal expansions of a TILs have been described (38), no substantial clonal dominance was observed within TNBC's γδ TIL populations when analyzed by spectratyping, NGS or single-cell PCR during our current study. This observed absence of significant clonal expansions in TNBC's γδ TILs is starkly contrasting the very skewed TCRδ1 repertoires in the adult peripheral blood (39, 40, 25) or in fetal CMV infections in utero containing several high-frequency clonotypes (31). Interestingly, proliferation proficiency of Vδ2.sup.+ cells noticed in infectious challenges (41), is frequently absent in cancer patients (39). Also, elegant mouse model studies indicate that γδ T cells can prevent cancer development in the early disease stages (42, 43), but once the disease becomes more advanced, γδ TILs become rapidly proliferation-deficient, while maintaining other functional activities such as IFNγ or CD69 upregulation. Since we could not detect any γδ TILs with the Th17 phenotype, it's possible that the tumor microenvironment may be particularly inhibitory for this subset. The assumption of an early proliferation deficiency of γδ TILs would also favor single cell PCR instead of NGS for the identification of relevant receptors within the context of γδ TILs. However, a study as ours is technically challenging, and currently it is difficult to perform single cell sequencing analysis of tumor tissue in a high trough put manner.

[0407] Our data are compatible with the earlier findings of low relapse incidence of leukemia following cord blood transplantations (25). In this scenario, the high frequency of public Vδ2.sup.neg TCRδ chains in the cord blood cells could contribute substantially to a potential abundance of tumor-reactive receptors in the post-transplant repertoire (39, 40). In addition, CMV reactivation in patients who received non-T-cell-depleted peripheral blood stem cells after myeloablative conditioning regimens was associated with a reduced risk of leukemic relapse (44). We and others have suggested that this effect is partially mediated via γδ T cells (25, 45).

[0408] Willcox et al. have identified endothelial protein C receptor (EPCR) as a CMV-induced stress ligand for Vγ4Vδ5 T cells (22). We now classify the receptors chains of CMV-reactive clones partially as public. In one patient, we detected public TCRγ and TCRδ chains with the EPCR reactivity to be present at the tumor side, suggesting that these chains, particularly the Vδ5, could form receptors with tumor-reactivity. Indeed, 76 TILs in many TNBC patients expressed a shared Vδ5 TCR chain associated with anti-CMV responses. However, all TNBC patients with this particular shared Vδ5 TCR chain were CMV-negative. It is conceivable that CMV reactivations may not be clinically beneficial only in leukemias (46), but also could confer some protection against certain solid tumors. However, we also demonstrate with multiple TCR complexes comprised of public TCRγ or δ chains, that the corresponding chain is frequently private and key for anti-tumor activity. Therefore in these patients the corresponding counterpart might not mediate CMV or tumor reactivity when paired with a different opposing chain, as also suggested by our data and others (33).

[0409] Many clinical trials with ex vivo and in vitro expanded γδ T cells were not very successful (47) and the functional diversity within the γδ T cell repertoire may be a major factor contributing to these numerous failures of clinical translations of γδ T cell-based therapeutics (48). The observation that public TCRδ chains are frequently involved in the observed anti-tumor reactivity points toward possible strategies for creating potentially clinically-important T cells with defined γδ TCRs (TEGs) utilizing shared TCRγ and/or δ chains. Indeed, high-throughput analyses of CDR3 regions combined with single-cell sequencing of γδ TILs can narrow down very quickly the extremely diverse TCRδ repertoire from 10.sup.18 to literally perhaps less than 10.sup.2 sequences of therapeutic interest for generating novel therapeutic TEGs (49). Such receptors could be quickly analyzed functionally and custom made for each patient. Nevertheless, the absence of HLA restriction during the measured antitumor activities suggests the potential usage of these novel, freshly-created TEGs in numerous genetically unrelated patients.

[0410] For generating off the shelf products analyzing cord blood donors with a natural high frequency of public TCRγ and δ chains when compared to the adult repertoire could be a natural starting point. Shared TCRγ and δ chains have also been reported in patients with acute leukemia (50) and ovarian cancer (51) and such samples could also be an interesting source for further functional analyses. However, though the frequency and potency of tumor reactive receptors was in our analyses always higher within complexes harboring shared as compared to non-shared receptor chains, the identification of interesting receptors will always require a functional confirmation of defined receptors against a comprehensive tumor panel. Many analyzed receptor complexes harboring shared TCRγ or δ chains were complementary in reactivity against completely different types of cancer or not reactive at all suggesting that these receptors target complementary and so far unknown ligands.

[0411] Screening of TEGs against a limited panel of tumor cell lines and the potential absence of co-stimulatory signals that might be needed for the γδ T cell response somewhat restrict the interpretation of our data. Clearly, distinct TCRγδ pairs mediated different patterns of tumor reactivity, indicating that each individual pair of public TCRγδ chains may be reactive only against defined subsets of targets. One limitation of our studies clearly arises from screening of TEGs against a rather limited panel of tumor cell lines as we observed different patterns for tumor reactivity for different γδ TCR pairs. In addition, γδ TCR pairs might depend on additional co-stimulation not present within the TEG format. However, all tested receptors where active within the TEG format and expression within NEGs or GEGs did not show additional activity. This suggests that also for many Vδ2.sup.neg γδ T cells the TCR VS chain alone is sufficient for full T cell activation but also that each individual pair with public TCR chains is apparently reactive only against defined subsets of targets. While an inside out mechanism involving CD277 (52, 53) and RhoB (24) has now been established for V.sub.79V2 TCR-mediated recognition, most ligands remain to be defined for many V2.sup.neg TCR76 combinations and testing of potentially interesting chains should therefore always include either a large and comprehensive tumor panels.

[0412] In summary, we describe frequencies of shared TCRδ chains within the peripheral blood γδ TCRs and γδ TILs. We also demonstrate that public TCRγ or δ chains are active and complementary participants in daily cancer immune surveillance. However, despite functional proofs of direct tumor-reactivity of involved receptors, we did not observe substantial clonal expansion of shared TCRδ repertoires within the local microenvironment, suggesting proliferation deficiency of γδ TILs in advanced cancer patients. In contrast, we detected shared tumor-reactive TCRδs within the peripheral blood repertoire of healthy individuals, which was compatible with the proposed role of the public tumor-reactive TCRδs in cancer immune surveillance. Thus, the identification of therapeutically relevant TCRs might be facilitated by analyzing shared TCR76 repertories in different compartments in healthy and cancer patients. This involvement of public Vδ2+ and V2.sup.neg TCR clonotypes in tumor immune surveillance could be exploited for augmenting tumor-specific immunity. In particular, clarifying the precise nature of the recognized ligands, the exact mode of their recognition and their tissue distribution and regulation of expression may lead to developing novel therapeutic approaches and thus improving future 7b T cell-based cancer therapies.

TABLE-US-00006 TABLE 5 Overview used primers for NGS library preparation cDNA synthesis TRB reverse primer constant CAGTATCTGGAGTCATTGA TRD reverse primer constant CTTGGATGACACGAGAT Template switch adaptor AAGCAGUGGTAUCAACGCAGA GUNNNNUNNNNUNNNNUCTT (rG)4 1st PCR TRB nested reverse primer TGCTTCTGATGGCTCAAACAC constant region TRD nested reverse primer AACGGATGGTTTGGTATGAG constant region Forward primer (anneals to CACTCTATCCGACAAGCAGTG switch adaptor) GTATCAACGCAG 2nd PCR TRB nested reverse primer ACACSTTKTTCAGGTCCTC constant region TRD nested reverse primer TTTGGTATGAGGCTGACTTC constant region Forward primer (anneals to CACTCTATCCGACAAGCAGT switch adaptor)

TABLE-US-00007 TABLE 6 Overview of used antibodies in different experiments. Antibody Fluorchrome/color Species Dilution Isotype Clone Cat No Source TCRγ Mouse 1:40  IgG γ3,20 TCR1153 Thermo monoclonal Fisher TCRγ FITC Mouse 1:20  IgG1 IMMU510 IM1349 Beckman monoclonal Coulter CD69 Mouse 1:30  IgG CH11 NCLCD69 Leica monoclonal Biosystems CMV Mouse Flex IgG1, CCH2 + IS752 Dako monoclonal System K + L DDG9 Cleaved Rabbit 1:700 IgG 5A1E mAb9664 Cell Caspase 3 monoclonal Signalling IFNγ Goat 1:200 IgG polyclonal AF285NA R&D polyclonal Systems IL-17 Goat 1:200 IgG polyclonal AF317NA R&D polyclonal Systems anti-rabbit/ Donkey 1:500 IgG polyclonal Ab175470 Abcam Alexa Fluor 568 sec. Ab anti-Mouse Rabbit 1:700 IgG polyclonal A11059 Thermo IgG/Alexa H + L Fisher Fluor 488 sec. Ab anti-goat Donkey 1:500 IgG polyclonal ab150131 Abcam IgG/Alexa Fluor 647 sec. Ab anti-goat Donkey 1:500 IgG polyclonal Ab150132 Abcam IgG/Alexa Fluor 594 sec. Ab CD3 eFluor450 Mouse 1:40  IgG2a OKT3 16-0037-81 eBioscience monoclonal TCRαβ APC Mouse 1:10  IgG1 IP26 14-9986-42 eBioscience monoclonal TCRγδ PE Mouse 1:10  IgG1 IMMU510 B49716 Beckman monoclonal Coulter TCRγδ APC Mouse 1:5  IgG1 B1 (RUO) 555718 BD monoclonal biosciences

TABLE-US-00008 TABLE 7 Overview of used primers for single cell PCR Primers Single cell PCR Forward primers Vg18-F1 AGGGGAAGGCCCCACAGCGTCTTC Vg18-F2: CAGCGTCTTCWGTACTATGAC Vg9-F1 TGACGGCACTGTCAGAAAGGAATC Vg9-F2 TGAGGTGGATAGGATACCTGAAAC Vd1-F1 (Biomed) ATGCAAAAAGTGGTCGCTATTCTG Vd1-F2 CAACTTCAAGAAAGCAGCGAAATC Vd2-F1 (Biomed) ATACCGAGAAAAGGACATCTATG Vd2-F2 CAAGGTGACATTGATATTGCAAAG Vd3-F1 GGTTTTCTGTGAAACACATTCTGAC Vd3-F2 CTTTCACTTGGTGATCTCTCCAG Vd4-F1(Biorned) ATGACCAGCAAAATGCAACAGAAG Vd4-F2 CGCTACTCATTGAATTTCCAGAAG Vd5-F1(Biomed) TACCCTGCTGAAGGTCCTACATTC Vd5-F2 CTGTCTTCTTAAACAAAAGTGCCAAG Vd6-F1(Biomed) CCCTGCATTATTGATAGCCATACG Vd6-F2 TGCCAAGCAGTTCTCATTGCATATC Reverse primers TRg-JP1/2-R1 TTACCAGGYGAAGTTACTATGAGC TRg-J1/2-R1 AAGTGTTGTTCCACTGCCAAAGAG TRg-JP-R1 AAGCTTTGTTCCGGGACCAAATAC Jd1-R1 TTGGTTCCACAGTCACACGGGTTC Jd2-R1 CTGGTTCCACGATGAGTTGTGTTC Jd3-R1 CAACTCACGGGGCTCCACGAAGAG Jd4-R1 TTGTACCTCCAGATAGGTTCCTTTG

TABLE-US-00009 TABLE 8 Shared TCRδ sequences (dataset 1) clonal frequency >0.1% Sequence CDR3δ Identified in donor Vδ1 CALGDSYGGGPLYTDKLIF* 13, 19 Vδ2 CACDVLGDTDKLIF** 18, 19, 20 CACDLLGDTGDKLIF** 25, 29 CACDTAGGSWDTRQMFF** 13, 19 CACDTLGAYTDKLIF** 20, 25 CACDTLGDTDKLIF** 19, 23 CACDTLLGDSSWDTRQMFF** 13, 19 CACDTPSSWDTRQMFF** 13, 19 CACDTTGGPSSWDTRQMFF** 12, 23 CACDTVGDTDKLIF** 11, 29 CACDTVGGTDKLIF** 15, 19 CACDTVGTYTDKLIF** 13, 25 CACDTVLGDTRSWDTRQMFF* 20, 70 CACDTWGTDKLIF** 29, 31 CACDTWGYTDKLIF** 29, 31

[0413] Examples of shared sequences within 14 healthy donors were identified. CDR36 sequences obtained with NGS of dataset 1 with a clonal frequency >0.1% were compared to identify shared sequences between donors. *Indicates sequence of clone FE11 which has been isolated from an additional healthy donor. **Indicates sequence was also identified in another dataset.

TABLE-US-00010 TABLE 9 TRG TRD Pnt Cln Rearrangement TRG CDR3 Rearrangement TRD CDR3 B   9.sup.# TRGV5*GJ1** CATWDRLYYKKLF.sup.& TRDV1*DD3*DJ1 CALGNGNHIGYWRYTDKLIF B  23.sup.# TRGV8*GJ1 CATWDNYKKLF TRAV29/DV5DD3*D CAASSPIRGYTGSDKLIF.sup.% J1* C 132.sup.#$ TRGV4*GJ1* CATWDGFYYKKLF TRAV29/DV5DJ1DD CAASSPIRGYTGSDKLIF.sup.% 2DD3* D  37.sup.# TRGV8*GJ1 CATWDNYMKLF TRAV29/DV5 CAASSPIRGYTGSDKLIF.sup.% *DD2*DD3*DJ1 E 113.sup.# TRGV4*GJ1 CATWDGPPYYKKLF TRAV29/DV5 CAASSPIRGYTGSDKLIF.sup.% *DD2DD3**DJ1 F   2.sup.# TRGV4*GJ1 CATWDGPPYYKKLF TRDV3 CASSYTLKLGDTPGRVRDWKLIF *DD2*DD3*DJ1 F   4.sup.# TRGV2GJ1 CATWDGQKKLF TRDV1*DD3*DJ1 CALGELRYWGIVDKLIF Z e11.sup.# TRGV8*GJ1 CATWDNYKKLF TRDV1*DD3*01DJ1 CALGDYLGDKYPSYDLLGDTTDKLIF Z i11.sup.# TRGV8*GJ1 CATWDNYKKLF TRDV1*DD1*DD2*D CALGELRGQISFLYLLGDTTDKLIF D3*DJ 1

[0414] Overview of examples of paired sequences of γδ TIL's found in patients with triple negative breast cancer. Bold alphabets indicate identical sequences. # Indicates that these clones were used to generate TEG's for functional essays. $ Indicates clone published by Lafarge et al; doi:10.1002/eji.200425837. % Indicates delta chain published by Lafarge et al; doi:10.1002/eji.200425837. & Indicates gamma chain published by Uldirch et al.; doi:10.1038/ni.2713

Example 3: Stability Testing

[0415] A pharmaceutical composition described herein containing at least one polypeptide described herein or an engineered cell expressing a polypeptide described herein is stored in a sealed container at 25° C. or 4° C. and the container is placed in an atmosphere having 30%, 40%, 50%, 60%, 70%, 75%, 80%, 90% or 95% relative humidity. After 1 month, 2 months, 3 months, 6 months, 1 year, 1.5 years, 2 years, 2.5 years or 3 years, at least 50%, 60%, 70%, 80% or 90% of the pharmaceutical composition shall remain as determined by standard protocols.

[0416] While specific embodiments of the present invention have been shown and described herein, it will be obvious to those skilled in the art that such embodiments are provided by way of example only. Numerous variations, changes, and substitutions will now occur to those skilled in the art without departing from the invention. It should be understood that various alternatives to the embodiments of the invention described herein may be employed in practicing the invention. It is intended that the following claims define the scope of the invention and that methods and structures within the scope of these claims and their equivalents be covered thereby.

LIST OF REFERENCES

[0417] 1. Chien Y H, Meyer C, Bonneville M. 2014. gammadelta T Cells: First Line of Defense and Beyond. Annu. Rev. Immunol. [0418] 2. Kim S K, Cornberg M, Wang X Z, Chen H D, Selin L K, Welsh R M. 2005.

[0419] Private specificities of CD8 T cell responses control patterns of heterologous immunity. J Exp Med 201: 523-33 [0420] 3. Miles J J, Elhassen D, Borg N A, Silins S L, Tynan F E, Burrows J M, Purcell A W, Kjer-Nielsen L, Rossjohn J, Burrows S R, McCluskey J. 2005. CTL recognition of a bulged viral peptide involves biased TCR selection. J Immunol 175: 3826-34 [0421] 4. Venturi V, Price D A, Douek D C, Davenport M P. 2008. The molecular basis for public T-cell responses? Nat Rev Immunol 8: 231-8 [0422] 5. Wang C, Liu Y, Cavanagh M M, Le Saux S, Qi Q, Roskin K M, Looney T J, Lee J Y, Dixit V, Dekker C L, Swan G E, Goronzy J J, Boyd S D. 2015. B-cell repertoire responses to varicella-zoster vaccination in human identical twins. Proc Natl Acad Sci USA 112: 500-5 [0423] 6. Kuball J, Dossett M L, Wolfl M, Ho W Y, Voss R H, Fowler C, Greenberg P D. 2007. Facilitating matched pairing and expression of TCR chains introduced into human T cells. Blood 109: 2331-8 [0424] 7. Bolotin D A, Poslavsky S, Mitrophanov I, Shugay M, Mamedov I Z, Putintseva E V, Chudakov D M. 2015. MiXCR: software for comprehensive adaptive immunity profiling. Nat Methods 12:380-1 [0425] 8. Shugay M, Britanova O V, Merzlyak E M, Turchaninova M A, Mamedov I Z, Tuganbaev T R, Bolotin D A, Staroverov D B, Putintseva E V, Plevova K, Linnemann C, Shagin D, Pospisilova S, Lukyanov S, Schumacher T N, Chudakov D M. 2014. Towards error-free profiling of immune repertoires. Nat Methods 11: 653-5 [0426] 9. Scheper W, van Dorp S, Kersting S, Pietersma F, Lindemans C, Hol S, Heijhuurs S, Sebestyen Z, Grunder C, Marcu-Malina V, Marchant A, Donner C, Plachter B, Vermijlen D, van Baarle D, Kuball J. 2013. gammadeltaT cells elicited by CMV reactivation after allo-SCT cross-recognize CMV and leukemia. Leukemia 27: 1328-38 [0427] 10. Scheper w. 2014. Cancer immunotherapy using γδT cells: dealing with diversity. Thesis [0428] 11. Grunder C, van D S, Hol S, Drent E, Straetemans T, Heijhuurs S, Scholten K, Scheper W, Sebestyen Z, Martens A, Strong R, Kuball J. 2012. gamma9 and delta2CDR3 domains regulate functional avidity of T cells harboring gamma9delta2TCRs. Blood 120: 5153-62 [0429] 12. Straetemans T, Grunder C, Heijhuurs S, Hol S, Slaper-Cortenbach I, Bonig H, Sebestyen Z, Kuball J. 2015. Untouched GMP-ready purified engineered immune cells to treat cancer. Clin Cancer Res [0430] 13. de Witte M A, Kierkels G J, Straetemans T, Britten C M, Kuball J. 2015. Orchestrating an immune response against cancer with engineered immune cells expressing alphabetaTCRs, CARs, and innate immune receptors: an immunological and regulatory challenge. Cancer Immunol Immunother 64: 893-902 [0431] 14. Salgado R, Denkert C, Campbell C, Savas P, Nuciforo P, Aura C, de Azambuja E, Eidtmann H, Ellis C E, Baselga J, Piccart-Gebhart M J, Michiels S, Bradbury I, Sotiriou C, Loi S. 2015. Tumor-Infiltrating Lymphocytes and Associations With Pathological Complete Response and Event-Free Survival in HER2-Positive Early-Stage Breast Cancer Treated With Lapatinib and Trastuzumab: A Secondary Analysis of the NeoALTTO Trial. JAMA Oncol 1: 448-54 [0432] 15. Loi S, Dushyanthen S, Beavis P A, Salgado R, Denkert C, Savas P, Combs S, Rimm D L, Giltnane J M, Estrada M V, Sanchez V, Sanders M E, Cook R S, Pilkinton M A, Mallal S A, Wang K, Miller V A, Stephens P J, Yelensky R, Doimi F D, Gomez H, Ryzhov S V, Darcy P K, Arteaga C L, Balko J M. 2016. RAS/MAPK Activation Is Associated with Reduced Tumor-Infiltrating Lymphocytes in Triple-Negative Breast Cancer: Therapeutic Cooperation Between MEK and PD-1/PD-L1 Immune Checkpoint Inhibitors. Clin Cancer Res 22: 1499-509 [0433] 16. Nielsen T O, Hsu F D, Jensen K, Cheang M, Karaca G, Hu Z, Hernandez-Boussard T, Livasy C, Cowan D, Dressler L, Akslen L A, Ragaz J, Gown A M, Gilks C B, van de Rijn M, Perou C M. 2004. Immunohistochemical and clinical characterization of the basal-like subtype of invasive breast carcinoma. Clin Cancer Res 10: 5367-74 [0434] 17. Bender C, Zipeto D, Bidoia C, Costantini S, Zamo A, Menestrina F, Bertazzoni U. 2009. Analysis of colorectal cancers for human cytomegalovirus presence. Infect Agent Cancer 4: 6 [0435] 18. Mamedov I Z, Britanova O V, Zvyagin I V, Turchaninova M A, Bolotin D A, Putintseva E V, Lebedev Y B, Chudakov D M. 2013. Preparing unbiased T-cell receptor and antibody cDNA libraries for the deep next generation sequencing profiling. Front Immunol 4: 456. [0436] 19. Hidalgo J V, Bronsert P, Orlowska-Volk M, Diaz L B, Stickeler E, Werner M, Schmitt-Graeff A, Kayser G, Malkovsky M, Fisch P. 2014. Histological Analysis of gammadelta T Lymphocytes Infiltrating Human Triple-Negative Breast Carcinomas. Front Immunol 5: 632 [0437] 20. Schneider C A, Rasband W S, Eliceiri K W. 2012. NIH Image to ImageJ: 25 years of image analysis. Nat Methods 9: 671-5 [0438] 21. Brauninger A, Hansmann M L, Strickler J G, Dummer R, Burg G, Rajewsky K, Kuppers R. 1999. Identification of common germinal-center B-cell precursors in two patients with both Hodgkin's disease and non-Hodgkin's lymphoma. N Engl J Med 340: 1239-47 [0439] 22. Straetemans T, Grunder C, Heijhuurs S, Hol S, Slaper-Cortenbach I, Bonig H, Sebestyen Z, Kuball J. 2015. Untouched GMP-Ready Purified Engineered Immune Cells to Treat Cancer. Clin Cancer Res 21: 3957-68 [0440] 23. Grunder C, van D S, Hol S, Drent E, Straetemans T, Heijhuurs S, Scholten K, Scheper W, Sebestyen Z, Martens A, Strong R, Kuball J. 2012. gamma9 and delta2CDR3 domains regulate functional avidity of T cells harboring gamma9delta2TCRs. Blood 120: 5153-62 [0441] 24. Sebestyen Z, Scheper W, Vyborova A, Gu S, Rychnavska Z, Schiffler M, Cleven A, Cheneau C, van Noorden M, Peigne C M, Olive D, Lebbink R J, Oostvogels R, Mutis T, Schuurhuis G J, Adams E J, Scotet E, Kuball J. 2016. RhoB Mediates Phosphoantigen Recognition by Vgamma9Vdelta2 T Cell Receptor. Cell Rep 15: 1973-85 [0442] 25. Scheper W, van Dorp S, Kersting S, Pietersma F, Lindemans C, Hol S, Heijhuurs S, Sebestyen Z, Grunder C, Marcu-Malina V, Marchant A, Donner C, Plachter B, Vermijlen D, van Baarle D, Kuball J. 2013. gammadeltaT cells elicited by CMV reactivation after allo-SCT cross-recognize CMV and leukemia. Leukemia 27: 1328-38 [0443] 26. Marcu-Malina V, Heijhuurs S, van B M, Hartkamp L, Strand S, Sebestyen Z, Scholten K, Martens A, Kuball J. 2011. Redirecting alphabeta T cells against cancer cells by transfer of a broadly tumor-reactive gammadeltaT-cell receptor. Blood 118: 50-9 [0444] 27. Holtmeier W, Chowers Y, Lumeng A, Morzycka-Wroblewska E, Kagnoff M F. 1995. The delta T cell receptor repertoire in human colon and peripheral blood is oligoclonal irrespective of V region usage. J Clin Invest 96: 1108-17 [0445] 28. Chien Y H, Meyer C, Bonneville M. 2014. gammadelta T Cells: First Line of Defense and Beyond. Annu. Rev. Immunol. [0446] 29. Hidalgo J V, Bronsert P, Orlowska-Volk M, Diaz L B, Stickeler E, Werner M, Schmitt-Graeff A, Kayser G, Malkovsky M, Fisch P. 2014. Histological Analysis of gammadelta T Lymphocytes Infiltrating Human Triple-Negative Breast Carcinomas. Front Immunol 5: 632 [0447] 30. Gentles A J, Newman A M, Liu C L, Bratman S V, Feng W, Kim D, Nair Vδ, Xu Y, Khuong A, Hoang C D, Diehn M, West R B, Plevritis S K, Alizadeh A A. 2015. The prognostic landscape of genes and infiltrating immune cells across human cancers. Nat Med 21: 938-45 [0448] 31. Coffelt S B, Kersten K, Doornebal C W, Weiden J, Vrijland K, Hau C S, Verstegen N J, Ciampricotti M, Hawinkels L J, Jonkers J, de Visser K E. 2015. IL-17-producing gammadelta T cells and neutrophils conspire to promote breast cancer metastasis. Nature 522: 345-8 [0449] 32. Li B, Li T, Pignon J C, Wang B, Wang J, Shukla S A, Dou R, Chen Q, Hodi F S, Choueiri T K, Wu C, Hacohen N, Signoretti S, Liu J S, Liu X S. 2016. Landscape of tumor-infiltrating T cell repertoire of human cancers. Nat Genet [0450] 33. Willcox C R, Pitard V, Netzer S, Couzi L, Salim M, Silberzahn T, Moreau J F, Hayday A C, Willcox B E, chanet-Merville J. 2012. Cytomegalovirus and tumor stress surveillance by binding of a human gammadelta T cell antigen receptor to endothelial protein C receptor. Nat. Immunol. 13: 872-9 [0451] 34. Uldrich A P, Le Nours J, Pellicci D G, Gherardin N A, McPherson K G, Lim R T, Patel O, Beddoe T, Gras S, Rossjohn J, Godfrey D I. 2013. CD1d-lipid antigen recognition by the gammadelta TCR. Nat Immunol 14: 1137-45 [0452] 35. Couzin-Frankel J. 2013. Breakthrough of the year 2013. Cancer immunotherapy. Science 342: 1432-3 [0453] 36. Lim W A, June C H. 2017. The Principles of Engineering Immune Cells to Treat Cancer. Cell 168: 724-40 [0454] 37. Bouchie A, DeFrancesco L, Sheridan C, Webb S. 2017. Nature Biotechnology's academic spinouts of 2016. Nat Biotechnol 35: 322-33 [0455] 38. Sittig S P, Kollgaard T, Gronbaek K, Idorn M, Hennenlotter J, Stenzl A, Gouttefangeas C, Thor Straten P. 2013. Clonal expansion of renal cell carcinoma-infiltrating T lymphocytes. Oncoimmunology 2: e26014 [0456] 39. Davey M S, Willcox C R, Joyce S P, Ladell K, Kasatskaya S A, McLaren J E, Hunter S, Salim M, Mohammed F, Price D A, Chudakov D M, Willcox B E. 2017. Clonal selection in the human Vdelta1 T cell repertoire indicates gammadelta TCR-dependent adaptive immune surveillance. Nat Commun 8: 14760 [0457] 40. Ravens S, Schultze-Florey C, Raha S, Sandrock I, Drenker M, Oberdorfer L, Reinhardt A, Ravens I, Beck M, Geffers R, von Kaisenberg C, Heuser M, Thol F, Ganser A, Forster R, Koenecke C, Prinz I. 2017. Human gammadelta T cells are quickly reconstituted after stem-cell transplantation and show adaptive clonal expansion in response to viral infection. Nat Immunol [0458] 41. Ding Y, Ma F, Wang Z, Li B. 2015. Characteristics of the Vdelta2 CDR3 Sequence of Peripheral gammadelta T Cells in Patients with Pulmonary Tuberculosis and Identification of a New Tuberculosis-Related Antigen Peptide. Clin Vaccine Immunol 22: 761-8 [0459] 42. Dadi S, Chhangawala S, Whitlock B M, Franklin R A, Luo C T, Oh S A, Toure A, Pritykin Y, Huse M, Leslie C S, Li M O. 2016. Cancer Immunosurveillance by Tissue-Resident Innate Lymphoid Cells and Innate-like T Cells. Cell 164: 365-77 [0460] 43. Xiang Z, Liu Y, Zheng J, Liu M, Lv A, Gao Y, Hu H, Lam K T, Chan G C, Yang Y, Chen H, Tsao G S, Bonneville M, Lau Y L, Tu W. 2014. Targeted activation of human Vgamma9Vdelta2-T cells controls epstein-barr virus-induced B cell lymphoproliferative disease. Cancer Cell 26: 565-76 [0461] 44. Elmaagacli A H, Koldehoff M. 2016. Cytomegalovirus replication reduces the relapse incidence in patients with acute myeloid leukemia. Blood 128: 456-9 [0462] 45. Airoldi I, Bertaina A, Prigione I, Zorzoli A, Pagliara D, Cocco C, Meazza R, Loiacono F, Lucarelli B, Bernardo M E, Barbarito G, Pende D, Moretta A, Pistoia V, Moretta L, Locatelli F. 2015. gammadelta T-cell reconstitution after HLA-haploidentical hematopoietic transplantation depleted of TCR-alphabeta+/CD19+ lymphocytes. Blood 125: 2349-58 [0463] 46. Scheper W, Grunder C, Straetemans T, Sebestyen Z, Kuball J. 2013. Hunting for clinical translation with innate-like immune cells and their receptors. Leukemia [0464] 47. Deniger D C, Moyes J S, Cooper U. 2014. Clinical applications of gamma delta T cells with multivalent immunity. Front Immunol 5: 636 [0465] 48. Scheper W, Sebestyen Z, Kuball J. 2014. Cancer Immunotherapy Using gammadeltaT Cells: Dealing with Diversity. Front Immunol 5: 601 [0466] 49. de Witte M A, Kierkels G J, Straetemans T, Britten C M, Kuball J. 2015. Orchestrating an immune response against cancer with engineered immune cells expressing alphabetaTCRs, CARs, and innate immune receptors: an immunological and regulatory challenge. Cancer Immunol Immunother 64: 893-902 [0467] 50. Meeh P F, King M, O'Brien R L, Muga S, Buckhalts P, Neuberg R, Lamb L S, Jr. 2006. Characterization of the gammadelta T cell response to acute leukemia. Cancer Immunol. Immunother. 55: 1072-80 [0468] 51. Xu C, Zhang H, Hu H, He H, Wang Z, Xu Y, Chen H, Cao W, Zhang S, Cui L, Ba D, He W. 2007. Gammadelta T cells recognize tumor cells via CDR3delta region. Mol Immunol 44: 302-10 [0469] 52. Sandstrom A, Peigne C M, Leger A, Crooks J E, Konczak F, Gesnel M C, Breathnach R, Bonneville M, Scotet E, Adams E J. 2014. The intracellular B30.2 domain of butyrophilin 3A1 binds phosphoantigens to mediate activation of human Vgamma9Vdelta2 T cells. Immunity 40: 490-500 [0470] 53. Harly C, Guillaume Y, Nedellec S, Peigne C M, Monkkonen H, Monkkonen J, Li J, Kuball J, Adams E J, Netzer S, chanet-Merville J, Leger A, Herrmann T, Breathnach R, Olive D, Bonneville M, Scotet E. 2012. Key implication of CD277/butyrophilin-3 (BTN3A) in cellular stress sensing by a major human gammadelta T-cell subset. Blood 120: 2269-79