ARTIFICIAL MARKER ALLELE

20210198681 · 2021-07-01

Assignee

Inventors

Cpc classification

International classification

Abstract

This invention relates to a method for making an artificial marker allele for the identification of a nucleic acid of interest in an organism. The invention also relates to determining the presence of a nucleic acid of interest in a mixed population and a method for introgressing a nucleic acid of interest into a population. The invention also relates to organisms, particularly plants and seeds, comprising such a marker allele and to various uses for the artificial marker allele.

Claims

1. A method for making an artificial marker allele for the identification of a nucleic acid of interest, preferably encoding a polypeptide conferring a trait of interest, in an organism, said method comprising: (a) identifying at least one genomic locus in the genome of said organism, which is genetically linked to said nucleic acid of interest, and (b) introducing at least one InDel into said at least one genomic locus, thereby making a marker allele which is inheritable to subsequent generations of said organism along with said nucleic acid of interest.

2. The method according to claim 1, wherein said at least one InDel comprises at least one nucleotide insertion and/or at least one nucleotide deletion.

3. The method according to claim 1, wherein said genomic locus is unique within the genome of said organism and highly conserved across different genotypes of said organism and/or wherein the nucleotide sequence of the genomic locus obtained after insertion of the at least one artificial InDel is unique within the genome of said organism.

4. The method according to claim 1, wherein said genomic locus is positioned outside of any coding region, splicing signal or regulatory element of the nucleic acid of interest and/or is positioned in a region flanking the nucleic acid of interest or within the nucleic acid of interest.

5. The method according to claim 4, wherein the region flanking the nucleic acid of interest is located at the 3′ end of the nucleic acid of interest.

6. The method according to claim 5, wherein the region flanking the nucleic acid of interest is a distance of at least 2 cM or 1 cM or 0.5 cM or 0.1 cM from said nucleic acid of interest.

7. The method according to claim 1, wherein said at least one InDel comprises an insertion and wherein said insertion comprises a nucleotide sequence in the range of between 1 and 60 contiguous base pairs and which sequence is non-homologous to the genome of the organism in which said at least one InDel is introduced, preferably said insertion comprises a nucleotide sequence of at least 10 or at least 20 contiguous base pairs.

8. The method according to claim 1, wherein said at least one InDel comprises a deletion and wherein said deletion is in the range of between 1 and 60 contiguous base pairs, preferably at least 10 or at least 20 contiguous base pairs, relative to the corresponding wild type sequence of the genomic locus in which said at least one InDel is introduced.

9. The method according to claim 1, wherein said at least one InDel is introduced by a programmable nuclease, preferably said programmable nuclease is selected from CRISPR nuclease and guide RNA systems, zinc finger nucleases, TALENs, or meganucleases.

10. The method according to claim 1, wherein said nucleic acid of interest may be an endogenous gene, a heterologous gene, a mutated gene, a transgenic gene or a modified gene introduced or generated by gene editing or base editing.

11. A method for determining the presence of a nucleic acid of interest, preferably encoding a polypeptide conferring a trait of interest, in a mixed population of individuals comprising the nucleic acid of interest and individuals not comprising the nucleic acid of interest, said method comprising detection of an artificial marker allele as defined in claim 1 using at least one molecular marker specific for the artificial marker allele and/or at least one molecular marker specific for the wild type genomic locus.

12. A method for assessing the homogeneity of a population of individuals comprising a nucleic acid of interest, preferably encoding a polypeptide conferring a trait of interest, said method comprising detection of an artificial marker allele as defined in claim 1 and determining homogeneity in the population by using at least one molecular marker specific for the artificial marker allele and/or at least one molecular marker specific for the wild type genomic locus, wherein the detection of the wild type genomic locus indicates heterogenous distribution of individuals comprising the nucleic acid of interest in the population.

13. A method for making an artificial marker allele for the detection of a nucleic acid of interest comprising designing one or more genotype-specific InDels and introducing said InDels into a genomic locus in the genome of an organism, wherein the genomic locus is genetically linked to the nucleic acid of interest.

14. A method for utilizing an artificial marker allele obtainable by claim 1 in marker assisted selection.

15. A plant or seed comprising an artificial marker allele obtainable by a method according to claim 1.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0109] One or more embodiments of the invention will now be described, by way of example only, with reference to the accompanying drawing, in which:

[0110] FIG. 1A-C shows a schematic representation of marker-assisted analyses and a quality control assay in which the purity of multiplied seeds having a desired trait can be assured, by using the InDel approach of the present invention.

[0111] FIG. 2 shows a schematic representation of a breeding process in which an InDel is introduced into the genomic locus of a donor plant (comprising the nucleic acid of interest, preferably encoding a polypeptide conferring the trait of interest) at the beginning of the breeding process, i.e. before the donor is crossed with a desired elite line.

[0112] FIG. 3 shows InDel marker-assisted selection of a gene encoding a mutated cytochrome P450 oxidase conferring male sterility.

[0113] FIG. 4 shows InDel marker-assisted selection of a gene encoding a point-mutated acetolactate synthase conferring herbicide resistance.

EXAMPLES

Example 1: Deletion Marker Allele

Introduction of a Deletion by Genome Editing for Marker-Assisted Selection

[0114] This example demonstrates the use of a deletion marker for the detection of a desired trait, which would be otherwise difficult to identify due to the characteristics of the genomic regions flanking the causative polymorphism.

[0115] The Beta vulgaris mutant BvCYP703A2_gst as disclosed in DE 10 2016 106 656.7 comprises a deletion in the gene encoding for a cytochrome P450 oxidase which confers to the mutant a male sterile phenotype (wildtype (WT) BvCYP703=BvCYP703_WT (SEQ ID NO: 75)). This phenotype can be used e.g. to improve breeding programs and for the production of hybrid seeds.

[0116] The mutant BvCYP703A2_gst (SEQ ID NO: 76) comprises a large deletion between position 1560 and 2100 (see FIG. 3). However, due to the characteristics of the genomic regions flanking the deletion (i.e. highly repetitive and high AT content) it is difficult (if not impossible) to design suitable primers and assays that would allow direct detection of the causative polymorphism itself. It would therefore not be possible to screen progeny plants, which were obtained by crossing a wild-type plant with the donor, for the desired genotype by direct detection of the deletion due to the lack of suitable detection assays.

[0117] The inventors have therefore identified a region in the flanking region of the gene encoding a cytochrome P450 oxidase which is suitable for InDel marker-assisted selection of the desired genotype. The naturally occurring deletion causing the trait (male sterility) is located between positions −200 and +333 of the BvCYP703A2 gene (numbering starts at the translation initiation site). Since the deletion causes a disruption of the gene, there is no doubt that remaining gene features (e.g. exons) are unfunctional and additional manipulation within the remaining exons does not cause pleiotropic effects. Therefore, parts of remaining exon 1, spanning region +334 to +500 were chosen as target site for an artificial InDel marker allele. The maximum distance from the deletion position +334 to the end of the region of interest (+500) is 166 bp corresponding to a genetic distance of 0.00096 cM. Blast analysis of the 166 bp fragment did not reveal unspecific hits in the sugar beet genome. Further sequence analysis (repetitivity, GC content, base distribution) led to definition of region +434 to +443 as target site for an artificial deletion, with an InDel specific primer set between positions +420 to +449.

[0118] A deletion is inserted into this target site via genomic editing as described herein (SEQ ID NO: 77). Suitable primers are designed specific to the flanking region of the deletion marker (see above). Due to its tight linkage to the desired genotype, this deletion can then be used to identify progeny plants conferring male sterility. For homo/heterogenous detection of the deletion two PCR reactions should be performed.

[0119] Possible primers which can be used for the detection of the donor and/or wild type strain may be:

TABLE-US-00001 BvCYP703A2_WT_fwd: (SEQ ID NO: 45) 5′-TAGACGACTTGAACTATTTGTGAG-3′ BvCYP703A2_gst_fwd: (SEQ ID NO: 46) 5′-TAGACGACTTGAACTTCATAGGGC-3′ BvCYP703A2_rev: (SEQ ID NO: 47) 5′-AAAGTATTGCTTCCCTAGCAACA-3′

Example 2: Insertion Marker Allele

Introduction of an Insertion by Genome Editing for Marker-Assisted Selection

[0120] This example demonstrates that a desired trait, which is difficult to detect because its causal link is a single nucleotide polymorphism (SNP), can be reliably identified by using the herein described InDel marker approach.

[0121] In this example, a single point mutation at position +1706 in the gene encoding for the enzyme acetolactate synthase confers resistance to sulfonyl urea herbicides in a Beta vulgaris plant (as disclosed in WO 2012/049268; wildtype (WT) BvALS=BvALS_WT (SEQ ID NO: 78; point-mutated BvALS=BvALS_SU_res (SEQ ID NO: 79)). This single nucleotide polymorphism is difficult to detect because primers designed specifically for screening plants having the donor trait would differ in only one single nucleotide in comparison to the wild-type sequence, thereby increasing the likelihood of false-positives and/or false negatives which limits the quality of the screen.

[0122] This drawback can be overcome by introducing an InDel marker into the flanking region of the mutated gene encoding for acetolactate synthase (see FIG. 4).

[0123] The inventors have identified a morphogenic flanking region of the mutated gene suitable for the design of an artificial marker allele. The SNP causing the trait (SU resistance, W569L) is located at position +1706 of the BvALS gene (numbering starts at the translation initiation site). The annotated 3′UTR region of the gene ends at position +2252. The inventors were unable to localize a genomic feature starting from position +2253 to +4000. The maximum distance from the SNP position +1706 to the end of the region of interest (+4000) is 2294 bp corresponding to a genetic distance of 0.00036 cM. Blast analysis of the 2294 bp fragment did not reveal unspecific hits in the sugar beet genome. Iterative sequence analysis (blast, alignments) led to selection of region +2274 to +2445 suitable for artificial InDel placement. Further sequence analysis (repetitively, GC content, base distribution) led to definition of region +2285 to +2293 as artificial target site, with an InDel specific primer set between positions +2274 to +2303 (see FIG. 4).

[0124] Into this target site a 9 bp long insertion can be inserted which is non-homologous and unique to the genomic pool of the donor line (SEQ ID NO: 80). Suitable primers are designed for the flanking regions of the insertion as described herein. For homo/heterogenous detection of the insertion marker two PCR reactions are required.

[0125] Based on this approach it is then possible to screen progeny plants, obtained from crossing the donor with the wild-type plant, for the insertion of the desired mutation conferring herbicide resistance without the need to rely on the causative polymorphism itself.

[0126] Possible primers which can be used for the detection of the donor and/or wild type strain may be:

TABLE-US-00002 BvALS_WT_fwd: (SEQ ID NO: 48) 5′-ACTAGTTGGCTTGGTGCATCT-3′ BvALS_SU_res_fwd: (SEQ ID NO: 49) 5′-ACTAGTTGGCTGCACTATCGTGC-3′ BvALS_rev: (SEQ ID NO: 50) 5′-CCAATGCTCCCATGTCAGGT-3′

Example 3: Quality Control Assay to Assure Purity of Seed Multiplications for a Respective Trait

[0127] This example illustrates how purity of multiplied seeds having a desired trait can be assured by using the herein described InDel approach.

[0128] In this example, the donor line comprising a desired trait is modified by introducing a nucleotide sequence (GCACTATCG) into its genome to generate an artificial insertion marker allele which is tightly linked to the desired trait.

[0129] After crossing the donor comprising the insertion marker allele with a wildtype plant, which does not contain the artificial marker allele, F1 progeny plants are obtained which are heterogenous in their genetic composition. Backcrossing and subsequent selection result in plants which contain the trait of interest within the genetic background of the wildtype plant. In order to ensure homogeneity and purity of seed multiplication of plants comprising the desired trait, seed samples are analyzed by using primer pairs specific for the wildtype (primers 1+3) and/or the donor (primer 2+3). Analysis of the seed samples by e.g. (q)PCR then readily allows assessment of the degree of purity (see FIG. 1C).

[0130] Based on this quality control assay, it is thus possible to reliably assess whether the tested seed samples are homozygous for the desired trait or whether the seeds are “contaminated” with the wildtype gene/trait corresponding to the desired donor trait. Such quality control would not be possible, if the polymorphism linked to the desired trait is a single nucleotide polymorphism, since a single nucleotide mismatch does not offer sufficient resolution and specificity to ensure a reliable quality assessment by (q)PCR.

Example 4: GE Based Technology for the Generation of Artificial InDel Marker Alleles which are Linked to a Desired Trait

[0131] This example provides a technical description on how to [0132] (a) generate a deletion marker allele via GE based gene modification into a donor genome having a large deletion in the gene encoding a cytochrome P450 oxidase causing male sterility (Example 1), [0133] (b) generate an insertion marker allele via GE based gene modification into a donor genome having a point mutation in the gene encoding for the enzyme acetate lactate synthase conferring herbicide resistance in a Beta vulgaris plant (Example 2), and [0134] (c) modify an endogenous gene encoding the enzyme acetate lactate synthase by introducing a specific point mutation (G.fwdarw.T) via GE, thereby conferring herbicide resistance in a Beta vulgaris plant and generating an insertion marker allele linked to the artificially generated trait of interest.
Design and Selection of crRNA:

[0135] Suitable crRNAs for Cpf1-induced induction of double strand breaks were designed by using the CRISPR RGEN Tools (http://www.rgenome.net/cas-designer/ [Park J., Bae S., and Kim J.-S. Cas-Designer: A web-based tool for choice of CRISPR-Cas9 target sites. Bioinformatics 31, 4014-4016 (2015). and Bae S., Park J., and Kim J.-S. Cas-OFFinder: A fast and versatile algorithm that searches for potential off-target sites of Cas9 RNA-guided endonucleases. Bioinformatics 30, 1473-1475 (2014).). Therefore, suitable protospacers within the genomic DNA sequence were identified and selected. To ensure functionality of Cpf1 endonuclease from Lachnospiraceae bacterium ND2006 (Lb) (SEQ ID NO: 51), protospacers with a length of 24 nucleotides were selected, wherein their genomic binding sequence at the 5′ end was flanked with an essential protospacer adjacent motif (PAM) having the sequence 5′-TTTV-3′ (V is G, C or A). Suitable protospacers were selected based on the prescribed quality criteria of the tool and analyzed for potential off-targets with an internal reference genome of B. vulgaris.

[0136] For further experiments crRNAs were selected, which in addition to the actual target sequence had at most 15 identical bases with a functional PAM. Since the first 18 nucleotides of the protospacer are essential for recognizing and cleaving the target sequence, it was thereby possible to avoid unwanted cleavage within other genomic sequences [Tang, X., L. G. Lowder, T. Zhang, A. A. Malzahn, X. Zheng, D. F. Voytas, Z. Zhong, Y. Chen, Q. Ren, Q. Li, E. R. Kirkland, Y. Zhang and Y. Qi (2017). “A CRISPR-Cpf1 system for efficient genome editing and transcriptional repression in plants.” Nat Plants 3: 17018.]. Based on this approach, the following potential crRNAs specific for various positions were identified (see Table A).

TABLE-US-00003 TABLE A Selected target sequences. PAM sequences are underlined. Genomic target sequence with 5′- Binding Name of flanking PAM on +/− crRNA (underlined) strand Function crRNA_ TTTAggtatggttg − generating ALS_G/T tccaatgggaagat G.fwdarw.T point (SEQ ID NO: 1) mutation in ALS crRNA_ TTTCggctatggat − candidate 1 ALS_In1 gttgtgttgcatca for (SEQ ID NO: 2) generating an insertion marker for MAS in ALS crRNA_ TTTCtacgtggttc + Candidate 2 ALS_In2 ggttgatcatatag for (SEQ ID NO: 3) generating an insertion for MAS in ALS crRNA_ TTTGtacgtggttcg + Generating a CYP_Del gttgatcatatag deletion (SEQ ID NO: 4) marker for MAS in CYP

Cloning of Genetic Elements:

[0137] For the cloning of Cpf1- and crRNA expression cassettes, a hindering recognition sequence of the restriction enzyme BbsI was removed from the target vector pZFNnptII by introducing a point mutation (T.fwdarw.G). The mutagenesis was performed with a commercially available mutagenesis kit according to the manufacturer's instructions by using two mutagenesis primers (see Table B).

TABLE-US-00004 TABLE B  Mutagenesis primers used for the introduction of the point mutation (G.fwdarw.T, underlined) for removal of the BbsI recognition sequence Name Sequence 5′.fwdarw.3′ Mutagenesis CAGTGCAGCCGTCG primer 1 TCTGAAAACGACA (SEQ ID NO: 5) Mutagenesis AACGTCAGAAGCC primer 2 GACTGCACTATAG (SEQ ID NO: 6)

[0138] For the expression of the Lbcpf1 gene in B. vulgaris a DNA fragment comprising a DNA sequence, codon-optimized for A. thaliana, was synthesized wherein the DNA sequence had a 5′ flanking PcUbi promoter sequence from Petroselinum crispum and a 3′ flanking 3A terminator sequence from Pea sp. (SEQ ID NO: 52). Restriction cleavage sites within the coding sequence of Lbcpf1 which are relevant for cloning, were removed by introducing silent mutations (i.e. nucleotide exchange without effecting the amino acid sequence). Codon-optimization was performed based on the GeneArt algorithm from ThermoScientific. To allow the transport of cpf1 into the nucleus of the cell, the coding sequence of cpf1 was linked to a nuclear localization signal (NLS) from SV40 at the 5′ end and a NLS from Nucleoplasmin at the 3′ end. For the ligation with the binary target vector pZFNnptII the expression cassette was flanked by two HindIII restriction cleavage sites. For the cloning of the crRNA-expression cassette an additional PstI cleavage site was inserted between the 5′ flanking HindIII cleavage site and the PcUbi promoter sequence. Ligation of pZFNnptII_LbCpf1 was done by following a standard protocol. Successful insertion of the PcUbi::Cpf1::TPea expression cassette (SEQ ID NO: 52) was confirmed via sequencing, wherein the used primers were designed to specifically bind to a region spanning the flanking region of the vector as well as parts of the expression cassette (see Table C).

TABLE-US-00005 TABLE C Primers used for sequencing of the PcUbi::Cpf1::TPea expression cassette integrated into pZFNnptII vector Name Sequence 5′.fwdarw.3′ pSeq_LbCpf1_F1 AGCGCAACGCAATTAATGTG (SEQ ID NO: 7) pSeq_LbCpf1_R1 GATGAAGCTGAGGTAGTACC (SEQ ID NO:8) pSeq_LbCpf1_F2 AGGAAGGTTAGCAAGCTCGAG (SEQ ID NO: 9) pSeq_LbCpf1_R2 TCTCGTCGACCTTCTGGATG (SEQ ID NO: 10) pSeq_LbCpf1_F3 ATGCTGAGTACGATGACATCC (SEQ ID NO: 11) pSeq_LbCpf1_R3 TAGACCTGCTTCTCAACCTTCA (SEQ ID NO: 12) pSeq_LbCpf1_F4 ACCACTCACTCCTCGATAAG (SEQ ID NO: 13) pSeq_LbCpf1_R4 AACGACAATCTGATCGGGTAC (SEQ ID NO: 14)

[0139] After transcription in a plant cell, crRNAs were intended to be cleaved by two flanking ribozymes. Therefore, the precursor crRNAs were flanked by the coding sequences of a Hammerhead ribozyme (SEQ ID NO: 53) and a HDV ribozyme (SEQ ID NO: 54) [Tang, X., L. G. Lowder, T. Zhang, A. A. Malzahn, X. Zheng, D. F. Voytas, Z. Zhong, Y. Chen, Q. Ren, Q. Li, E. R. Kirkland, Y. Zhang and Y. Qi (2017). “A CRISPR-Cpf1 system for efficient genome editing and transcriptional repression in plants.” Nat Plants 3: 17018.]. Other approaches exist for the transcription of crRNA, e.g. via PolII promoters, Cpf1 cleavage from mRNA, other ribozymes etc. For a seamless ligation of the single protospacer to the sequence of the crRNA repeats, two BbsI recognition sequences were integrated between the crRNA repeat and the HDV ribozyme, wherein the overhangs used for cloning were adjusted accordingly.

[0140] To ensure an identical expression strength of cpf1 and crRNAs, the crRNA ribozyme cassette was flanked by a PcUbi promoter sequence at the 5′ end and a 3A terminator sequence at the 3′ end. The crRNA expression cassette was flanked by two PstI cleavage sites for the later ligation into the pZFNnptII_Cpf1 target vector (SEQ ID NO: 55). The crRNA expression cassette (SEQ ID NO: 56) was commercially obtained as a synthetic DNA fragment. Ligation was performed by following a standard protocol. The correct insertion of the expression cassette was confirmed by multiple rounds of sequencing. The protospacer were ordered as complementary oligonucleotides and annealed according to standard protocols. The 24 bp long DNA fragments generated in this way were flanked by 4nt overhangs relevant for the ligation step (see Table D).

TABLE-US-00006 TABLE D Sequences of oligonucleotides used for the generation of 24 bp short protospacer. 4 nt overhangs used for ligation are underlined Name crRNA Sequence 5′.fwdarw.3′ crRNA_ALS_G/T AGATGGTATGGTTGTCCAATGGGAAGAT (SEQ ID NO: 15) GGCCATCTTCCCATTGGACAACCATACC (SEQ ID NO: 16) crRNA_ALS_In1 AGATGGCTATGGATGTTGTGTTGCATCA (SEQ ID NO: 17) GGCCTGATGCAACACAACATCCATAGCC (SEQ ID NO: 18) crRNA_ALS_In2 AGATTACGTGGTTCGGTTGATCATATAG (SEQ ID NO: 19) GGCCCTATATGATCAACCGAACCACGTA (SEQ ID NO: 20) crRNA_CYP_Del AGATTACGTGGTTCGGTTGATCATATAG (SEQ ID NO: 21) GGCCCTATATGATCAACCGAACCACGTA (SEQ ID NO: 22)

[0141] The efficiency of the 4 crRNAs were tested via Agrobacterium induced gene transfer in leaves of B. vulgaris. The pZFNtDTnptII plasmid (SEQ ID NO: 57) was co-transformed to verify the transformation efficiency. Transformation of the leaf explants were done by vacuum infiltration following a standard protocol. The fluorescence of tDT was measured after six days by fluorescence microscopy. Explants with a heterogenous fluorescence were discarded. Leaf explants were shock-frozen in liquid nitrogen ten days after infiltration, ground and genomic DNA was isolated via the CTAB protocol. The efficiency of the single crRNAs was validated via NGS (external service provider) based on the number of inserted edits (e.g. number of insertions, deletions or nucleotide exchanges) relative to non-edited sequences in the genomic DNA.

[0142] Since all tested crRNAs showed activity, the crRNAs crRNA_ALS_G/T (SEQ ID NO: 58), crRNA_CYP_Del (SEQ ID NO: 59), crRNA_ALS_In1 (SEQ ID NO: 60) (most efficient) and crRNA_ALS_In2 (SEQ ID NO: 61), with the above described ribozyme, promoter and terminator sequences as reverse-oriented expression cassettes were ordered as synthetic DNA constructs (in total 4 constructs; for each crRNAs one construct (SEQ ID NO: 62, 63, 64, 65)). The DNA constructs were each flanked by two PstI restriction cleavage sites for cloning into the target vector pZFNnptII_LbCpf1 (SEQ ID NO: 55). After insertion of crRNAs, LbCpf1 and crRNA expression cassettes were ligated via HindIII from the pZFNnptII_LbCpf1_crRNA vector (SEQ ID NO: 23, 71, 72, 73, 74) into the pUbitDTnptII vector (SEQ ID NO: 66, 67, 68, 69, 70).

Generation and Use of Repair Templates for HD-Repair

ALS G→T Mutation

[0143] In order to generate the G.fwdarw.T point mutation, the repair template was designed to comprise 1000 bp upstream and downstream of the point mutation. The whole DNA template was ordered as a 2001 bp long synthetic DNA fragment (SEQ ID NO: 24) and directly used for transformation in the vector backbone of the provider. The repair template plasmid and the pUbitDTnptII_LbCpf1_crRNA plasmid (SEQ ID NO: 67) were introduced into B. vulgaris callus culture via biolistic co-bombardment using a gene gun according to an optimized delivery protocol. The transformation efficiency was validated based on the transient tDT fluorescence via fluorescence microscopy one day after transformation. The callus culture was cultivated in shoot induction medium in the absence of selective pressure (i.e. without Kanamycin). The regenerated shoots were subsequently tested for the site-directed mutation (in principle, if point mutation results in increased ALS resistance, such increase can be used for selection of the desired event). Therefore, genomic DNA was isolated via CTAB. Point mutations were amplified via two PCRs and the use of primers 5′ALS_G/T and ALS_G/T_Rv, as well as ALS_G/T_Fw and 3′ALS_G/T. Afterwards, PCR products were sequenced in each case with both primers. Here, it is important that binding of the first primer occurs within the homology region of the repair template and binding of the second primer outside of the 5′ and 3′ flanking homology regions of the repair template (see Table E).

TABLE-US-00007 TABLE E Primers used for the detection of point mutations Size of Sequence PCR Name 5′.fwdarw.3′ product Binding 5′ALS_G/T GTT TTG GAT 1138 bp 5′ outside GTA GAG GAT the repair ATT CCT AGA template (SEQ ID NO: 25) ALS_G/T_Rv CAG GGA AGA Within the TAT CAG CAG repair ATT TG template (SEQ ID NO: 26) ALS_G/T_Fw CTA CAA TTA 1127 bp Within the GGG TGG AAA repair ATC TC template (SEQ ID NO: 27) 3′ALS_G/T CTC TAG TGG 3′ outside TCA CCT GGC the repair ATC template (SEQ ID NO: 28)

[0144] In addition to the detection of the successful point mutation in the genome of B. vulgaris, the undesired integration of plasmid DNA was also analyzed. Therefore, genomic DNA, for which the successful integration of a point mutation at the desired locus had been confirmed, was analyzed for the presence of plasmid DNA via PCR. Sequence regions within the cpf1, the crRNA ribozyme cassette and the tDT were amplified using the primers listed in Table F below.

TABLE-US-00008 TABLE F Primers used for the detection of sTABLE integrated plasmid-specific sequences in the genome of B. vulgaris shoots Size Sequence of PCR Name 5′.fwdarw.3′ product Binding pSEQ_ ACCACTCACTCCTCGATAAG 214 Cpf1 LbCpf1_F4 (SEQ ID NO: 29) pSeq_ TAGACCTGCTTCTCAACCTT LbCpf1_R3 CA (SEQ ID NO: 30) pSeq_ TGCAGCGGATCCAAATTAC 172 crRNA- Ribozyme_F TG ribozyme (SEQ ID NO: 31) cassette pSeq_ CCTGGTCCCATTCGCCAT Ribozyme_R (SEQ ID NO: 32) pSeq_ TTACAAGAAGCTGTCCTTCC 400 tDT tDT_F (SEQ ID NO: 33) pSeq_ GTACTGTTCCACGATGGTGT tDT_R (SEQ ID NO: 34)

ALS 9 bp Insertion:

[0145] For the ALS 9 bp insertion an analogous approach was used as described for ALS G.fwdarw.T mutations above. The 9 bp insertion GCACTATCG was flanked upstream and downstream with a 1000 bp homologous sequence (SEQ ID NO: 35).

TABLE-US-00009 TABLE G Primers used for the detection of the insertion Size of sequence the PCR Name 5′.fwdarw.3′ product Binding 5′ALS_ GTG CTG ATG 1148 + 5′ outside Insertion TTA AAT TGG 9 bp the repair CAT TGC template (SEQ ID NO: 36) ALS_ CTA GTG GCA Within the Insertion_ GAC TAA GAA repair Rv TTA TG template (SEQ ID NO: 37) ALS_ GAA TGC TCT 1165 + Within the Insertion_ TCC TGT ATT 9 bp repair Fw GCT TG template (SEQ ID NO: 38) 3′ALS_ CAG TTC AAC 3′ outside Insertion ACA AAA GAA the repair GTT GTC template (SEQ ID NO: 39)

Combined Insertion of the G→T Point Mutation and the 9 bp Insertion in ALS:

[0146] In general, an analogous procedure is applied as for both approaches described above. In this case, however, the repair template is only flanked by 250 bp homologous sequences upstream and downstream, since homologues flanking sequences with 1000 bp upstream and downstream of the respective repair templates would overlap. In this setup, the plasmids for crRNA_ALS_G/T and crRNA_ALS_In1, as well as both repair templates were transformed using biolistic co-bombardment. Detection of the point mutation and the 9 bp insertion was done as described above.

CYP Deletion Marker:

[0147] The deletion can also be generated and detected using one of the above described approaches. For the generation of a deletion marker, it is important that the repair template must contain the 9 bp deletion (ATTTGTGAG). This is then also flanked 1000 bp homologous sequences upstream and downstream of the repair template and used for the construct (SEQ ID NO: 40).

TABLE-US-00010 TABLE H Primers used for the detection of the deletion Size of Sequences the PCR Name 5′.fwdarw.3′ product Binding 5′CYP_ GTC TTT ACA 1167 − 5′ outside Deletion TAG CAA AAC 9 bp the repair AAT ATT GAA template G (SEQ ID NO: 41) CYP_ CTA ACA CTT Within the Deletion_Rv CCC TCA AAT repair TAA CAA C template (SEQ ID NO: 42) CYP_ CAA TAG TGG 1198 − Within the Deletion_Fw TGA TGT GGC 9 bp repair CTT GG template (SEQ ID NO: 43) 3′CYP_ GGT AAC TAG 3′ outside Deletion TAA AAG TAT the repair ACT CAT C template (SEQ ID NO: 44)