NOVEL SULFONAMIDE DERIVATIVES HAVING SELECTIVE NOX INHIBITING ACTIVITY

20210171456 · 2021-06-10

    Inventors

    Cpc classification

    International classification

    Abstract

    A compound of formula (I) or a pharmaceutically acceptable salt thereof. The compound is useful in therapy, e.g. for the treatment of a condition or disorder associated with nicotinamide adenine dinucleotide phosphate oxidase 4 or 2 (Nox4 or Nox2) activity. A pharmaceutical composition comprising the compound.

    Claims

    1. A compound of formula (I) ##STR00070## or a pharmaceutically acceptable salt thereof, wherein n is an integer of from 1 to 5; each R.sub.1 is independently selected from C1-C6 alkyl, C3-C6 carbocyclyl, C3-C6 carbocyclyl-C1-C3 alkyl, C1-C6 alkoxy, C1-C6 alkoxy-C1-C3 alkyl, C3-C6 carbocyclyloxy, C3-C6 carbocyclyloxy-C1-C3 alkyl, 4- to 6-membered heterocyclyl, 4- to 6-membered heterocyclyl-C1-C3 alkyl, hydroxy, hydroxy-C1-C3 alkyl, carboxy, carboxy-C1-C3 alkyl, C1-C6 alkoxycarbonyl, C1-C6 alkoxycarbonyl-C1-C3 alkyl, and halogen; and when n is at least 2, two R.sub.1 attached to adjacent atoms of the phenyl ring, together with the phenyl ring atoms to which they are attached, may form a 4- to 6-membered non-aromatic ring optionally containing one or more heteroatoms and optionally substituted with one or more moieties independently selected from C1-C3 alkyl and halogen; R.sub.2 is selected from C1-C6 alkyl, C3-C6 carbocyclyl, C3-C6 carbocyclyl-C1-C3 alkyl, C1-C6 alkoxy, C1-C6 alkoxy-C1-C3 alkyl, C3-C6 carbocyclyloxy, C3-C6 carbocyclyloxy-C1-C3 alkyl, halogen, hydroxy, and hydroxy-C1-C3 alkyl; R.sub.3, R.sub.4, R.sub.5, and R.sub.6 are independently selected from H and F; any alkyl is optionally substituted with one or more halogens; and any carbocyclyl or heterocyclyl is optionally substituted with one or more moieties independently selected from halogen and C1-C3 alkyl; provided that the compound is not: 4-butyl-N-[2-(2-ethoxyphenyl)ethyl]benzene-1-sulfonamide, 3,4-dichloro-N-[2-(2-ethoxyphenyl)ethyl]benzene-1-sulfonamide, 5-bromo-2-chloro-N-[2-(2-methoxy-phenyl)-ethyl]-benzenesulfonamide, 5-bromo-2-chloro-N-[2-(2-trifluoromethoxy-phenyl)-ethyl]-benzenesulfonamide, N-[2-(2-methoxyphenyl)-ethyl]-4-methylbenzenesulfonamide, N-[2-(2-hydroxyphenyl)ethyl]-4-methylbenzenesulfonamide, N-(2-iodophenethyl)-4-methylbenzenesulfonamide, N-(2-bromophenethyl)-4-methylbenzenesulfonamide, 4-methyl-N-(2-(2′,3′,4′,5′-tetrahydro-[1,1′-biphenyl]-2-yl)ethyl)benzenesulfonamide, or 3-methyl-N-(2-methylphenethyl)-4-(1H-tetrazol-1-yl)benzenesulfonamide.

    2. The compound of claim 1, or a pharmaceutically acceptable salt thereof, wherein R.sub.2 is selected from C1-C3 alkyl, halogen, hydroxy, and hydroxy-C1-C3 alkyl.

    3. The compound of claim 2, or a pharmaceutically acceptable salt thereof, wherein R.sub.2 is selected from C1-C3 alkyl, halogen, and hydroxy.

    4. The compound of claim 3, or a pharmaceutically acceptable salt thereof, wherein R.sub.2 is hydroxy.

    5. The compound of claim 1, or a pharmaceutically acceptable salt thereof, wherein each R.sub.1 is independently selected from C1-C6 alkyl, C3-C6 cyclolalkyl, C3-C6 cycloalkyl-C1-C3 alkyl, C1-C6 alkoxy, C1-C6 alkoxy-C1-C3 alkyl, hydroxy, hydroxy-C1-C3 alkyl, carboxy, carboxy-C1-C3 alkyl, and halogen; and when n is at least 2, two R.sub.1 attached to adjacent atoms of the phenyl ring, together with the phenyl ring atoms to which they are attached, may form a 4- to 6-membered non-aromatic ring optionally containing one or more heteroatoms and optionally substituted with one or more moieties independently selected from C1-C3 alkyl and halogen.

    6. The compound of claim 1, of formula (Ib) ##STR00071## or a pharmaceutically acceptable salt thereof, wherein k is 0 or 1; m is 0 or 1; n is an integer of from 3 to 5; each R.sub.1, R.sub.2, R.sub.3, R.sub.4, R.sub.5, and R.sub.6 are as defined in claim 1; and each R.sub.1a is independently selected from C1-C6 alkyl, C1-C6 alkoxy, C1-C6 alkoxy-C1-C3 alkyl, halogen, hydroxy, hydroxy-C1-C3 alkyl, carboxy, and carboxy-C1-C3 alkyl; wherein any alkyl is optionally substituted with one or more halogens.

    7. The compound of claim 6, or a pharmaceutically acceptable salt thereof, wherein k is 1.

    8. The compound of claim 6 or 7, or a pharmaceutically acceptable salt thereof, wherein m is 1.

    9. The compound of claim 6, or a pharmaceutically acceptable salt thereof, wherein each R.sub.1a is independently selected from C1-C3 alkyl, hydroxy, carboxy, and halogen.

    10. The compound of claim 9, or a pharmaceutically acceptable salt thereof, wherein each R.sub.1a is independently selected from C1-C3 alkyl, hydroxy, and halogen.

    11. The compound of claim 1, or a pharmaceutically acceptable salt thereof, wherein n is 3.

    12. A compound according to claim 1, selected from N-[2-(2-methoxyphenyl)ethyl]-2,4,6-trimethylbenzene-1-sulfonamide; N-[2-(2-fluorophenyl)ethyl]-2,4,6-trimethylbenzene-1-sulfonamide; N-[2-(2-fluorophenyl)ethyl]-2,2,4,6,7-pentamethyl-2,3-dihydro-1-benzofuran-5-sulfonamide; 4-bromo-2,6-dichloro-N-[2-(2-methoxyphenyl)ethyl]benzene-1-sulfonamide; 4-bromo-2,6-dichloro-N-[2-(2-fluorophenyl)ethyl]benzene-1-sulfonamide; N-[2-(2-chlorophenyl)ethyl]-2,4,6-trimethylbenzene-1-sulfonamide; N-[2-(2-bromophenyl)ethyl]-2,4,6-trimethylbenzene-1-sulfonamide; 4-bromo-2-chloro-N-[2-(2-chlorophenyl)ethyl]benzene-1-sulfonamide; N-[2-(2-chlorophenyl)ethyl]-2,2,4,6,7-pentamethyl-2,3-dihydro-1-benzofuran-5-sulfonamide; 2,4,6-trimethyl-N-{2-[2-(trifluoromethyl)phenyl]ethyl}benzene-1-sulfonamide; 2-chloro-6-methyl-N-[2-(2-methylphenyl)ethyl]benzene-1-sulfonamide; 2-chloro-N-[2-(2-chlorophenyl)ethyl]-6-methylbenzene-1-sulfonamide; 2-chloro-N-[2-(2-chlorophenyl)ethyl]benzene-1-sulfonamide; 2,4,6-trimethyl-N-[2-(2-methylphenyl)ethyl]benzene-1-sulfonamide; 2,4,6-trimethyl-N-{2-[2-(trifluoromethoxy)phenyl]ethyl}benzene-1-sulfonamide; 2-chloro-6-methyl-N-{2-[2-(trifluoromethyl)phenyl]ethyl}benzene-1-sulfonamide; 4-bromo-2,6-dichloro-N-[2-(2-methylphenyl)ethyl]benzene-1-sulfonamide; 2,4-dichloro-N-[2-(2-methylphenyl)ethyl]benzene-1-sulfonamide; 4-bromo-2,6-dichloro-N-{2-[2-(trifluoromethyl)phenyl]ethyl}benzene-1-sulfonamide; 4-bromo-2,6-dichloro-N-[2-(2-chlorophenyl)ethyl]benzene-1-sulfonamide; 2,6-dichloro-N-[2-(2-fluorophenyl)ethyl]benzene-1-sulfonamide; 2,6-dichloro-N-{2-[2-(trifluoromethyl)phenyl]ethyl}benzene-1-sulfonamide; 2,6-dichloro-N-[2-(2-chlorophenyl)ethyl]benzene-1-sulfonamide; 2,6-dichloro-N-[2-(2-fluorophenyl)ethyl]-4-(pyridin-3-yl)benzene-1-sulfonamide; 2,6-dichloro-4-cyclopropyl-N-[2-(2-fluorophenyl)ethyl]benzene-1-sulfonamide; 2,6-dichloro-N-[2-(2-chlorophenyl)ethyl]-4-cyclopropylbenzene-1-sulfonamide; 2,6-dichloro-N-[2-(2-chlorophenyl)ethyl]-4-(trifluoromethyl)benzene-1-sulfonamide; N-[2,2-difluoro-2-(2-methylphenyl)ethyl]-2,4,6-trimethylbenzene-1-sulfonamide; 4-bromo-2,6-dichloro-N-[2,2-difluoro-2-(2-methylphenyl)ethyl]benzene-1-sulfonamide; N-[2-(2-chlorophenyl)-2,2-difluoroethyl]-2,4,6-trimethylbenzene-1-sulfonamide; 4-bromo-2,6-dichloro-N-[2-(2-chlorophenyl)-2,2-difluoroethyl]benzene-1-sulfonamide; N-[2-(2-chlorophenyl)ethyl]-2,6-dimethyl-4-(propan-2-yl)benzene-1-sulfonamide; 2,6-dimethyl-N-[2-(2-methylphenyl)ethyl]-4-(propan-2-yl)benzene-1-sulfonamide; N-[2-fluoro-2-(2-methylphenyl)ethyl]-2,4,6-trimethylbenzene-1-sulfonamide; 4-bromo-2,6-dichloro-N-[2-fluoro-2-(2-methylphenyl)ethyl]benzene-1-sulfonamide; N-[2-fluoro-2-(2-methylphenyl)ethyl]-2,6-dimethyl-4-(propan-2-yl)benzene-1-sulfonamide; N-[2-(2-hydroxyphenyl)ethyl]-2,4,6-trimethylbenzene-1-sulfonamide; 4-bromo-2,6-dichloro-N-[2-(2-hydroxyphenyl)ethyl]benzenesulfonamide; 2,6-dichloro-N-[2-(2-hydroxyphenyl)ethyl]-4-(trifluoromethyl)benzenesulfonamide; 2,6-dichloro-N-[2-(2-hydroxyphenyl)ethyl]benzenesulfonamide; 2,4-dichloro-6-hydroxy-N-[2-(2-hydroxyphenyl)ethyl]benzenesulfonamide; 2,4-dichloro-6-hydroxy-N-[2-(o-tolyl)ethyl]benzenesulfonamide; 4-chloro-3-hydroxy-N-[2-(2-hydroxyphenyl)ethyl]benzenesulfonamide; 6-chloro-3-hydroxy-N-[2-(2-hydroxyphenyl)ethyl]-2,4-dimethyl-benzenesulfonamide; 3,5-dichloro-2-[2-(o-tolyl)ethylsulfamoyl]benzoic acid; N-[2-(2-chlorophenyl)ethyl]-4-methoxy-2,6-dimethyl-benzenesulfonamide; N-[2-(2-hydroxyphenyl)ethyl]-4-methoxy-2,6-dimethyl-benzenesulfonamide; and 4-hydroxy-N-[2-(2-hydroxyphenyl)ethyl]-2,6-dimethyl-benzenesulfonamide; or a pharmaceutically acceptable salt thereof.

    13. A pharmaceutical composition comprising a compound according to claim 1, or a pharmaceutically acceptable salt thereof, and optionally a pharmaceutically acceptable excipient.

    14-16. (canceled)

    17. A method for the treatment of a disorder selected from endocrine disorders, cardiovascular disorders, respiratory disorders, metabolism disorders, skin disorders, bone disorders, neuroinflammatory disorders, neurodegenerative disorders, kidney diseases, reproduction disorders, diseases affecting the eye, diseases affecting the lens, conditions affecting the inner ear, inflammatory disorders, liver diseases, pain, cancers, allergic disorders, traumatisms, septic shock, hemorrhagic shock, anaphylactic shock, diseases or disorders of the gastrointestinal system, abnormal angiogenesis, angiogenesis-dependent conditions, lung infections, acute lung injury, pulmonary arterial hypertension, obstructive lung disorders, and fibrotic lung disease, by administering a therapeutically effective amount of a compound of claim 1, to a mammal in need of such treatment.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0076] FIG. 1 is a bar chart showing cell viability as a ratio of basal cell viability of human brain microvascular endothelial cells subjected to hypoxia and starvation (OGD: oxygen and glucose deprivation) for 5 h and then cultured for 24 h in the absence or presence of Example 11 at a concentration of 2, 10 or 20 μM. Basal=no hypoxia or starvation, cells cultured in the presence of culture medium only. OGD=5 h of hypoxia or starvation, cells cultured in the presence of culture medium only.

    [0077] FIG. 2 is a bar chart showing cell viability as a ratio of basal cell viability of human brain microvascular endothelial cells subjected to hypoxia and starvation (OGD) for 5 h and then cultured for 24 h in the absence or presence of Example 17 at a concentration of 0.3, 3 or 10 μM. Basal=no hypoxia or starvation, cells cultured in the presence of culture medium only. OGD=5 h of hypoxia or starvation, cells cultured in the presence of culture medium only.

    [0078] FIG. 3 is a bar chart showing cell viability as a ratio of basal cell viability of human brain microvascular endothelial cells subjected to hypoxia and starvation (OGD: oxygen and glucose deprivation) for 6 h and then cultured for 24 h in the absence or presence of Example 44 at a concentration of from 0.6 to 9.6 μM. Basal=no hypoxia or starvation, cells cultured in the presence of culture medium only. OGD=6 h of hypoxia or starvation, cells cultured in the presence of culture medium only (*p<0.05, ***p<0.001).

    [0079] FIG. 4 is a bar chart showing cell viability (in % of basal cell viability) of hippocampal brain slices subjected to hypoxia and starvation for 5 h and then cultured for 24 h in the absence (OGD) or presence of Example 11 at a concentration of 0.3 μM, 3 μM, or 10 μM. Basal=no hypoxia or starvation, cells cultured in the presence of culture medium only. OGD=5 h of hypoxia or starvation, cells cultured in the presence of culture medium only.

    [0080] FIG. 5 is a bar chart showing cell viability (in % of basal cell viability) of hippocampal brain slices subjected to hypoxia and starvation for 5 h and then cultured for 24 h in the absence (OGD) or presence of Example 17 at a concentration of 0.3, 3 or 10 μM. Basal=no hypoxia or starvation, cells cultured in the presence of culture medium only. OGD=5 h of hypoxia or starvation, cells cultured in the presence of culture medium only.

    [0081] FIG. 6 shows coronal brain section slices from C57B16/J mice that had been exposed to middle cerebral artery occlusion for 1 h. The slices have been stained with 2,3,5-triphenyl tetrazolium chloride (TTC) to visualize the ischemic lesions. Control=mice having received vehicle only, and sacrificed after 24 hours; Example 17=mice having received Example 17 at a dosage of 2.56 mg/kg body weight, administered by one ip injection per hour, from 1 hour after reperfusion until 6 hours after reperfusion, and sacrificed after 24 hours.

    [0082] FIG. 7 is a bar chart showing the mean infarct volume (in mm.sup.3) in mice in a model of acute stroke. Control=mice having received vehicle only. Example 17=mice having received Example 17 at a dosage of 2.56 mg/kg body weight, administered by one ip injection per hour, from 1 hour after reperfusion until 6 hours after reperfusion. The mice were sacrificed after 24 hours.

    [0083] FIG. 8 shows coronal brain section slices from C57B16/J mice that had been exposed to middle cerebral artery occlusion for 1 h. Control=mice having received vehicle only, and sacrificed after 24 hours; Example 17=mice having received Example 17 at a dosage of 2.56 mg/kg body weight, administered by one ip injection per hour, from 30 minutes before reperfusion until 4.5 hours, and sacrificed after 24 hours.

    [0084] FIG. 9 is a bar chart showing the mean infarct volume (in mm.sup.3) in mice in a model of acute ischemic stroke. Control=mice having received only vehicle. Example 17=mice having received Example 17 at a dosage of 2.56 mg/kg body weight, administered by one ip injection per hour, from 30 minutes before reperfusion until 4.5 hours after reperfusion. The mice were sacrificed after 24 hours.

    [0085] FIG. 10 is a bar chart showing cell viability (in % of basal cell viability) of cultured human neuroblastoma SHSY-5Y cells exposed to okadaic acid, in the absence or presence of different concentrations of Example 17 or melatonin as a positive control. Basal=Cells cultivated in the presence of culture medium only; OA=cells cultured in the presence of okadaic acid at a concentration of 15 nM; Ex. 17 (0.3 μM)=cells cultured in the presence of okadaic acid (15 nM) and Ex. 17 at a concentration of 0.3 μM; Ex. 17 (3 μM)=cells cultured in the presence of okadaic acid (15 nM) and Ex. 17 at a concentration of 3 μM; Ex. 17 (10 μM)=cells cultured in the presence of okadaic acid (15 nM) and Ex. 17 at a concentration of 10 μM; Melatonin (10 μM)=cells cultured in the presence of okadaic acid (15 nM) and melatonin at a concentration of 10 μM.

    [0086] FIG. 11A represents time schedule for the treatment of hippocampal slices (Nox4 knockout or wildtype), including 40 minutes of stabilization, followed by 6 hours of treatment with okadaic acid (1 μM), or with okadaic acid (1 μM) in the presence of either the Nox inhibitor VAS2870 (3-benzyl-7-(2-benzoxazolyl)thio-1,2,3-triazolo[4,5-d]pyrimidine) (10 μM) or Example 11 (10 μM). FIG. 11B is a bar chart representing cell viability (in % of the viability of hippocampal slices cultured only in culture medium) of Nox4 knockout (KO) or wildtype (WT) hippocampal cells, respectively. Basal=hippocampal slices cultured only in culture medium; OA1 (1 μM)=hippocampal slices cultured in the presence of okadaic acid (1 μM). FIG. 11C is a bar chart representing cell viability (in % of the viability of hippocampal slices cultured only in culture medium) of wildtype hippocampal cells cultured in only culture medium (Basal); in the presence of okadaic acid at a concentration of 1 μM (OA); in the presence of okadaic acid (1 μM) and VAS2870 at a concentration of 10 μM (VAS) and in the presence of okadaic acid (1 μM) and Example 11 at a concentration of 10 μM (Ex. 11).

    [0087] FIG. 12 is a bar chart representing the effect of the cytokines IL-10 (20 ng/ml) and IFN-γ (20 ng/ml) on human islet cells (Cyt); on human islet cells in the presence of Example 17 (1 μM) (Cyt+Ex. 17); on human islet cells in the presence of Phos-I2 (2 μM) (Cyt+Nox2 inh); and on human islet cells in the presence of ML-171 (2 μM) (Cyt+Nox1 inh), respectively. The effect is shown as a cell death ratio compared to human islet cells cultured in the absence of any cytokines (Control).

    [0088] FIG. 13 is a bar chart representing the effect of palmitate (1.5 mM) and high glucose (20 mM) on human islet cells (Palm HG); on human islet cells in the presence of Example 17 (1 μM) (Palm HG Ex. 17); on human islet cells in the presence of Phos-I2 (2 μM) (Palm HG NOX2 inh); and on human islet cells in the presence of ML-171 (2 μM) (Palm HG NOX1 inh), respectively. The effect is shown as a cell death ratio compared to human islet cells cultured in culture medium only (Control). Also shown are the cell death ratios for human islet cells cultured in the presence of Example 17 at 1 μM (Ex. 17), Phos-I2 at 2 μM (NOX2 inh) and ML-171 at 2 μM (NOX1 inh).

    [0089] FIG. 14 is a bar chart showing total fluorescence from epithelial cells of rat lens explants (untreated), from epithelial cells of rat lens explants treated with TGFβ for 8 hours (TGFβ), from epithelial cells of rat lens explants treated with TGFβ and Example 11 for 8 hours (TGFβ/Ex. 11), and from epithelial cells of rat lens explants treated with TGFβ and Example 17 for 8 hours (TGFβ/Ex. 17), and stained for superoxide with DHE. Means and SEM were calculated using Graph Pad Prism v7.0. Statistical significance was determined using one-way ANOVA, using Tukey post-hoc estimation (**p<0.01, ***p<0.001, n=3 individual independent experiments). Error bars: SEM.

    [0090] FIG. 15(A-H) shows micrographs, taken on days 0, 2, 3 and 5, of rat lens explants treated and cultured for 5 days with TGFβ (A-D), or with TGFβ and Example 17 (E-H).

    [0091] FIG. 16 is a bar chart showing the upregulation of genes, in P21 rat lens epithelial explants at 48 hours of culture with (TGFβ) or without (control) treatment with TGFβ. The upregulation is expressed as relative fold change (AU) compared to expression of the same genes in the control culture.

    [0092] FIG. 17 is a bar chart showing the upregulation of genes, in P21 rat lens epithelial explants treated with TGFβ alone (TGFβ) or with TGFβ and Example 11 (TGFβ+Ex. 11) at 48 hours of culture treated. The upregulation is expressed as relative fold change (AU) compared to expression of the same genes in the presence of TGFβ alone.

    [0093] FIG. 18 is a bar chart showing the upregulation of genes, in P21 rat lens epithelial explants treated with TGFβ alone (TGFβ) or with TGFβ and Example 17 (TGFβ+Ex. 17) at 48 hours of culture treated. The upregulation is expressed as relative fold change (AU) compared to expression of the same genes in the presence of TGFβ alone. Means and SEM were calculated using GraphdPad Prism v7.0. Statistical significance was determined using one-way ANOVA, using Tukey post-hoc estimation (*p<0.05, **p<0.01, ***p<0.001, ****p<0.0001 n=3 individual independent experiments). Error bars: SEM.

    [0094] FIG. 19 is a bar chart showing the mean gray value for glial fibrillary acidic protein (GFAP) immunoreactivity measured in eye preparations obtained from healthy (Control) or diabetic rats (Diabetic), and from diabetic rats treated with Example 17 (Diabetic+Example 17), respectively. The immunoreactivity measured in eye preparations from healthy rats is set as 100%, and values obtained from diabetic rats with or without treatment with Example 17 are indicated versus the control values. ***p<0.001, ##p<0.01.

    DETAILED DESCRIPTION OF THE INVENTION

    [0095] In general any term used herein shall be given its normal meaning as accepted within the field to which the present invention belongs. For the sake of clarity, however, some definitions will be given herein below, and shall apply throughout the specification and the appended claims, unless otherwise specified or apparent from the context.

    [0096] The term “endocrine disorder” refers to disorders of the endocrine system and may be as well endocrine gland hyposecretion as hypersecretion, or tumors of endocrine glands. Diabetes and polycystic ovarian syndrome are examples of endocrine disorders.

    [0097] The term “cardiovascular disorder or disease” comprises atherosclerosis, especially diseases or disorders associated with endothelial dysfunction including but not limited to hypertension, cardiovascular complications of Type I or Type II diabetes, intimal hyperplasia, coronary heart disease, cerebral, coronary or arterial vasospasm, endothelial dysfunction, heart failure including congestive heart failure, peripheral artery disease, restenosis, trauma caused by a stent, stroke, ischemic attack, vascular complications such as after organ transplantation, myocardial infarction, hypertension, formation of atherosclerotic plaques, platelet aggregation, angina pectoris, aneurysm, aortic dissection, ischemic heart disease, cardiac hypertrophy, pulmonary embolus, thrombotic events including deep vein thrombosis, injury caused after ischemia by restoration of blood flow or oxygen delivery as in organ transplantation, open heart surgery, angioplasty, hemorrhagic shock, angioplasty of ischemic organs including heart, brain, liver, kidney, retina and bowel.

    [0098] The term “respiratory disorder or disease” comprises bronchial asthma, bronchitis, allergic rhinitis, adult respiratory syndrome, cystic fibrosis, lung viral infection (influenza), pulmonary hypertension, idiopathic pulmonary fibrosis and chronic obstructive pulmonary diseases (COPD).

    [0099] The term “allergic disorder” includes hay fever and asthma.

    [0100] The term “traumatism” includes polytraumatism.

    [0101] The term “disease or disorder affecting the metabolism” includes obesity, metabolic syndrome and Type II diabetes.

    [0102] The term “skin disease or disorder” includes psoriasis, eczema, dermatitis, wound healing and scar formation.

    [0103] The term “bone disorder” includes osteoporosis, osteoporosis, osteosclerosis, periodontitis, and hyperparathyroidism.

    [0104] The term “neurodegenerative disease or disorder” comprises a disease or a state characterized by a central nervous system (CNS) degeneration or alteration, especially at the level of the neurons such as Alzheimer's disease, Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis, epilepsy and muscular dystrophy. It further comprises neuroinflammatory and demyelinating states or diseases such as leukoencephalopathies, and leukodystrophies.

    [0105] The term “demyelinating” is referring to a state or a disease of the CNS comprising the degradation of the myelin around the axons. In the context of the invention, the term demyelinating disease is intended to comprise conditions which comprise a process that demyelinate cells such as multiple sclerosis, progressive multifocal leukoencephalopathy (PML), myelopathies, any neuroinflammatory condition involving autoreactive leukocyte within the CNS, congenital metabolic disorder, a neuropathy with abnormal myelination, drug induced demyelination, radiation induced demyelination, a hereditary demyelinating condition, a prion induced demyelinating condition, encephalitis induced demyelination or a spinal cord injury. Preferably, the condition is multiple sclerosis.

    [0106] The term “kidney disease or disorder” includes diabetic nephropathy, renal failure, glomerulonephritis, nephrotoxicity of aminoglycosides and platinum compounds and hyperactive bladder. In a particular embodiment, the term according to the invention includes chronic kidney diseases or disorders.

    [0107] The term “reproduction disorder or disease” includes erectile dysfunction, fertility disorders, prostatic hypertrophy and benign prostatic hypertrophy.

    [0108] The term “disease or disorder affecting the eye and/or the lens” includes cataract including diabetic cataract, re-opacification of the lens post cataract surgery, diabetic and other forms of retinopathy.

    [0109] The term “conditions affecting the inner ear” includes presbyacusis, tinnitus, Meniere's disease and other balance problems, utriculolithiasis, vestibular migraine, and noise induced hearing loss and drug induced hearing loss (ototoxicity).

    [0110] The term “inflammatory disorder or disease” means inflammatory bowel disease, sepsis, septic shock, adult respiratory distress syndrome, pancreatitis, shock induced by trauma, bronchial asthma, allergic rhinitis, rheumatoid arthritis, chronic rheumatoid arthritis, arteriosclerosis, intracerebral hemorrhage, cerebral infarction, heart failure, myocardial infarction, psoriasis, cystic fibrosis, stroke, acute bronchitis, chronic bronchitis, acute bronchiolitis, chronic bronchiolitis, osteoarthritis, gout, myelitis, ankylosing spondylitis, Reuter syndrome, psoriatic arthritis, spondylarthritis, juvenile arthritis or juvenile ankylosing spondylitis, reactive arthritis, infectious arthritis or arthritis after infection, gonococcal arthritis, syphilitic arthritis, Lyme disease, arthritis induced by “angiitis syndrome,” polyarteritis nodosa, anaphylactic angiitis, Luegenec granulomatosis, rheumatoid polymyalgia, articular cell rheumatism, calcium crystal deposition arthritis, pseudogout, non-arthritic rheumatism, bursitis, tendosynovitis, epicondyle inflammation (tennis elbow), carpal tunnel syndrome, disorders by repetitive use (typing), mixed form of arthritis, neuropathic arthropathy, hemorrhagic arthritis, vascular peliosis, hypertrophic osteoarthropathy, multicentric reticulohistiocytosis, arthritis induced by specific diseases, blood pigmentation, sickle cell disease and other hemoglobin abnormality, hyperlipoproteinemia, dysgammaglobulinemia, hyperparathyroidism, acromegaly, familial Mediterranean fever, Bechet's disease, systemic autoimmune disease erythematosus, multiple sclerosis and Crohn's disease or diseases like relapsing polychondritis, chronic inflammatory bowel diseases (IBD) or the related diseases which require the administration to a mammal in a therapeutically effective dose of a compound expressed by Formula (I) in a sufficient dose to inhibit NADPH oxidase.

    [0111] The term “liver diseases or disorders” include liver fibrosis, alcohol induced fibrosis, steatosis and non-alcoholic steatohepatitis.

    [0112] The term “arthritis” means acute rheumatic arthritis, chronic rheumatoid arthritis, chlamydial arthritis, chronic absorptive arthritis, anchylous arthritis, arthritis based on bowel disease, filarial arthritis, gonorrheal arthritis, gouty arthritis, hemophilic arthritis, hypertrophic arthritis, juvenile chronic arthritis, Lyme arthritis, neonatal foal arthritis, nodular arthritis, ochronotic arthritis, psoriatic arthritis or suppurative arthritis, or the related diseases which require the administration to a mammal in a therapeutically effective dose of a compound expressed by Formula (I) in a sufficient dose to inhibit NADPH oxidase.

    [0113] The term “pain” includes hyperalgesia associated with inflammatory pain.

    [0114] The term “cancer” means carcinoma (e.g., fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteogenic sarcoma, chordoma, angiosarcoma, endothelium sarcoma, lymphangiosarcoma, lymphangioendothelioma, periosteoma, mesothelioma, Ewing's tumor, leiomyosarcoma, rhabdomyo sarcoma, colon carcinoma, pancreatic cancer, breast cancer, ovarian cancer, renal cancer, prostatic carcinoma, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinoma, cystadenocarcinoma, medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma, hepatocellular carcinoma, cholangiocarcinoma, choriocarcinoma, seminoma, embryonal carcinoma, Wilms' tumor, cervical cancer, orchioncus, lung cancer, small-cell lung cancer, lung adenocarcinoma, bladder cancer or epithelial cancer) or the related diseases which require the administration to a mammal in a therapeutically effective dose of a compound expressed by the Formula (I) in a sufficient dose to inhibit NADPH oxidase.

    [0115] The term “disease or disorders of the gastrointestinal system”, includes gastric mucosa disorders ischemic bowel disease management, enteritis/colitis, cancer chemotherapy, or neutropenia.

    [0116] The term “angiogenesis” includes sprouting angio genesis, intussusceptive angiogenesis, vasculogenesis, arteriogenesis and lymphangiogenesis. Angiogenesis is the formation of new blood vessels from pre-existing capillaries or post-capillary venules and occurs in pathological conditions such as cancers, arthritis and inflammation. A large variety of tissues, or organs comprised of organized tissues, can support angiogenesis in disease conditions including skin, muscle, gut, connective tissue, joints, bones and the like tissue in which blood vessels can invade upon angiogenic stimuli. As used herein, the term “angiogenesis-dependent condition” is intended to mean a condition where the process of angiogenesis or vasculogenesis sustains or augments a pathological condition. Vasculogenesis results from the formation of new blood vessels arising from angioblasts which are endothelial cell precursors.

    [0117] Both processes result in new blood vessel formation and are included in the meaning of the term angiogenesis-dependent conditions. Similarly, the term “angiogenesis” as used herein is intended to include de novo formation of vessels such as those arising from vasculogenesis as well as those arising from branching and sprouting of existing vessels, capillaries and venules.

    [0118] The term “angiogenesis inhibitory”, means which is effective in the decrease in the extent, amount, or rate of neovascularization. Effecting a decrease in the extent, amount, or rate of endothelial cell proliferation or migration in the tissue is a specific example of inhibiting angiogenesis. Angiogenesis inhibitory activity is particularly useful in the treatment of any cancers as it targets tumor growth process and in the absence of neovascularization of tumor tissue, the tumor tissue does not obtain the required nutrients, slows in growth, ceases additional growth, regresses and ultimately becomes necrotic resulting in killing of the tumor. Further, an angiogenesis inhibitory activity is particularly useful in the treatment of any cancers as it is particularly effective against the formation of metastases because their formation also requires vascularization of a primary tumor so that the metastatic cancer cells can exit the primary tumor and their establishment in a secondary site requires neovascularization to support growth of the metastases.

    [0119] As used herein, “treatment” and “treating” includes prophylaxis of a named disorder or condition, or amelioration or elimination of the disorder once it has been established. Thus, treatment generally means obtaining a desired pharmacological and physiological effect. The effect may be prophylactic in terms of preventing or partially preventing a disease, symptom or condition thereof and/or may be therapeutic in terms of a partial or complete cure of a disease, condition, symptom or adverse effect attributed to the disease.

    [0120] The term “subject” as used herein refers to mammals. Mammals contemplated by the present invention include humans and non-human mammals, such as primates, domesticated animals such as farm animals, e.g. cattle, sheep, pigs, horses and the like, as well as pet animals, such as dogs and cats, and the like.

    [0121] “An effective amount” (or “therapeutically effective amount”, etc) refers to an amount of a compound that confers a therapeutic effect on the treated subject. The therapeutic effect may be objective (i.e., measurable by some test or marker) or subjective (i.e., subject gives an indication of or feels an effect).

    [0122] The term “inhibitor” used in the context of the invention is defined as a molecule that inhibits completely or partially the activity of another molecule, e.g. an enzyme.

    [0123] “Pharmaceutically acceptable” means being useful in preparing a pharmaceutical composition that is generally safe, non-toxic and neither biologically nor otherwise undesirable and includes being useful for veterinary use as well as human pharmaceutical use.

    [0124] The term “alkyl” either alone or as part of a radical, refers to straight or branched chain alkyl of the general formula C.sub.nH.sub.2n+1.

    [0125] The expression “Cm-Cn” in connection with a moiety such as, for example, an alkyl or carbocyclyl, indicates that the moiety contains a number of carbon atoms ranging from m to n (where n is higher than m).

    [0126] The term “Cm-Cn alkyl” refers to an alkyl containing from m to n carbon atoms, wherein n is an integer higher than m, and m is at least 1. For example, methyl is a Cl alkyl.

    [0127] The term “Cm-Cn alkoxycarbonyl” refers to a moiety of formula

    ##STR00002##

    [0128] wherein R is a Cm-Cn alkyl group.

    [0129] The term “Cm-Cn alkoxycarbonyl-Cp-Cq” alkyl refers to refers to a Cp-Cq alkyl group having one hydrogen atom replaced by a Cm-Cn alkoxycarbonyl group, i.e. a a Cp-Cq alkyl group substituted by a Cm-Cn alkoxycarbonyl group.

    [0130] The term “carbocyclyl” or “carbocyclic ring” refers to a saturated or unsaturated (e.g. monounsaturated or diunsaturated), non-aromatic or aromatic cyclic moiety containing only carbon atoms in the ring. A saturated carbocyclyl is referred to as a cycloalkyl, while phenyl is an aromatic carbocyclyl.

    [0131] The term “Cm-Cn carbocyclyl” refers to a carbocyclyl containing from m to n carbon atoms in the ring, wherein m is an integer higher than or equal to 3.

    [0132] The term “Cm-Cn carbocyclyl-Cp-Cq alkyl” refers to a Cp-Cq alkyl substituted with Cm-Cn carbocyclyl. For example, cyclopropylmethyl is a C3 carbocyclyl-Cl alkyl radical of formula

    ##STR00003##

    [0133] The term “Cm-Cn alkoxy” refers to a moiety of formula

    ##STR00004##

    [0134] wherein R is Cm-Cn alkyl. For example, methoxy is Cl alkoxy.

    [0135] The term “Cm-Cn alkoxy-Cp-Cq alkyl” refers to a Cp-Cq alkyl substituted with Cm-Cn alkoxy. For example methoxymethyl is Cl alkoxy-Cl alkyl.

    [0136] The term “Cm-Cn carbocyclyloxy” refers to a moiety of formula

    ##STR00005##

    [0137] wherein R is Cm-Cn carbocyclyl; and m is an integer of at least 3.

    [0138] The term “Cm-Cn carbocyclyloxy-Cp-Cq alkyl” refers to a Cp-Cq alkyl substituted with Cm-Cn carbocyclyloxy.

    [0139] The term “carboxy” refers to a moiety of formula —COOH, which may also be represented as

    ##STR00006##

    [0140] The term “carboxy-Cm-Cn alkyl” refers to a Cm-Cn alkyl group having one hydrogen atom replaced by a carboxy function (i.e. substituted by a carboxy group). One example is carboxymethyl.

    [0141] The term “m- to n-membered heterocyclyl” refers to a cyclic moiety containing from m to n ring atoms, of which at least one is a heteroatom, e.g. a cyclic moiety containing from 1 to k-1 heteroatoms, wherein k is the total number of ring atoms (i.e. k is an integer of from m to n); e.g. 1-4 heteroatoms, or 1-3 heteroatoms, or 1 or 2 heteroatoms, e.g. 1 heteroatom. The heterocyclyl may be saturated or unsaturated and, when unsaturated, may be non-aromatic or aromatic (i.e. heteroaromatic). An aromatic heterocyclyl may also be referred to as a “heteroaryl”.

    [0142] The term “m- to n-membered heterocyclyl-Cp-Cq alkyl” refers to a Cp-Cq alkyl (wherein p represents an integer of at least 1) substituted with an m- to n-membered heterocyclyl.

    [0143] The term “halogen” refers to F, Cl, Br or I; preferably F, Cl or Br.

    [0144] The term “heteroatom” refers to an atom selected from nitrogen (N), oxygen (O), and sulphur (S).

    [0145] The term “non-aromatic”, as used herein, also includes “non-heteroaromatic” unless otherwise specified.

    [0146] The term “hydroxy” refers to the moiety HO—.

    [0147] The term “hydroxy-Cm-Cn alkyl” refers to an alkyl group containing from m to n carbon atoms and having one hydrogen atom replaced by a hydroxy function, i.e. a Cm-Cn alkyl substituted by a hydroxy function. One example is hydroxymethyl.

    [0148] The expression “adjacent phenyl ring atoms” (as in the expression “two R.sub.1 attached to adjacent phenyl ring atoms”) refers to two adjacent carbon atoms of a phenyl ring.

    [0149] In the context of the present disclosure, the expression “two R.sub.1 attached to adjacent phenyl ring atoms” or “two R.sub.1 attached to adjacent atoms of the phenyl ring” refers to two moieties R.sub.1 that, in a compound of formula (I), are adjacently situated on the phenyl ring substituted by n moieties R.sub.1, wherein n is at least 2.

    [0150] In a compound of formula (I), n is an integer ranging from 1 to 5. In some embodiments, n is an integer ranging from 1 to 4. In some embodiments, n is an integer ranging from 1 to 3. In some embodiments, n is 1 or 2. In some embodiments, n is 1. In some further embodiments, n is an integer ranging from 2 to 5, e.g. from 3 to 5, or from 4 to 5. In still other embodiments, n is an integer ranging from 2 to 4. In still other embodiments, n is 2 or 3. In still other embodiments, n is 3 or 4. In some embodiments, n is 2. In some embodiments, n is 3. In some embodiments, n is 4. In some embodiments, n is 5.

    [0151] In a compound of formula (I), each R.sub.1 is independently selected from C1-C6 alkyl, C3-C6 carbocyclyl, C3-C6 carbocyclyl-C1-C3 alkyl, C1-C6 alkoxy, C1-C6 alkoxy-C1-C3 alkyl, C3-C6 carbocyclyloxy, C3-C6 carbocyclyloxy-C1-C3 alkyl, 4- to 6-membered heterocyclyl, 4- to 6-membered heterocyclyl-C1-C3 alkyl, hydroxy, hydroxy-C1-C3 alkyl, carboxy, carboxy-C1-C3 alkyl, C1-C6 alkoxycarbonyl, C1-C6 alkoxycarbonyl-C1-C3 alkyl, and halogen; and when n is at least 2, two R.sub.1 attached to adjacent atoms of the phenyl ring, together with the atoms to which they are attached, may form a 4- to 6-membered non-aromatic ring optionally containing one or more heteroatoms and optionally substituted with one or more moieties independently selected from C1-C3 alkyl and halogen.

    [0152] In some embodiments, each R.sub.1 is independently selected from C1-C6 alkyl, C3-C6 carbocyclyl, C3-C6 carbocyclyl-C1-C3 alkyl, C1-C6 alkoxy, C1-C6 alkoxy-C1-C3 alkyl, C3-C6 carbocyclyloxy, C3-C6 carbocyclyloxy-C1-C3 alkyl, 4- to 6-membered heterocyclyl, 4- to 6-membered heterocyclyl-C1-C3 alkyl, hydroxy, hydroxy-C1-C3 alkyl, carboxy, carboxy-C1-C3 alkyl, C1-C6 alkoxycarbonyl, C1-C6 alkoxycarbonyl-C1-C3 alkyl, and halogen.

    [0153] In some embodiments, each R.sub.1 is independently selected from C1-C6 alkyl, C3-C6 carbocyclyl, C3-C6 carbocyclyl-C1-C3 alkyl, C1-C6 alkoxy, C1-C6 alkoxy-C1-C3 alkyl, C3-C6 carbocyclyloxy, C3-C6 carbocyclyloxy-C1-C3 alkyl, 4- to 6-membered heterocyclyl, 4- to 6-membered heterocyclyl-C1-C3 alkyl, hydroxy, hydroxy-C1-C3 alkyl, carboxy, carboxy-C1-C3 alkyl, and halogen; and when n is at least 2, two R.sub.1 attached to adjacent atoms of the phenyl ring, together with the atoms to which they are attached, may form a 4- to 6-membered non-aromatic ring optionally containing one or more heteroatoms and optionally substituted with one or more moieties independently selected from C1-C3 alkyl and halogen.

    [0154] In some embodiments, each R.sub.1 is independently selected from C1-C6 alkyl, C3-C6 carbocyclyl, C1-C6 alkoxy, 4- to 6-membered heterocyclyl, hydroxy, carboxy, and halogen; and when n is at least 2, two R.sub.1 attached to adjacent atoms of the phenyl ring, together with the atoms to which they are attached, may form a 4- to 6-membered non-aromatic ring optionally containing one or more heteroatoms and optionally substituted with one or more moieties independently selected from C1-C3 alkyl and halogen.

    [0155] In some embodiments, each R.sub.1 is independently selected from C1-C6 alkyl, C3-C6 carbocyclyl, C3-C6 carbocyclyl-C1-C3 alkyl, C1-C6 alkoxy, C1-C6 alkoxy-C1-C3 alkyl, C3-C6 carbocyclyloxy, C3-C6 carbocyclyloxy-C1-C3 alkyl, 4- to 6-membered heterocyclyl, 4- to 6-membered heterocyclyl-C1-C3 alkyl, hydroxy, hydroxy-C1-C3 alkyl, and halogen; and when n is at least 2, two R.sub.1 attached to adjacent atoms of the phenyl ring, together with the atoms to which they are attached, may form a 4- to 6-membered non-aromatic ring optionally containing one or more heteroatoms and optionally substituted with one or more moieties independently selected from C1-C3 alkyl and halogen.

    [0156] In some embodiments, each R.sub.1 is independently selected from C1-C6 alkyl, C3-C6 carbocyclyl, C3-C6 carbocyclyl-C1-C3 alkyl, C1-C6 alkoxy, C1-C6 alkoxy-C1-C3 alkyl, C3-C6 carbocyclyloxy, C3-C6 carbocyclyloxy-C1-C3 alkyl, 4- to 6-membered heterocyclyl, 4- to 6-membered heterocyclyl-C1-C3 alkyl, and halogen; and when n is at least 2, two R.sub.1 attached to adjacent phenyl ring atoms, together with the atoms to which they are attached, may form a 4- to 6-membered non-aromatic ring optionally containing one or more heteroatoms and optionally substituted with one or more moieties selected from C1-C3 alkyl and halogen.

    [0157] In some embodiments, each R.sub.1 is independently selected from C1-C6 alkyl, C3-C6 carbocyclyl, C3-C6 carbocyclyl-C1-C3 alkyl, C1-C6 alkoxy, C1-C6 alkoxy-C1-C3 alkyl, C3-C6 carbocyclyloxy, C3-C6 carbocyclyloxy-C1-C3 alkyl, 4- to 6-membered heterocyclyl, 4- to 6-membered heterocyclyl-C1-C3 alkyl, and halogen.

    [0158] In some embodiments, each R.sub.1 is independently selected from C1-C6 alkyl, C3-C6 carbocyclyl, C3-C6 carbocyclyl-C1-C3 alkyl, 4- to 6-membered heterocyclyl, 4- to 6-membered heterocyclyl-C1-C3 alkyl, and halogen; and when n is at least 2, two R.sub.1 attached to adjacent atoms of the phenyl ring, together with the atoms to which they are attached, may form a 4- to 6-membered non-aromatic ring optionally containing one or more heteroatoms and optionally substituted with one or more moieties selected from C1-C3 alkyl and halogen.

    [0159] In some other embodiments, each R.sub.1 is independently selected from C1-C6 alkyl, C3-C6 carbocyclyl, C1-C6 alkoxy, C3-C6 carbocyclyloxy, 4- to 6-membered heterocyclyl, and halogen; and when n is at least 2, two R.sub.1 attached to adjacent atoms of the phenyl ring, together with the atoms to which they are attached, may form a 4- to 6-membered non-aromatic ring optionally containing one or more heteroatoms and optionally substituted with one or more moieties selected from C1-C3 alkyl and halogen.

    [0160] In some embodiments, each R.sub.1 is independently selected from C1-C6 alkyl, C1-C6 alkoxy, C1-C6 alkoxy-C1-C3 alkyl, 4- to 6-membered heterocyclyl, 4- to 6-membered heterocyclyl-C1-C3 alkyl, and halogen; and when n is at least 2, two R.sub.1 attached to adjacent atoms of the phenyl ring, together with the atoms to which they are attached, may form a 4- to 6-membered non-aromatic ring optionally containing one or more heteroatoms and optionally substituted with one or more moieties selected from C1-C3 alkyl and halogen.

    [0161] In some embodiments, each R.sub.1 is independently selected from C1-C6 alkyl, C3-C6 carbocyclyl, C3-C6 carbocyclyl-C1-C3 alkyl, and halogen; and when n is at least 2, two R.sub.1 attached to adjacent atoms of the phenyl ring, together with the atoms to which they are attached, may form a 4- to 6-membered non-aromatic ring optionally containing one or more heteroatoms and optionally substituted with one or more moieties selected from C1-C3 alkyl and halogen.

    [0162] In some other embodiments, each R.sub.1 is independently selected from C1-C6 alkyl, C3-C6 carbocyclyl, 4- to 6-membered heterocyclyl, and halogen; and when n is at least 2, two R.sub.1 attached to adjacent atoms of the phenyl ring, together with the atoms to which they are attached, may form a 4- to 6-membered non-aromatic ring optionally containing one or more heteroatoms and optionally substituted with one or more moieties selected from C1-C3 alkyl and halogen.

    [0163] In some embodiments, each R.sub.1 is independently selected from C1-C6 alkyl, C3-C6 carbocyclyl, C3-C6 carbocyclyl-C1-C3 alkyl, C1-C6 alkoxy, C1-C6 alkoxy-C1-C3 alkyl, C3-C6 carbocyclyloxy, C3-C6 carbocyclyloxy-C1-C3 alkyl, and halogen.

    [0164] In some embodiments, each R.sub.1 is independently selected from C1-C6 alkyl, 4- to 6-membered heterocyclyl, 4- to 6-membered heterocyclyl-C1-C3 alkyl, and halogen; and when n is at least 2, two R.sub.1 attached to adjacent atoms of the phenyl ring, together with the atoms to which they are attached, may form a 4- to 6-membered non-aromatic ring optionally containing one or more heteroatoms and optionally substituted with one or more moieties selected from C1-C3 alkyl and halogen.

    [0165] In some embodiments, each R.sub.1 is independently selected from C1-C6 alkyl, C3-C6 carbocyclyl, and halogen; and when n is at least 2, two R.sub.1 attached to adjacent atoms of the phenyl ring, together with the atoms to which they are attached, may form a 4- to 6-membered non-aromatic ring optionally containing one or more heteroatoms and optionally substituted with one or more moieties selected from C1-C3 alkyl and halogen.

    [0166] In some other embodiments, each R.sub.1 is independently selected from C1-C6 alkyl, C3-C6 carbocyclyl, 4- to 6-membered heterocyclyl, and halogen.

    [0167] In some embodiments, each R.sub.1 is independently selected from C1-C6 alkyl, C3-C6 carbocyclyl, C3-C6 carbocyclyl-C1-C3 alkyl, and halogen.

    [0168] In some embodiments, each R.sub.1 is independently selected from C1-C6 alkyl, 4- to 6-membered heterocyclyl, and halogen; and when n is at least 2, two R.sub.1 attached to adjacent atoms of the phenyl ring, together with the atoms to which they are attached, may form a 4- to 6-membered non-aromatic ring optionally containing one or more heteroatoms and optionally substituted with one or more moieties selected from C1-C3 alkyl and halogen.

    [0169] In some embodiments, each R.sub.1 is independently selected from C1-C6 alkyl, and halogen; and when n is at least 2, two R.sub.1 attached to adjacent atoms of the phenyl ring, together with the atoms to which they are attached, may form a 4- to 6-membered non-aromatic ring optionally containing one or more heteroatoms and optionally substituted with one or more moieties selected from C1-C3 alkyl and halogen.

    [0170] In some embodiments, each R.sub.1 is independently selected from C1-C6 alkyl, 4- to 6-membered heterocyclyl, and halogen. In some embodiments, each R.sub.1 is independently selected from C1-C6 alkyl, C3-C6 carbocyclyl, and halogen. In some embodiments, each R.sub.1 is independently selected from C1-C6 alkyl, and halogen. In some embodiments, each R.sub.1 is independently selected from C1-C6 alkyl and C3-C6 carbocyclyl. In some embodiments, each R.sub.1 is independently selected from halogen.

    [0171] In some further embodiments, each R.sub.1 is independently selected from C1-C6 alkyl, C3-C6 carbocyclyl, C3-C6 carbocyclyl-C1-C3 alkyl, C1-C6 alkoxy, C1-C6 alkoxy-C1-C3 alkyl, hydroxy, hydroxy-C1-C3 alkyl, carboxy, carboxy-C1-C3 alkyl, and halogen; and when n is at least 2, two R.sub.1 attached to adjacent atoms of the phenyl ring, together with the atoms to which they are attached, may form a 4- to 6-membered non-aromatic ring optionally containing one or more heteroatoms and optionally substituted with one or more moieties independently selected from C1-C3 alkyl and halogen.

    [0172] In some further embodiments, each R.sub.1 is independently selected from C1-C6 alkyl, C3-C6 carbocyclyl, C3-C6 carbocyclyl-C1-C3 alkyl, C1-C6 alkoxy, C1-C6 alkoxy-C1-C3 alkyl, hydroxy, hydroxy-C1-C3 alkyl, and halogen; and when n is at least 2, two R.sub.1 attached to adjacent atoms of the phenyl ring, together with the atoms to which they are attached, may form a 4- to 6-membered non-aromatic ring optionally containing one or more heteroatoms and optionally substituted with one or more moieties independently selected from C1-C3 alkyl and halogen.

    [0173] In some further embodiments, each R.sub.1 is independently selected from C1-C6 alkyl, C3-C6 carbocyclyl, C1-C6 alkoxy, hydroxy, carboxy, and halogen; and when n is at least 2, two R.sub.1 attached to adjacent atoms of the phenyl ring, together with the atoms to which they are attached, may form a 4- to 6-membered non-aromatic ring optionally containing one or more heteroatoms and optionally substituted with one or more moieties independently selected from C1-C3 alkyl and halogen.

    [0174] In some further embodiments, each R.sub.1 is independently selected from C1-C6 alkyl, C3-C6 carbocyclyl, C1-C6 alkoxy, hydroxy, and halogen; and when n is at least 2, two R.sub.1 attached to adjacent atoms of the phenyl ring, together with the atoms to which they are attached, may form a 4- to 6-membered non-aromatic ring optionally containing one or more heteroatoms and optionally substituted with one or more moieties independently selected from C1-C3 alkyl and halogen.

    [0175] In some further embodiments, each R.sub.1 is independently selected from C1-C6 alkyl, C3-C6 carbocyclyl, C3-C6 carbocyclyl-C1-C3 alkyl, hydroxy, hydroxy-C1-C3 alkyl, carboxy, carboxy-C1-C3 alkyl, and halogen; and when n is at least 2, two R.sub.1 attached to adjacent atoms of the phenyl ring, together with the atoms to which they are attached, may form a 4- to 6-membered non-aromatic ring optionally containing one or more heteroatoms and optionally substituted with one or more moieties independently selected from C1-C3 alkyl and halogen.

    [0176] In some further embodiments, each R.sub.1 is independently selected from C1-C6 alkyl, C3-C6 carbocyclyl, hydroxy, and halogen; and when n is at least 2, two R.sub.1 attached to adjacent atoms of the phenyl ring, together with the atoms to which they are attached, may form a 4- to 6-membered non-aromatic ring optionally containing one or more heteroatoms and optionally substituted with one or more moieties independently selected from C1-C3 alkyl and halogen.

    [0177] In some further embodiments, each R.sub.1 is independently selected from C1-C6 alkyl, C3-C6 carbocyclyl, C3-C6 carbocyclyl-C1-C3 alkyl, C1-C6 alkoxy, C1-C6 alkoxy-C1-C3 alkyl, and halogen; and when n is at least 2, two R.sub.1 attached to adjacent atoms of the phenyl ring, together with the atoms to which they are attached, may form a 4- to 6-membered non-aromatic ring optionally containing one or more heteroatoms and optionally substituted with one or more moieties independently selected from C1-C3 alkyl and halogen.

    [0178] In some further embodiments, each R.sub.1 is independently selected from C1-C6 alkyl, C3-C6 carbocyclyl, C1-C6 alkoxy, and halogen; and when n is at least 2, two R.sub.1 attached to adjacent atoms of the phenyl ring, together with the atoms to which they are attached, may form a 4- to 6-membered non-aromatic ring optionally containing one or more heteroatoms and optionally substituted with one or more moieties independently selected from C1-C3 alkyl and halogen.

    [0179] In some further embodiments, each R.sub.1 is independently selected from C1-C6 alkyl, C3-C6 carbocyclyl, C3-C6 carbocyclyl-C1-C3 alkyl, C1-C6 alkoxy, C1-C6 alkoxy-C1-C3 alkyl, hydroxy, hydroxy-C1-C3 alkyl, carboxy, carboxy-C1-C3 alkyl, and halogen; e.g. from C1-C6 alkyl, C3-C6 carbocyclyl, C3-C6 carbocyclyl-C1-C3 alkyl, C1-C6 alkoxy, C1-C6 alkoxy-C1-C3 alkyl, hydroxy, hydroxy-C1-C3 alkyl, and halogen.

    [0180] In some further embodiments, each R.sub.1 is independently selected from C1-C6 alkyl, C3-C6 carbocyclyl, C1-C6 alkoxy, hydroxy, carboxy, and halogen; e.g. from C1-C6 alkyl, C3-C6 carbocyclyl, C1-C6 alkoxy, hydroxy, and halogen.

    [0181] In some further embodiments, each R.sub.1 is independently selected from C1-C6 alkyl, C3-C6 carbocyclyl, C3-C6 carbocyclyl-C1-C3 alkyl, hydroxy, hydroxy-C1-C3 alkyl, carboxy, carboxy-C1-C3 alkyl, and halogen.

    [0182] In some further embodiments, each R.sub.1 is independently selected from C1-C6 alkyl, C3-C6 carbocyclyl, hydroxy, and halogen.

    [0183] In some further embodiments, each R.sub.1 is independently selected from C1-C6 alkyl, C3-C6 carbocyclyl, C3-C6 carbocyclyl-C1-C3 alkyl, C1-C6 alkoxy, C1-C6 alkoxy-C1-C3 alkyl, and halogen.

    [0184] In some further embodiments, each R.sub.1 is independently selected from C1-C6 alkyl, C3-C6 carbocyclyl, C1-C6 alkoxy, and halogen.

    [0185] In some embodiments, each R.sub.1 is independently selected from halogen and hydroxy.

    [0186] In some further embodiments, at least one R.sub.1 is selected from halogen.

    [0187] When R.sub.1 is C1-C6 alkyl, R.sub.1 more particularly may be C1-C4 alkyl, or C1-C3 alkyl. In some embodiments, when R.sub.1 is C1-C6 alkyl, R.sub.1 more particularly is methyl or isopropyl. In some embodiments, when R.sub.1 is C1-C6 alkyl, R.sub.1 more particularly is methyl.

    [0188] When R.sub.1 is C3-C6 carbocyclyl, R.sub.1 more particularly may be C3-C5 carbocyclyl. In some embodiments, when R.sub.1 is C3-C6 carbocyclyl, R.sub.1 more particularly is cyclopropyl.

    [0189] When R.sub.1 is C3-C6 carbocyclyl-C1-C3 alkyl, R.sub.1 more particularly may be C3-C5 carbocyclyl-C1-C3 alkyl, e.g. cyclopropyl-C1-C3 alkyl, or cyclopropyl-C1-C2 alkyl, such as cyclopropylmethyl. In some embodiments, when R.sub.1 is C3-C6 carbocyclyl-C1-C3 alkyl, R.sub.1 more particularly is C3-C6 carbocyclyl-C1-C2 alkyl, e.g. R.sub.1 is C3-C6 carbocyclylmethyl, or C3-C5 carbocyclylmethyl.

    [0190] In some embodiments, when any R.sub.1 is a carbocyclyl or comprises a carbocyclyl (as in C3-C6 carbocyclyl-C1-C3 alkyl), the carbocyclyl is non-aromatic. In some embodiments, when any R.sub.1 is a carbocyclyl or comprises a carbocyclyl, the carbocyclyl is non-aromatic and saturated.

    [0191] When R.sub.1 is C1-C6 alkoxy, R.sub.1 more particularly may be C1-C4 alkoxy, or C1-C3 alkoxy. In some embodiments, when R.sub.1 is C1-C6 alkoxy, R.sub.1 more particularly is methoxy.

    [0192] When R.sub.1 is C1-C6 alkoxy-C1-C3 alkyl, R.sub.1 more particularly may be C1-C3 alkoxy-C1-C3 alkyl, e.g. methoxy-C1-C3 alkyl, or methoxy-C1-C2 alkyl, such as methoxymethyl. In some embodiments, when R.sub.1 is C1-C6 alkoxy-C1-C3 alkyl, R.sub.1 more particularly is C1-C3 alkoxymethyl.

    [0193] When R.sub.1 is C3-C6 carbocyclyloxy, R.sub.1 more particularly may be C3-C5 carbocyclyloxy, e.g. cyclopropyloxy.

    [0194] When R.sub.1 is C3-C6 carbocyclyloxy-C1-C3 alkyl, R.sub.1 more particularly may be C3-C5 carbocyclyloxy-C1-C3 alkyl, e.g. cyclopropyloxy-C1-C3 alkyl, or cyclopropyloxy-C1-C2 alkyl, such as cyclopropyloxymethyl. In some embodiments, when R.sub.1 is C3-C6 carbocyclyloxy-C1-C3 alkyl, R.sub.1 more particularly is C3-C6 carbocyclyloxy-C1-C2 alkyl, e.g. R.sub.1 is C3-C6 carbocyclyloxymethyl, or C3-C5 carbocyclyloxymethyl.

    [0195] In some embodiments, when R.sub.1 is a carbocyclyl or comprises a carbocyclyl moiety, such carbocyclyl is not phenyl.

    [0196] When R.sub.1 is 4- to 6-membered heterocyclyl or 4- to 6-membered heterocyclyl-C1-C3 alkyl, the 4-6 membered heterocylyl e.g. may be a 5- or 6-membered heterocyclyl. Any such heterocyclyl may contain one or more heteroatoms, e.g. 1, 2, 3 or 4 heteroatoms, or 1-3 heteroatoms, e.g. 1 or 2 heteroatoms, or 1 heteroatom, selected from N, O and S.

    [0197] In some embodiments, when R.sub.1 is 4- to 6-membered heterocyclyl or 4- to 6-membered heterocyclyl-C1-C3 alkyl, such heterocyclyl is non-aromatic. In some embodiments, when R.sub.1 is 5- or 6-membered heterocyclyl or 5- or 6-membered heterocyclyl-C1-C3 alkyl, such heterocyclyl is (hetero)aromatic, i.e. 5- or 6-membered heteroaryl. In some embodiments, when R.sub.1 is 4- to 6-membered heterocyclyl or 4- to 6-membered heterocyclyl-C1-C3 alkyl, the heterocyclyl is 5- or 6-membered, in particular 5- or 6-membered heteroaryl, and contains one or more heteroatoms, e.g. 1, 2 or 3 heteroatoms, or 1 or 2 heteroatoms, e.g. 1 heteroaom. In some of these embodiments, any such heteroatom is nitrogen (N). In some embodiments, when R.sub.1 is 4- to 6-membered heterocyclyl or 4- to 6-membered heterocyclyl-C1-C3 alkyl, the heterocyclyl is pyridinyl, e.g. 3-pyridinyl.

    [0198] In some other embodiments, any 4-6-membered heterocyclyl may be selected from azetidinyl, pyrrolidinyl, tetrahydrofuryl, tetrahydrothienyl, pyrrolyl, furyl, thienyl, imidazolidinyl, pyrazolidinyl, oxazolidinyl, isoxazolidinyl, thiazolidinyl, isothiazolidinyl, dioxolyl, dithiolyl, imidazolyl, pyrazolyl, oxazolyl, isoxazolyl, thiazolyl, isothiazolyl, triazolyl, furazolyl, oxadiazolyl, thiadiazolyl, dithiazolyl, tetrazolyl, piperidinyl, tetrahydropyranyl, thianyl, pyridinyl, piperazinyl, morpholinyl, thiomorpholinyl, dioxanyl, diazinyl, oxazinyl, thiazinyl, and triazinyl.

    [0199] When R.sub.1 is halogen, such halogen e.g. may be selected from F, Cl and Br. In some embodiments, any such halogen is selected from Cl and Br.

    [0200] When R.sub.1 is hydroxy-C1-C3 alkyl, R.sub.1 more particularly may be hydroxy-C1-C2 alkyl, such as hydroxymethyl.

    [0201] When R.sub.1 is carboxy-C1-C3 alkyl, R.sub.1 more particularly may be carboxy-C1-C2 alkyl, such as carboxyymethyl.

    [0202] When R.sub.1 is C1-C6 alkoxycarbonyl, R.sub.1 more particularly may be C1-C3 alkoxycarbonyl, e.g.

    [0203] C1-C2 alkoxycarbonyl, such as methoxycarbonyl.

    [0204] When R.sub.1 is C1-C6 alkoxycarbonyl-C1-C3 alkyl, R.sub.1 more particularly may be C1-C3 alkoxycarbonyl-C1-C3 alkyl, e.g. C1-C2 alkoxycarbonyl-C1-C3 alkyl, such as methoxycarbonyl-C1-C3 alkyl. Even more particularly, R.sub.1 more particularly may be C1-C3 alkoxycarbonyl-C1-C2 alkyl, e.g. C1-C2 alkoxycarbonyl-C1-C2 alkyl, such as methoxycarbonyl-C1-C2 alkyl; in particular R.sub.1 more may be C1-C3 alkoxycarbonylmethyl, e.g. C1-C2 alkoxycarbonylmethyl, such as methoxycarbonylmethyl.

    [0205] When the compound of formula (I) comprises two R.sub.1 attached to adjacent atoms of the phenyl ring, such R.sub.1, together with the phenyl ring atoms to which they are attached, may form a 4- to 6-membered non-aromatic ring optionally containing one or more heteroatoms and optionally substituted with one or more moieties independently selected from C1-C3 alkyl and halogen. In some embodiments, the ring is 5- or 6-membered. In some embodiments, the ring is 5-membered. In some embodiments, the ring is 5- or 6-membered and optionally contains one or more heteroatoms selected from N, O and S. When such ring contains one or more heteroatoms, it e.g. may contain 1-3 heteroatoms, e.g. 1 or 2 heteroatoms, or 1 heteroatom.

    [0206] When two R.sub.1 attached to adjacent atoms of the phenyl ring, together with the atoms to which they are attached, form a 4- to 6-membered non-aromatic ring optionally containing one or more heteroatoms, such ring is optionally substituted with one or more moieties independently selected from C1-C3 alkyl and halogen, e.g. 1-4 moieties, or 1-3 moieties, e.g. 1 or 2 moieties, independently selected from C1-C3 alkyl and halogen. In some embodiments, any such moiety is independently selected from methyl, ethyl, isopropyl, F, Cl, and Br, e.g. from methyl, F, Cl, and Br, or from methyl, F and Cl. In some embodiments, any such moiety is selected from C1-C3 alkyl, e.g. methyl.

    [0207] In some other particular embodiments, each R.sub.1 is independently selected from methyl, isopropyl, trifluoromethyl, cyclopropyl, Cl, Br, pyridinyl, hydroxy and carboxy. In some further particular embodiments, each R.sub.1 is independently selected from methyl, isopropyl, trifluoromethyl, cyclopropyl, Cl, Br, hydroxy and carboxy; e.g. from methyl, isopropyl, trifluoromethyl, cyclopropyl, Br, hydroxy and carboxy; in particular from methyl, isopropyl, cyclopropyl, Br, hydroxy and carboxy, e.g. from isopropyl, cyclopropyl, Br, hydroxy and carboxy.

    [0208] In some other particular embodiments, each R.sub.1 is independently selected from methyl, isopropyl, trifluoromethyl, cyclopropyl, Cl, Br, pyridinyl, and hydroxy. In some further particular embodiments, each R.sub.1 is independently selected from methyl, isopropyl, trifluoromethyl, cyclopropyl, Cl, Br, hydroxy and carboxy; e.g. from methyl, isopropyl, trifluoromethyl, cyclopropyl, Br, and hydroxy; in particular from methyl, isopropyl, cyclopropyl, Br, and hydroxy, e.g. from isopropyl, cyclopropyl, Br, and hydroxy.

    [0209] In some other particular embodiments, each R.sub.1 is independently selected from methyl, isopropyl, trifluoromethyl, cyclopropyl, Cl, Br, and pyridinyl. In some further particular embodiments, each R.sub.1 is independently selected from methyl, isopropyl, trifluoromethyl, cyclopropyl, Cl and Br; e.g. from methyl, isopropyl, trifluoromethyl, cyclopropyl, and Br; in particular from methyl, isopropyl, cyclopropyl, and Br, e.g. from isopropyl, cyclopropyl, and Br.

    [0210] In a compound of formula (I), R.sub.2 is selected from C1-C6 alkyl, C3-C6 carbocyclyl, C3-C6 carbocyclyl-C1-C3 alkyl, C1-C6 alkoxy, C1-C6 alkoxy-C1-C3 alkyl, C3-C6 carbocyclyloxy, C3-C6 carbocyclyloxy-C1-C3 alkyl, halogen, hydroxy, and hydroxy-C1-C3 alkyl. In some embodiments, R.sub.2 is selected from C1-C6 alkyl, C3-C6 carbocyclyl, C1-C6 alkoxy, C3-C6 carbocyclyloxy, halogen, and hydroxy.

    [0211] In some embodiments, R.sub.2 is selected from C1-C6 alkyl, C1-C6 alkoxy, C1-C6 alkoxy-C1-C3 alkyl, halogen, hydroxy, and hydroxy-C1-C3 alkyl.

    [0212] In some embodiments, R.sub.2 is selected from C1-C6 alkyl, C3-C6 carbocyclyl, C3-C6 carbocyclyl-C1-C3 alkyl, halogen, hydroxy, and hydroxy-C1-C3 alkyl.

    [0213] In some embodiments, R.sub.2 is selected from C1-C6 alkyl, C1-C6 alkoxy, halogen, and hydroxy.

    [0214] In some embodiments, R.sub.2 is selected from C1-C6 alkyl, halogen, and hydroxy. In some embodiments, R.sub.2 is selected from C1-C6 alkyl, and hydroxy. In still further embodiments, R.sub.2 is selected from C1-C6 alkyl, and halogen. In some embodiments, R.sub.2 is selected from C1-C6 alkyl.

    [0215] In some embodiments, R.sub.2 is selected from C1-C6 alkyl, halogen, hydroxy, and hydroxy-C1-C3 alkyl. In some embodiments, R.sub.2 is selected from halogen, hydroxy, and hydroxy-C1-C3 alkyl. In some embodiments, R.sub.2 is selected from halogen and hydroxy. In some embodiments, R.sub.2 is selected from halogen. In some embodiments, R.sub.2 is selected from hydroxy and hydroxy-C1-C3 alkyl, e.g. R.sub.2 is hydroxy.

    [0216] When R.sub.2 is C1-C6 alkyl, R.sub.2 more particularly may be C1-C4 alkyl, in particular C1-C3 alkyl. In some embodiments, when R.sub.2 is C1-C6 alkyl, R.sub.2 more particularly is methyl.

    [0217] When R.sub.2 is C3-C6 carbocyclyl, R.sub.2 more particularly may be C3-C5 carbocyclyl. In some embodiments, when R.sub.2 is C3-C6 carbocyclyl, R.sub.2 more particularly is cyclopropyl.

    [0218] When R.sub.2 is C3-C6 carbocyclyl-C1-C3 alkyl, R.sub.2 more particularly may be C3-C5 carbocyclyl-C1-C3 alkyl, e.g. cyclopropyl-C1-C3 alkyl, or cyclopropyl-C1-C2 alkyl, such as cyclopropylmethyl. In some embodiments, when R.sub.2 is C3-C6 carbocyclyl-C1-C3 alkyl, R.sub.2 more particularly is C3-C6 carbocyclyl-C1-C2 alkyl, e.g. R.sub.2 is C3-C6 carbocyclylmethyl, or C3-C5 carbocyclylmethyl.

    [0219] In some embodiments, when any R.sub.2 is a carbocyclyl or comprises a carbocyclyl (as in C3-C6 carbocyclyl-C1-C3 alkyl), the carbocyclyl is non-aromatic. In some embodiments, when any R.sub.2 is a carbocyclyl or comprises a carbocyclyl, the carbocyclyl is non-aromatic and saturated, i.e. cycloalkyl. In some embodiments, when R.sub.2 is a carbocyclyl or comprises a carbocyclyl moiety, such carbocyclyl is not phenyl.

    [0220] When R.sub.2 is C1-C6 alkoxy, R.sub.2 more particularly may be C1-C4 alkoxy, or C1-C3 alkoxy. In some embodiments, when R.sub.2 is C1-C6 alkoxy, R.sub.2 more particularly is methoxy.

    [0221] When R.sub.2 is C1-C6 alkoxy-C1-C3 alkyl, R.sub.2 more particularly may be C1-C3 alkoxy-C1-C3 alkyl, e.g. methoxy-C1-C3 alkyl, or methoxy-C1-C2 alkyl, such as methoxymethyl. In some embodiments, when R.sub.2 is C1-C6 alkoxy-C1-C3 alkyl, R.sub.2 more particularly is C1-C3 alkoxymethyl.

    [0222] When R.sub.2 is C3-C6 carbocyclyloxy, R.sub.2 more particularly may be C3-C5 carbocyclyloxy, e.g. cyclopropyloxy.

    [0223] When R.sub.2 is C3-C6 carbocyclyloxy-C1-C3 alkyl, R.sub.2 more particularly may be C3-C5 carbocyclyloxy-C1-C3 alkyl, e.g. cyclopropyloxy-C1-C3 alkyl, or cyclopropyloxy-C1-C2 alkyl, such as cyclopropyloxymethyl. In some embodiments, when R.sub.2 is C3-C6 carbocyclyloxy-C1-C3 alkyl, R.sub.2 more particularly is C3-C6 carbocyclyloxy-C1-C2 alkyl, e.g. R.sub.2 is C3-C6 carbocyclyloxymethyl, or C3-C5 carbocyclyloxymethyl.

    [0224] When R.sub.2 is halogen, such halogen e.g. may be selected from F, Cl and Br. In some embodiments, any such halogen is selected from Cl and Br. In some other embodiments, any such halogen is selected from F and Cl. In still other embodiments, when R.sub.2 is halogen, it more particularly is F. In still other embodiments, when R.sub.2 is halogen, it more particularly is Cl. In still other embodiments, when R.sub.2 is halogen, it more particularly is Br.

    [0225] When R.sub.2 is hydroxy-C1-C3 alkyl, R.sub.2 in particular may be hydroxy-C1-C2 alkyl, e.g. R.sub.2 may be hydroxymethyl.

    [0226] For the avoidance of doubt, it is pointed out that in any of the above mentioned embodiments, any alkyl (whether in R.sub.1 or R.sub.2) is optionally substituted with one or more, e.g. 1-3, halogens, e.g. selected one or more halogens independently selected from F, Cl and Br, or from F and Cl, in particular from F, unless otherwise specified. In some embodiments, no such halogen is present as optional substituent.

    [0227] Furthermore, in any of the above mentioned embodiments, any carbocyclyl or heterocyclyl is optionally substituted with one or more, e.g. 1-3, moieties selected from halogen and C1-C3 alkyl. In some embodiments, any such moiety is selected from halogen and methyl, e.g. from F, Cl, Br and methyl, or from F, Cl and methyl, or from F and methyl. In some embodiments, any such moiety is selected from C1-C3 alkyl, e.g. methyl. In other embodiments, any such moiety is selected from halogen, e.g. from F, Cl and Br, or from F and Cl, in particular from F. In some embodiments, no such optional substituent is present on any carbocyclyl or heterocyclyl.

    [0228] In a compound of formula (I) each one of R.sub.3, R.sub.4, R.sub.5, and R.sub.6 is independently selected from H and F. In some embodiments, at least two of R.sub.3, R.sub.4, R.sub.5, and R.sub.6 are H. In some embodiments, at least three of R.sub.3, R.sub.4, R.sub.5, and R.sub.6 are H. In some embodiments, R.sub.3 and R.sub.4 are H. In some embodiments, R.sub.3, R.sub.4, and R.sub.5 are H. In some embodiments, R.sub.3, R.sub.4, R.sub.5, and R.sub.6 are all H. In some particular embodiments, R.sub.3 and R.sub.4 are H, and R.sub.5 and R.sub.6 are F. In some other particular embodiments, R.sub.3, R.sub.4, and R.sub.5 are H, and R.sub.6 is F. In still other embodiments, at least one of R.sub.3, R.sub.4, R.sub.5, and R.sub.6 is F; e.g. at least one of R.sub.5 and R.sub.6 is F. In still further embodiments, R.sub.3 and R.sub.4 are H; and R.sub.5 and R.sub.6 are selected from H and F.

    [0229] In some embodiments, the compound of formula (I) more particularly is a compound of formula (Ia)

    ##STR00007##

    [0230] wherein

    [0231] m is 0 or 1;

    [0232] n is an integer of from 2 to 5; e.g. n is 2, 3 or 4; or n is 2 or 3;

    [0233] each R.sub.1, R.sub.2, R.sub.3, R.sub.4, R.sub.5, and R.sub.6 are as defined herein; and each R.sub.1a is independently selected from C1-C6 alkyl, C1-C6 alkoxy, C1-C6 alkoxy-C1-C3 alkyl, halogen, hydroxy, hydroxy-C1-C3 alkyl, carboxy, and carboxy-C1-C3 alkyl, wherein any alkyl is optionally substituted by one or more halogens, e.g. one or more F.

    [0234] In some embodiments of a compound of formula (Ia), m is 0. In some other embodiments of a compound of formula (Ia), m is 1.

    [0235] In some embodiments of a compound of formula (Ia), n is 2. In some other embodiments of a compound of formula (Ia), n is 3.

    [0236] In some embodiments, the compound of formula (Ia) more particularly is a compound of formula (Ib)

    ##STR00008##

    [0237] wherein k is 0 or 1; m is 0 or 1; n is an integer of from 3 to 5; and each R.sub.1a, R.sub.1, R.sub.2, R.sub.3, R.sub.4, R.sub.5, and R.sub.6 are as defined herein.

    [0238] In some embodiments of a compound of formula (Ib), n is 3 or 4.

    [0239] In some embodiments of a compound of formula (Ib), n is 4. In some of the embodiments where n is 4, k is 1 and m is 1. In some other embodiments of a compound of formula (Ib), n is 3, i.e. the compound may be represented by formula (Ic)

    ##STR00009##

    [0240] wherein k, m, each R.sub.1a, R.sub.1, R.sub.2, R.sub.3, R.sub.4, R.sub.5, and R.sub.6 are as defined herein.

    [0241] In some other particular embodiments, k is 0 and m is 1, i.e. the compound of formula (Ic) is as represented by formula (Id)

    ##STR00010##

    [0242] wherein each R.sub.1a, R.sub.2, R.sub.3, R.sub.4, R.sub.5, and R.sub.6 are as defined herein.

    [0243] In some further particular embodiments of a compound of formula (Ic), k and m are both 0, i.e. the compound of formula (Ic) is as represented by formula (Ie)

    ##STR00011##

    [0244] wherein R.sub.1a, R.sub.2, R.sub.3, R.sub.4, R.sub.5, and R.sub.6 are as defined herein.

    [0245] In some further particular embodiments of a compound of formula (Ic), k and m are both 1, i.e. the compound of formula (Ic) is as represented by formula (If),

    ##STR00012##

    [0246] wherein each R.sub.1a, R.sub.1, R.sub.2, R.sub.3, R.sub.4, R.sub.5, and R.sub.6 are as defined herein.

    [0247] In some further particular embodiments of a compound of formula (Ic), k is 1 and m is 0, i.e. the compound of formula (Ic) is as represented by formula (Ig),

    ##STR00013##

    [0248] wherein each R.sub.1, R.sub.1a, R.sub.2, R.sub.3, R.sub.4, R.sub.5, and R.sub.6 are as defined herein.

    [0249] In some embodiments of a compound of formula (Ig), R.sub.1a and R.sub.1 are both halogen. In some of these embodiments, R.sub.1a is C1; e.g. R.sub.1a is Cl, and R.sub.1 is Br or Cl.

    [0250] Some further embodiments of a compound of formula (I), more particularly may be represented by formula (Ih)

    ##STR00014##

    [0251] wherein

    [0252] j is 0 or 1;

    [0253] m is 0 and 1;

    [0254] p is an integer of from 0 to 4, e.g. from 0 to 3, or from 0 to 2;

    [0255] each R.sub.1a, R.sub.1, R.sub.2, R.sub.3, R.sub.4, R.sub.5, and R.sub.6 are as defined herein;

    [0256] each R.sub.7 is independently selected from C1-C3 alkyl and halogen; and

    [0257] ring A is a 4- to 6-membered non-aromatic ring optionally containing one or more heteroatoms, e.g. 1 or 2 heteroatoms; e.g. a 5- or 6-membered non-aromatic ring optionally containing one or more heteroatoms, e.g. 1 or 2 heteroatoms.

    [0258] In some embodiments of a compound of formula (Ih), p is an integer of from 1 to 4, or from 1 to 3, e.g. p is 2.

    [0259] In some embodiments of a compound of formula (Ih), each R.sub.7 is independently selected from C1-C3 alkyl, e.g. each R.sub.7 is methyl.

    [0260] In some embodiments, of a compound of formula (Ih) ring A is non-aromatic, e.g. non-aromatic and 5-membered. For example, in some embodiments, a compound of formula (Ih) more particularly may be represented by formula (Ii)

    ##STR00015##

    [0261] wherein

    [0262] j is 0 or 1; e.g. j is 1;

    [0263] M is 0 or 1; e.g. m is 1;

    [0264] p is an integer of from 0 to 4, e.g. from 0 to 3, or from 0 to 2; e.g. p is an integer of from 1 to 4 or from 1 to 3;

    [0265] q is 0, 1 or 2; e.g. q is 1 or 2;

    [0266] Z is C(R.sub.8).sub.2, NR.sub.8, O or S; e.g. Z is C(R.sub.8).sub.2 or O; or Z is O;

    [0267] each R.sub.1a, R.sub.1, R.sub.2, R.sub.3, R.sub.4, R.sub.5, and R.sub.6 are as defined herein;

    [0268] each R.sub.7 is independently selected from C1-C3 alkyl and halogen;

    [0269] each R.sub.8 is independently selected from H and C1-C3 alkyl; e.g. H and methyl; and

    [0270] and any alkyl is optionally substituted by one or more halogens, e.g. one or more F.

    [0271] In some embodiments of a compound of formula (Ii), q is 1; e.g. q is 1 and Z is O.

    [0272] In some embodiments, the compound of formula (Ii) more particularly may be represented by formula (Ij)

    ##STR00016##

    [0273] wherein j, m, Z, each R.sub.1a, R.sub.1, R.sub.2, R.sub.3, R.sub.4, R.sub.5, R.sub.6 and each R.sub.7 are as defined herein. In some embodiments of a compound of formula (Ij), each R.sub.1a, R.sub.1 and R.sub.7 is C1-C3 alkyl, e.g. each is methyl.

    [0274] In some embodiments of a compound of formula (Ii) or (Ij), m is 1. In some embodiments of a compound of formula (Ii) or (Ij), j is 1. In some embodiments of a compound of formula (Ii) or (Ij), Z is O. In some particular embodiments, m is 1 and j is 1. In some embodiments of a compound of formula (Ii) or (Ij), m is 1, j is 1, and Z is O.

    [0275] In a compound of any one of the formulas (Ia), (Ib), (Ic), (Id), (Ie), (If), (Ig), (Ih), (Ii) or (Ij), each R.sub.1a is independently selected from C1-C6 alkyl, C1-C6 alkoxy, C1-C6 alkoxy-C1-C3 alkyl, halogen, hydroxy, hydroxy-C1-C3 alkyl, carboxy, and carboxy-C1-C3 alkyl, wherein any alkyl is optionally substituted by one or more halogens, e.g. one or more F.

    [0276] In some embodiments, each R.sub.1a is independently selected from C1-C6 alkyl, C1-C6 alkoxy, halogen, hydroxy, and carboxy, wherein any alkyl is optionally substituted by one or more halogens, e.g. one or more F.

    [0277] In some embodiments, each R.sub.1a is independently selected from C1-C6 alkyl, C1-C6 alkoxy, C1-C6 alkoxy-C1-C3 alkyl, and halogen, wherein any alkyl is optionally substituted by one or more halogens, e.g. one or more F.

    [0278] In some embodiments, each R.sub.1a is independently selected from C1-C6 alkyl, C1-C6 alkoxy, and halogen, wherein any alkyl is optionally substituted by one or more halogens, e.g. one or more F.

    [0279] In some embodiments, each R.sub.1a is independently selected from C1-C6 alkyl, C1-C6 alkoxy, hydroxy, carboxy, and halogen, wherein any alkyl is optionally substituted by one or more halogens, e.g. one or more F.

    [0280] In some embodiments, each R.sub.1a is independently selected from C1-C6 alkyl, C1-C6 alkoxy, hydroxy, and halogen, wherein any alkyl is optionally substituted by one or more halogens, e.g. one or more F.

    [0281] In some further embodiments, each R.sub.1a is selected from C1-C6 alkyl, hydroxy, carboxy and halogene.g. from C1-C3 alkyl, hydroxy, carboxy and halogen, in particular from methyl, hydroxy, carboxy and Cl. In some embodiments each R.sub.1a is independently selected from C1-C3 alkyl, hydroxy and halogen; e.g. from methyl, hydroxy and halogen; in particular from methyl, hydroxy and Cl.

    [0282] In some embodiments each R.sub.1a is independently selected from C1-C3 alkyl and halogen; e.g. from methyl and halogen; in particular from methyl and Cl.

    [0283] In some of embodiments, one R.sub.1a is hydroxy, e.g. one R.sub.1a is hydroxy and, if present, the other R.sub.1a is as indicated herein, e.g. selected from C1-C3 alkyl, optionally substituted by one or more halogen, and halogen, in particular methyl and Cl. In some embodiments, one R.sub.1a is hydroxy and, if present, the other R.sub.1a is halogen, e.g. Cl.

    [0284] In some further embodiments, one R.sub.1a is halogen, in particular Cl. In some embodiments, when k in formula (Ic) is 1, i.e. in some embodiments of a compound of formula (Id) or (If), one R.sub.1a is Cl, and the other one is Cl, hydroxy, carboxy or methyl; e.g. Cl, hydroxy or methyl; or Cl or methyl; or Cl or hydroxy. In some embodiments, both R.sub.1a are Cl. In some other embodiments, one R.sub.1a is methyl, and the other one is Cl, hydroxy, carboxy or methyl, e.g. Cl, hydroxy, or methyl; or Cl or methyl. In some embodiments, one R.sub.1a is C1-C3 alkyl, e.g. methyl. In some embodiments, when k in formula (Ic) is 1, i.e. in some embodiments of a compound of formula (Id) or (If), both R.sub.1a are methyl.

    [0285] In some embodiments, each R.sub.1a is independently selected from C1-C3 alkyl, C1-C3 alkoxy, C1-C3 alkoxy-C1-C3 alkyl, hydroxy, hydroxy-C1-C3 alkyl, carboxy, carboxy-C1-C3 alkyl, and halogen; or from C1-C3 alkyl, C1-C3 alkoxy, hydroxy, carboxy, and halogen; or from C1-C3 alkyl, C1-C3 alkoxy, hydroxy, and halogen; wherein any alkyl may optionally be substituted by one or more halogen, e.g. one or more F.

    [0286] In some embodiments, each R.sub.1a is independently selected from C1-C3 alkyl, C1-C3 alkoxy, C1-C3 alkoxy-C1-C3 alkyl, and halogen; or from C1-C3 alkyl, C1-C3 alkoxy, and halogen; wherein any alkyl may optionally be substituted by one or more halogen, e.g. one or more F.

    [0287] In some embodiments, each R.sub.1a is independently from C1-C6 alkyl, and halogen. In some embodiments, e.g. in some embodiments of a compound of formula (Id), each R.sub.1a is independently selected from C1-C3 alkyl and halogen, e.g. from methyl and halogen, such as from methyl, F, Cl, or Br; or from methyl, Cl or Br; in particular from methyl and Cl.

    [0288] In some other embodiments, each R.sub.1a is independently selected from C1-C6 alkyl, e.g. from C1-C3 alkyl. In some embodiments each R.sub.1a is methyl. In still other embodiments, each R.sub.1a is independently selected from halogen, e.g. from F, Cl, and Br; or from Cl and Br. In some embodiments, each R.sub.1a is Cl.

    [0289] In some further embodiments, at least one R.sub.1a is selected from hydroxy, hydroxy-C1-C3 alkyl, carboxy, carboxy-C1-C3 alkyl, and halogen; e.g. from hydroxy, carboxy and halogen; or from hydroxy and carboxy, in particular hydroxy.

    [0290] In some other particular embodiments, e.g. of a compound of formula (Ia), (Ib) or (Ic), each R.sub.1 and each R.sub.1a are independently selected from C1-C3 alkyl, e.g. each R.sub.1 is methyl or isopropyl, and each R.sub.1a methyl.

    [0291] In some other embodiments, e.g. of a compound of formula (Ia), (Ib) or (Ic), each R.sub.1 and each R.sub.1a are halogen, e.g. each is independently selected from Cl and Br.

    [0292] In some embodiments, e.g. of a compound of formula (Ic), R.sub.1 is Br or cyclopropyl; and each R.sub.1a is Cl. In some other particular embodiments, e.g. of a compound of formula (Ic), R.sub.1 is Br and each R.sub.1a is Cl.

    [0293] In some further particular embodiments of a compound of formula (I), each R.sub.1 is independently selected from methyl, trifluoromethyl, isopropyl, cyclopropyl, pyridinyl, Cl, Br, hydroxy, and carboxy; and when n is at least 2, two R.sub.1 attached to adjacent carbon atoms on the phenyl ring may form a dihydrobenzofuran ring, optionally substituted with one or more, e.g. 1 or 2, C1-C3 alkyl groups, e.g. methyl groups; and R.sub.2 is selected from methyl, trifluoromethyl, methoxy, F, Cl, Br, and hydroxy.

    [0294] In some further particular embodiments of a compound of formula (I), each R.sub.1 is independently selected from methyl, trifluoromethyl, isopropyl, cyclopropyl, Cl, Br, hydroxy, and carboxy; and when n is at least 2, two R.sub.1 attached to adjacent carbon atoms on the phenyl ring may form a dihydrobenzofuran ring, optionally substituted with one or more, e.g. 1 or 2, C1-C3 alkyl groups, e.g. methyl groups; and R.sub.2 is selected from methyl, trifluoromethyl, F, Cl, Br, and hydroxy.

    [0295] In some further particular embodiments of a compound of formula (I), each R.sub.1 is independently selected from methyl, isopropyl, cyclopropyl, Cl, Br, hydroxy and carboxy; and R.sub.2 is selected from methyl, Cl, Br, and hydroxy.

    [0296] In some further particular embodiments of a compound of formula (I), each R.sub.1 is independently selected from methyl, isopropyl, cyclopropyl, Cl, Br, and hydroxy; and R.sub.2 is selected from methyl, Cl, Br, and hydroxy.

    [0297] In some further particular embodiments of a compound of formula (I), each R.sub.1 is independently selected from methyl, trifluoromethyl, isopropyl, cyclopropyl, pyridinyl, Cl, and Br; and when n is at least 2, two R.sub.1 attached to adjacent carbon atoms on the phenyl ring may form a dihydrobenzofuran ring, optionally substituted with one or more, e.g. 1 or 2, C1-C3 alkyl groups, e.g. methyl groups; and R.sub.2 is selected from methyl, trifluoromethyl, methoxy, F, Cl, Br, and hydroxy.

    [0298] In some further particular embodiments of a compound of formula (I), each R.sub.1 is independently selected from methyl, trifluoromethyl, isopropyl, cyclopropyl, Cl, and Br; and when n is at least 2, two R.sub.1 attached to adjacent carbon atoms on the phenyl ring may form a dihydrobenzofuran ring, optionally substituted with one or more, e.g. 1 or 2, C1-C3 alkyl groups, e.g. methyl groups; and R.sub.2 is selected from methyl, trifluoromethyl, F, Cl, Br, and hydroxy.

    [0299] In some further particular embodiments of a compound of formula (I), each R.sub.1 is independently selected from methyl, isopropyl, cyclopropyl, Cl, and Br; and R.sub.2 is selected from methyl, Cl, Br, and hydroxy.

    [0300] Some preferred embodiments of the invention are illustrated in formulas (Ik) to (Io):

    ##STR00017##

    [0301] wherein k is 0 or 1; preferably k is 1; and R.sub.1, R.sub.2, R.sub.3, R.sub.4, R.sub.5, and R.sub.6 are as defined herein.

    [0302] In some further preferred embodiments of a compound of formula (I), said compound comprises at least one hydroxy or hydroxy-C1-C3 alkyl, e.g. at least one hydroxy. For example, a particularly preferred embodiment is as represented by formula (Ip)

    ##STR00018##

    [0303] wherein n, R.sub.1, R.sub.3, R.sub.4, R.sub.5, and R.sub.6 are as defined herein.

    [0304] In some further embodiments, at least one R.sub.1 is hydroxy, i.e. the compound may be represented by formula (Iq)

    ##STR00019##

    [0305] wherein R.sub.1, R.sub.2, R.sub.3, R.sub.4, R.sub.5, and R.sub.6 are as defined herein, and n is an integer of from 1 to 5, e.g. from 2 to 4. In some of embodiments of a compound of formula (Iq), only one R.sub.1 is hydroxy, i.e. any further R.sub.1 is as defined herein, but is different from hydroxy.

    [0306] In some particular embodiments, R.sub.2 and one R.sub.1 only are hydroxy, i.e. the compound may be represented by formula (Ir)

    ##STR00020##

    [0307] wherein R.sub.3, R.sub.4, R.sub.5, and R.sub.6 are as defined herein, n is an integer of from 1 to 5, e.g. from 2 to 4, and R.sub.1b is a moiety R.sub.1 as defined herein, but different from hydroxy.

    [0308] In some embodiments of a compound of formula (Iq), e.g. of formula (Ir), the R.sub.1 group that is hydroxy is in ortho position on the phenyl ring to which it is attached.

    [0309] In some embodiments of a compound of formula (Iq), the R.sub.1 group that is hydroxy is in meta position on the phenyl ring to which it is attached. In some of these embodiments, the compound is a compound of formula (Ir).

    [0310] In some embodiments of a compound of formula (Iq), the R.sub.1 group that is hydroxy is in para position on the phenyl ring to which it is attached. For example, in some embodiments of a compound of formula (If), R.sub.1 is hydroxy; e.g. R.sub.1 is hydroxy and R.sub.1a is as defined herein, but different from hydroxy. In some of these embodiments, R.sub.2 is hydroxy.

    [0311] For the avoidance of doubt, it is pointed out that any reference to a compound of formula (I) also should be construed as a reference to a compound of any one of formulas (Ia), (Ib), (Ic), (Id), (Ie), (If), (Ig), (Ih), (Ii), or (Ij), (Ik), (Im), (In), (Io), (Ip), (Iq) and (Ir) unless otherwise indicated or apparent from the context.

    [0312] In some further embodiments of a compound of formula (I), each R.sub.1 is independently selected from C1-C6 alkyl, C3-C6 cycloalkyl, C1-C6 alkoxy, 5- or 6-membered heteroaryl, hydroxy, carboxy, and halogen; and when n is at least 2, two R.sub.1 attached to adjacent atoms of the phenyl ring, together with the atoms to which they are attached, may form a 4- to 6-membered non-aromatic ring optionally containing one or more heteroatoms and optionally substituted with one or more moieties independently selected from C1-C3 alkyl;

    [0313] R.sub.2 is selected from C1-C6 alkyl, C1-C6 alkoxy, halogen, and hydroxy;

    [0314] R.sub.3, R.sub.4, R.sub.5, and R.sub.6 are independently selected from H and F; and any alkyl is optionally substituted with one or more halogens, e.g. one or more F.

    [0315] In some embodiments of a compound of formula (I),

    [0316] each R.sub.1 is independently selected from C1-C3 alkyl, cyclopropyl, C1-C3 alkoxy, 5- or 6-membered heteroaryl, hydroxy, carboxy, and halogen; and when n is at least 2, two R.sub.1 attached to adjacent atoms of the phenyl ring, together with the atoms to which they are attached, may form a 5- or 6-membered non-aromatic ring optionally containing one or more heteroatoms and optionally substituted with one or more moieties independently selected from C1-C3 alkyl;

    [0317] R.sub.2 is selected from C1-C3 alkyl, C1-C3 alkoxy, halogen, and hydroxy;

    [0318] R.sub.3, R.sub.4, R.sub.5, and R.sub.6 are independently selected from H and F; and any alkyl is optionally substituted with one or more halogens.

    [0319] In some embodiments of a compound of formula (I),

    [0320] each R.sub.1 is independently selected from methyl, trifluoromethyl, isopropyl, cyclopropyl, methoxy, pyridyl, hydroxy, carboxy, and halogen; and when n is at least 2, two R.sub.1 attached to adjacent atoms of the phenyl ring, together with the atoms to which they are attached, may form a 5-membered non-aromatic ring optionally containing one or more heteroatoms and optionally substituted with one or more methyl;

    [0321] R.sub.2 is selected from methyl, trifluoromethyl, methoxy, halogen, and hydroxy; and

    [0322] R.sub.3, R.sub.4, R.sub.5, and R.sub.6 are independently selected from H and F.

    [0323] In some embodiments of a compound of formula (I),

    [0324] each R.sub.1 is independently selected from methyl, trifluoromethyl, isopropyl, cyclopropyl, methoxy, pyridyl, hydroxy, carboxy, and halogen (e.g. Cl and Br);

    [0325] R.sub.2 is selected from methyl, trifluoromethyl, methoxy, halogen (e.g. F, Cl and Br), and hydroxy; and

    [0326] R.sub.3, R.sub.4, R.sub.5, and R.sub.6 are independently selected from H and F.

    [0327] In some embodiments of a compound of formula (I),

    [0328] each R.sub.1 is independently selected from methyl, trifluoromethyl, isopropyl, cyclopropyl, methoxy, hydroxy, carboxy, and halogen;

    [0329] R.sub.2 is selected from methyl, trifluoromethyl, methoxy, halogen, and hydroxy; and

    [0330] R.sub.3, R.sub.4, R.sub.5, and R.sub.6 are independently selected from H and F.

    [0331] In some embodiments of a compound of formula (I),

    [0332] each R.sub.1 is independently selected from methyl, trifluoromethyl, isopropyl, cyclopropyl, methoxy, hydroxy, carboxy, Cl and Br;

    [0333] R.sub.2 is selected from methyl, trifluoromethyl, methoxy, F, Cl, Br, and hydroxy; and

    [0334] R.sub.3, R.sub.4, R.sub.5, and R.sub.6 are independently selected from H and F.

    [0335] In some further embodiments of a compound of formula (I),

    [0336] each R.sub.1 is independently selected from C1-C6 alkyl, C3-C6 cycloalkyl, 5- or 6-membered heteroaryl, hydroxy, carboxy, and halogen; and when n is at least 2, two R.sub.1 attached to adjacent atoms of the phenyl ring, together with the atoms to which they are attached, may form a 4- to 6-membered non-aromatic ring optionally containing one or more heteroatoms and optionally substituted with one or more moieties independently selected from C1-C3 alkyl;

    [0337] R.sub.2 is selected from C1-C6 alkyl, C1-C6 alkoxy, halogen, and hydroxy;

    [0338] R.sub.3, R.sub.4, R.sub.5, and R.sub.6 are independently selected from H and F; and any alkyl is optionally substituted with one or more halogens.

    [0339] In some embodiments of a compound of formula (I),

    [0340] each R.sub.1 is independently selected from C1-C3 alkyl, cyclopropyl, 5- or 6-membered heteroaryl, hydroxy, carboxy, and halogen; and when n is at least 2, two R.sub.1 attached to adjacent atoms of the phenyl ring, together with the atoms to which they are attached, may form a 5- or 6-membered non-aromatic ring optionally containing one or more heteroatoms and optionally substituted with one or more moieties independently selected from C1-C3 alkyl;

    [0341] R.sub.2 is selected from C1-C3 alkyl, C1-C3 alkoxy, halogen, and hydroxy;

    [0342] R.sub.3, R.sub.4, R.sub.5, and R.sub.6 are independently selected from H and F; and any alkyl is optionally substituted with one or more halogens.

    [0343] In some embodiments of a compound of formula (I),

    [0344] each R.sub.1 is independently selected from C1-C3 alkyl, cyclopropyl, 5- or 6-membered heteroaryl, hydroxy, carboxy, and halogen; and when n is at least 2, two R.sub.1 attached to adjacent atoms of the phenyl ring, together with the atoms to which they are attached, may form a 5- or 6-membered non-aromatic ring optionally containing one or more heteroatoms and optionally substituted with one or more moieties independently selected from C1-C3 alkyl;

    [0345] R.sub.2 is selected from C1-C3 alkyl, C1-C3 alkoxy, halogen, and hydroxy;

    [0346] R.sub.3, R.sub.4, R.sub.5, and R.sub.6 are independently selected from H and F; and any alkyl is optionally substituted with one or more halogens.

    [0347] In some embodiments of a compound of formula (I),

    [0348] each R.sub.1 is independently selected from methyl, trifluoromethyl, isopropyl, cyclopropyl, pyridyl, hydroxy, carboxy, and halogen; and when n is at least 2, two R.sub.1 attached to adjacent atoms of the phenyl ring, together with the atoms to which they are attached, may form a 5-membered non-aromatic ring optionally containing one or more heteroatoms and optionally substituted with one or more methyl;

    [0349] R.sub.2 is selected from methyl, trifluoromethyl, methoxy, halogen, and hydroxy; and

    [0350] R.sub.3, R.sub.4, R.sub.5, and R.sub.6 are independently selected from H and F.

    [0351] In some embodiments of a compound of formula (I),

    [0352] each R.sub.1 is independently selected from methyl, trifluoromethyl, isopropyl, cyclopropyl, pyridyl, hydroxy, carboxy, and halogen (e.g. Cl and Br);

    [0353] R.sub.2 is selected from methyl, trifluoromethyl, methoxy, halogen (e.g. F, Cl and Br), and hydroxy; and

    [0354] R.sub.3, R.sub.4, R.sub.5, and R.sub.6 are independently selected from H and F.

    [0355] In some embodiments of a compound of formula (I),

    [0356] each R.sub.1 is independently selected from methyl, trifluoromethyl, isopropyl, cyclopropyl, hydroxy, carboxy, and halogen;

    [0357] R.sub.2 is selected from methyl, trifluoromethyl, methoxy, halogen, and hydroxy; and

    [0358] R.sub.3, R.sub.4, R.sub.5, and R.sub.6 are independently selected from H and F.

    [0359] In some embodiments of a compound of formula (I),

    [0360] each R.sub.1 is independently selected from methyl, trifluoromethyl, isopropyl, cyclopropyl, hydroxy, carboxy, Cl and Br;

    [0361] R.sub.2 is selected from methyl, trifluoromethyl, methoxy, F, Cl, Br, and hydroxy; and

    [0362] R.sub.3, R.sub.4, R.sub.5, and R.sub.6 are independently selected from H and F.

    [0363] In some further embodiments of a compound of formula (I),

    [0364] each R.sub.1 is independently selected from C1-C6 alkyl, C3-C6 cycloalkyl, 5- or 6-membered heteroaryl, hydroxy, and halogen; and when n is at least 2, two R.sub.1 attached to adjacent atoms of the phenyl ring, together with the atoms to which they are attached, may form a 4- to 6-membered (preferably non-aromatic) ring optionally containing one or more heteroatoms and optionally substituted with one or more moieties independently selected from C1-C3 alkyl;

    [0365] R.sub.2 is selected from C1-C6 alkyl, C1-C6 alkoxy, halogen, and hydroxy;

    [0366] R.sub.3, R.sub.4, R.sub.5, and R.sub.6 are independently selected from H and F; and any alkyl is optionally substituted with one or more halogens.

    [0367] In some embodiments of a compound of formula (I),

    [0368] each R.sub.1 is independently selected from C1-C3 alkyl, cyclopropyl, 5- or 6-membered heteroaryl, hydroxy, and halogen; and when n is at least 2, two R.sub.1 attached to adjacent atoms of the phenyl ring, together with the atoms to which they are attached, may form a 5- or 6-membered non-aromatic ring optionally containing one or more heteroatoms and optionally substituted with one or more moieties independently selected from C1-C3 alkyl;

    [0369] R.sub.2 is selected from C1-C3 alkyl, C1-C3 alkoxy, halogen, and hydroxy;

    [0370] R.sub.3, R.sub.4, R.sub.5, and R.sub.6 are independently selected from H and F; and any alkyl is optionally substituted with one or more halogens.

    [0371] In some embodiments of a compound of formula (I),

    [0372] each R.sub.1 is independently selected from C1-C3 alkyl, cyclopropyl, 5- or 6-membered heteroaryl, hydroxy, and halogen; and when n is at least 2, two R.sub.1 attached to adjacent atoms of the phenyl ring, together with the atoms to which they are attached, may form a 5- or 6-membered non-aromatic ring optionally containing one or more heteroatoms and optionally substituted with one or more moieties independently selected from C1-C3 alkyl;

    [0373] R.sub.2 is selected from C1-C3 alkyl, C1-C3 alkoxy, halogen, and hydroxy;

    [0374] R.sub.3, R.sub.4, R.sub.5, and R.sub.6 are independently selected from H and F; and any alkyl is optionally substituted with one or more halogens.

    [0375] In some embodiments of a compound of formula (I),

    [0376] each R.sub.1 is independently selected from methyl, trifluoromethyl, isopropyl, cyclopropyl, pyridyl, hydroxy, and halogen; and when n is at least 2, two R.sub.1 attached to adjacent atoms of the phenyl ring, together with the atoms to which they are attached, may form a 5-membered non-aromatic ring optionally containing one or more heteroatoms and optionally substituted with one or more methyl;

    [0377] R.sub.2 is selected from methyl, trifluoromethyl, methoxy, halogen, and hydroxy; and

    [0378] R.sub.3, R.sub.4, R.sub.5, and R.sub.6 are independently selected from H and F.

    [0379] In some embodiments of a compound of formula (I),

    [0380] each R.sub.1 is independently selected from methyl, trifluoromethyl, isopropyl, cyclopropyl, pyridyl, hydroxy, and halogen (e.g. Cl and Br);

    [0381] R.sub.2 is selected from methyl, trifluoromethyl, methoxy, halogen (e.g. F, Cl and Br), and hydroxy; and

    [0382] R.sub.3, R.sub.4, R.sub.5, and R.sub.6 are independently selected from H and F.

    [0383] In some embodiments of a compound of formula (I),

    [0384] each R.sub.1 is independently selected from methyl, trifluoromethyl, isopropyl, cyclopropyl, hydroxy, and halogen;

    [0385] R.sub.2 is selected from methyl, trifluoromethyl, methoxy, halogen, and hydroxy; and

    [0386] R.sub.3, R.sub.4, R.sub.5, and R.sub.6 are independently selected from H and F.

    [0387] In some embodiments of a compound of formula (I),

    [0388] each R.sub.1 is independently selected from methyl, trifluoromethyl, isopropyl, cyclopropyl, hydroxy, Cl and Br;

    [0389] R.sub.2 is selected from methyl, trifluoromethyl, methoxy, F, Cl, Br, and hydroxy; and

    [0390] R.sub.3, R.sub.4, R.sub.5, and R.sub.6 are independently selected from H and F.

    [0391] In some further embodiments of a compound of formula (I),

    [0392] each R.sub.1 is independently selected from C1-C6 alkyl, C3-C6 cycloalkyl, 5- or 6-membered heteroaryl, and halogen; and when n is at least 2, two R.sub.1 attached to adjacent atoms of the phenyl ring, together with the atoms to which they are attached, may form a 4- to 6-membered (preferably non-aromatic) ring optionally containing one or more heteroatoms and optionally substituted with one or more moieties independently selected from C1-C3 alkyl;

    [0393] R.sub.2 is selected from C1-C6 alkyl, C1-C6 alkoxy, halogen, and hydroxy;

    [0394] R.sub.3, R.sub.4, R.sub.5, and R.sub.6 are independently selected from H and F; and any alkyl is optionally substituted with one or more halogens.

    [0395] In some embodiments of a compound of formula (I),

    [0396] each R.sub.1 is independently selected from C1-C3 alkyl, cyclopropyl, 5- or 6-membered heteroaryl, and halogen; and when n is at least 2, two R.sub.1 attached to adjacent atoms of the phenyl ring, together with the atoms to which they are attached, may form a 5- or 6-membered non-aromatic ring optionally containing one or more heteroatoms and optionally substituted with one or more moieties independently selected from C1-C3 alkyl;

    [0397] R.sub.2 is selected from C1-C3 alkyl, C1-C3 alkoxy, halogen, and hydroxy;

    [0398] R.sub.3, R.sub.4, R.sub.5, and R.sub.6 are independently selected from H and F; and any alkyl is optionally substituted with one or more halogens.

    [0399] In some embodiments of a compound of formula (I),

    [0400] each R.sub.1 is independently selected from C1-C3 alkyl, cyclopropyl, 5- or 6-membered heteroaryl, and halogen; and when n is at least 2, two R.sub.1 attached to adjacent atoms of the phenyl ring, together with the atoms to which they are attached, may form a 5- or 6-membered non-aromatic ring optionally containing one or more heteroatoms and optionally substituted with one or more moieties independently selected from C1-C3 alkyl;

    [0401] R.sub.2 is selected from C1-C3 alkyl, C1-C3 alkoxy, halogen, and hydroxy;

    [0402] R.sub.3, R.sub.4, R.sub.5, and R.sub.6 are independently selected from H and F; and any alkyl is optionally substituted with one or more halogens.

    [0403] In some embodiments of a compound of formula (I),

    [0404] each R.sub.1 is independently selected from methyl, trifluoromethyl, isopropyl, cyclopropyl, pyridyl, and halogen; and when n is at least 2, two R.sub.1 attached to adjacent atoms of the phenyl ring, together with the atoms to which they are attached, may form a 5-membered non-aromatic ring optionally containing one or more heteroatoms and optionally substituted with one or more methyl;

    [0405] R.sub.2 is selected from methyl, trifluoromethyl, methoxy, halogen, and hydroxy; and

    [0406] R.sub.3, R.sub.4, R.sub.5, and R.sub.6 are independently selected from H and F.

    [0407] In some embodiments of a compound of formula (I),

    [0408] each R.sub.1 is independently selected from methyl, trifluoromethyl, isopropyl, cyclopropyl, pyridyl, and halogen (e.g. Cl and Br);

    [0409] R.sub.2 is selected from methyl, trifluoromethyl, methoxy, halogen (e.g. F, Cl and Br), and hydroxy; and

    [0410] R.sub.3, R.sub.4, R.sub.5, and R.sub.6 are independently selected from H and F.

    [0411] In some embodiments of a compound of formula (I),

    [0412] each R.sub.1 is independently selected from methyl, trifluoromethyl, isopropyl, cyclopropyl, and halogen;

    [0413] R.sub.2 is selected from methyl, trifluoromethyl, methoxy, halogen, and hydroxy; and

    [0414] R.sub.3, R.sub.4, R.sub.5, and R.sub.6 are independently selected from H and F.

    [0415] In some embodiments of a compound of formula (I),

    [0416] each R.sub.1 is independently selected from methyl, trifluoromethyl, isopropyl, cyclopropyl, C1 and Br;

    [0417] R.sub.2 is selected from methyl, trifluoromethyl, methoxy, F, Cl, Br, and hydroxy; and

    [0418] R.sub.3, R.sub.4, R.sub.5, and R.sub.6 are independently selected from H and F.

    [0419] In some of the above embodiments, R.sub.2 is selected from C1-C3 alkyl (optionally substituted by one or more halogen), halogen, and hydroxy, e.g. methyl, trifluoromethyl, chloro and hydroxy, in particular methyl, chloro and hydroxy. In some of the above embodiments, R.sub.2 is hydroxy. In some others of the above embodiments, R.sub.2 is methyl or trifluoromethyl, in particular methyl. In still some others of the above embodiments, R.sub.2 is halogen, e.g. chloro.

    [0420] In still some further embodiments, each R.sub.1 (including, when present, R.sub.1a) and R.sub.2 are independently selected from C1-C3 alkyl, hydroxy, and halogen (e.g. methyl, hydroxy, F, Cl, and Br), wherein any alkyl is optionally substituted by one or more halogen; e.g. R.sub.1 is selected from C1-C3 alkyl, hydroxy, and halogen, and R.sub.2 is hydroxy.

    [0421] Compounds of formula (I) may be prepared by following methods generally well-known to the person of ordinary skill in the art of chemical synthesis, in light of the below described illustrating examples. For example, the compounds of the invention may be prepared by reacting a suitably substituted benzenesulfonyl chloride 1 with amine 2, as illustrated in Reaction Scheme 1.

    ##STR00021##

    [0422] The reaction as illustrated in Reaction Scheme 1 may be performed at any suitable temperature, preferably room temperature, in a suitable solvent for the reactants, such as dichloromethane, and preferably in the presence of a suitable base, e.g. triethylamine.

    [0423] The compounds of the present invention are Nox4 inhibitors and/or Nox2 inhibitors. Some of the compounds have a high selectivity for Nox4 and therefore may be used in diseases involving (associated with activity of) Nox4. Some of the compounds are capable of inhibiting both Nox2 and Nox4, and therefore may be used in diseases involving (associated with activity of) either Nox2 or Nox4, or—advantageously—both Nox2 and Nox4. Some of the compounds have a high selectivity for Nox2 and therefore may be used in diseases involving (associated with activity of) Nox2.

    [0424] For example, in some embodiments, a compound of formula (I), e.g. a compound wherein R.sub.2 is hydroxy or hydroxy-C1-C3 alkyl (in particular hydroxy), is useful as a Nox2 and Nox4 inhibitor, in particular as a Nox2 inhibitor.

    [0425] In some advantageous embodiments, the compound of formula (I) is an inhibitor of both Nox2 and Nox4.

    [0426] In some further embodiments, a compound of formula (I), e.g. a compound of formula (I) wherein R.sub.2 is not selected from hydroxy and hydroxy-C1-C3 alkyl (e.g. R.sub.2 is selected from C1-C6 alkyl and halogen, such as C1-C6 alkyl) is useful in particular as a Nox4 inhibitor.

    [0427] Depending on the process conditions a compound of the invention may be obtained in neutral, but also as a salt form. Acid addition salts of the inventive compound may in a manner known per se be transformed into the free base using basic agents such as alkali or by ion exchange.

    [0428] The free base obtained may also form salts with organic or inorganic acids. Alkali addition salts of the inventive compound may in a manner known per se be transformed into the free acid by using acidic agents such as acid or by ion exchange. The free acid obtained may also form salts with organic or inorganic bases.

    [0429] In the preparation of acid or base addition salts, preferably such acids or bases are used which form suitably therapeutically acceptable salts. Examples of such acids are hydrohalogen acids, sulfuric acid, phosphoric acid, nitric acid, aliphatic, alicyclic, aromatic or heterocyclic carboxylic or sulfonic acids, such as formic acid, acetic acid, propionic acid, succinic acid, glycolic acid, lactic acid, malic acid, tartaric acid, citric acid, ascorbic acid, maleic acid, hydroxymaleic acid, pyruvic acid, p-hydroxybenzoic acid, embonic acid, methanesulfonic acid, ethanesulfonic acid, hydroxyethanesulfonic acid, halogenbenzenesulfonic acid, toluenesulfonic acid or naphthalenesulfonic acid. Base addition salts include those derived from inorganic bases, such as ammonium or alkali or alkaline earth metal hydroxides, carbonates, bicarbonates, and the like, and organic bases such as alkoxides, alkyl amides, alkyl and aryl amines, and the like. Examples of bases useful in preparing salts of the present invention include sodium hydroxide, potassium hydroxide, ammonium hydroxide, potassium carbonate, and the like.

    [0430] Pharmaceutical formulations are usually prepared by mixing the active substance, i.e. a compound of formula (I), or a pharmaceutically acceptable salt thereof, with conventional pharmaceutical excipients. The formulations can be further processed by known methods such as granulation, compression, microencapsulation, spray coating, etc. The formulations may be prepared by conventional methods in the dosage form of tablets, capsules, granules, powders, syrups, suspensions, suppositories or injections. Liquid formulations may be prepared by dissolving or suspending the active substance in water or other suitable vehicles. Tablets and granules may be coated in a conventional manner.

    [0431] For clinical use, a compound of formula (I) is formulated into pharmaceutical formulations for oral, rectal, parenteral or other mode of administration. These pharmaceutical preparations are a further object of the invention.

    [0432] Usually the effective amount of active compound is between 0.1-95% by weight of the preparation, preferably between 0.2-20% by weight in preparations for parenteral use and preferably between 1 and 50% by weight in preparations for oral administration.

    [0433] The dose level and frequency of dosage of the specific compound will vary depending on a variety of factors including the potency of the specific compound employed, the metabolic stability and length of action of that compound, the patient's age, body weight, general health, sex, diet, mode and time of administration, rate of excretion, drug combination, the severity of the condition to be treated, and the patient undergoing therapy. The daily dosage may, for example, range from about 0.001 mg to about 100 mg per kilo of body weight, administered singly or multiply in doses, e.g. from about 0.01 mg to about 25 mg each. Normally, such a dosage is given orally but parenteral administration may also be chosen.

    [0434] In the preparation of pharmaceutical formulations containing the compound of the present invention in the form of dosage units for oral administration the compound may be mixed with solid, powdered ingredients, such as lactose, saccharose, sorbitol, mannitol, starch, amylopectin, cellulose derivatives, gelatin, or another suitable ingredient, as well as with disintegrating agents and lubricating agents such as magnesium stearate, calcium stearate, sodium stearyl fumarate and polyethylene glycol waxes. The mixture is then processed into granules or pressed into tablets.

    [0435] Soft gelatine capsules may be prepared with capsules containing a mixture of the active compound of the invention, vegetable oil, fat, or other suitable vehicle for soft gelatine capsules. Hard gelatine capsules may contain granules of the active compound. Hard gelatine capsules may also contain the inventive compound in combination with solid powdered ingredients such as lactose, saccharose, sorbitol, mannitol, potato starch, corn starch, amylopectin, cellulose derivatives or gelatine.

    [0436] Dosage units for rectal administration may be prepared (i) in the form of suppositories which contain the active substance mixed with a neutral fat base; (ii) in the form of a gelatine rectal capsule which contains the active substance in a mixture with a vegetable oil, paraffin oil or other suitable vehicle for gelatine rectal capsules; (iii) in the form of a ready-made micro enema; or (iv) in the form of a dry micro enema formulation to be reconstituted in a suitable solvent just prior to administration.

    [0437] Liquid preparations for oral administration may be prepared in the form of syrups or suspensions, e.g. solutions or suspensions containing from 0.2% to 20% by weight of the active ingredient and the remainder consisting of sugar or sugar alcohols and a mixture of ethanol, water, glycerol, propylene glycol and polyethylene glycol. If desired, such liquid preparations may contain colouring agents, flavouring agents, saccharine and carboxymethyl cellulose or other thickening agent. Liquid preparations for oral administration may also be prepared in the form of a dry powder to be reconstituted with a suitable solvent prior to use.

    [0438] Solutions for parenteral, e.g. intravenous administration, or for administration e.g. to the eye, may be prepared as a solution of a compound of the invention in a pharmaceutically acceptable solvent, preferably in a concentration from 0.01 to 10% by weight, or from 0.1% to 10% by weight. These solutions may also contain stabilizing ingredients and/or buffering ingredients and are dispensed into unit doses in the form of ampoules or vials. Solutions for parenteral administration may also be prepared as a dry preparation to be reconstituted with a suitable solvent extemporaneously before use.

    [0439] The compounds of formula (I) may also be used or administered in combination with one or more additional therapeutically active agents. The components may be in the same formulation or in separate formulations for administration simultaneously or sequentially.

    [0440] Accordingly, in a further aspect of the invention, there is provided a combination product comprising:

    [0441] (A) a compound of formula (I) as defined herein; and

    [0442] (B) another therapeutic agent; whereby (A) and (B) is formulated in admixture with a pharmaceutically acceptable excipient.

    [0443] Such combination products provide for the administration of the compound of formula (I) in conjunction with the other therapeutic agent, and may thus be presented either as separate formulations, wherein at least one of those formulations comprises the compound of formula (I), and at least one comprises the other therapeutic agent, or may be presented (i.e. formulated) as a combined preparation (i.e. presented as a single formulation including a compound of formula (I) and the other therapeutic agent).

    [0444] Thus, there is further provided:

    [0445] (1) a pharmaceutical formulation including a compound of formula (I), another therapeutic agent, and a pharmaceutically acceptable excipient, e.g. an adjuvant, diluent or carrier; or

    [0446] (2) a kit of parts comprising, as components:

    [0447] (a) a pharmaceutical formulation including a compound of formula (I), as defined herein, in admixture with a pharmaceutically acceptable excipient, e.g. an adjuvant, diluent or carrier; and

    [0448] (b) a pharmaceutical formulation including another therapeutic agent in admixture with a pharmaceutically acceptable excipient, e.g. an adjuvant, diluent or carrier, which components (a) and (b) are each provided in a form that is suitable for administration in conjunction with the other.

    [0449] In some embodiments, the compound of formula (I) (or a pharmaceutically acceptable salt thereof) is for use in the treatment of an endocrine disorder. In some embodiments, the compound of formula (I) is for use in the treatment of a cardiovascular disorder or disease. In some embodiments, the compound of formula (I) is for use in the treatment of a respiratory disorder or disease. In some embodiments, the compound of formula (I) is for use in the treatment of an allergic disorder. In some embodiments, the compound of formula (I) is for use in the treatment of a traumatism. In some embodiments, the compound of formula (I) is for use in the treatment of a disease or disorder affecting the metabolism. In some embodiments, the compound of formula (I) is for use in the treatment of a skin disease or disorder. In some embodiments, the compound of formula (I) is for use in the treatment of a bone disorder. In some embodiments, the compound of formula (I) is for use in the treatment of a neurodegenerative disease or disorder, e.g. Alzheimer's disease. In some embodiments, the compound of formula (I) is for use in the treatment of a kidney disease or disorder. In some embodiments, the compound of formula (I) is for use in the treatment of a reproduction disorder or disease. In some embodiments, the compound of formula (I) is for use in the treatment of a disease or disorder affecting the eye and/or the lens. In some embodiments, the compound of formula (I) is for use in the treatment of a conditions affecting the inner ear. In some embodiments, the compound of formula (I) is for use in the treatment of an inflammatory disorder. In some embodiments, the compound of formula (I) is for use in the treatment of liver disease or disorders. In some embodiments, the compound of formula (I) is for use in the treatment of arthritis. In some embodiments, the compound of formula (I) is for use in the treatment of pain, e.g. hyperalgesia associated with inflammatory pain. In some embodiments, the compound of formula (I) is for use in the treatment of cancer, e.g. breast cancer. In some embodiments, the compound of formula (I) is for use in the treatment of a disease or disorder of the gastrointestinal system. In some embodiments, the compound of formula (I) is for use in the treatment of abnormal angiogenesis.

    [0450] In still further embodiments, the compound of formula (I) is for use in the treatment of fibrosis. In some of these embodiments, the fibrosis is pulmonary fibrosis. In some other of these embodiments, the fibrosis is cystic fibrosis. In still of these embodiments, the fibrosis is liver fibrosis, e.g. alcohol induced liver fibrosis. In still further embodiments, the compound of formula (I) is for use in the treatment of diabetes, e.g. type 2 diabetes. In still further embodiments, the compound of formula (I) is for use in the treatment of chronic kidney disease (also referred to as chronic kidney failure). In some embodiments, the compound of formula (I) is for use in the manufacturing of a medicament for the treatment of any of the aforementioned diseases or disorders.

    [0451] In some particular embodiments, the compounds disclosed herein are useful in the treatment of ischemic retinopathies, such as diabetic retinopathy. Thus, in some embodiments, a compound according to the invention is provided for use in the treatment of retinopathy, e.g. an ischemic retinopathy, such as diabetic retinopathy. The compound may be provided in formulation suitable for administration to the eye, e.g. an eye drop formulation, optionally containing one or more further active ingredients, e.g. an anti-inflammatory agent.

    [0452] In some further embodiments, a compound of formula (I) is used in a combination with an antitumor agent in the treatment of a malignant hyperproliferative disease. Such combination therapy may be particularly useful in cancer chemotherapy, to counteract an anti-apoptotic effect of Nox4 that may lead to tumor resistance to the antitumor agent. Thus, there is further provided:

    [0453] (1) a pharmaceutical formulation including a compound of formula (I), as hereinbefore defined, an antitumor agent, and a pharmaceutically acceptable excipient, e.g. an adjuvant, diluent or carrier; or

    [0454] (2) a kit of parts comprising, as components:

    [0455] (a) a pharmaceutical formulation including a compound of formula (I), as defined herein, in admixture with a pharmaceutically acceptable excipient, e.g. an adjuvant, diluent or carrier; and

    [0456] (b) a pharmaceutical formulation including an antitumor agent in admixture with a pharmaceutically acceptable excipient, e.g. an adjuvant, diluent or carrier, which components (a) and (b) are each provided in a form that is suitable for administration in conjunction with the other.

    [0457] The components (a) and (b) in any of the above kit of parts may be administered at the same time, in sequence, or separately from each other. The compound of the present invention may also be used or administered in combination with other modes of treatment, such as irradiation for the treatment of cancer.

    [0458] According to one aspect, there is provided a method of inhibiting the activity of Nox4, in a patient in need thereof, by administering to said patient a therapeutically effective amount of a compound of formula (I), as defined herein. The patient may be any mammal, but preferably is a human. The patient to be treated may be one suffering from a condition or disorder associated with an elevated activity of Nox4, or a patient at risk of developing such a condition or disorder. Examples of such conditions and disorders are cardiovascular disorders, respiratory disorders, metabolism disorders, skin disorders, bone disorders, neuroinflammatory and/or neurodegenerative disorders, kidney diseases, reproduction disorders, diseases affecting the eye and/or the lens and/or conditions affecting the inner ear, inflammatory disorders, liver diseases, pain, cancers, allergic disorders, traumatisms, septic, hemorrhagic and anaphylactic shock, diseases or disorders of the gastrointestinal system, angiogenesis, angiogenesis-dependent conditions, lung infections, acute lung injury, pulmonary arterial hypertension, obstructive lung disorders, fibrotic lung disease, and lung cancer.

    [0459] In one embodiment, the compound of the present invention is for use in the treatment of stroke. In one particular embodiment, the stroke is ischemic. The compound of the present invention is considered to have neuroprotective activity in the treatment of stroke. Therefore, the compound of the present invention suitably is used in combination with removal of blood clots in the treatment of ischemic stroke. In one particular embodiment, the compound of the present invention is used in combination with tPA (tissue plasminogen activator) in the treatment of ischemic stroke.

    [0460] A compound of formula (I) is useful for the treatment of any mammal subject, e.g. a human or an animal (a non-human mammal). In some embodiments, the treated subject is a human. In some other embodiments, the treated subject is a non-human mammal, e.g. a farm animal, a pet animal, or a laboratory animal. In some embodiments, the treated non-human mammal is a pet animal. In some embodiments, the pet animal is a dog. In some other embodiments, the pet animal is a cat. In other embodiments, the treated subject is a farm animal, e.g. a cow, or a pig, or a sheep. In other embodiments, the treated subject is a horse.

    [0461] The invention will be illustrated by the following, non-limiting Examples.

    EXAMPLES

    [0462] In the Examples, flash column chromatography was performed on a Teledyne ISCO, Combi Flash Rf+Lumen using a RediSep Rf silica column. Preparative HPLC was performed on a Gilson system equipped with a UV detector using an XBridge Prep C-18 5 μm OBD, 50×19 mm column. Analytical HPLC-MS was performed using an Agilent 1100 series Liquid Chromatograph/Mass Selective Detector (MSD) (Single Quadrupole) equipped with an electrospray interface and a UV diode array detector. Analyses were performed by two methods using either an ACE 3 C8 (3.0×50 mm) column with a gradient of acetonitrile in 0.1% aqueous TFA over 3 min and a flow of 1 mL/min, or an Xbridge C18 (3.0×50 mm) column with a gradient of acetonitrile in 10 mM ammonium bicarbonate over 3 min and a flow of 1 mL/min. .sup.1H-NMR spectra were recorded on a Varian 400 MHz instrument at 25° C.

    [0463] The compounds have been named using the software MarvinSketch 16.2.29.0. In addition, the commercial names or trivial names are used for the commercial starting materials and reagents.

    Example 1

    N-[2-(2-methoxyphenyl)ethyl]-2,4,6-trimethylbenzene-1-sulfonamide

    [0464] 2,4,6-Trimethylbenzenesulfonyl chloride (38 mg, 0.17 mmol) was dissolved in DCM (2 mL) and 2-(2-methoxyphenyl)ethanamine (45 mg, 0.30 mmol) was added followed by triethylamine (50 μL, 0.35 mmol). The reaction mixture was stirred for 2 hours at room temperature. Water (1 mL) was added. The layers were separated and the organic phase was concentrated. Purification by preparative HPLC (XBridge C18 19×50 mm; 0.1% TFA(aq)/MeCN; 80:20 to 30:70) afforded the title compound as a white solid (8.7 mg, 15%). MS ESI+ m/z 334 [M+H].sup.+.

    Example 2

    N-[2-(2-fluorophenyl)ethyl]-2,4,6-trimethylbenzene-1-sulfonamide

    [0465] 2,4,6-Trimethylbenzenesulfonyl chloride (38 mg, 0.17 mmol) was dissolved in DCM (2 mL) and 2-(2-fluorophenyl)ethanamine (41.1 mg, 0.30 mmol) was added followed by triethylamine (50 μL, 0.35 mmol). The reaction mixture was stirred for 2 hours at room temperature. Water (1 mL) was added. The layers were separated and the organic phase was concentrated. Purification by preparative HPLC (XBridge C18 19×50 mm; 0.1% TFA(aq)/MeCN; 80:20 to 30:70) afforded the title compound as a white solid (4.6 mg, 8%). MS ESI+ m/z 322 [M+H].sup.+.

    Example 3

    N-[2-(2-fluorophenyl)ethyl]-2,2,4,6,7-pentamethyl-2,3-dihydro-1-benzofuran-5-sulfonamide

    [0466] 2,2,4,6,7-Pentamethyl-3H-benzofuran-5-sulfonyl chloride (27 mg, 0.09 mmol) was dissolved in DCM (2 mL) and 2-(2-fluorophenyl)ethanamine (22 mg, 0.16 mmol) was added followed by triethylamine (50 μL, 0.35 mmol). The reaction mixture was stirred for 1 hour at room temperature. Water (1 mL) was added. The layers were separated and the organic phase was concentrated. Purification by preparative HPLC (XBridge C18 19×50 mm; 0.1% TFA(aq)/MeCN; 80:20 to 30:70) afforded the title compound as a white solid (36.6 mg, 22%). MS ESI+ m/z 392 [M+H].sup.+.

    Example 4

    [0467] 4-bromo-2,6-dichloro-N-[2-(2-methoxyphenyl)ethyl]benzene-1-sulfonamide 4-Bromo-2,6-dichloro-benzenesulfonyl chloride (25 mg, 0.08 mmol) was dissolved in DCM (2 mL) and 2-(2-methoxyphenyl)ethanamine (20 mg, 0.13 mmol) was added followed by triethylamine (50 μL, 0.46 mmol). The reaction mixture was stirred for 1 hour at room temperature. Water (1 mL) was added. The layers were separated and the organic phase was concentrated. Purification by preparative HPLC (XBridge C18 19×50 mm; 0.1% TFA(aq)/MeCN; 80:20 to 30:70) afforded the title compound as a white solid (34 mg, 20%). MS ESI+ m/z 440 [M+H].sup.+.

    Example 5

    4-bromo-2,6-dichloro-N-[2-(2-fluorophenyl)ethyl]benzene-1-sulfonamide

    [0468] 4-Bromo-2,6-dichloro-benzenesulfonyl chloride (500 mg, 1.54 mmol) was dissolved in DCM (2 mL) and 2-(2-fluorophenyl)ethanamine (0.34 mL, 2.62 mmol) was added followed by triethylamine (0.43 mL, 3.08 mmol). The reaction mixture was stirred for 1 hour at room temperature. DCM (10 mL) and brine (10 mL) were added to the mixture. The layers were separated and the organic phase was dried over magnesium sulfate, filtered and the solvent was evaporated. Purification by column chromatography on silica gel with PE/DCM (60:40 to 40:60) afforded the title compound as pale yellow solid (484 mg, 73%). .sup.1H NMR (400 MHz, CDCl.sub.3) δ 2.88 (t, J=6.8 Hz, 2H), 3.30-3.41 (m, 2H), 5.25 (t, J=5.8 Hz, 1H), 6.95-7.01 (m, 1H), 7.04 (td, J=7.5, 0.9 Hz, 1H), 7.13 (td, J=7.5, 1.5 Hz, 1H), 7.17-7.25 (m, 1H), 7.58 (s, 2H). MS ESI+ m/z 428 [M+H].sup.+.

    Example 6

    N-[2-(2-chlorophenyl)ethyl]-2,4,6-trimethylbenzene-1-sulfonamide

    [0469] 2,4,6-Trimethylbenzenesulfonyl chloride (38 mg, 0.17 mmol) was dissolved in DCM (2 mL) and 2-(2-chlorophenyl)ethanamine (46 mg, 0.3 mmol) was added followed by triethylamine (50 μL, 0.35 mmol). The reaction mixture was stirred for 1 hour at room temperature. Water (1 mL) was added. The layers were separated and the organic phase was concentrated. Purification by preparative HPLC (XBridge C18 19×50 mm; 0.1% TFA(aq)/MeCN; 80:20 to 30:70) afforded the title compound as a white solid (7.9 mg, 13%). MS ESI+ m/z 338 [M+H].sup.+.

    Example 7

    N-[2-(2-bromophenyl)ethyl]-2,4,6-trimethylbenzene-1-sulfonamide

    [0470] 2,4,6-Trimethylbenzenesulfonyl chloride (38 mg, 0.17 mmol) was dissolved in DCM (2 mL) and 2-(2-bromophenyl)ethanamine (59 mg, 0.3 mmol) was added followed by triethylamine (50 μL, 0.35 mmol). The reaction mixture was stirred for 1 hour at room temperature. Water (1 mL) was added. The layers were separated and the organic phase was concentrated. Purification by preparative HPLC (XBridge C18 19×50 mm; 0.1% TFA(aq)/MeCN; 80:20 to 30:70) afforded the title compound as a white solid (7.9 mg, 13%). MS ESI+ m/z 384 [M+H].sup.+.

    Example 8

    4-bromo-2-chloro-N-[2-(2-chlorophenyl)ethyl]benzene-1-sulfonamide

    [0471] 4-Bromo-2-chloro-benzenesulfonyl chloride (38 mg, 0.13 mmol) was dissolved in DCM (1 mL) and 2-(2-chlorophenyl)ethanamine (35 mg, 0.22 mmol) was added followed by triethylamine (38 μL, 0.27 mmol). The reaction mixture was stirred for 1 hour at room temperature. Water (1 mL) was added. The layers were separated and the organic phase was concentrated. Purification by preparative HPLC (XBridge C18 19×50 mm; 0.1% TFA(aq)/MeCN; 80:20 to 30:70) afforded the title compound as a white solid (7.8 mg, 15%). MS ESI+ m/z 410 [M+H].sup.+.

    Example 9

    N-[2-(2-chlorophenyl)ethyl]-2,2,4,6,7-pentamethyl-2,3-dihydro-1-benzofuran-5-sulfonamide

    [0472] 2,2,4,6,7-Pentamethyl-3H-benzofuran-5-sulfonyl chloride (38 mg, 0.13 mmol) was dissolved in DCM (2 mL) and 2-(2-chlorophenyl)ethanamine (46 mg, 0.3 mmol) was added followed by triethylamine (50 μL, 0.35 mmol). The reaction mixture was stirred for 1 hour at room temperature. Water (1 mL) was added. The layers were separated and the organic phase was concentrated. Purification by preparative HPLC (XBridge C18 19×50 mm; 0.1% TFA(aq)/MeCN; 80:20 to 30:70) afforded the title compound as a white solid (6.9 mg, 10%). MS ESI+ m/z 408 [M+H].sup.+.

    Example 10

    2,4,6-trimethyl-N-{2-[2-(trifluoromethyl)phenyl]ethyl}benzene-1-sulfonamide

    [0473] 2,4,6-Trimethylbenzenesulfonyl chloride (38 mg, 0.17 mmol) was dissolved in DCM (2 mL) and 2-[2-(trifluoromethyl)phenyl]ethanamine (56 mg, 0.3 mmol) was added followed by triethylamine (50 μL, 0.35 mmol). The reaction mixture was stirred for 1 hour at room temperature. Water (1 mL) was added. The layers were separated and the organic phase was concentrated. Purification by preparative HPLC (XBridge C18 19×50 mm; 0.1% TFA(aq)/MeCN; 80:20 to 30:70) afforded the title compound as a white solid (8.0 mg, 12%). MS ESI+ m/z 372 [M+H].sup.+.

    Example 11

    2-chloro-6-methyl-N-[2-(2-methylphenyl)ethyl]benzene-1-sulfonamide

    [0474] 2-Chloro-6-methyl-benzenesulfonyl chloride (38 mg, 0.17 mmol) was dissolved in DCM (2 mL) and 2-(o-tolyl)ethanamine (40 mg, 0.30 mmol) was added followed by triethylamine (50 μL, 0.35 mmol). The reaction mixture was stirred for 1 hour at room temperature. Water (1 mL) was added. The layers were separated and the organic phase was concentrated. Purification by preparative HPLC (XBridge C18 19×50 mm; 0.1% TFA(aq)/MeCN; 80:20 to 30:70) afforded the title compound as a white solid (5.6 mg, 14%). MS ESI+ m/z 324 [M+H].sup.+.

    Example 12

    2-chloro-N-[2-(2-chlorophenyl)ethyl]-6-methylbenzene-1-sulfonamide

    [0475] 2-Chloro-6-methyl-benzenesulfonyl chloride (38 mg, 0.17 mmol) was dissolved in DCM (2 mL) and 2-(2-chlorophenyl)ethanamine (46 mg, 0.3 mmol) was added followed by triethylamine (50 μL, 0.35 mmol). The reaction mixture was stirred for 1 hour at room temperature. Water (1 mL) was added. The layers were separated and the organic phase was concentrated. Purification by preparative HPLC (XBridge C18 19×50 mm; 0.1% TFA(aq)/MeCN; 80:20 to 30:70) afforded the title compound as a white solid (8.0 mg, 13%). MS ESI+ m/z 344 [M+H].sup.+.

    Example 13

    2-chloro-N-[2-(2-chlorophenyl)ethyl]benzene-1-sulfonamide

    [0476] 2-Chlorobenzenesulfonyl chloride (38 mg, 0.18 mmol) was dissolved in DCM (2 mL) and 2-(2-chlorophenyl)ethanamine (46 mg, 0.3 mmol) was added followed by triethylamine (50 μL, 0.35 mmol). The reaction mixture was stirred for 1 hour at room temperature. Water (1 mL) was added. The layers were separated and the organic phase was concentrated. Purification by preparative HPLC (XBridge C18 19×50 mm; 0.1% TFA(aq)/MeCN; 80:20 to 30:70) afforded the title compound as a white solid (6.2 mg, 11%). MS ESI+ m/z 330 [M+H].sup.+.

    Example 14

    2,4,6-trimethyl-N-[2-(2-methylphenyl)ethyl]benzene-1-sulfonamide

    [0477] 2,4,6-Trimethylbenzenesulfonyl chloride (38 mg, 0.17 mmol) was dissolved in DCM (2 mL) and 2-(o-tolyl)ethanamine (40 mg, 0.3 mmol) was added followed by triethylamine (50 μL, 0.35 mmol). The reaction mixture was stirred for 1 hour at room temperature. Water (1 mL) was added. The layers were separated and the organic phase was concentrated. Purification by preparative HPLC (XBridge C18 19×50 mm; 0.1% TFA(aq)/MeCN; 80:20 to 30:70) afforded the title compound as a white solid (1.1 mg, 2%). MS ESI+ m/z 318 [M+H].sup.+.

    Example 15

    2,4,6-trimethyl-N-{2-[2-(trifluoromethoxy)phenyl]ethyl}benzene-1-sulfonamide

    [0478] 2,4,6-Trimethylbenzenesulfonyl chloride (38 mg, 0.17 mmol) was dissolved in DCM (2 mL) and 2-[2-(trifluoromethoxy)phenyl]ethanamine (61 mg, 0.3 mmol) was added followed by triethylamine (50 μL, 0.35 mmol). The reaction mixture was stirred for 1 hour at room temperature. Water (1 mL) was added. The layers were separated and the organic phase was concentrated. Purification by preparative HPLC (XBridge C18 19×50 mm; 0.1% TFA(aq)/MeCN; 80:20 to 30:70) afforded the title compound as a white solid (3.7 mg, 6%). MS ESI+ m/z 388 [M+H].sup.+.

    Example 16

    2-chloro-6-methyl-N-{2-[2-(trifluoromethyl)phenyl]ethyl}benzene-1-sulfonamide

    [0479] 2-Chloro-6-methyl-benzenesulfonyl chloride (38 mg, 0.17 mmol) was dissolved in DCM (2 mL) and 2-[2-(trifluoromethyl)phenyl]ethanamine (56 mg, 0.3 mmol) was added followed by triethylamine (50 μL, 0.35 mmol). The reaction mixture was stirred for 1 hour at room temperature. Water (1 mL) was added. The layers were separated and the organic phase was concentrated. Purification by preparative HPLC (XBridge C18 19×50 mm; 0.1% TFA(aq)/MeCN; 80:20 to 30:70) afforded the title compound as a white solid (6.8 mg, 10%). MS ESI+ m/z 378 [M+H].sup.+.

    Example 17

    4-bromo-2,6-dichloro-N-[2-(2-methylphenyl)ethyl]benzene-1-sulfonamide

    [0480] 4-Bromo-2,6-dichloro-benzenesulfonyl chloride (38 mg, 0.12 mmol) was dissolved in DCM (2 mL) and 2-(o-tolyl)ethanamine (40 mg, 0.3 mmol) was added followed by triethylamine (50 μL, 0.35 mmol). The reaction mixture was stirred for 1 hour at room temperature. Water (1 mL) was added. The layers were separated and the organic phase was concentrated. Purification by preparative HPLC (XBridge C18 19×50 mm; 0.1% TFA(aq)/MeCN; 80:20 to 30:70) afforded the title compound as a white solid (24 mg, 33%). MS ESI+ m/z 424 [M+H].sup.+.

    Example 18

    2,4-dichloro-N-[2-(2-methylphenyl)ethyl]benzene-1-sulfonamide

    [0481] 2,4-Dichlorobenzenesulfonyl chloride (43 mg, 0.18 mmol) was dissolved in DCM (2 mL) and 2-(o-tolyl)ethanamine (40 mg, 0.3 mmol) was added followed by triethylamine (50 μL, 0.35 mmol). The reaction mixture was stirred for 1 hour at room temperature. Water (1 mL) was added. The layers were separated and the organic phase was concentrated. Purification by preparative HPLC (XBridge C18 19×50 mm; 0.1% TFA(aq)/MeCN; 80:20 to 30:70) afforded the title compound as a white solid (27 mg, 45%). MS ESI+ m/z 344 [M+H].sup.+.

    Example 19

    4-bromo-2,6-dichloro-N-{2-[2-(trifluoromethyl)phenyl]ethyl}benzene-1-sulfonamide

    [0482] 4-Bromo-2,6-dichloro-benzenesulfonyl chloride (200 mg, 0.62 mmol) was dissolved in DCM (0.7 mL) and triethylamine (0.17 mL, 1.23 mmol) was added followed by 2-[2-(trifluoromethyl)phenyl]ethanamine (0.17 mL, 1.05 mmol). The reaction mixture was stirred for 1.5 hour at room temperature. DCM (10 mL) and brine (10 mL) were added to the mixture. The layers were separated and the organic phase was dried over magnesium sulfate, filtered and the solvent was evaporated. Purification by column chromatography on silica gel with petroleum ether/DCM (60:40 to 40:60) afforded the title compound as pale yellow solid (189 mg, 64%). MS ESI− m/z 476 [M−H].sup.−.

    Example 20

    4-bromo-2,6-dichloro-N-[2-(2-chlorophenyl)ethyl]benzene-1-sulfonamide

    [0483] 4-Bromo-2,6-dichloro-benzenesulfonyl chloride (200 mg, 0.62 mmol) was dissolved in DCM (0.7 mL) and 2-(2-chlorophenyl)ethanamine (0.15 mL, 1.05 mmol) was added followed by triethylamine (0.17 mL, 1.23 mmol). The reaction mixture was stirred for 1.5 hour at room temperature. DCM (10 mL) and brine (10 mL) were added to the mixture. The layers were separated and the organic phase was dried over magnesium sulfate, filtered and the solvent was evaporated. Purification by column chromatography on silica gel with petroleum ether/DCM (60:40 to 40:60) afforded the title compound as white solid (231 mg, 84%). .sup.1H NMR (400 MHz, CDCl.sub.3) δ 2.97 (t, J=7.0 Hz, 2H), 3.31-3.43 (m, 2H), 5.25 (t, J=6.0 Hz, 1H), 7.15-7.21 (m, 3H), 7.29-7.34 (m, 1H), 7.58 (s, 2H). MS ESI− m/z 442 [M−H].sup.−.

    Example 21

    2,6-dichloro-N-[2-(2-fluorophenyl)ethyl]benzene-1-sulfonamide

    [0484] 2,6-Dichlorobenzenesulfonyl chloride (100 mg, 0.41 mmol) was dissolved in DCM (0.5 mL) and triethylamine (0.11 mL, 0.81 mmol) was added followed by 2-(2-fluorophenyl)ethanamine (0.09 mL, 0.69 mmol). The reaction mixture was stirred for 1.5 hour at room temperature. DCM (10 mL) and brine (10 mL) were added to the mixture. The layers were separated and the organic phase was dried over magnesium sulfate, filtered and the solvent was evaporated. Purification by column chromatography on silica gel with petroleum ether/DCM (60:40 to 40:60) afforded the title compound as white solid (74 mg, 52%). .sup.1H NMR (400 MHz, CDCl.sub.3) δ 2.88 (t, J=6.9 Hz, 2H), 3.36-3.46 (m, 2H), 5.31 (t, J=5.7 Hz, 1H), 6.95-7.02 (m, 1H), 7.05 (td, J=7.5, 1.0 Hz, 1H), 7.14 (td, J=7.5, 1.6 Hz, 1H), 7.17-7.24 (m, 1H), 7.32 (dd, J=8.7, 7.3 Hz, 1H), 7.43 (s, 1H), 7.45 (d, J=0.7 Hz, 1H). MS ESI+ m/z 348 [M+H].sup.+.

    Example 22

    2,6-dichloro-N-{2-[2-(trifluoromethyl)phenyl]ethyl}benzene-1-sulfonamide

    [0485] 2,6-Dichlorobenzenesulfonyl chloride (100 mg, 0.41 mmol) was dissolved in DCM (0.5 mL) and triethylamine (0.11 mL, 0.81 mmol) was added followed by 2-[2-(trifluoromethyl)phenyl]ethanamine (0.11 mL, 0.69 mmol). The reaction mixture was stirred for 2 hours at room temperature. DCM (10 mL) and brine (10 mL) were added to the mixture. The layers were separated and the organic phase was dried over magnesium sulfate, filtered and the solvent was evaporated. Purification by column chromatography on silica gel with petroleum ether/DCM (60:40 to 40:60) afforded the title compound as white solid (131 mg, 80%). MS ESI+ m/z 398 [M+H].sup.+.

    Example 23

    2,6-dichloro-N-[2-(2-chlorophenyl)ethyl]benzene-1-sulfonamide

    [0486] 2,6-Dichlorobenzenesulfonyl chloride (100 mg, 0.41 mmol) was dissolved in DCM (0.5 mL) and triethylamine (0.11 mL, 0.81 mmol) was added followed by 2-(2-chlorophenyl)ethanamine (0.10 mL, 0.69 mmol). The reaction mixture was stirred for 2 hours at room temperature. DCM (10 mL) and brine (10 mL) were added to the mixture. The layers were separated and the organic phase was dried over magnesium sulfate, filtered and the solvent was evaporated. Purification by column chromatography on silica gel with petroleum ether/DCM (60:40 to 40:60) afforded the title compound as white solid (110 mg, 73%). MS ESI+ m/z 366 [M+H].sup.+.

    Example 24

    2,6-dichloro-N-[2-(2-fluorophenyl)ethyl]-4-(pyridin-3-yl)benzene-1-sulfonamide

    [0487] 4-Bromo-2,6-dichloro-N-[2-(2-fluorophenyl)ethyl]benzene-1-sulfonamide (50 mg, 0.12 mmol) and 3-pyridylboronic acid (17 mg, 0.14 mmol) were dissolved in DME (3 mL) and 2 M aqueous solution of K.sub.2CO.sub.3 (0.18 mL, 0.35 mmol) was added followed by PdCl.sub.2(dppf) (9.56 mg, 0.010 mmol). The reaction mixture was stirred for 16 hours at 80° C. under nitrogen atmosphere. DCM (10 mL) and brine (10 mL) were added to the mixture. The layers were separated and the organic phase was dried over magnesium sulfate, filtered and the solvent was evaporated. Purification by column chromatography on silica gel with petroleum ether/DCM (60:40 to 0:100) then with PE/EtOAc (60:40 to 30:70) afforded the title compound as pale yellow solid (38 mg, 74%). .sup.1H NMR (400 MHz, CDCl.sub.3) δ 2.91 (t, J=6.7 Hz, 2H), 3.36-3.46 (m, 2H), 5.44 (t, J=5.8 Hz, 1H), 6.99 (dd, J=11.6, 6.6 Hz, 1H), 7.05 (t, J=7.3 Hz, 1H), 7.19 (dt, J=15.1, 7.5 Hz, 2H), 7.68 (s, 2H), 7.81 (s, 1H), 8.28 (d, J=4.8 Hz, 1H), 8.81 (s, 1H), 8.98 (s, 1H). MS ESI+ m/z 425 [M+H].sup.+.

    Example 25

    2,6-dichloro-4-cyclopropyl-N-[2-(2-fluorophenyl)ethyl]benzene-1-sulfonamide

    [0488] 4-Bromo-2,6-dichloro-N-[2-(2-fluorophenyl)ethyl]benzene-1-sulfonamide (50 mg, 0.12 mmol) and potassium cyclopropyltrifluoroborate (21 mg, 0.14 mmol) were dissolved in DME (3 mL) and 2 M aqueous solution of K.sub.2CO.sub.3 (0.18 mL, 0.35 mmol) was added followed by PdCl.sub.2(dppf) (9.56 mg, 0.010 mmol). The reaction mixture was stirred for 16 hours at 80° C. under nitrogen atmosphere. DCM (10 mL) and brine (10 mL) were added to the mixture. The layers were separated and the organic phase was dried over magnesium sulfate, filtered and the solvent was evaporated. Purification by column chromatography on silica gel with petroleum ether/DCM (60:40 to 40:60) afforded the title compound as white solid (24 mg, purity 70%). MS ESI+ m/z 388 [M+H].sup.+.

    Example 26

    2,6-dichloro-N-[2-(2-chlorophenyl)ethyl]-4-cyclopropylbenzene-1-sulfonamide

    [0489] 4-Bromo-2,6-dichloro-N-[2-(2-chlorophenyl)ethyl]benzene-1-sulfonamide (50 mg, 0.12 mmol) and potassium cyclopropyltrifluoroborate (21 mg, 0.14 mmol) were dissolved in DME (3 mL) and 2 M aqueous solution of K.sub.2CO.sub.3 (0.18 mL, 0.35 mmol) was added followed by PdCl.sub.2(dppf) (9.6 mg, 0.010 mmol). The reaction mixture was stirred for 16 hours at 80° C. under nitrogen atmosphere. DCM (10 mL) and brine (10 mL) were added to the mixture. The layers were separated and the organic phase was dried over magnesium sulfate, filtered and the solvent was evaporated. Purification by column chromatography on silica gel with petroleum ether/DCM (60:40 to 40:60) afforded the title compound as white solid (24 mg, 46%). MS ESI+ m/z 406 [M+H].sup.+.

    Example 27

    2,6-dichloro-N-[2-(2-chlorophenyl)ethyl]-4-(trifluoromethyl)benzene-1-sulfonamide

    [0490] 2,6-Dichloro-4-(trifluoromethyl)benzenesulfonyl chloride (60 mg, 0.19 mmol) was dissolved in DCM (0.4 mL) and triethylamine (0.05 mL, 0.35 mmol) was added followed by 2-(2-chlorophenyl)ethanamine (0.05 mL, 0.33 mmol). The reaction mixture was stirred for 2 hours at room temperature. DCM (10 mL) and brine (10 mL) were added to the mixture. The layers were separated and the organic phase was dried over magnesium sulfate, filtered and the solvent was evaporated. Purification by column chromatography on silica gel with petroleum ether/DCM (60:40 to 40:60) afforded the title compound as white solid (51 mg, 60%). MS ESI− m/z 430 [M−H].sup.−.

    Example 28

    N-[2,2-difluoro-2-(2-methylphenyl)ethyl]-2,4,6-trimethylbenzene-1-sulfonamide

    [0491] 2,4,6-trimethylbenzenesulfonyl chloride (30 mg, 0.14 mmol) and 2,2-difluoro-2-(2methyl-phenyl)-ethan-1-amine hydrochloride (48 mg, 0.23 mmol) were dissolved in DCM (0.5 mL) and triethylamine (0.6 mL, 0.46 mmol) was added. The reaction mixture was stirred for 2 hours at room temperature. DCM (10 mL) and brine (10 mL) were added to the mixture. The layers were separated and the organic phase was dried over magnesium sulfate, filtered and the solvent was evaporated. Purification by column chromatography on silica gel with petroleum ether/DCM (60:40 to 40:60) afforded the title compound as white solid (34 mg, 69%). .sup.1H NMR (400 MHz, CDCl.sub.3) δ 2.29 (t, J=2.2 Hz, 3H), 2.30 (s, 3H), 2.57 (s, 6H), 3.63 (td, J=14.2, 6.7 Hz, 2H), 4.81 (t, J=6.5 Hz, 1H), 6.91 (s, 2H), 7.15 (dd, J=15.6, 7.8 Hz, 2H), 7.27-7.33 (m, 2H). MS ESI+ m/z 354 [M+H].sup.+.

    Example 29

    4-bromo-2,6-dichloro-N-[2,2-difluoro-2-(2-methylphenyl)ethyl]benzene-1-sulfonamide

    [0492] 4-Bromo-2,6-dichlorobenzenesulfonyl chloride (45 mg, 0.14 mmol) and 2,2-difluoro-2-(2methyl-phenyl)-ethan-1-amine hydrochloride (49 mg, 0.24 mmol) were dissolved in DCM (0.5 mL) and triethylamine (0.06 mL, 0.46 mmol) was added. The reaction mixture was stirred for 3 hours at room temperature and then DCM (10 mL) and brine (10 mL) were added. The layers were separated and the organic phase was dried over magnesium sulfate, filtered and the solvent was evaporated. Purification by column chromatography on silica gel with petroleum ether/DCM (100:0 to 95:5) afforded the title compound as white solid (32 mg, 50%). .sup.1H NMR (400 MHz, CDCl.sub.3) δ 2.39 (t, J=2.1 Hz, 2H), 3.88 (td, J=14.5, 6.4 Hz, 1H), 5.76 (t, J=6.4 Hz, 1H), 7.08-7.18 (m, 2H), 7.27-7.36 (m, 2H), 7.56 (s, 2H). MS ESI− 458 [M−H].sup.−. Hr.

    Example 30

    N-[2-(2-chlorophenyl)-2,2-difluoroethyl]-2,4,6-trimethylbenzene-1-sulfonamide

    [0493] 2,4,6-Trimethylbenzene-1-sulfonyl chloride (50 mg, 0.23 mmol) was dissolved in DCM (1 mL) and 2-(2-chlorophenyl)-2,2-difluoroethan-1-amine (66 mg, 0.34 mmol) was added followed by triethylamine (0.1 mL, 0.69 mmol). The reaction mixture was stirred for 2 hours at room temperature. DCM (10 mL) and brine (10 mL) were added to the mixture. The layers were separated and the organic phase was dried over magnesium sulfate, filtered and the solvent was evaporated. Purification by column chromatography on silica gel with DCM/MeOH (100:0 to 99:1) afforded the title compound as colorless oil (63 mg, 74%). .sup.1H NMR (400 MHz, CDCl.sub.3) δ 2.29 (s, 3H), 2.53 (s, 6H), 3.88 (td, J=13.7, 7.0 Hz, 2H), 4.80 (t, J=7.0 Hz, 1H), 6.86 (s, 2H), 7.21-7.26 (m, 1H), 7.27-7.36 (m, 2H), 7.43 (dd, J=7.7, 1.6 Hz, 1H). MS ESI− 372 [M−H].sup.−.

    Example 31

    4-bromo-2,6-dichloro-N-[2-(2-chlorophenyl)-2,2-difluoroethyl]benzene-1-sulfonamide

    [0494] 4-Bromo-2,6-dichlorobenzenesulfonyl chloride (50 mg, 0.15 mmol) was dissolved in DCM (1 mL) and 2-(2-chlorophenyl)-2,2-difluoroethan-1-amine (50 mg, 0.26 mmol) was added followed by triethylamine (0.06 mL, 0.46 mmol). The reaction mixture was stirred for 2 hours at room temperature. DCM (10 mL) and brine (10 mL) were added to the mixture. The layers were separated and the organic phase was dried over magnesium sulfate, filtered and the solvent was evaporated. Purification by column chromatography on silica gel with DCM/MeOH (100:0 to 99:1) afforded the title compound as colorless oil (45 mg, 66%). .sup.1H NMR (400 MHz, CDCl.sub.3) δ, 4.11 (td, J=14.3, 6.5 Hz, 2H), 5.71 (t, J=6.5 Hz, 1H) 7.17-7.26 (m, 1H), 7.31-7.39 (m, 2H), 7.43-7.51 (m, 1H), 7.55 (s, 2H). MS ESI− 478 [M−H].sup.−.

    Example 32

    N-[2-(2-chlorophenyl)ethyl]-2,6-dimethyl-4-(propan-2-yl)benzene-1-sulfonamide

    [0495] 4-Isopropyl-2,6-dimethyl-benzenesulfonylchloride (50 mg, 0.20 mmol) was dissolved in DCM (0.5 mL) and 2-(2-chlorophenyl)ethylamine (48 μL, 0.34 mmol) was added followed by triethylamine (0.08 mL, 0.61 mmol). The reaction mixture was stirred for 2 hours at room temperature. DCM (10 mL) and brine (10 mL) were added to the mixture. The layers were separated and the organic phase was dried over magnesium sulfate, filtered and the solvent was evaporated. Purification by column chromatography on silica gel with petroleum ether/DCM (65:35 to 40:60) afforded the title compound as colorless oil (56 mg, 75%). MS ESI− m/z 364 [M−H].sup.−.

    Example 33

    2,6-dimethyl-N-[2-(2-methylphenyl)ethyl]-4-(propan-2-yl)benzene-1-sulfonamide

    [0496] 4-Isopropyl-2,6-dimethyl-benzenesulfonylchloride (50 mg, 0.20 mmol) was dissolved in DCM (0.5 mL) and 2-(2-methylphenyl)ethylamine (50 μL, 0.34 mmol) was added followed by triethylamine (0.08 mL, 0.58 mmol) The reaction mixture was stirred for 2 hours at room temperature. DCM (10 mL) and brine (10 mL) were added to the mixture. The layers were separated and the organic phase was dried over magnesium sulfate, filtered and the solvent was evaporated. Purification by column chromatography on silica gel with petroleum ether/DCM (65:35 to 40:60) afforded the title compound as colorless oil (43 mg, 60%). .sup.1H NMR (400 MHz, CDCl.sub.3) δ 1.23 (s, 3H), 1.24 (s, 3H), 2.17 (s, 3H), 2.56 (s, 6H), 2.79 (t, J=7.1 Hz, 2H), 2.84 (hept, J=9.7 Hz, 1H), 3.07-3.18 (m, 2H), 4.41 (t, J=6.2 Hz, 1H), 6.96 (s, 2H), 6.99-7.03 (m, 1H), 7.07-7.16 (m, 3H). MS ESI− m/z 344 [M−H].sup.−.

    Example 34

    N-[2-fluoro-2-(2-methylphenyl)ethyl]-2,4,6-trimethylbenzene-1-sulfonamide

    [0497] 2,4,6-Trimethylbenzene-1-sulfonyl chloride (50 mg, 0.23 mmol) was dissolved in DCM (1 mL) and 2-fluoro-2-(2-methylphenyl)ethan-1-amine (52 mg, 0.34 mmol) was added followed by triethylamine (0.1 mL, 0.69 mmol). The reaction mixture was stirred for 2 hours at room temperature. DCM (10 mL) and brine (10 mL) were added to the mixture. The layers were separated and the organic phase was dried over magnesium sulfate, filtered and the solvent was evaporated. Purification by column chromatography on silica gel with DCM/MeOH (100:0 to 99:1) afforded the title compound as colorless oil (45 mg, 59%). .sup.1H NMR (400 MHz, CDCl.sub.3) δ 2.18 (s, 3H), 2.30 (s, 3H), 2.64 (s, 6H), 3.13 (dddd, J=16.3, 14.5, 8.9, 3.5, 1H), 3.26 (dddd, J=32.5, 14.5, 9.1, 2.9, 1H), 5.02 (dd, J=9.1, 3.5 Hz, 1H), 5.61 (ddd, J=47.9, 8.9, 2.9 Hz, 1H), 6.96 (s, 2H), 7.09-7.14 (m, 1H), 7.17-7.30 (m, 4H). .sup.19F NMR (376 MHz, CDCl.sub.3) δ −185.14 (ddd, J=47.9, 32.5, 16.3 Hz). MS ESI+ m/z 336 [M+H].sup.+.

    Example 35

    4-bromo-2,6-dichloro-N-[2-fluoro-2-(2-methylphenyl)ethyl]benzene-1-sulfonamide

    [0498] 4-Bromo-2,6-dichlorobenzenesulfonyl chloride (50 mg, 0.15 mmol) was dissolved in DCM (1 mL) and 2-fluoro-2-(2-methylphenyl)ethan-1-amine (35 mg, 0.23 mmol) was added followed by triethylamine (60 μL, 0.45 mmol). The reaction mixture was stirred for 2 hours at room temperature. DCM (10 mL) and brine (10 mL) were added to the mixture. The layers were separated and the organic phase was dried over magnesium sulfate, filtered and the solvent was evaporated. Purification by column chromatography on silica gel with DCM/MeOH (100:0 to 99:1) afforded the title compound as white solid (45 mg, 66%). .sup.1H NMR (400 MHz, CDCl.sub.3) δ 2.22 (s, 3H), 3.28 (dddd, J=17.2, 14.7, 8.5, 4.4 Hz, 1H), 3.49 (dddd, J=31.4, 14.7, 8.2, 2.8 Hz, 1H), 5.63 (ddd, J=47.8, 8.5, 2.8 Hz, 1H), 5.69-5.73 (m, 1H), 7.04-7.18 (m, 3H), 7.20-7.25 (m, 1H), 7.56 (s, 2H). .sup.19F NMR (376 MHz, CDCl.sub.3) δ −185.14 (ddd, J=47.8, 31.4, 17.2 Hz). MS ESI− m/z 440 [M−H].sup.−.

    [0499] The compound of Example 35 exists as 2 optical isomers (enantiomers). The two isomers were separated using Supercritical Fluid Chromatography (SFC), as follows: The racemate (65 mg) was dissolved in 1.2 mL of methanol (MeOH) and the preparative chromatography was performed by stacked injections of 100 μL of this solution on an SFC system connected to a photodiode array (PDA) detector. The column used was a 5 μm, YMC Chiral Cellulose-SC, 10 mm×250 mm (diameter×length) column and the column temperature was set to 45° C. An isocratic condition of 20% MeOH in CO.sub.2 was applied at a flow rate of 15 mL/min. The back pressure was set to 120 Bar. The PDA scanned from 220 to 400 and the enantiomers were collected in separate fractions (with the aid of up to 2 mL/min of MeOH as make up solvent for the collection) and pooled from each injection. In this system, the retention time of enantiomer 1 (isomer 1) was 2.43 min (2.26-2.57 min) and that of enantiomer 2 (isomer 2) was 2.72 min (2.59-2.97 min). An amount of 20 mg of each enantiomer was obtained. The enantiomeric ratio was >99% for each of the two isolated isomers.

    Example 36

    N-[2-fluoro-2-(2-methylphenyl)ethyl]-2,6-dimethyl-4-(propan-2-yl)benzene-1-sulfonamide

    [0500] 4-Isopropyl-2,6-dimethylbenzenesulfonyl chloride (50 mg, 0.20 mmol) was dissolved in DCM (1 mL) and 2-fluoro-2-(2-methylphenyl)ethan-1-amine (47 mg, 0.30 mmol) was added followed by triethylamine (0.09 mL, 0.60 mmol). The reaction mixture was stirred for 2 hours at room temperature. DCM (10 mL) and brine (10 mL) were added to the mixture. The layers were separated and the organic phase was dried over magnesium sulfate, filtered and the solvent was evaporated. Purification by column chromatography on silica gel with DCM/MeOH (100:0 to 99:1) afforded the title compound as white solid (52 mg, 71%). .sup.1H NMR (400 MHz, CDCl.sub.3) δ 1.24 (d, J=6.9 Hz, 6H), 2.15 (s, 3H), 2.66 (s, 6H), 2.85 (hept, J=6.9 Hz, 1H), 3.22 (dddd, J=16.5, 14.7, 8.8, 3.6 Hz, 1H), 3.33 (dddd, J=32.4, 14.7, 9.2, 2.9 Hz, 1H), 5.03 (dd, J=9.2, 3.6 Hz, 1H), 5.60 (ddd, J=48.0, 8.8, 2.9 Hz, 1H), 6.99 (s, 2H), 7.08-7.15 (m, J=6.9 Hz, 1H), 7.16-7.30 (m, 3H). .sup.19F NMR (376 MHz, CDCl.sub.3) δ −185.14 (ddd, J=48.0, 32.4, 16.5 Hz). MS ESI+ m/z 364 [M+H].sup.+.

    Example 37

    N-[2-(2-hydroxyphenyl)ethyl]-2,4,6-trimethylbenzene-1-sulfonamide

    [0501] 2-(2-Aminoethyl)phenol (53 mg, 0.39 mmol) was dissolved in DCM (2 mL) and TMS-Cl (49 μL, 0.39 mmol) was added followed by triethylamine (0.1 mL, 0.69 mmol). The reaction mixture was stirred for 30 minutes at room temperature then 2,4,6-trimethylbenzenesulfonyl chloride (50 mg, 0.23 mmol) was added. The reaction mixture was stirred for 1 hour. Acidic water (1 mL) was added and the mixture was stirred for few minutes, the phases were separated and the organic phase was evaporated. Purification by column chromatography on silica gel with DCM/MeOH (100:0 to 97:3) afforded the title compound as yellow solid (45 mg, 61%). MS ESI+ m/z 320 [M+H].sup.+.

    Example 38

    4-bromo-2,6-dichloro-N-[2-(2-hydroxyphenyl)ethyl]benzenesulfonamide

    [0502] 2-(2-aminoethyl)phenol (53 mg, 0.39 mmol) was dissolved in DCM (2 mL) and TMS-Cl (50 μL, 0.40 mmol) was added followed by triethylamine (100 μL, 0.73 mmol). The reaction mixture became clear and was stirred for 20 minutes before 4-bromo-2,6-dichloro-benzenesulfonyl chloride (74 mg, 0.23 mmol) was added. The reaction mixture was stirred for 1 h before water (2 mL) was added. The reaction mixture was stirred for 5 minutes and the organic phase was collected. The aqueous phase was extracted with DCM (2 mL) and the combined organics were dried (MgSO.sub.4) and concentrated. The mixture was dissolved in acetonitrile (1 mL) and 1 drop of 2N HCl was added and the reaction mixture was allowed to stir for 10 minutes. The reaction mixture was concentrated and purified by column chromatography on silica gel with DCM/MeOH (95:5) as eluent. Yield 40 mg (41%). MS ESI.sup.+ m/z 426 [M+H].sup.+. 1H NMR (CDCl3) 2.85 (t, J=6.6 Hz, 2H), 3.35 (t, J=6.6 Hz, 2H), 4.84 (s, br, 1H), 5.44 (s, br, 1H), 6.67-6.73 (m, 1H), 6.77-6.86 (m, 1H), 6.98-7.04 (m, 1H), 7.05-7.13 (m, 1H), 7.55 (s, 2H).

    Example 39

    2,6-dichloro-N-[2-(2-hydroxyphenyl)ethyl]-4-(trifluoromethyl)benzenesulfonamide

    [0503] 2-(2-aminoethyl)phenol (53 mg, 0.39 mmol) was dissolved in DCM (2 mL) and TMS-Cl (50 μL, 0.40 mmol) was added followed by triethylamine (100 μL, 0.73 mmol). The reaction mixture became clear and was stirred for 20 minutes before 2,6-dichloro-4-(trifluoromethyl)benzenesulfonyl chloride (72 mg, 0.23 mmol) was added. The reaction mixture was stirred for 2 hours and 1 drop of water was added and the reaction mixture was concentrated. DCM (2 mL) was added to the residue followed by 3 drops of 3N HCl followed by addition of water (1 mL). The mixture was stirred for 5 minutes and then was extracted with DCM (2×1 mL). The combined organics were dried (MgSO.sub.4) and concentrated. The crude product was purified by column chromatography on silica gel with DCM/MeOH (100:0 to 95:5) as the eluent. Yield 20.5 mg (21%). MS ESI.sup.+ m/z 431 [M+17].sup.+. 1H NMR (CDCl.sub.3) ppm 2.85 (t, J=6.64, 2H), 3.41 (t, J=6.64, 2H), 6.64-6.69 (m, 1H), 6.76-6.82 (m, 1H), 6.98-7.02 (m, 1H), 7.03-7.09 (m, 1H), 7.61 (s, 2H).

    Example 40

    2,6-dichloro-N-[2-(2-hydroxyphenyl)ethyl]benzenesulfonamide

    [0504] 2-(2-aminoethyl)phenol (53 mg, 0.39 mmol) was dissolved in DCM (2 mL) and TMS-Cl (50 μL, 0.40 mmol) was added followed by triethylamine (100 μL, 0.73 mmol). The reaction mixture became clear and was stirred for 20 minutes before 2,6-dichlorobenzenesulfonyl chloride (56 mg, 0.23 mmol) was added. The reaction mixture was stirred for 2 hours before 1 drop of water was added and the reaction mixture was concentrated. DCM (2 mL) was added to the residue followed by 3 drops of 3N HCl followed by addition of water (1 mL). The mixture was stirred for 5 minutes and then was extracted with DCM (2×1 mL). The combined organics were dried (MgSO.sub.4) and concentrated. The crude product was purified by column chromatography on silica gel with petroleum ether/Ethylacetate (100:0 to 50:50) as the eluent. Yield 12 mg (15%). MS ESI.sup.+ m/z 346 [M+H].sup.+.

    Example 41

    2,4-dichloro-6-hydroxy-N-[2-(2-hydroxyphenyl)ethyl]benzenesulfonamide

    [0505] 2-(2-Aminoethyl)phenol (90 mg, 0.66 mmol) was dissolved in dry DCM (3 mL) and TMS-Cl (83 μL, 0.66 mmol) was added followed by triethylamine (136 μL, 1.16 mmol). The reaction mixture was stirred for 30 minutes at room temperature before 2,4-dichloro-6-hydroxy-benzenesulfonyl chloride (101 mg, 0.386 mmol was added. The reaction mixture was stirred for 1 hour before 2N HCl(aq) was added. The reaction mixture was concentrated and purified by preparative HPLC (XBridge C18 column, 10-60% acetonitrile in NH.sub.4CO.sub.3/NH.sub.3 buffer) to give 72 mg, (51%) of a light yellow solid. MS ESI.sup.+ m/z 362 [M+H].sup.+ 1H NMR (CDCl.sub.3) 2.86 (t, 2H), 3.27 (q, 2H), 5.00 (br s, 1H), 5.53 (br t, 1H), 6.71 (d, 1H), 6.86 (dt, 1H), 6.94 (d, 1H), 6.98 (d, 1H), 7.04 (dd, 1H), 7.12 (dt, 1H), 10.08 (s, 1H)

    Example 42

    2,4-dichloro-6-hydroxy-N-[2-(o-tolyl)ethyl]benzenesulfonamide

    [0506] 2-(o-tolyl)ethanamine (31 mg, 0.23 mmol) was dissolved in dry DCM (2 mL) followed by addition of triethylamine (45 μL, 0.38 mmol) and 2,4-dichloro-6-hydroxy-benzenesulfonyl chloride. The reaction mixture was stirred for 30 minutes at room temperature before 2,4-dichloro-6-hydroxy-benzenesulfonyl chloride (50 mg, 0.19 mmol was added. The reaction mixture was stirred for 1 hour and concentrated. The residue was dissolved in acetonitrile and purified by preparative HPLC (XBridge C18 column, 10-70% acetonitrile in NH.sub.4CO.sub.3 NH.sub.3 buffer). The product obtained was dissolved in dichloromethane and filtered to remove the residual NH.sub.4CO.sub.3 from the buffer before it was concentrated. The colorless oil was dissolved in water and freeze dried to give a white solid. Yield 24 mg (35%). MS ESI.sup.+ m/z 360 [M+H].sup.+ 1H NMR (CDCl.sub.3) 2.25 (s, 3H), 2.86 (t, 2H), 3.20 (q, 2H), 6.99 (q, 2H), 7.06 (m, 1H), 7.15 (m, 3H), 10.07 (s, 1H)

    Example 43

    4-chloro-3-hydroxy-N-[2-(2-hydroxyphenyl)ethyl]benzenesulfonamide

    [0507] 2-(2-Aminoethyl)phenol (51.4 mg, 0.37 mmol) was dissolved in dry DCM (2 mL) and TMS-Cl (48 μL, 0.37 mmol) was added followed by triethylamine (78 μL, 0.66 mmol). The reaction mixture was stirred for 30 minutes at room temperature before 4-chloro-3-hydroxy-benzenesulfonyl chloride (50 mg, 0.22 mmol was added. The reaction mixture was stirred for 1 hour before 2N HCl (aq) was added and the reaction mixture was concentrated. The residue was dissolved in acetonitrile-water and purified by preparative HPLC (XBridge C18 column, 10-60% acetonitrile in NH.sub.4CO.sub.3/NH.sub.3 buffer) to give 22 mg (31%) of the product. MS ESI.sup.+ m/z 328 [M+H].sup.+ 1H NMR (CDCl.sub.3) 2.80 (t, 2H), 3.25 (q, 2H), 5.11 (br s, 1H), 6.19 (br s, 1H), 6.73 (dd, 1H), 6.81 (dt, 1H), 6.97 (dd, 1H), 7.08 (dt, 1H), 7.25 (dd, 1H), 7.36 (d, 1H), 7.40 (d, 1H).

    Example 44

    6-chloro-3-hydroxy-N-[2-(2-hydroxyphenyl)ethyl]-2,4-dimethyl-benzenesulfonamide

    [0508] 2-(2-Aminoethyl)phenol (47 mg, 0.34 mmol) was dissolved in dry DCM (2 mL) and TMS-Cl (43 μL, 0.34 mmol) was added followed by triethylamine (71 μL, 0.60 mmol). The reaction mixture was stirred for 30 minutes at room temperature before 6-chloro-3-hydroxy-2,4-dimethyl-benzenesulfonyl chloride (51.0 mg, 0.20 mmol) was added and the mixture was stirred for an additional 1 h. After the reaction was complete, 4N HCl in dioxane was added and the mixture was stirred for 15 minutes. The reaction mixture was concentrated, and the residue was dissolved in acetonitrile-water and purified by preparative HPLC (XBridge C18 column, 10-70% acetonitrile in NH.sub.4CO.sub.3/NH.sub.3 buffer) to obtain 29 mg (41%) of the title product as a white solid. MS ESI.sup.+ m/z 356 [M+H].sup.+ 1H NMR (CDCl.sub.3) 2.25 (s, 3H), 2.60 (s, 3H), 2.83 (t, 2H), 3.19 (q, 2H), 5.05 (br s, 1H), 5.56 (t, 1H), 6.74 (dd, 1H), 6.83 (dt, 1H), 7.02 (dd, 1H), 7.10 (m, 2H).

    Example 45

    3,5-dichloro-2-[2-(o-tolyl)ethylsulfamoyl]benzoic acid

    [0509] 2-(o-tolyl)ethanamine (26.5 mg, 0.196 mmol) was dissolved in dry DCM (2 mL) followed by addition of triethylamine (39 μL, 0.34 mmol) and methyl 3,5-dichloro-2-chlorosulfonyl-benzoate (51.0 mg, 0.168 mol). The reaction mixture was stirred for 2.5 hours at room temperature and concentrated. The residue was dissolved in acetonitrile and purified by preparative HPLC (XBridge C18 column, 20-80% acetonitrile in NH.sub.4CO.sub.3/NH.sub.3 buffer). The product obtained was dissolved in dichloromethane, filtered to remove residual NH.sub.4CO.sub.3 from the buffer and concentrated. The residue was dissolved in water and freeze dried to obtain the product as a white solid (26 mg, 40% yield). MS ESI.sup.+ m/z 388 [M+H].sup.+ 1H NMR (CDCl.sub.3) 2.44 (s, 3H), 3.15 (t, 2H), 3.92 (t, 2H), 7.18 (m, 4H), 7.77 (d, 1H), 7.90 (d, 1H).

    Example 46

    N-[2-(2-chlorophenyl)ethyl]-4-methoxy-2,6-dimethyl-benzenesulfonamide

    [0510] 4-methoxy-2,6-dimethyl-benzenesulfonyl chloride (100 mg, 0.426 mmol) was dissolved in DCM (2 mL) and 2-(2-chlorophenyl)ethanamine (66.3 mg, 0.426 mol) was added followed by triethylamine (131 μL, 0.94 mmol). The reaction mixture was stirred for 3 hours, diluted with water and extracted with DCM (2×10 mL). The combined organics were dried over (MgSO.sub.4) and concentrated. The crude product was purified by column chromatography on silica gel with DCM/MeOH (100:0 to 97.5:2.5) to afford the title compound as a colorless oil. Yield 95 mg (63%). MS m/z 354 [M+H].sup.+. HPLC purity 95%. 1H-NMR (400 MHz, CDCl.sub.3): ppm 2.58 (s, 6H), 2.89 (t, J=7.0 Hz, 2H), 3.16-3.21 (m, 2H), 3.81 (s, 3H), 4.40-4.46 (m, 1H), 6.61 (s, 2H), 7.10-7.19 (m, 3H), 7.26-7.33 (m, 1H).

    Example 47

    N-[2-(2-hydroxyphenyl)ethyl]-4-methoxy-2,6-dimethyl-benzenesulfonamide

    [0511] 4-methoxy-2,6-dimethyl-benzenesulfonyl chloride (100 mg, 0.426 mmol) was dissolved in DCM (4 mL) and TMS-Cl (0.0919 mL, 0.724 mmol) was added followed by triethylamine (150 μL g, 0.128 mol). The reaction was stirred for 10 minutes before 4-methoxy-2,6-dimethyl-benzenesulfonyl chloride (100 mg, 0.426 mol) was added. The reaction mixture was stirred for 1 hour before 0.25N HCl (4 mL) was added and the mixture was stirred for 10 minutes. The reaction mixture was extracted with DCM (2×10 mL) and the combined organics were dried (MgSO.sub.4) and concentrated to give a colorless oil. The crude product was purified by column chromatography on silica gel with DCM/MeOH (100:0 to 97.5:2.5) to afford the title compound. Yield 40 mg (28%). MS m/z 336 [M+H].sup.+. 1H NMR (400 MHz, CDCl.sub.3) ppm 2.56 (s, 6H), 2.79 (t, J=6.44 Hz, 2H), 3.12-3.17 (m, 2H), 3.80 (s, 3H), 4.84-4.90 (m, 1H), 5.70 (bs, 1H), 6.60 (s, 2H), 6.74-6.80 (m, 2H), 6.95-7.00 (m, 1H), 7.06-7.10 (m, 1H).

    Example 48

    4-hydroxy-N-[2-(2-hydroxyphenyl)ethyl]-2,6-dimethyl-benzenesulfonamide

    [0512] N-[2-(2-hydroxyphenyl)ethyl]-4-methoxy-2,6-dimethyl-benzenesulfonamide (35.0 mg, 0.104 mmol) was dissolved in DCM (300 μL) and a 1N solution of BBr.sub.3 (300 μL, 0.3 mmol) was added. The reaction mixture was stirred for 3 hours before water was added. An emulsion formed. The mixture was diluted with DCM and water. The aqueous phase was extracted with DCM (11×). The combined organics were dried (MgSO.sub.4) and concentrated. The crude product was purified by preparative HPLC (ACE C18 19×50 mm); 0.1% TFA in water/MeCN; 90:10 to 30:70 to give 2.0 mg (6%) of a white solid. MS ESI.sup.+ m/z 322 [M+H].sup.+. HPLC purity>95%.

    [0513] The structural formulas of Examples 1-48 are shown in Table 1.

    TABLE-US-00001 TABLE 1 Example Structural formula Chemical name 1 [00022]embedded image N-[2-(2-methoxyphenyl)ethyl]-2,4,6- trimethylbenzene-1-sulfonamide 2 [00023]embedded image N-[2-(2-fluorophenyl)ethyl]-2,4,6- trimethylbenzene-1-sulfonamide 3 [00024]embedded image N-[2-(2-fluorophenyl)ethyl]-2,2,4,6,7- pentamethyl-2,3-dihydro-1-benzofuran-5- sulfonamide 4 [00025]embedded image 4-bromo-2,6-dichloro-N-[2-(2- methoxyphenyl)ethyl]benzene-1- sulfonamide 5 [00026]embedded image 4-bromo-2,6-dichloro-N-[2-(2- fluorophenyl)ethyl]benzene-1-sulfonamide 6 [00027]embedded image N-[2-(2-chlorophenyl)ethyl]-2,4,6- trimethylbenzene-1-sulfonamide 7 [00028]embedded image N-[2-(2-bromophenyl)ethyl]-2,4,6- trimethylbenzene-1-sulfonamide 8 [00029]embedded image 4-bromo-2-chloro-N-[2-(2- chlorophenyl)ethyl]benzene-1-sulfonamide 9 [00030]embedded image N-[2-(2-chlorophenyl)ethyl]-2,2,4,6,7- pentamethyl-2,3-dihydro-1-benzofuran-5- sulfonamide 10 [00031]embedded image 2,4,6-trimethyl-N-{2-[2- (trifluoromethyl)phenyl]ethyl}benzene-1- sulfonamide 11 [00032]embedded image 2-chloro-6-methyl-N-[2-(2- methylphenyl)ethyl]benzene-1-sulfonamide 12 [00033]embedded image 2-chloro-N-[2-(2-chlorophenyl)ethyl]-6- methylbenzene-1-sulfonamide 13 [00034]embedded image 2-chloro-N-[2-(2- chlorophenyl)ethyl]benzene-1-sulfonamide 14 [00035]embedded image 2,4,6-trimethyl-N-[2-(2- methylphenyl)ethyl]benzene-1-sulfonamide 15 [00036]embedded image 2,4,6-trimethyl-N-{2-[2- (trifluoromethoxy)phenyl]ethyl}benzene-1- sulfonamide 16 [00037]embedded image 2-chloro-6-methyl-N-{2-[2- (trifluoromethyl)phenyl]ethyl}benzene-1- sulfonamide 17 [00038]embedded image 4-bromo-2,6-dichloro-N-[2-(2- methylphenyl)ethyl]benzene-1-sulfonamide 18 [00039]embedded image 2,4-dichloro-N-[2-(2- methylphenyl)ethyl]benzene-1-sulfonamide 19 [00040]embedded image 4-bromo-2,6-dichloro-N-{2-[2- (trifluoromethyl)phenyl]ethyl}benzene-1- sulfonamide 20 [00041]embedded image 4-bromo-2,6-dichloro-N-[2-(2- chlorophenyl)ethyl]benzene-1-sulfonamide 21 [00042]embedded image 2,6-dichloro-N-[2-(2- fluorophenyl)ethyl]benzene-1-sulfonamide 22 [00043]embedded image 2,6-dichloro-N-{2-[2- (trifluoromethyl)phenyl]ethyl}benzene-1- sulfonamide 23 [00044]embedded image 2,6-dichloro-N-[2-(2- chlorophenyl)ethyl]benzene-1-sulfonamide 24 [00045]embedded image 2,6-dichloro-N-[2-(2-fluorophenyl)ethyl]-4- (pyridin-3-yl)benzene-1-sulfonamide 25 [00046]embedded image 2,6-dichloro-4-cyclopropyl-N-[2-(2- fluorophenyl)ethyl]benzene-1-sulfonamide 26 [00047]embedded image 2,6-dichloro-N-[2-(2-chlorophenyl)ethyl]-4- cyclopropylbenzene-1-sulfonamide 27 [00048]embedded image 2,6-dichloro-N-[2-(2-chlorophenyl)ethyl]-4- (trifluoromethyl)benzene-1-sulfonamide 28 [00049]embedded image N-[2,2-difluoro-2-(2-methylphenyl)ethyl]- 2,4,6-trimethylbenzene-1-sulfonamide 29 [00050]embedded image 4-bromo-2,6-dichloro-N-[2,2-difluoro-2-(2- methylphenyl)ethyl]benzene-1-sulfonamide 30 [00051]embedded image N-[2-(2-chlorophenyl)-2,2-difluoroethyl]- 2,4,6-trimethylbenzene-1-sulfonamide 31 [00052]embedded image 4-bromo-2,6-dichloro-N-[2-(2- chlorophenyl)-2,2-difluoroethyl]benzene-1- sulfonamide 32 [00053]embedded image N-[2-(2-chlorophenyl)ethyl]-2,6-dimethyl-4- (propan-2-yl)benzene-1-sulfonamide 33 [00054]embedded image 2,6-dimethyl-N-[2-(2-methylphenyl)ethyl]- 4-(propan-2-yl)benzene-1-sulfonamide 34 [00055]embedded image N-[2-fluoro-2-(2-methylphenyl)ethyl]-2,4,6- trimethylbenzene-1-sulfonamide 35 [00056]embedded image 4-bromo-2,6-dichloro-N-[2-fluoro-2-(2- methylphenyl)ethyl]benzene-1-sulfonamide 36 [00057]embedded image N-[2-fluoro-2-(2-methylphenyl)ethyl]-2,6- dimethyl-4-(propan-2-yl)benzene-1- sulfonamide 37 [00058]embedded image N-[2-(2-hydroxyphenyl)ethyl]-2,4,6- trimethylbenzene-1-sulfonamide 38 [00059]embedded image 4-bromo-2,6-dichloro-N-[2-(2- hydroxyphenyl)ethyl]benzenesulfonamide 39 [00060]embedded image 2,6-dichloro-N-[2-(2-hydroxyphenyl)ethyl]- 4-(trifluoromethyl)benzenesulfonamide 40 [00061]embedded image 2,6-dichloro-N-[2-(2- hydroxyphenyl)ethyl]benzenesulfonamide 41 [00062]embedded image 2,4-dichloro-6-hydroxy-N-[2-(2- hydroxyphenyl)ethyl]benzenesulfonamide 42 [00063]embedded image 2,4-dichloro-6-hydroxy-N-[2-(o- tolyl)ethyl]benzenesulfonamide 43 [00064]embedded image 4-chloro-3-hydroxy-N-[2-(2- hydroxyphenyl)ethyl]benzenesulfonamide 44 [00065]embedded image 6-chloro-3-hydroxy-N-[2-(2- hydroxyphenyl)ethyl]-2,4-dimethyl- benzenesulfonamide 45 [00066]embedded image 3,5-dichloro-2-[2-(o- tolyl)ethylsulfamoyl]benzoic acid 46 [00067]embedded image N-[2-(2-chlorophenyl)ethyl]-4-methoxy-2,6- dimethyl-benzenesulfonamide 47 [00068]embedded image N-[2-(2-hydroxyphenyl)ethyl]-4-methoxy- 2,6-dimethyl-benzenesulfonamide 48 [00069]embedded image 4-hydroxy-N-[2-(2-hydroxyphenyl)ethyl]- 2,6-dimethyl-benzenesulfonamide

    [0514] Biological Assays

    [0515] In Vitro Assays of Nox Inhibiting Activity

    [0516] Materials

    [0517] RPMI 1640 with Glutamax, DMEM/F12 (1:1), Hanks' buffered salt solution (HBSS), fetal bovine serum (FBS), and Amplex Red were purchased from Invitrogen, Paisley, UK. Pest (penicillin, streptomycin), neomycin, blasticidine, ionomycin, phorbol myristate acetate (PMA), diphenyleneiodonium chloride (DPI), dapsone, ML-171, Phox-I2, xanthine, hypoxanthine, xanthine oxidase, DMSO, DPPH (2,2-diphenyl-1-picrylhydrazyl), Tween® 20, sucrose, flavin adenine dinucleotide (FAD), phosphatidic acid, ethylene glycol-bis(β-aminoethyl ether)-N,N,N′,N′-tetraacetic acid (EGTA), horseradish peroxidase (HRP) and NADPH were purchased from Sigma-Aldrich. Ficoll Paque Plus (GE Healthcare) GKT136901 (chemical name: 2-(2-Chlorophenyl)-4-methyl-5-(pyridin-2-ylmethyl)-1H-pyrazolo[4,3-c]pyridine-3,6-dione), a Nox1/Nox4 selective inhibitor, was a kind gift from prof. Harald H H Schmidt (Maastricht University, Netherlands).

    [0518] Cell Culture

    [0519] HEK293 overexpressing Nox4 (CJ Nox4) cells were purchased from Redoxis, Lund, Sweden. HEK 293 cells expressing Nox5, Nox3 (HEK TRex) and CHO cells expressing Nox1, were a kind gift from Vincent Jaque Center Medical Universitaire, Geneva, Switzerland. Nox2 expressed in isolated neutrophils were isolated from whole blood (human), as previously described (Anvari E, et al., Free Radic Res 2015; 49:1308-1318).

    [0520] HEK293 cells (CJ Nox4) were cultured in RPMI 1640 with Glutamax supplemented with FBS (10%), penicillin (100 U/ml) and streptomycin (100 mg/ml) at 37° C. in air with 5% CO.sub.2. Every third passage 200 □g/ml neomycin were supplied in growth medium as selective agent.

    [0521] HEK293T cells expressing tetracycline-inducible human (Nox3 or Nox4) and HEK293 cells stably expressing human Nox5 were generated as described previously (Serrander et al., 2007a,b). HEK cells were cultured in Dulbecco's modified Eagle medium (DMEM) with 4.5 g/l glucose, supplemented with FBS (10%), penicillin (100 U/ml) and streptomycin (100 mg/ml) at 37° C. in air with 5% CO.sub.2.

    [0522] CHO cells expressing Nox1 were cultured in DMEM 12 medium (DMEM/F12) supplemented with FBS (10%), penicillin (100 U/ml) and streptomycin (100 μg/ml) at 37° C. in air with 5% CO.sub.2.

    [0523] ROS Measurement in Assays

    [0524] Reactive oxygen produced in whole cells or in membrane preparation of Nox1, Nox3, Nox4, Nox5 and xanthine oxidase and glucose oxidase were determined using Amplex Red as detection probe of formed H.sub.2O.sub.2. Amplex Red (10-acetyl-3,7-dihydroxyphenoxazine) in combination with HRP and co-factors reacts with H.sub.2O.sub.2 in a 1:1 stoichiometry to form a highly fluorescent resorufin excitated at 544 nm producing emission at 590 nm.

    [0525] DPPH Redox Assay

    [0526] DPPH, a well-known sensitive chemical of monitoring reactions involving radicals described by Xiong Q, et al., Biol Pharm Bull 1996; 19:1580-1585, was used as control to exclude any redox active compound. DPPH was incubated with decreasing concentrations (200-0.003 μM) of compounds of the invention or prior art compound GKT136901 (as a positive control). The plate was kept in the dark for 60 min, after which the absorbance of the solution was measured at 518 nm.

    [0527] Fluorescence Based Amplex Red Assays of Intact Nox Expressing HEK and CHO Cells

    [0528] Adherent cells (CHO, HEK) were collected by trypsinization, centrifuged, washed with HBSS, counted, and resuspended in HBSS. Cells were seeded in 96-well black flat bottom plates at a density of 50,000-100,000 cells/well. All compounds were dissolved in DMSO and concentrations ranging from 0.003 to 200 μM were tested in Nox cellular assays with a final concentration of DMSO of 1%. Cells were incubated at 37° C. with the compounds for 30 minutes before measurement. Cells expressing Nox1 and Nox2 were activated with the PKC activator PMA (0.1 μM). Nox5 was activated with the Ca2+ ionophore ionomycin (1 μM) and further enforced with PMA. The CJ HEK 293 cells overexpressed Nox4 constitutively. In the HTS screen HEK 293 TRex was used and tetracycline (1 mg/ml) was added 18 h before measurement to induce Nox4 expression. Production of hydrogen peroxide by Nox in intact cells was measured using Amplex Red fluorescence as described by Jaquet V, et al., Br J Pharmacol 2011; 164:507-520. Assay reagents including HRP (0.1 mM) and Amplex Red (50 μM) were added to initiate production of hydrogen peroxide. Fluorescence was read in a fluorescence plate reader at 37° C. every minute between 30-60 minutes.

    [0529] Membrane Preparation

    [0530] Membranes from transfected cells overexpressing Nox1 (CHO), Nox2 (PLB), Nox3 (HEK), Nox4 (HEK) or Nox5 (HEK) were prepared as described in Pailcz et al., 2001, J. Biol. Chem, 76, 3090-3097. Cells were suspended and homogenized in sonication buffer containing PBS, sucrose (11%), NaCl (120 mM) and EGTA (1 mM) supplemented with protease inhibitors and further processed and then broken by sonication cooled with an ice bath. Then the sample was centrifuged at 200×g for 10 min. Supernatant was carefully added on top of a 17/40% discontinuous sucrose gradient and centrifuged at 150 000×g for 60 min. Membranes containing Nox isoforms were collected at the 17/40% sucrose interface as described by Jaquet V, et al., Br J Pharmacol 2011; 164:507-520. For the Nox isoforms Nox1, Nox2, Nox3 a subunit-specific cell-free, membrane-based system has been developed and recombinant proteins of the subunits were added to receive activation of the Nox-iso forms in the cell-free assay. The Amplex Red assay was performed in black 96-well flat bottom plates. Assay reagents including HRP (0.1 mM), FAD (6 μM), phosphatidic acid (15 μM) and Amplex Red (50 μM) were added followed by NADPH (30 μM) to initiate production of hydrogen peroxide. The production of hydrogen peroxide was followed by use of a fluorescence plate reader, read at 37° C. every minute between 30-60 minutes.

    [0531] Determination of IC.sub.50 for Nox2 Inhibition in Human Neutrophils Using Isoluminol-Dependent Chemiluminescence

    [0532] Compounds of the invention were tested for selectivity against Nox2 in isolated neutrophils from whole blood (human), as previously described (Anvari E, et al., vide supra). Levels of ROS from PMA stimulated primary human neutrophils were measured using isoluminol-dependent chemiluminescence. Isoluminol is a hydrophobic dye unable to pass biological membranes, hence extracellular ROS can be determined. The dye is excited by ROS and the light emitted when the excited molecules return to the ground state, relative to the amount of released ROS, is measured. This reaction is catalyzed and amplified by peroxidases. Naturally occurring peroxidase can achieve this, however secretion of endogenous peroxidases is limited and hence additional peroxidase in the form of HRP needs to be added. Compounds of the invention and GKT136901 were diluted at 4× working concentration and titrated from 100 μM to 0.006 μM in 1:4 steps as final concentrations. DPI was diluted in isoluminol buffer at 4× working concentration titrated from 10 μM to 0.0006 μM as final concentrations. PMA was diluted in isoluminol buffer at 4× working concentration for a final concentration of 30 ng/ml. Compounds and DPI had a final DMSO concentration of 1% in the wells and DMSO of 1% also in the control. Luminescence was detected using FluoStar Optima (BMG, Labtech). The isoluminol buffer was prepared immediately prior to addition to test plate. The buffer contained HRP fraction with or without PMA (30 ng/ml). Stock solutions at 6 μg/ml (PMA in HBSS), 3 μg/ml (PMA in DMSO) and 24 mM (DPI) were used and further diluted at the day of analysis to 4× working concentrations in HBSS with or without DMSO.

    [0533] Amplex Red Xanthine Oxidase (XO) Assay

    [0534] The assay was designed for Amplex Red analysis of production of hydrogen peroxide. Test compounds were incubated with 5 mU/ml bovine derived xanthine oxidase for 15 min at room temperature followed by the addition of substrate and detection mix (final concentrations of 0.2 U/ml HRP, 5 μM hypoxanthine, and 50 μM Amplex Red). As described by Hirano K et al., Antioxid Redox Signal 2015 10; 23:358-374, production of hydrogen peroxide was followed by fluorescence detection during 30 min at 37° C. in a plate reader that use excitation at 544 nm producing emission at 590 nm.

    [0535] Amplex Red and Glucose Oxidase (GO) Assay

    [0536] The assay was performed using a modified form of Invitrogen Amplex™ Red Glucose/Glucose Oxidase Assay Kit Cat no: A22189. Test compounds were incubated with 5 mU/ml glucose oxidase for 30 min at room temperature, followed by the addition of substrate and detection mix (final concentrations of 0.1 U/ml HRP, 10 mM glucose, 50 μM Amplex Red in phosphate buffer pH 7.4) and then fluorescence detection of hydrogen peroxide production was performed during 30 min at 37° C. in a plate reader that use excitation at 544 nm producing emission at 590 nm.

    [0537] Results of above described biological assays are shown in Tables 2 and 3.

    TABLE-US-00002 TABLE 2 Biological effect Ex. 11 Ex. 17 Ex. 26 IC.sub.50 on hNox4 in recombinant cells 2.4 μM 0.27 μM 0.36 μM Ki on hNox4 in membrane assay 4.4 μM 0.56 μM  2.2 μM Activity on Nox1, Nox2, Nox3 and inactive inactive inactive Nox5 Inhibition of oxygen consumption in yes yes yes Nox4 expressing HEK293 cells Inhibition of oxygen consumption No No No in Nox1 expressing CHO cells

    TABLE-US-00003 TABLE 3 IC.sub.50 (μM) of compounds of the invention and of prior art compound GKT136901 Ex. Nox4 Nox1 Nox2 Nox3 Nox5 XO DPPH GO 2 2.2 — — n.a. — — — n.a. 6 0.27 — — n.a. — — — n.a. 7 0.27 — — n.a. — — n.a. 9 1.6 — — n.a. — — — n.a. 11 2.4 — — — — — — — 14 0.09 — — n.a. — — — n.a. 17 0.27 — — — — — — — 20 0.9 — n.a. n.a. — — — n.a. 25 1.1 — n.a. n.a. — — — n.a. 26 0.36 — — — — — — — 27 1.6 — n.a. n.a. — — — n.a. 35 1.7 — — n.a. — — — n.a. 35 1.7 — — n.a. — — — n.a. (isomer 1) 35 4.9 — — n.a. — — — n.a. (isomer 2) 37 0.8 — 0.9 n.a. — — — n.a. 38 0.3 — 1.5 n.a. — — — n.a. 44 2.4 — 0.9 n.a. — — — n.a. 46 0.3 — — n.a. — — — n.a. 47 1.6 — 1.0 n.a. — — — n.a. 48 22 — 0.87 n.a. — — — n.a. GKT136901 1.6 0.5 9 n.a. 66-22 n.a. active n.a. The sign “—” stands for “inactive”; “n.a.” stands for “not analyzed”.

    [0538] Ischemic Stroke and Nox4—In Vitro Model

    [0539] Compounds of the invention (Examples 11, 17 and 44) have demonstrated neuroprotective effect, using two different in vitro stroke models. Hippocampal brain slices and human brain micro-vascular endothelial cells were subjected to hypoxia and glucose deprivation (starvation) for 5 hours and were tested for viability after 24 hours of culture in the presence of Example 11 or Example 17 at different concentrations. Additionally, human brain micro-vascular endothelial cells were subjected to hypoxia and glucose deprivation (starvation) for 6 hours and were tested for viability after 24 hours of culture in the presence of Example 44 at various concentrations. The results are shown in FIGS. 1-5.

    [0540] In Vivo Model of Acute Ischemic Stroke

    [0541] A mouse model of acute ischemic stroke by transient middle cerebral artery occlusion (tMCAO) was used. The model has been described by Kleinschnitz C, et al. 2010, J Exp Med 203(3):513-518. C57B16/J mice were anesthetized with isoflurane (0.8% in oxygen). The animal was placed on a heating-pad, and rectal temperature was maintained at 37.0° C. using a servo-controlled rectal probe-heating pad (Cibertec, Spain). Transient cerebral ischemia was induced using an intraluminal filament technique. Using a surgical microscope (Tecnoscopio OPMI pico, Carl Zeiss, Meditec Iberia SA, Spain), a midline neck incision was made and the right common and external carotid arteries were isolated and permanently ligated. A microvascular temporary ligature was placed on the internal carotid artery to non-permanently cut the blood flow. A silicon rubber-coated monofilament (6023910PK10, Doccol Corporation, Sharon, Mass., USA) was inserted through a small incision into the common carotid artery and advanced into the internal carotid artery until a resistance was felt. The tip of the monofilament was precisely located at the origin of the right middle cerebral artery so as to interrupt blood flow. The filament was held in place by a tourniquet suture in the common carotid artery to prevent filament relocation during the ischemia period. Animals were maintained under anaesthesia during 1 h occlusion followed by the reperfusion period that started when the mono filament was removed. After the surgery, wounds were carefully sutured and animals were allowed to recover from surgery in a temperature-controlled cupboard. Operation time per animal did not exceed 15 minutes. Animals were excluded from the stroke analysis, if they died within the first 24 h period, or if an intracerebral haemorrhage occurred.

    [0542] Example 17 was dissolved in a mixture of DMSO/Cremophor/saline. Either Example 17 (2.56 mg/kg), or vehicle (DMSO/Cremophor/saline) was administered by intraperitoneal (ip) injection either 1 hour after reperfusion or 30 min before the removal of the filament. Injection was performed in total 6 times, once per hour, and the mice were sacrificed after 24 h.

    [0543] After sacrificing the mice (24 h reperfusion), brains were quickly removed and cut in four 2-mm thick coronal sections using a mouse brain slice matrix (Harvard Apparatus, Spain). The slices were stained for 15 min at room temperature with 2% 2,3,5-triphenyltetrazolium chloride (TTC; Sigma-Aldrich, The Netherlands) in PBS to visualize the infarctions (FIGS. 6 and 8). Indirect infarct volumes were calculated by volumetry (ImageJ software, National Institutes of Health, USA) according to the following equation: V.sub.indirect (mm.sup.3)=V.sub.infarct×(1−(V.sub.ih−V.sub.ch)/V.sub.ch), where the term (V.sub.ih−V.sub.ch) represents the volume difference between the ischemic hemisphere and the control hemisphere and (V.sub.ih−V.sub.ch)/V.sub.ch expresses this difference as a percentage of the control hemisphere (FIGS. 7 and 9).

    [0544] As may be seen from FIGS. 6 and 8, the control animals suffer from large areas of neuronal cell death, shown by the white areas in the images. The mice that were treated by Example 17 had significant reduction in brain damage, as shown by the significantly reduced area of white, demonstrating the protective effect of the highly selective Nox4 inhibitor. FIGS. 7 and 9 show a substantial reduction of infarct volume in animals treated by Example 17, compared to control animals.

    [0545] In Vitro Models of Alzheimer (Tauopathy)

    [0546] Tauopathy belongs to a class of neurodegenerative diseases associated with the pathological aggregation of tau protein in neurofibrillary or gliofibrillary tangles in the human brain. Tangles are formed of a microtubule-associated protein known as tau, causing it to aggregate in an insoluble form. In an in vitro model cultured human neuroblastoma SHSY-5Y cells were exposed to okadaic acid (15 nM), in the absence or presence of different concentrations (0.3 μM, 3 μM, or 10 μM) of Example 17, or in the presence of melatonin (10 μM) as a positive control (FIG. 10).

    [0547] In a further experiment, mice hippocampal slices treated were treated with okadaic acid. The animals were either wildtype (WT) or Nox4 knockout (KO) mice. The slices were stabilized for 40 minutes in culture medium and treated for 6 hours with okadaic acid (1 μM), in the absence or presence of Example 11 (10 μM). The Nox inhibitor VAS2870 (3-benzyl-7-(2-benzoxazolyl)thio-1,2,3-triazolo[4,5-d]pyrimidine) was used as a positive control. Cell viability was determined by MTT assay. The results are illustrated in FIG. 11.

    [0548] Effects on Human Islet Cell Viability

    [0549] Human islet cells were incubated at control condition, with the cytokines IL-1β (20 ng/ml)+IFN-γ (20 ng/ml), or with palmitate (1.5 mM+2% BSA)+high glucose (20 mM) (PH) for 2 days with or without Nox1 inhibitor ML-171 (2 μM), Nox2 inhibitor Phos-I2 (2 μM) or Example 17 (1 μM). Islets were photographed in an inverted fluorescence microscope and the intensities of red (PI) and blue (Bisbenzimide) signals were quantified using Image J software. Results are indicated as mean±S.E.M for 7 human islet donors.

    [0550] As illustrated in FIGS. 12 and 13, the Nox1 selective inhibitor ML171 (Gianni D, et al., ACS Chem Biol. 2010 Oct. 15; 5(10): 981-93), at a concentration of 2 μM, failed to reduce human islet cell death during a 48 h culture period with cytokines or high glucose+palmitate. The Rac1/Nox2 selective inhibitor Phox-I2 (Bosco E E, et al., Chem Biol. 2012 Feb. 24; 19(2): 228-42), at a concentration of 2 μM, also failed to protect human islets against cytokines but partially protected against high glucose+palmitate. On the other hand, Example 17, at a concentration of only 1 μM, protected both against cytokines and high glucose+palmitate.

    [0551] Modulation of TGFβ-Induced Lens Epithelial to Mesenchymal Transition (EMT)

    [0552] Ocular tissues were collected from postnatal-day-21 albino Wistar rats (Rattus norvegicus) that were sacrificed by asphyxiation and subsequent cervical dislocation.

    [0553] Lens epithelial explants were prepared as previously described (Wang Q, et al., Investigative ophthalmology & visual science. 2010; 51(7):3599-610) and cultured in Medium 199 (M199) with Earle's salts (Life Technologies, USA), supplemented with 50 μg/mL L-glutamine, 50 IU/mL penicillin/50 μg/mL streptomycin (Thermo Scientific, USA), 2.5 μg/mL Amphostat B (Thermo Scientific, USA) and 0.1% bovine serum albumin (BSA) (Sigma, USA). M199 was equilibrated at 37° C., 5% CO.sub.2. To induce EMT, recombinant TGF-β2 was added to media in each culture dish at a working concentration of 200 μg/ml (R&D Systems, USA). Prior to the addition of TGF-β2, some explants were pre-treated for 30 minutes with Example 11 or Example 17, at working concentrations of 2.4 μM and 0.3 μM, respectively. The progression of EMT in live cells was observed and captured using phase-contrast microscopy (Olympus CK2, Japan) and a digital camera (Leica DFC-280, Germany). Percentage cell loss quantification was performed using the thresholding function of ImageJ (NIH), such that cells could be distinguished from bare lens capsule.

    [0554] For immunofluorescence analyses, at the end of the culture period, explants were fixed in absolute methanol for 45 seconds, followed by 3 consecutive 15 second rinses in phosphate buffered saline (PBS). Explants were blocked in 10% normal goat serum (NGS) for 1 hour at room temperature. Excess NGS was removed and primary antibody was applied, diluted in 0.15% NGS/PBS supplemented with 1% bovine serum albumin (BSA). Dishes were left to incubate overnight at 4° C. in a humidified chamber. α-smooth muscle actin was labelled with a specific monoclonal mouse antibody (Sigma, USA), diluted 1:100. Nox4 was labelled with a specific polyclonal rabbit antibody (Santa Cruz Biotechnology, USA), diluted 1:50. The following day, dishes were equilibrated at room temperature and subject to 3×5 minute washes in PBS/BSA. An appropriate secondary antibody was diluted in PBS/BSA and applied to each explant for 2 hours in dark conditions. α-smooth muscle actin was detected using goat anti-mouse Alexa-Fluor 488 (Cell Signaling, USA). Nox4 was detected using an anti-rabbit whole IgG conjugated to Alexfluor 594 (Sigma). A dilution of 1:1000 was used for all secondary antibodies. Dishes were subsequently rinsed in PBS/BSA and a 1:2000 solution of bisbenzimide (Hoechst dye) diluted in PBS/BSA was applied for 3 minutes to visualize cell nuclei. Immunofluorescent labelling was viewed and captured using epifluorescence microscopy (Leica-DMLB, Germany), and a digital camera (Q-Imaging MicroPublisher 3.3 RTV, Canada).

    [0555] At a determined treatment period, 1 μL of 30 mM DHE (dihydroethidium, Life Technologies, USA) (reconstituted in DMSO according to manufacturer's instructions) was added to each dish containing 1 mL of Hank's Balanced Salt Solution (Life Technologies) to yield a working concentration of 3004. Dishes were returned to the incubator for 30 minutes. Explants were then rinsed in cold phosphate-buffered saline (PBS) (3×15 seconds), before being mounted in 40 μl of 10% glycerol/PBS. In its reduced form, DHE typically fluoresces blue; however, it undergoes oxidation in the presence of the superoxide anion, enabling it to intercalate with the cell's DNA and emit red fluorescence; staining nuclei of cells (Wang X, et al. Imaging ROS signaling in cells and animals. J Mol Med (Berl). 2013; 91(8):917-27). DHE staining was viewed with an epifluorescence microscope (Leica-DMLB, Germany) and digital camera (Q-Imaging MicroPublisher 3.3 RTV, Canada). Total fluorescence was calculated using ImageJ (NIH, USA). (FIG. 14).

    [0556] It further was noted that explants treated with TGFβ alone underwent EMT that was marked by elongation of the lens epithelial cells (LECs) by 2 days of treatment (FIG. 15B), and progressive cell loss by day 3 and day 5 (FIGS. 15C and 15D, respectively), compared to untreated epithelial explants where cells remained cobblestone (data not shown), and to day 0 control explants (FIGS. 15A and 15E). Progressive cell loss revealed bare lens capsule that presented prominent lens capsular wrinkling (FIG. 15C, white arrowheads). This was in contrast to untreated explants where cells remained cuboidal over 5 days, comparable to explants at day 0 (FIGS. 15A and 15E). Co-treatment with TGFβ and Example 17 appeared to delay the progression of EMT (FIG. 15F); a similar effect was obtained when co-treating with TGFβ and Example 11. Although there was some bare capsule evident by 2 days of culture with both TGFβ and either inhibitor added (FIG. 15F), cells did not elongate as much compared to when treated with only TGFβ, and did not exhibit any lens capsular wrinkling by day 3 (FIG. 15G). By day 5, TGFβ-treated explants had some clusters of cells remaining (FIG. 15D), whereas in explants treated with TGFβ and either Example 11 or 17, some of the remaining cells appeared epithelial-like. Neither inhibitor significantly promoted cell survival on any of the culture days. The findings from the study suggest that Nox4 is not fundamentally required for all aspects of TGFβ induced lens EMT, and that lens epithelial cells may be capable of upregulating compensatory mechanisms. The study demonstrate that TGFβ-induced Nox4 activity is responsible for ROS production in early stages of lens EMT.

    [0557] Gene Expression Analysis

    [0558] Quantitative RT-PCR (qRT-PCR) gene expression analysis was performed as previously described (Shu D, et al., Investigative ophthalmology & visual science. 2017; 58(2):781-96.).

    [0559] The gene name abbreviations, gene names and NCBI identifiers of the studied genes are shown in Table 4 and the forward and reverse primers sequences used for the qRT-PCR expression are shown in Tables 5 and 6, respectively.

    TABLE-US-00004 TABLE 4 Gene abbreviation Gene name NCBI ID Smurf1 SMAD Specific E3 Ubiquitin Protein NM_001109598.1 Ligase 1 Snail1 Snail Family Transcriptional NM_053805.1 Repressor 1 GAPDH Glyceraldehyde-3-Phosphate NM_017008.4 Dehydrogenase NCad Neural Cadherin NM_031333.1 Fn Fibronectin NM_019143.2 Col1A1 Collagen Type I Alpha 1 Chain NM_053304.1T αSMA actin, alpha 2, smooth muscle NM_031004.2 Ecad Epithelial Cadherin NM_031334.1 MMP9 Matrix metallopeptidase 9 NM_031055.1 CTGF Connective Tissue Growth Factor NM_022266.2

    TABLE-US-00005 TABLE 5 Gene Forward (5′-3′)  SEQ  abbreviation primer sequence ID NO. Smurf1 AAGGCTTCAAGGCTCTGCAA 1 Snail1 CGTGTGTGGAGTTCACCTTCC 2 GAPDH AGACAGCCGCATCTTCTTGT 3 NCad CTGCCATGACCTTCTACGGA 4 Fn CCATCACTGGTCTGGAGCC 5 Col1A1 TGACTGGAAGAGCGGAGAGT 6 αSMA CTATGCTCTGCCTCATGCCA 7 Ecad CTGGACCGAGAGAGTTACCC 8 MMP9 TGAGGCCCCTACAGAGTCTT 9 CTGF GCGTGTGCACTGCCAAAGAT 10

    TABLE-US-00006 TABLE 6 Gene Forward (5′-3′)  SEQ  abbreviation primer sequence ID NO. Smurf1 AAGGCCCACACCTGCTTTAAT 11 Snail1 TTTGCCACTGTCCTCATCGG 12 GAPDH ATGACTCTACCCACGGCAAG 13 NCad TTTGCCATCCTGACAGACCC 14 Fn ACCAGTTGGGGAAGCTCATC 15 Col1A1 GATAGCGACATCGGCAGGAT 16 αSMA CTCACGCTCAGCAGTAGTCA 17 Ecad GGCACCGACCTCATTCTCAA 18 MMP9 TCCAATACCGACCGTCCTTG 19 CTGF TGGCTCGCATCATAGTTGGG 20

    [0560] For data analysis, the 2{circumflex over ( )}-ΔΔCt method was used to estimate the relative fold change in gene expression. Using the 2{circumflex over ( )}-ΔΔCt method, the gene of interest was quantified relative to, firstly, the housekeeping gene, GAPDH and, secondly, to relative gene expression in untreated explants.

    [0561] Gene expression analysis by qRT-PCR revealed significantly elevated mRNA transcripts for aSMA, Col1A and Fn upon TGFβ treatment (FIG. 16). Both of the compounds were able to downregulate the TGFβ-driven upregulation of Col1A and Fn, and both were able to downregulate aSMA expression (FIGS. 17 and 18), albeit Example 17 did so at a higher degree than Example 11. It therefore appears that a higher dose of Example 11 may be required to attenuate TGFβ-induced ROS. However, both compounds inhibited TGFβ-induced upregulation of mesenchymal genes, suggesting that both compounds were actively targeting Nox4-mediated regulation of these genes.

    [0562] Streptozotocin Rat Model of Diabetic Retinopathy

    [0563] Animals were maintained on a 12 h light-dark cycle, at 22-25° C. Food and water were available ad libitum. Diabetes was induced by a single dose of streptozotocin (STZ, 70 mg/kg, ip, Sigma-Aldrich, Germany) dissolved in sodium citrate (0.1M) buffer (diabetic group) after a fasting period of 8-12 hours. Animals with blood glucose levels>350 mg/d1, after 72 hours post-STZ injection were considered diabetic. Both male and female Sprague-Dawley rats were used in the study. Three experimental groups were employed, namely Control (n=6), Diabetic (n=7), and Diabetic-treated group (n=6). Example 17 (10 mg/ml) dissolved in DMSO was administered as eye drops, for two weeks, starting two (2) days after STZ administration. Animals were euthanized 24 hours after the last treatment, and their eyes were removed.

    [0564] Immunohistochemical studies were performed according to Arias et al. (Diabetes, 67, 321-333, 2018). In short, the eyes removed from the euthanized animals were fixed by immersion in 4% paraformaldehyde in 0.1 M phosphate buffer for 45 min at 4° C. The eyecups were isolated and fixed in 4% paraformaldehyde in 0.1 M phosphate buffer for 1.5 h at 4° C. After fixation, tissues were embedded in optimal cutting temperature compound (OCT compound, Prolabo, Leuven, Belgium) and frozen in isopentane for 1 min. Serial transverse retinal sections (10 μm) were collected.

    [0565] Antibodies raised against the macroglia marker glial fibrillary acidic protein (GFAP) were employed. Quantification using the public domain ImageJ 1.43m software was employed for the mean gray value [integrated density (fluorescence density)/delineated area] calculated and expressed as a percentage of the mean gray value of the control. Statistical analysis of the data was performed using GraphPad Prism v5.0 (San Diego, Calif., USA) and differences between groups were evaluated by one-way analysis of variance (ANOVA) with Neuman-Keuls. Statistical significance was set at p<0.05. As shown in FIG. 19, Example 17 (10 mg/ml) administered as eye drops for two weeks attenuated the diabetes induced increase in GFAP immunoreactivity.

    [0566] Solubility, Chemical and Metabolic Stability and Plasma Protein Binding Properties

    [0567] Solubility, chemical and metabolic stability and plasma protein binding properties of the inventive compounds have also been studied as described herein below.

    [0568] Determination of Solubility

    [0569] Two μl of test compound (from 10 mM DMSO stock) were diluted 100× in 10 mM potassium phosphate pH 7.4 in a HPLC glass vial, sealed and incubated for 24 h under rotation (900 rpm) at room temperature. After the incubation 150 μl were transferred to conical glass inserts and centrifuged for 20 min at 10,000×g. Two μl of the supernatant were transferred to a 96-well plate, diluted 100× with acetonitrile/H.sub.2O (60/40, vol/vol) and analyzed by LC-MS/MS.

    [0570] Determination of Chemical Stability

    [0571] Test compound was pipetted into an HPLC vial, from 10 mM DMSO, to yield 2 μM final concentration in three separate vials containing buffers with different pH. At reaction start the three different buffers were mixed with isopropanol (1:2, buffer:isopropanol). The buffers used were: pH 2 (H.sub.3PO.sub.4/KH.sub.2PO.sub.4 10 mM), pH 7.4 (KH.sub.2PO.sub.4/K.sub.2HPO.sub.4 10 mM) and pH 10 (Glycine/NaOH 10 mM). Immediately (<1 minute) after buffer or buffer/isopropanol addition, a 100 μl aliquot was added to a separate plate containing 100 μl acetonitrile:H.sub.2O (60:40) and Warfarin (internal standard, IS), sealed and frozen at −20° C. This test was made for 2 h and 20 h. Analysis was performed on a XEVO TQ mass spectrometer coupled to an Acquity UPLC system in ESI.sup.+MRM mode, separation on a BEH C18 2×50 mm column.

    [0572] Determination of Metabolic Stability

    [0573] The microsomal metabolic stability assay utilizes pooled human, or animal (mouse) species, liver microsomes with supplemented cofactor (NADPH) to primarily facilitate cytochrome P450 (CYP) reactivity against target compound. Test compound (1 μM incubation concentration) and microsomes (0.5 mg/ml incubation concentration) were diluted in 0.1 M phosphate buffer, pH 7.4, in a volume of 150 μl. The reaction was initiated with addition of NADPH (1 mM). The incubation times were 0, 5, 15, 40 min and the reaction was quenched, at each time point, by addition of 100 μl acetonitrile containing Warfarin as IS. The plate was then sealed, centrifuged and frozen at −20 C until LC-MS/MS analysis.

    [0574] Determination of Plasma Protein Binding

    [0575] Example compounds were incubated at 10 μM in plasma and then equilibrium dialysed for 4 h, using a rapid equilibrium device. Protein binding (fu %) was determined by LS/MS as previously described (Anvari E, et al., vide supra).

    [0576] Results obtained for some compounds of the invention are shown in Table 7 herein below.

    TABLE-US-00007 TABLE 7 Metab. Metab. fu % fu % Kinetic Chem. stab, stab, human mouse solub. stab. human mouse plasma plasma Ex. μM pH 7.4 t.sub.1/2 min t.sub.1/2 min protein protein 17 0.16 stable 3-4 2-3  0.02 0.04 35 4.5 stable 11-13 6-20 0.02 0.02 37 >100 stable  6-10 2-4  1.1 0.56 38 77 stable  9-11 2-4  0.62 0.56 44 94 stable 36 7 1.5 2.5 46 16 stable 2 2 0.26 0.21 47 >100 stable 14 1 3.0 1.7 48 97 stable 69 16 1.1 0.5

    [0577] As may be seen from Table 7, some of the compounds of the invention have surprisingly favourable characteristics in terms of solubility, metabolic stability and plasma protein binding.