Use of Syncytin for Targeting Drug and Gene Delivery to Lung Tissue

Abstract

The invention relates to a pharmaceutical composition for targeting drug delivery including gene delivery to lung tissue, comprising at least a therapeutic drug or gene associated to a syncytin protein, and its use in the prevention and/or treatment of lung diseases, in particular in gene therapy of said diseases using lentiviral vector particles or lentivirus-like particles pseudotyped with syncytin protein.

Claims

1-15. (canceled)

16. A method of preventing and/or treating lung diseases in a patient in need thereof, comprising administering to the patient a therapeutically effective amount of a pharmaceutical composition targeting lung tissue, comprising at least a therapeutic drug associated to a syncytin protein.

17. The method according to claim 16, wherein the syncytin protein is human or murine syncytin.

18. The method according to claim 17, wherein the syncytin is selected from the group consisting of human Syncytin-1, human Syncytin-2, murine syncytin-A and murine syncytin-B.

19. The method according to claim 16, wherein the therapeutic drug and the syncytin protein are incorporated into particles.

20. The method according to claim 19, wherein the particles are selected from the group consisting of liposomes, exosomes, viral particles and virus-like particles.

21. The method according to claim 19, wherein the syncytin protein is displayed on the surface of the particles.

22. The method according to claim 19, wherein the particles are lentiviral or lentiviral-like particles pseudotyped with syncytin protein.

23. The method according to claim 16, wherein the drug is selected from the group consisting of therapeutic genes, genes encoding therapeutic proteins or peptides, therapeutic antibodies or antibody fragments, genome editing enzymes, interfering RNA, guide RNA for genome editing, antisense RNA capable of exon skipping; anti-bacterial drugs, anti-viral drugs, anti-fungal drugs, anti-parasitic drugs; anti-inflammatory drugs; immunotherapeutic drugs, immunomodulatory drugs, immunosuppressive drugs, anti-allergic drugs, anti-histaminic drugs and immunostimulating drugs.

24. The method according to claim 19, wherein the drug is a gene of interest packaged into a viral vector particle.

25. The method according to claim 16, wherein the drug is a gene of interest packaged into a lentiviral vector particle pseudotyped with syncytin protein.

26. The method according to claim 16, wherein the lung diseases are selected from the group consisting of: genetic diseases affecting the lungs; infectious diseases affecting the lungs; inflammatory or auto-immune diseases of the lungs, asthma, chronic obstructive pulmonary disease, pulmonary fibrosis, oedema, emphysema, hypertension, acute respiratory distress syndrome, pneumoconiosis, interstitial lung disease, diffuse parenchymal lung disease, lung transplant rejection and lung disease in new born and premature babies.

27. The method according to claim 16, for use in gene therapy of the lung diseases.

28. The method according to claim 16, wherein the drug is a gene of interest for therapy selected from the group consisting of: SERPINA3, SERPINA1, MMP, in particular MMP1, MMP2 and MMP9, CFTR, SFTPB, SFTPC, ABCA3, CSF2RA, TERT, TERC, SFTPA2, SLC34A2, DKC1, TERC, TERT, TINF2, NF1, TSC1, FLCN, STAT3, HPS1, GBA, SMPD1, SLC7A7, SMAD9, KCNK3 and CAV1 genes, and functional variants thereof.

29. The method according to claim 16, which is for administration by injection, inhalation or broncho-alveolar lavage.

30. A pharmaceutical composition targeting lung tissue, comprising virus particles pseudotyped with syncytin protein, packaging a gene of interest selected from the group comprising: the genes SERPINA3, SERPINA1, MMP, in particular MMP1, MMP2 and MMP9, CFTR, SFTPB, SFTPC, ABCA3, CSF2RA, TERT, TERC, SFTPA2, SLC34A2, DKC1, TERC, TERT, TINF2, NF1, TSC1, FLCN, STAT3, HPS1, GBA, SMPD1, SLC7A7, SMAD9, KCNK3, CAV1, functional variants thereof, interfering RNA, guide RNA for genome editing, antisense RNA capable of exon skipping, wherein the RNA target the gene of interest.

31. The pharmaceutical composition according to claim 30, wherein the virus particles are lentiviral vector particles.

32. A pharmaceutical composition for targeting lung tissue, comprising virus-like particles, pseudotyped with syncytin protein, an interfering RNA, guide RNA for genome editing or antisense RNA capable of exon skipping, said RNA targeting a gene of interest selected from the group of genes comprising: SERPINA3, SERPINA1, MMP, in particular MMP1, MMP2 and MMP9, CFTR, SFTPB, SFTPC, ABCA3, CSF2RA, TERT, TERC, SFTPA2, SLC34A2, DKC1, TERC, TERT, TINF2, NF1, TSC1, FLCN, STAT3, HPS1, GBA, SMPD1, SLC7A7, SMAD9, KCNK3 and CAV1.

33. The pharmaceutical composition according to claim 32, wherein the virus-like particles are lentivirus-like particles.

Description

FIGURE LEGENDS

[0155] FIG. 1: Bioluminescence analysis following SynA-LV Luc2 delivery.

[0156] Bioluminescence of mice injected with LucII-expressing vectors comparing vectors pseudotyped with Syncytin A (SyA) or VSVg versus control PBS. Two representative mice per group. Mice 1 & 2 were injected with PBS, mice 10 & 11 were injected with LV-SyA-LucII and mice 12 & 15 were injected with LV-VSVg-LucII. Bioluminescence analyses were performed at day 16 post IV injection with the IVIS Lumina apparatus. The whole body luminescence is measured in photon/sec. Bioluminescence is measured on the front and on the back of the mice using a contour mask of the animal. [0157] PBS group: The signal of mouse 1 (S1) from the back is 3.531.10.sup.5photons/second, and from the front 1.446.10.sup.4 photons/second. For mouse 2 (S2), the signal from the back is 3.351.10.sup.5photons/second and from the front 1.163.10.sup.4 photons/second. [0158] LV-SyA-LucII group: For the mouse 10 (S10), the signal from the back is 3.952.10.sup.7photons/second and from the front 1.019.10.sup.7 photons/second. For mouse 11 (S11) the signal from the back is 4.344.10.sup.7 photons/second and from the front 3,573.10.sup.7 photons/second. [0159] LV-VSVg-LucII group: For mouse 12 (S12), the signal from the back is 3.052.10.sup.8 photons/second and from the front 6.636.10.sup.8photons/second. For mouse 15 (S15), the signal from the front is 5.478.10.sup.8 photons/second and from the front 8,311.10.sup.8 photons/second.

[0160] FIG. 2: Quantification of the bioluminescence signal in the lungs following Syncytin A-LV LucII systemic delivery.

[0161] LV-Syncytin A or -VSVg encoding LucII transgene (LV-SynA (n=20) or LV-VSVg (n=4)) was injected intravenously into albinos C57Bl/6 mice at a dose of 5×10.sup.5 ig (infectious genome)/mouse, PBS is injected as a control (n=11). Bioluminescence signal is measured in the lungs (photons/sec) in individual mice over time, at day 7, 14 and 21 post-injection (upon exposure of the back). Each dot represents a mouse.

[0162] FIG. 3. Biodistribution of gene transfer following syncytinA-mediated gene delivery.

[0163] LV-Syncytin A encoding LucII transgene (LV-SA-LucII; n=6) were injected intravenously into albinos C57Bl/6 mice (3×10.sup.5 ng p24/mouse). As control a LV-VSVg encoding the same transgene was used (LV-VSVg-LucII; n=4), as well as PBS (n=3). The Vector Copy Number per diploid cell (VCN) was measured by qPCR in the different organs recovered at the time of sacrifice of the mice at week 3. The grey zone indicated the limit of quantification of the technique.

[0164] FIG. 4: PCR around the PSI sequence of the integrated provirus in lungs of mice injected with a single dose of LV-SynA vector

[0165] LV-Syncytin A or -VSVg encoding LucII transgene (LV-SynA (n=6) or LV-VSVg (n=4)) was injected intravenously into albinos C57Bl/6 mice at a dose of 5×10.sup.5 ig (infectious genome)/mouse, PBS is injected as a control (n=2). Genomic DNA is extracted from total lung cells at 3 weeks post-injection. A PCR is performed on these gDNA, amplifying the PSI sequence of the integrated provirus, the expected fragment of PSI is at 489 bp.

[0166] FIG. 5: Representative immunohistostaining of luciferase in the lung following syncytinA-mediated gene delivery.

[0167] A-LV-Syncytin A encoding LucII transgene (LV-SA-LucII; n=6) were injected intravenously into albinos C57Bl/6 mice (3×10.sup.5 ng p24/mouse). As control PBS (n=3) was used. Sections of frozen lung (representative of 3 mice tested in such way) were stained with an anti-luciferase antibody and revealed with a secondary antibody coupled with AlexaFluor 594. Nuclei were counterstained by DAPI. Sections were visualized with the confocal microscope Leica SP8. The top panels of FIG. 5A correspond to a lung section from a PBS-treated control animal and the bottom panel corresponds to a lung section from a LV-SYnA-Luc2-treated mouse. The left panels of FIG. 5A show the luciferase immunostaining and the right panel shows the same section with the DAPI stain which shows all cell nuclei on the section.

[0168] B-C LV-Syncytin A encoding LucII transgene (LV-SA-LucII) was injected intravenously into albinos C57Bl/6 mice (5×105 IG/mouse). Three weeks after injection, mice were sacrificed, lungs were fixed, paraffin-embedded and sectioned for immunostaining. Images in (B) and (C) are representative of 8 mice tested in such way. Lung sections were stained with DAPI (B) to detect all cell nuclei defining the presence of alveoli; and with an anti-luciferase antibody revealed with a secondary antibody coupled with AlexaFluor 594 to detect the luciferase-expressing cells and in particular the epithelial cells lining the lung alveoli (C). Controls included mice injected with PBS in the same conditions (n=11 mice). Immunostaining of lungs in PBS-injected mice showed DAPI+cells without detectable luciferase (data not shown).

[0169] FIG. 6: Reduced immune response against transgene following systemic delivery using LV-SynA, compared to LV-VSVg, as measured using Elispot anti-IFNg and CBA.

[0170] Six-week-old C57BL/6 mice were injected intravenously (IV) into the tail vein with PBS, 7.5.10.sup.5 ig (infectious genome)/mouse of LV-SynA_GFP-HY or LV-VSVg_GFP-HY vectors.

[0171] (A) Twenty-one days later, spleen cells were harvested to measure Dby-specific CD4+T cell and Uty-specific CD8+ T cell response by γIFN-ELISPOT following peptide in vitro stimulation. Data represent one experiment including 3 mice per group.

[0172] (B) For the titration of cytokines secreted by T cells. Three weeks after the immunization, total splenocytes were re-stimulated in vitro by Dby, Uty peptides, or Concanavalin A (conA) as positive control. After 36 h of culture, supernatants were removed and titrated for the indicated cytokines (3 mice/group/experiment). Each point represent an individual measurement with at least 2 measurement per mice.

[0173] FIG. 7: Human lung MRC5 and WI26VA4 cells transduction with LV-SynA (n=2 experiments).

[0174] Vector copy number per cell were determined by qPCR following transduction of two cell lines with increasing concentrations (10.sup.5, 5×10.sup.5 infectious genome (ig)/mL) of a LV pseudotyped with Syncytin-A. As a positive control, cells were transduced with 10.sup.6 infectious units/mL of a LV pseudotyped with VSVg. The negative control consisted of non-transduced cells. Results of two experiments.

[0175] FIG. 8: Human lung MRC5 cells transduction with LV-Syncytins (-A, -B, -1 or -2) 7 days post-transduction (n=3 experiments).

[0176] Vector copy number per cell was determined at 7 days post-transduction by qPCR following transduction of MRC5 cells with a concentration of 10.sup.5 IG/mL of LV pseudotyped with Syncytins (-1, -2, -A or -B), in presence of Vectofusin-1® (12μg/mL). As a positive control, cells were transduced with 10.sup.6 IG/mL of a LV pseudotyped with VSVg. The negative control consisted of non-transduced cells. Results of two experiments for LV-SynB, LV-Syn1 and LV-Syn2, or three experiments for LV-SynA and LV-VSVg.

[0177] FIG. 9: Human Small Airway Epithelial Cells transduction with LV-Syncytins (-A, -1 or -2) 7 days post-transduction (n=5 experiments).

[0178] Vector copy number per cell was determined at 7 days post-transduction by qPCR following transduction of Human Small Airway Epithelial Cells (Primary Small Airway Epithelial Cells; Normal, Human (ATCC® PCS301010™) with a concentration of 10.sup.5 ig/mL of LV pseudotyped with Syncytins (-A, -1 or -2) in presence of Vectofusin-1® (12 μg/mL). As a positive control, cells were transduced with 10.sup.6 IG/mL of a LV pseudotyped with VSVg and confirmed the ability to transduce these cells (0.75 vector copy per cell was found) and to detect the transgene in these cells (data not shown). The negative control consisted of un-transduced cells (no vector). Results are averages of five experiments for LV-SynA, and three experiments for LV-Syn1, LV-Syn2 (and LV-VSVg).

[0179] FIG. 10: Comparison between the level of expression of mLy6e mRNA and the level of transduction on different cell lines.

[0180] (A) mRNA were extracted from different cell lines (A20IIA, C2C12, NIH/3T3) and converted into cDNA to perform a qRT-PCR on mLy6e, using PO as a housekeeping gene. Relative levels were calculated with the formula abundance=2.sup.−ΔCt. The qRT-PCR was validated by testing total cells from the lung, spleen or bone marrow of C57BL/6 mice which confirmed that the mLy6e expression level was the highest in lung cells, as published by Bacquin et al 2017 (data not shown).

[0181] (B) The same cell lines as in FIG. 10 (A) were transduced with LV-Syncytin A vectors encoding ΔNGFR at a dose of 10.sup.5 IG/mL. The level of transduction was analysed by flow cytometry at 7 days post-transduction.

[0182] FIG. 11: Comparison between the level of expression of hLy6e mRNA and the level of transduction on different cell lines.

[0183] (A) mRNA were extracted from different cell lines (HEK293T, HCT116, HT1080, WI26VA4, Jurkat, RAJI and MRC5) and converted into cDNA to perform a qRT-PCR on hLy6e, using PO as a housekeeping gene. Relative levels were calculated with the formula abundance=2.sup.−ΔCt. The numbers indicated on the bar graph are the actual values of mRNA expression.

[0184] (B) The same cell lines as in FIG. 10 (A) were transduced with LV-Syncytin A vectors encoding ΔNGFR at a dose of 10.sup.5 IG/mL. The level of transduction was analysed by flow cytometry at 7 days post-transduction.

EXAMPLE 1

Production of Stable and Infectious LV-SynA Particles

[0185] Materials and Methods

[0186] Cell Lines

[0187] Human embryonic kidney 293T cells were cultured at 37° C., 5% CO2 in Dulbecco's modified Eagle's medium (DMEM+glutamax) (Life Technologies, St-Aubin, France) supplemented with 10% of heat inactivated fetal calf serum (FCS) (Life Technologies).

[0188] Cloning of Syncytin A and Production of LV-Syn A.

[0189] a. Generation of a Plasmid Expressing Murine Syncytin-A.

[0190] Murine syncytin-A cDNA was cloned into a pCDNA3 plasmid using standard techniques.

[0191] b. Production of Syn-A-Pseudotyped Lentiviral Vectors.

[0192] HEK293T cells were co-transfected with the following 4 plasmids (quantities per flask), using calcium phosphate: pKLgagpol expressing the HIV-1 gagpol gene (14.6 μg), pKRev expressing HIV-1 rev sequences (5.6 μg), pcDNA3.1SynA (20 μg), and gene transfer plasmid, either PRRL-SFFV LucII expressing Luciferase 2 transgene under control of the Spleen Focus Forming Virus (SFFV) promoter or pRRL-SFFV-LucII-2A-ΔNGFR-WPRE expressing Luciferase 2 transgene and a truncated form of the nerve growth receptor (NGFR) transgene in a bicistronic cassette under control of the Spleen Focus Forming Virus (SFFV) (22.5 μg). After 24 hours, the cells are washed and fresh medium is added. The following day, medium is harvested, clarified by centrifugation 1500 rpm for 5 min and filtered 0.45 μm, then concentrated by ultracentrifugation 50000 g for 2 h at 12° C. and stored at −80° C. until used. VSVg-pseudotype particles were produced also by transient transfection as reported (Merten et al, Human gene therapy, 2011, 22, 343-356).

[0193] c. Titration of Syncytin-A-Pseudoptyped LV

[0194] Physical titer was determined by p24 ELISA (Alliance© HIV-1 Elisa kit, Perkin-Elmer, Villebon/Yvette, France) followed by a calculation of the titer as physical particles (pp) assuming that 1 fg of p24 corresponds to 12 pp of LV (Farson et al, Hum Gene Ther. 2001, 20, 981-97), as previously reported for other types of LV (Charrier et al, Gene therapy, 2011, 18, 479-487). Infectious titer was determined as infectious genome titer (IG/mL) using the murine lymphoma cell line A20. Serial dilutions of vector are added to A20 cells in the presence of Vectofusin-1® (12 μg/μL) for 6 hours. Medium is renewed and cells are incubated for 7 days and genomic DNA is obtained to measure vector copy number per cells using duplex qPCR on iCycler 7900HT (Applied Biosystems) with the primers: PSI forward 5′CAGGACTCGGCTTGCTGAAG3′ (SEQ ID NO:7), PSI reverse 5′TCCCCCGCTTAATACTGACG3′ (SEQ ID NO:8), and a PSI probe labeled with FAM (6-carboxyfluoresceine) 5′CGCACGGCAAGAGGCGAGG3′ (SEQ ID NO:9), Titin forward 5′AAAACGAGCAGTGACGTGAGC3′ (SEQ ID NO:10), Titin reverse 5′TTCAGTCATGCTGCTAGCGC3′ (SEQ ID NO:11) and a Titin probe labeled with VIC 5′TGCACGGAAGCGTCTCGTCTCAGTC3′ (SEQ ID NO:12).

[0195] Results

[0196] Murine Syncytins were explored as possible new pseudotype for HIV-1-derived LV for in vivo applications. Syncytin A is non-orthologue but functionally similar murine counterpart to human Syncytins-1 and -2 (Dupressoir et al, Proceedings of the National Academy of Sciences of the United States of America, 2005, 102, 725-730).

[0197] The murine SynA was cloned into an expression plasmid and used to produce lentiviral vector particles in 293T cells. It was found that SyncytinA can successfully pseudotype rHIV-derived LV. An optimization of the amount of SyncytinA plasmid for the transfection step increased the production of LV particles based on p24 levels in medium. In the conditions defined (20 μg DNA per plate, one harvest only; see Materials and Methods), it was possible to produce stable and infectious particles pseudotyped with murine syncytin. Lentiviral particles pseudotyped with this envelope could be successfully concentrated by ultracentrifugation using the same conditions as used for VSVg-pseudotyped particles (Charrier et al, Gene therapy, 2011, 18, 479-487). The concentrated stocks were cryopreserved at −80° C. and were stable for several months. LV-Syn A was very efficient at transducing the murine A20 B lymphoma cell line in the presence of Vectofusin-1 (VF1). The A20 cell line is used to generate the infectious titer for Syncytin-A-pseudotyped LV.

EXAMPLE 2

In Vivo Gene Delivery to the Lung Using LV-SynA Particles

[0198] Materials and Methods

[0199] Animals

[0200] Male or female 6 week old C57/Bl6 albinos mice were injected with 100 μL of LV-SynA (equivalent to 3.10.sup.5 ng p24) or 100 μL of PBS for the control mice in the tail vein. Mice are analyzed by bioluminescence at different time points and are sacrificed by cervical elongation at day 21 post-injection. Lungs are removed after sacrifice. The right lung is used fresh to sort the cells and realize qPCR. The left lung is frozen in isopentane and conserved at −80° C. to perform cryostat slices and immunohistostaining.

[0201] In Vivo Luciferase Imaging

[0202] C57BL/6 mice were anesthetized with ketamine (120 mg/kg) and xylasine (6 mg/kg) and 100 μL (150 μg/mL) of D-luciferin (Interchim, ref FP-M1224D) was administered intra-peritoneally and imaged 10 min later with a CCD camera ISO14N4191 (IVIS Lumina, Xenogen, MA, USA). A 3 min bioluminescent image was obtained using 10 cm field-of-view, binning (resolution) factor 4, 1/f stop and open filter. Region of interest (ROIs) were defined manually (using a standard area in each case), signal intensities were calculated using the living image 3.2 software (Xenogen) and expressed as photons per second. Background photon flux was defined from an ROI drawn over the control mice in which no vector had been administered.

[0203] Lung Cell Sorting

[0204] Lung are perfused with collagenase IV (1 mg/mL, Invitrogen) and DNase I (50 μg/mL, Roche) and then incubated at 37° C. 45 min. The reaction is stopped by the addition of EDTA (100 mM). The cells are then isolated by dilaceration. Lung cells are stained with an anti-CD45-FITC antibody (BD Pharmingen, ref 553080) and an anti-CD31-BV510 antibody (BD Horizon, ref 563089). Cells are then sorted on the MoFlo® Astrios (Beckman Coulter).

[0205] qPCR

[0206] Genomic DNA is extracted from the cells using the Wizard® Genomic DNA Purification Kit (Promega, ref. A1125). The multiplex qPCR is performed either on the PSI proviral sequence or on the WPRE proviral sequence, with the TitinMex5 as a normalization gene. The following primers and probes are used at a concentration of 0.104:

TABLE-US-00001 PSI F 5′ CAGGACTCGGCTTGCTGAAG 3′  (SEQ ID NO: 7) PSI R 5′ TCCCCCGCTTAATACTGACG 5′  (SEQ ID NO: 8) PSI probe (FAM) 5′ CGCACGGCAAGAGGCGAGG 3′  (SEQ ID NO: 9) WPRE F 5′ GGCACTGACAATTCCGTGGT 3′  (SEQ ID NO: 13) WPRE R 5′ AGGGACGTAGCAGAAGGACG 3′  (SEQ ID NO: 14) WPRE probe (FAM) 5′ ACGTCCTTTCCATGGCTGCTCGC 3′  (SEQ ID NO: 15) TitinMex5 F 5′ AAAACGAGCAGTGACGTGAGC 3′  (SEQ ID NO: 10) TitinMex5 R 5′ TTCAGTCATGCTGCTAGCGC 3′  (SEQ ID NO: 11) TitinMex5 5′ TGCACGGAAGCGTCTCGTCTCAGTC 3′ probe (VIC) (SEQ ID NO: 12)

[0207] The qPCR mix used is ABsolute qPCR ROX mix (Thermo Scientific, ref CM-205/A). The analysis is performed on the iCycler 7900HT (Applied Biosystems) with the SDS 2.4 software.

[0208] PCR

[0209] A PCR using the Taq Phusion (Thermo Scientific, ref. F-5495) is performed on gDNA from the lungs. The following primers are used at a concentration of 0.1 μM:

TABLE-US-00002 (SEQ ID NO: 19) Psi-F: 5′ AGCCTCAATAAAGCTTGCC 3′  (SEQ ID NO: 20) RRE-R: 5′ TCTGATCCTGTCGTAAGGG 3′ 

[0210] The PCR program is 98° C. 30 s.fwdarw.(98° C. 10 s, 61° C. 30 s, 72° C. 45 s)×35.fwdarw.72° C. 5 min. The PCR product is placed on a 2% agarose gel for electrophoresis and the expected band is at 489 bp.

[0211] Immunohistostaining on Lung Sections

[0212] Cryostat sections of mice lung (12 μm) are fixed in 4% paraformaldehyde solution during 10 min and then washed 3 times in PBS 1×. Sections are then stained with a polyclonal antibody anti-luciferase (Promega, ref G7451) diluted at 1/100 as a primary antibody and a donkey anti-goat AlexaFluor 594 (Invitrogen, ref A11058) diluted at 1/1000 as a secondary antibody. The primary antibody is incubated overnight at 4° C. in a humidity chamber and the secondary antibody is incubated for 2 h in a humidity chamber.

[0213] Results

[0214] The objective was to determine the biodistribution of syncytin-A-pseudotyped LV following intravenous systemic delivery. The transgene luciferase was used because it is bioluminescent and enables dynamic detection over time. Two different LVs coding for Luc2 were tested in four different mouse in vivo protocols. One LV was encoding only Luc2 transgene (LV-SA-LucII), the other was encoding Luc2 and dNGFR in a bicistronic cassette (LV-SA-LucII2AdNGFR). The bicistronic vector is much less potent to express Luc2. The bicistronic vector is therefore useful to confirm the transduction of organs by qPCR but the expression of transgene by bioluminescence was not optimal and therefore not quantified. As control, a LV-VSVG Luc2 was used. Four different in vivo protocols in mice were done to inject the vectors and measure transduction over time. The dose of vector is the maximal dose that can be used in a 100 μL volume of injection and corresponds to about 3×10.sup.5 ng p24 or 5×10.sup.5 IG per mouse. Transgene expression was measured in the mice at different time points (1, 2 and 3 weeks post injection) by in vivo bioluminescence detection and to confirm transgene expression with a different technique, luciferase immuno-histochemistry detection was performed on some mice 3 weeks after injection. Transduction was measured by qPCR 3 weeks post injection.

[0215] FIG. 1 shows the bioluminescence analysis in representative mice at week 2. A clear signal is observed in spleen and in the lungs following syncytin A LV delivery. Contrary to VSVG, syncytin A does not transduce liver.

[0216] The quantification of the lung signal was done in individual mice over time (upon exposure of the back). The signal obtained with LV-SA is strong and persisted over time as shown in FIG. 2B. These results show that a single intravenous administration of a LV-SynA vector to mice provides a significant, stable and long-lasting gene transfer in the lung, as detected with a bioluminescent transgene.

[0217] The amount of vector was measured by qPCR in the different organs recovered at the time of sacrifice of the mice at week 3. Results showed that vector copies were found preferentially in lung and spleen when administered by syncytin A-LV and in lung and liver when administered by VSVG-LV (FIG. 3). PCR around the PSI sequence of the integrated provirus confirms the detection of the transgene cassette in the lung of mice, 3 weeks after a single intravenous injection of LV-SynA vector, suggesting that stable integrative gene transfer can be achieved (FIG. 4).

[0218] Overall, by measuring transduction and transgene expression in lung, spleen and liver, it is clear that Syncytin-A-LV has a unique transduction profile. Based on qPCR, SyncytinA-LV can transduce the lung and spleen very efficiently but not the liver. The bioluminescent signal confirms the transduction of lung and spleen by Syncytin-A. While an average signal is obtained in the liver area, probably partially due to the adjacent signal in spleen, the levels are much weaker compared to that obtained with VSVg (Table I). VSVg-pseudotyped LV transduce liver very efficiently as shown by qPCR and bioluminescence.

TABLE-US-00003 TABLE I Different tropism of syncytin-A- and VSVg-pseudotyped LV A Average Vector Copy Number per Cell in organ ± SD (n) Group Lung Spleen Liver PBS 0.00 ± 0.00 (n = 7) 0.00 ± 0.00 (n = 8) 0.00 ± 0.00 (n = 6) LV-SA LucII 0.17 ± 0.17 (n = 8) 0.01 ± 0.01 (n = 8) 0.00 ± 0.00 (n = 5) LV-SA 0.32 ± 0.19 (n = 5) 0.03 ± 0.02 (n = 9) 0.00 ± 0.01 (n = 9) LucIIdNGFR LV-VSVg LucII 0.19 ± 0.06 (n = 4) 0.02 ± 0.01 (n = 4) 0.08 ± 0.05 (n = 4) B Average Bioluminescence of organ (photons/sec) × E+04 +/− SD (n) Group Lung Spleen Liver PBS    2 ± 1 (n = 8)    2 ± 0 (n = 8)     7 ± 2 (n = 8) LV-SA LucII 647 ± 1010 (n = 9)  214 ± 229 (n = 9)   233 ± 219 (n = 9) LV-VSVg LucII 6160 ± 7310 (n = 4)  4680 ± 2840 (n = 4) 42500 ± 28700 (n = 4) Table I (A-B) legend: Transduction levels and expression of the bioluminescent transgene luciferase were quantified in lung, spleen and live. Average values, SD and number of mice tested (n) were obtained in 4 different protocols (ranging from 1 to 4 depending on vector tested). A. Transduction was measured by qPCR 3 weeks after injection of vector. B. Bioluminescence was measured 2 weeks after injection of vector. Quantification was done by drawing a mask to define the organ area based on the largest area detected by the highest signal. The same mask was applied to all mice from a same protocol. The signal for lung was measured on the back of the mice. The signals for spleen and liver were measured on the front of the mice. The bioluminescent signal obtained with the bicistronic LV-SA LucII-dNGFR vector being much weaker than LV-SA LucII was not indicated.

[0219] The transduction of lung cells was examined in greater detail. Lung is a complex tissue containing alveoli composed of a single layer of squamous epithelial cells. Alveoli are separated from one another by connective tissue, interlaced with numerous capillaries and with infiltrating cells such as macrophages. The presence of the transgene Luc2 (LucII) was demonstrated to be in lung epithelial cells by 2 techniques. First, lungs were digested with a mixture of collagenase DNAse and the cells were stained with CD45 antibodies to recognize and sort CD45+ cells of hematopoietic origin and CD45− cells of non-hematopoietic origin i.e. lung parenchyma or stroma. The sorted cell DNA was extracted and analyzed by qPCR. Results show the presence of vector copies only in CD45− lung cells and not in the hematopoietic fraction (Table II). The level of transduction is coherent with the broad and clear bioluminescence signal observed.

TABLE-US-00004 TABLE II Transduction of lung stromal cells mouse cells VCN PBS 1 Total 0 LV-SA-LucII 2 CD45+ 0 CD45− 0.45 3 total 0.01

[0220] Immunohistochemistry staining of Luc2 was performed on frozen lung sections. Results suggest that Luc2 was expressed in epithelial cells of the lung throughout the organ (FIG. 5). A staining done on paraffin-embedded lung showed that the epithelial cells lining the alveoles are expressing the transgene (FIG. 5B) In some experiments, a double staining of F4/80 macrophages was done and did not show any Luc2 in macrophages, thus confirming the qPCR results. In addition, a staining of CD31+ lung endothelium was done and did not correspond to the marking obtained with Luc2.

[0221] The results show that the biodistribution of syncytin-A-LV is very different from that of VSVg-LV. Contrary to VSVg, syncytin A does not transduce liver and instead, transduced at high levels the mouse spleen and lungs. Thus, syncytin A LV could be useful as drug and gene delivery tools for lung epithelium including for lung gene therapy.

EXAMPLE 3

Reduced Immune Response Against Transgene Following Systemic Delivery Using LV-SynA, Compared to LV-VSVg

[0222] Materials and Methods

[0223] Determination of the Immune Response by ELISPOT

[0224] IFN-γ enzyme-linked immunospot assays (ELISPOT) were performed by culturing 10.sup.6 spleen cells per well with or without 1 μM of Dby or Uty peptide in IFN-γ Enzyme-Linked Immunospot plates (MAHAS45, Millipore, Molsheim, France). As a positive control, cells were stimulated with Concanavalin A (Sigma, Lyon, France) (5 μg/ml). After 24 h of culture at +37° C., plates were washed and the secretion of IFNγ was revealed with a biotinylated anti-IFNγ anti-body (eBiosciences), Streptavidin-Alkaline Phosphatase (Roche Diagnostics, Mannheim, Germany), and BCIP/NBT (Mabtech, Les Ulis, France). Spots were counted using an AID reader (Cepheid Benelux, Louven, Belgium) and the AID ELISpot Reader v6.0 software. Spot forming units (SFU) are represented after subtraction of background values obtained with non-pulsed splenocytes.

[0225] Cytokine Titration by Cytometric Bead Array

[0226] Stimulation media [medium, Uty (2 μg/mL), Dby (2 μg/mL), or Concanavalin A (5 μg/mL)] were plated and 10.sup.6 splenocytes/well were added. After 36 h of culture at +37° C., supernatants were frozen at −80° C. until the titration. Cytometric bead arrays were performed with BD Biosciences flex kits (IL-6, IFN-γ, TNFα, and RANTES). Briefly, capture bead populations with distinct fluorescence intensities and coated with cytokine-specific capture antibodies were mixed together. Next, 25 μL of the bead mix of beads was distributed and 25 μL of each sample (supernatants) was added. After 1 h of incubation at room temperature, cytokine-specific PE-antibodies were mixed together and 25 μL of this mix was added. After 1 h of incubation at room temperature, beads were washed with 1 mL of Wash buffer and data were acquired with an LSRII flow cytometer (BD Biosciences). FCAP software (BD Biosciences) was used for the analysis.

[0227] Results

[0228] The reduced immunogenicity of LV-SynA after systemic administration was tested in comparative assays with LV pseudotyped with VSVg (LV-VSVg). In these studies the transgene used was GFP-HY which encodes a fusion protein consisting of GFP tagged with the male HY gene sequences. When the transgene is presented by antigen-presenting cells, the Dby and Uty peptides are presented to CD4 and CD8 T cells which enable the detection of transgene-specific immune responses. The results show that systemic, intravenous (IV) administration of LV-SynA vector encoding GFP-HY to mice leads to less and very low levels of anti-transgene CD4 and CD8 T cell immune responses (FIG. 6A) and lower levels of cytokines (FIG. 6B) compared to LV-VSVg. These results are coherent with the possibility to achieve long-term expression of a transgene in lung following gene delivery with syncytin-pseudotyped vectors. The results also suggest that repeated administrations of transgene can be achieved with these vectors. The results also suggest that syncytin-pseudotyped vectors can be used safely in inflammatory conditions, without inducing high levels of additional immune responses or inflammation.

EXAMPLE 4

Transduction of Human and Murine Lung Cell Lines with LV-Syncytins

[0229] A first objective of this study was to evaluate if human lung cells could be transduced with a lentiviral vector pseudotyped with human or murine Syncytins (Syncytin-A, -B, -1 or -2). A second objective of this study was to determine whether or not the transduction of different human and murine cell lines and murine primary cells with a lentiviral vector pseudotyped with Syncytin A is correlated with Ly6e expression on the target cells.

[0230] Materials and Methods

[0231] Human Primary Small Airway Epithelial Cells and Human Lung Cell Lines Transduction with LV-Syn

[0232] Lentiviral vectors coding for Luc2 or ΔNGFR and pseudotyped with Syn-A, -B, -1 or -2 were used for these experiments. The vectors were tested by culturing at 37° C. 1×10.sup.5 MRC5 cells (human lung fetal cells, ECACC, ref 84101801), WI26VA4 cells (SV40-transformed human lung cells, ATCC, ref CCL-95.1) or Human Small Airway Epithelial Cells (Primary Small Airway Epithelial Cells; Normal, Human (ATCC® PCS301010™) with one concentration or two concentrations of LV-SynA lentiviral particles (1×10.sup.5 or 1×10.sup.5 and 5×10.sup.5 infectious genome (IG)/mL (infectious genome units defined on A20 cells)) in the presence of 12 μg/mL of Vectofusin-1® (Miltenyi Biotec, ref 130-111-163). As a positive control, cells were also cultured in parallel with 1×10.sup.6 IG (infectious genome units defined on HCT116 cells/mL) of LV-VSVg in the presence of Vectofusin-1. After 6 h of transduction at 37° C., the infection was stopped by changing the culture medium and adding fresh medium (DMEM+10% fetal calf serum+1% penicillin-streptomycin+1% glutamine) to the cells.

[0233] Three or seven days post-transduction, genomic DNA of the cells was extracted using the Wizard® Genomic DNA Purification Kit (Promega, ref A1125). Multiplex qPCR was performed to determine the vector copy number per cell using amplification of the PSI proviral sequence and albumin as a normalization gene. The following primers and probes were used at a concentration of 0.1 μM:

TABLE-US-00005 PSI F 5′ CAGGACTCGGCTTGCTGAAG 3′ (SEQ ID NO: 7) PSI R 5′ TCCCCCGCTTAATACTGACG 3′  (SEQ ID NO: 8) PSI probe (FAM) 5′ CGCACGGCAAGAGGCGAGG 3′  (SEQ ID NO: 9) Albumin F 5′ GCTGTCATCTCTTGTGGGCTGT 3′  (SEQ ID NO: 16) Albumin R 5′ ACTCATGGGAGCTGCTGGTTC 3′  (SEQ ID NO: 17) Albumin probe 5′ CCTGTCATGCCCACACAAATCTCTCC 3′ (VIC) (SEQ ID NO: 18)

[0234] The qPCR mix used was ABsolute qPCR ROX mix (Thermo Scientific, ref CM-205/A). The analysis was performed on the iCycler 7900HT (Applied Biosystems) with the SDS 2.4 software or on the LightCycler480 (Roche) with the LightCycler® 480 SW 1.5.1 software.

[0235] Ly6e mRNA Expression on Different Human and Murine Cell Lines and Murine Primary Cells.

[0236] mRNA from different human cell lines (HEK293T, HCT116, HT1080, WI26VA4, Jurkat and RAJI), murine cell lines (A20IIA, C2C12, NIH/3T3) and from total cells from the lung, spleen and bone marrow of C57BL/6 mice were extracted using the RNeasy® mini kit from Qiagen. The reverse transcription of the mRNA was performed using Verso cDNA synthesis kit from Thermofischer. A qPCR was performed on the cDNA using the following primers: mLy6e forward primer 5′ CGGGCTTTGGGAATGTCAAC 3′ (SEQ ID NO: 21), mLy6e reverse primer 5′ GTGGGATACTGGCACGAAGT 3′ (SEQ ID NO: 22), hLy6e forward primer 5′ AGACCTGTTCCC CGGCC 3′ (SEQ ID NO: 23), hLy6e reverse primer 5′ CAGCTGATGCCCATGGAAG 3′ (SEQ ID NO: 24), PO reverse primer 5′ CTCCAAGCAGATGCAGCAGA 3′ (SEQ ID NO: 25) and PO forward primer 5′ ACCATGATGCGCAAGGCCAT 3′ (SEQ ID NO: 26). PO was used as a warehouse gene. The abundance is calculated with the formula abundance=2-ΔCt.

[0237] Results

[0238] Human primary small airway epithelial cells and human lung cell lines transduction with LV-Syn(-A, -B, -1, -2)

[0239] The level of transduction of MRC5 and WI26VA4 cells following infection with a lentiviral vector pseudotyped with the murine syncytin A (LV-SynA) was measured in two independent transduction experiments. The level of transduction of MRC5 cells following infection with a lentiviral vector pseudotyped with the murine syncytin A (LV-SynA), the murine syncytin B (LV-SynB), the human syncytin 1 (LV-Syn1) or the human syncytin 2 (LV-Syn2) was also measured in two or three independent transduction experiments. A control lentiviral vector pseudotyped with VSVg (LV-VSVg) and used at a high concentration confirmed that the cells could be transduced in the experimental conditions used.

[0240] In addition, the level of transduction of Human Small Airway Epithelial cells following infection with a lentiviral vector pseudotyped with the murine syncytin A (LV-SynA), the human syncytin 1 (LV-Syn1) or the human syncytin 2 (LV-Syn2) was measured in five (SynA) or three (Syn1, Syn2) independent transduction experiments.

[0241] In all experiments, the integration of the provirus in the cells was confirmed with a qPCR using specific primers. The results are presented in FIGS. 7 to 9.

[0242] FIG. 7 represents the average levels of transduction of the MRC5 and WI26VA4 cells with a lentiviral vector pseudotyped with the murine syncytin A (LV-SynA) in 2 experiments. Two concentrations of vector were used (1 E+05 and 5E+05 ig/mL) showing a dose-dependent effect. Clearly, the transduction of MRC5 cells with the LV-SynA vector was more efficient than the transduction of WI26V4 cells, but both cell types were permissive. Vectors pseudotyped with VSVg were used at a higher concentration, as positive controls. In conclusion, the syncytin A pseudotype can be used to transduce human lung cells.

[0243] FIG. 8 shows that in addition to murine SynA, the human Syn2 can also transduce human lung cells, thereby supporting the use of Syncytin2-pseudotyped lentiviral vectors for therapeutic applications in lung. The Syncytin-2 pseudotype is very effective as it reaches levels at least as high as those of the positive VSvg control which was used at 10× higher concentration.

[0244] FIG. 9 shows that the murine syncytin A and the human syncytin 2 can be used to pseudotype lentiviral vectors to efficiently transduce human primary pulmonary epithelial cells. These results further demonstrate that syncytin-pseudotyped particles can be used to treat pulmonary diseases and in particular, diseases involving the lung epithelium and that human syncytin-pseudotyped vectors would be expected to deliver transgenes in lung following systemic administration.

[0245] Comparison Between the Level of Expression of Ly6e mRNA and the Level of Transduction in Different Cell Lines.

[0246] The level of expression of mLy6e and hLy6e mRNA and the level of transduction with LV-Syncytin A vectors encoding ΔNGFR were compared in different cell lines.

[0247] The results show that the expression of mLy6e, reported as the receptor for murine Syncytin A, on cell lines does not allow to predict the ability to transduce cells by LV pseudotyped with SynA (FIG. 10). C2C12 cells express relatively abundant levels of Ly6e but are not transduced. A20IIA cells which express the highest levels of Ly6emRNA are transduced, which may indicate that a threshold exists.

[0248] The receptor for mouse SynA is mouse Ly6e. It is not known if the human Ly6e is a receptor for any of the syncytins. The results show that there is no correlation between human Ly6e receptor expression mRNA levels and transduction with LV-SynA (FIG. 11). HCT116 which are colon carcinoma cells express hLy6e mRNA but are not transduced. Raji cells do not express the human Ly6e-mRNA but can be transduced.