Method for predicting a subject's response to valproic acid therapy
11041207 · 2021-06-22
Assignee
- The Trustees Of Columbia University In The City Of New York (New York, NY)
- Research Foundation For Mental Hygiene, Inc. (Menands, NY)
Inventors
Cpc classification
C12Q2600/106
CHEMISTRY; METALLURGY
A61P25/18
HUMAN NECESSITIES
A61K31/198
HUMAN NECESSITIES
C12Q1/6883
CHEMISTRY; METALLURGY
G01N2800/52
PHYSICS
International classification
C12Q1/6883
CHEMISTRY; METALLURGY
A61P25/18
HUMAN NECESSITIES
Abstract
The present invention provides, inter alia, methods for treating or ameliorating the effects of a disorder, such as schizophrenia or bipolar disorder, by increasing or decreasing proline levels. Further provided are methods of predicting and monitoring the clinical response in a patient, and diagnostic systems for identifying a patient likely to benefit from proline modulation.
Claims
1. A method for treating or ameliorating the effects of schizophrenia in a subject in need thereof comprising: a) obtaining a biological sample from the subject; b) determining, in the biological sample, the presence or absence of a Val.sup.158Met polymorphism in the COMT gene; and c) administering to the subject an effective amount of an agent that increases proline levels if the subject is determined from step b) to have a Val/Val genotype at codon 158; or d) administering to the subject an effective amount of an agent that decreases proline levels if the subject is determined from step b) to have a Val/Met or Met/Met genotype at codon 158, wherein the agent that increases proline levels is valproic acid (VPA) and the agent that decreases proline levels is vitamin D3.
2. The method of claim 1, further comprising determining a proline level in the subject and adjusting a treatment protocol for the subject based on the determined proline level.
3. The method of claim 1, wherein the subject is human.
4. The method of claim 1, wherein the Val.sup.158Met polymorphism in the COMT gene is a rs4680 G>A single nucleotide polymorphism (SNP).
5. The method of claim 1, which reduces a negative symptom of schizophrenia.
6. The method of claim 5, wherein the negative symptom is selected from the group consisting of diminished emotional expression, avolition, impaired social functioning, alogia, apathy, anhedonia and combinations thereof.
7. The method of claim 5, which comprises decreasing a total Scale for Negative Symptoms (SANS) score, a Brief Psychiatric Rating Scale (BPRS) negative symptom sub-scale score, a Positive and Negative Syndrome Scale (PANSS) negative symptom sub-scale score, a Brief Negative Symptom Scale (BNSS) score, clinical assessment interview for negative symptoms, negative assessment, or other measures of negative symptoms in the subject.
8. The method of claim 1, wherein the biological sample is selected from the group consisting of a blood sample, a biopsy sample, a plasma sample, a saliva sample, a tissue sample, a serum sample, a tear sample, a sweat sample, a skin sample, a cell sample, a hair sample, an excretion sample, a waste sample, a bodily fluid sample, a nail sample, a cheek swab, a cheek cell sample, and a mucous sample.
9. A method for treating or ameliorating the effects of schizophrenia in a subject in need thereof comprising: a) determining, using a biological sample of the subject, the presence or absence of a Val.sup.158Met polymorphism in the COMT gene of the subject; and b) administering to the subject an effective amount of an agent that increases proline levels if the subject is determined from step a) to have a Val/Val genotype at codon 158; or c) administering to the subject an effective amount of an agent that decreases proline levels if the subject is determined from step a) to have a Val/Met or Met/Met genotype at codon 158, wherein the agent that increases proline levels is valproic acid (VPA) and the agent that decreases proline levels is vitamin D3.
10. The method of claim 9, further comprising determining a proline level in the subject and adjusting a treatment protocol for the subject based on the determined proline level.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1) The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
(2) The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present invention. The invention may be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein.
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
DETAILED DESCRIPTION OF THE INVENTION
(11) One embodiment of the present invention is a method for predicting the clinical response of a subject with a disorder to a proline modulator comprising: a) obtaining a biological sample from the subject; b) determining the identity of the allele(s) of the Val.sup.158Met locus associated with the COMT gene in the sample; wherein the presence of ValNal is indicative of a subject who will benefit from an agent that increases proline levels, and wherein the presence of at least one Met allele is indicative of a subject who will benefit from an agent that decreases proline levels; and c) administering, if appropriate based on the results of step b), an effective amount of a proline modulator to the subject to achieve an appropriate clinical response.
(12) As used herein, the term “disorder” broadly refers to a syndrome, condition, chronic illness or a particular disease. For example, the disorder may be a psychiatric disorder. In the present invention, a “psychiatric disorder” is one of a number of disorders that affect mood, thinking, and behavior. Thus, as used herein, “psychiatric disorder” includes but is not limited to: schizophrenia, bipolar disorder, schizoaffective disorders, schizophreniform disorders, schizotypal and schizoid personality disorders, delusional disorders, 22q11.2 deletion syndrome, mood disorders, anxiety disorders, substance use disorders, and personality disorders.
(13) Other non-limiting examples of disorders according to the present invention include: schizophrenia, bipolar disorder, schizophrenia spectrum and other psychotic disorders, 22q11.2 deletion syndrome, depressive disorders, mood disorders, Alzheimer's disease, substance use disorders, addictive disorders, alcohol use disorder (AUD), anxiety disorders, obsessive-compulsive disorders, traumatic brain injury (TBI), and trauma and stressor-related disorders. In a preferred embodiment, the disorder is e.g., schizophrenia, bipolar disorder, alcohol use disorder (AUD) or traumatic brain injury (TBI).
(14) As used herein, the terms “treat,” “treating,” “treatment” and grammatical variations thereof mean subjecting an individual subject to a protocol, regimen, process or remedy, in which it is desired to obtain a physiologic response or outcome in that subject, e.g., a patient. However, because every treated subject may not respond to a particular treatment protocol, regimen, process or remedy, treating does not require that the desired physiologic response or outcome be achieved in each and every subject or subject population, e.g., patient population. Accordingly, a given subject or subject population, e.g., patient population may fail to respond or respond inadequately to treatment. The term “clinical response” as used herein means a reduction of the severity or number of symptoms or characteristics of a disorder, during or following treatment.
(15) In some aspects of this and other embodiments, the subject is a mammal. Preferably, the mammal is selected from the group consisting of humans, primates, farm animals, and domestic animals. More preferably, the mammal is a human.
(16) As used herein, a “biological sample” means a biological specimen, which may be a bodily fluid or a tissue. Biological samples include, for example, whole blood, serum, plasma, cerebro-spinal fluid, leukocytes or leukocyte subtype cells (e.g. neutrophils, basophils, and eosinophils, lymphocytes, monocytes, macrophages), fibroblast sample, olfactory neuron sample, and tissues from the central nervous system, such as the cortex and hippocampus. Examples of preferred biological samples include, e.g., a blood sample, a biopsy sample, a plasma sample, a saliva sample, a tissue sample, a serum sample, a tear sample, a sweat sample, a skin sample, a cell sample, a hair sample, an excretion sample, a waste sample, a bodily fluid sample, a nail sample, a cheek swab, a cheek cell sample, or a mucous sample.
(17) There is one single gene for COMT, which codes for both soluble COMT (S-COMT) and membrane-bound COMT (MB-COMT) using two separate promoters. The nucleic acid sequence for the human COMT gene is set forth in GenBank Accession Number Z26491 (see, e.g., SEQ ID NO: 1). Human S-COMT contains 221 amino acids (see, e.g., SEQ ID NO: 2), and the molecular mass is 24.4 kDa. Human MB-COMT (see, e.g., SEQ ID NO: 3) contains 50 additional amino acids, of which 20 are hydrophobic membrane anchors. The remainder of the MB-COMT molecule is suspended on the cytoplasmic side of the intracellular membranes. The corresponding molecular mass is 30.0 kDa.
(18) A single nucleotide polymorphism (SNP) in the COMT gene causes a trimodal distribution of low, intermediate, and high activity. That polymorphism is caused by autosomal codominant alleles and leads to 3- to 4-fold differences in COMT activity. It has been shown that the molecular basis for this variation in activity is due to a transition of guanine to adenine at codon 158 of the COMT gene that results in a substitution of valine (Val) by methionine (Met) at position 158 in MB-COMT (SEQ ID NO: 3) or the corresponding amino acid 108 in S-COMT (SEQ ID NO: 2). The SNP polymorphism is referred to interchangeably herein as “rs4680” or “G158A” or “Val.sup.158Met”. In subjects with 22q11.2 deletion syndrome (22q11DS), there is only one allele which determines COMT activity.
(19) Exemplary methods which may be used for the determination/identification of the COMT genotype or Val.sup.158Met polymorphism in the present invention are disclosed, for example, in US2003/0100476, which is incorporated herein by reference. Further examples of such methods include, but are not limited to, PCR-based restriction fragment length polymorphism analysis using the restriction enzyme αIII, allele specific hybridization, use of a primer in a polymerase chain reaction (PCR), such as, for example, anchor PCR or RACE PCR or in a ligase chain reaction (LCR), identification of alterations in restriction enzyme cleavage patterns, sequencing reactions, analysis of the protection from cleavage agents (such as, for example, nuclease, hydroxylamine or osmium tetroxide and with piperidine), recognition of mismatched base pairs in double strand DNA by specific enzymes, alterations in electrophoretic mobility, analysis of the movement of polymorphic fragments in polyacrylamide gels containing gradients of denaturant (denaturing gradient gel electrophoresis, DGGE), selective oligonucleotide hybridization (for example using a specialized exonuclease-resistance nucleotide), selective amplification depending on selective PCR or selective primer extension, oligonucleotide ligation assays, expansion methods using dideoxynucleotides derivatives, and Genetic Bit Analysis (GBA™). The detection of a variant in the COMT protein sequence can also be determined by methods such as in situ detection using an antibody specific to a variant sequence, immunoassays such as, for example, EIA or ELISA, immunofluorescence and the like. A preferred method for determining a COMT genotype is disclosed in Example 1.
(20) As set forth above, the determination/identification of the COMT genotype or mutation in the COMT protein of a subject may be carried out by methods known to the skilled artisan. Such methods may be carried out, e.g., on a biological sample obtained from the subject, such as for example, a blood sample or a sample obtained after a biopsy has been carried out on the subject. Furthermore, any cell type or tissue may be utilized in the detection procedures described above. In a preferred embodiment, a bodily fluid, e.g., blood, is obtained from the subject to determine the presence of the allelic variant of a polymorphic region, such as the region including the Val.sup.158Met, in the COMT gene. A bodily fluid, e.g., blood, can be obtained by known techniques (e.g., venipuncture). Alternatively, nucleic acid tests can be performed on dry samples (e.g., skin).
(21) As used herein, “an agent that increases or decreases proline levels” is used interchangeably with the phrase “proline modulator” and means any drug or other composition that increases or decreases the plasma proline levels in a subject. Such proline modulators may be administered to a subject in partly or fully deuterated forms, or containing other stable, medically appropriate isotopes such as, e.g., .sup.13C. Non-limiting examples of agents that increase proline levels include valproic acid (VPA, 2-propylpentanoic acid), divalproex sodium, valproate (2-propylpentanoate), sodium valproate, magnesium valproate, lactic acid, miR-23b, miR-23a/b, (L or D)-proline, (L or D)-arginine, (L or D)-glutamine, (L or D)-ornithine, (L or D)-glutamic acid, (L or D)-glutamate, poly(L or D)-proline, poly(L or D)-glutamine, poly(L or D)-ornithine, poly(L or D)-glutamate, poly(L or D)-arginine, analogs of any of the foregoing, and combinations thereof, including mixed polypeptides of (L or D)-proline, (L or D)-glutamine, (L or D)-ornithine, (L or D)-arginine, (L or D)-glutamic acid, or (L or D)-glutamate. As used herein, an “analog” of an agent means a chemical compound that is structurally and functionally similar to the agent. In the present invention, combinations of such agents and/or their analogs is also contemplated.
(22) Non-limiting examples of agents that decrease proline levels include, e.g., activators of PRODH or activators of peroxisomal proliferator-activated receptor gamma (PPARy). As used herein, “activators” when used with respect to PRODH or PPARy, means a drug or other composition that can increase the function or expression of PRODH or PPARy. In the present invention, a proline modulator that decreases proline levels in a subject includes, e.g., vitamin D.sub.1, vitamin D.sub.2, vitamin D.sub.3, vitamin D.sub.4, vitamin D.sub.5, Calcitriol, curcumin, one or more thiazolidinedione compounds, colchicine, Etanercept (Amgen/Pfizer), S26948 (Sigma-Aldrich), INT131 (InteKrin), phentoin, analogs of any of the foregoing, and combinations thereof.
(23) In the present invention, a “proline modulator” also includes any molecule, enzyme, or treatment that affects circulating proline levels. For example, Table 51 (Supplemental Content), which is incorporated by reference herein in its entirety, identifies molecules that up- or down-regulate expression of genes regulating proline synthesis, transport, or metabolism. All such molecules are “proline modulators” of the present invention. The products of these genes influence circulating proline levels. These genes may also be targeted using known gene editing tools including, for example, CRISPR/Cas9 based systems, TALENs, etc., and thus are also considered “proline modulators” of the present invention. Table 1 contains a list of genes that are up- or down-regulated by valproate compounds, including VPA, valproate sodium salt and divalproate salt. These genes may provide targets for new treatments to modulate proline.
(24) In the present invention, each embodiment optionally includes determining a proline level in the subject. Based on the determined proline level, if appropriate, the subject's treatment protocol may be adjusted. For example, by modifying the course of treatment, if necessary, including administering a different proline modulator to the subject, or stopping or omitting treatment with a proline modulator.
(25) TABLE-US-00001 TABLE 1 Genes regulated by VPA, valproate sodium salt or divalproate sodium salt Up-regulated genes ABAT FOS EHHADH EGR1 Acot1 THRSP Cyp4a14 DBP PDK4 CA3 TUBB2B CYP1A1 NR1D2 DPP8 AKR1D1 ANGPTL4 ELOVL4 AIG1 KIF5C RETSAT ELOVL6 FZD5 PEX11A TIMP3 CPT1A RRAGD CKB VNN1 SPP1 SAP30 DLX5 SLC22A8 LYZ GCFC2 MAPT HSD17B2 ZFP37 CLIC6 FMO2 PPAP2C CTSH CYP51A1 SLC34A2 CD36 RGN TUBB2A H1F0 GRPR CYP4A11 UBR2 AKR1C3 Plscr2 EGLN3 NGFRAP1 PFN2 GPC3 PENK USP2 ARMCX2 CEP104 BCL6 LRP11 GABRB1 IL1B TNRC18 HLA-DQB1 SERPINE1 MT2A PGM2L1 HMGCS1 ATP8B3 EDNRA GUCY1B3 Prl2c2 TNFRSF9 FAM5C GJB5 KRT23 L1TD1 RSPO4 LOC284379 S100A8 PODXL Retnla AKR1C3 FETUB CYP2S1 UGT2B10 BCMO1 SERPINB2 PRR15L DIO2 CEACAM19 GJB3 GPX2 PPBP SLC17A6 GATA4 MGARP FAM163A UPP1 MMP10 CD7 EPGN ACPP LRRC2 ATP13A4 BST1 TMPRSS11BNL GPR115 WFDC12 MUC5B HDC KRT8 C4orf26 GRIK2 KRT18 DPPA4 QRFPR KCNA3 LOC643037 CRYAA FGB Down-regulated genes FAM111A CDK1 ALAS2 ARNTL TOLLIP CCNA2 DCXR MX1 SLC16A1 C1orf210 GPR37 INMT IGFBP3 IL6 NPAS2 MFAP4 CDKN1A RRM2 CHKA ENPP2 LOC100912446 FBXW5 CCNB2 IRF7 CDH17 RBM8A PC ADAMTSL3 MFAP4 ITGA11 C1QTNF3 ASPN DLK1 PAPPA2 CSPG4 THBS4 EGFL6 COL8A1 TSPAN18 POSTN Tlr13 LYZ FMOD SOX10 AFF3 ITGBL1 TNMD NGFR AW551984 ELN OGN PTGDS EPHA3 NKD2 COL14A1 LPAR4 PODN LDB2 TRIM66 FAM180A ADRA1B Ccl9 HR MDGA1 LPPR4 SLC6A17 PCSK9 MSR1 EDIL3 SEMA3D LAMA2 LCP1 CTSS PTN EMR1 CHRDL1 RSPO2
(26) As used herein, an “analog” of vitamin D means a chemical compound that is structurally and functionally similar to vitamin D, or (1,25-dihydroxyvitamin D3 [1,25(OH).sub.2D.sub.3]). Non-limiting examples of vitamin D and analogs thereof include ergocalciferol, cholecalciferol, 22-oxacalcitriol, paricalcitol, doxercalciferol, alfacalcidol, dihydrotachystero, pharmaceutically acceptable salts thereof, and combinations thereof.
(27) As used herein, an “analog” of curcumin means a chemical compound that is structurally and functionally similar to curcumin, and curcuminoid species. Non-limiting examples of curcumin and analogs thereof include curcumin, curcuma oil, turmerone, demethoxycurcum in, bisdemethoxycurcum in, pharmaceutically acceptable salts thereof, and combinations thereof.
(28) Non-limiting examples of thiazolidinedione compounds include troglitazone, rosiglitazone, roglitazone, ciglitazone, darglitazone, englitazone, hydroxypioglitazone, ketopioglitazone, pioglitazone, pioglitazone hydrochloride, ragaglitazar, naveglitazar, aleglitazar, rivoglitazone, netoglitazone, pharmaceutically acceptable salts thereof, analogs of any of the foregoing, and combinations thereof.
(29) Non-limiting examples of pharmaceutically acceptable salts include, for example, acid salts formed from inorganic or organic acids. Such acid salts are non-toxic and include those derived from inorganic acids such as hydrochloric, hydrobromic, sulfuric, sulfamic, phosphoric, and nitric acid; and the salts prepared from organic acids such as acetic, propionic, succinic, glycolic, stearic, lactic, malic, tartaric, citric, ascorbic, palmoic, maleic, hydroxymaleic, phenylacetic, glutamic, mesylate, benzoic, salicylic, sulfanilic, 2-acetoxybenzoic, fumaric, toluenesulfonic, methanesulfonic, ethane disulfonic, oxalic, and isethionic acid. Non-limiting examples of pharmaceutically acceptable base salts include, for example, aluminum, ammonium, calcium, copper, ferric, ferrous, lithium, magnesium, manganic, manganous, potassium, sodium, and zinc salts.
(30) In some preferred embodiments, a pharmaceutically acceptable salt of valproate is sodium valproate. In other preferred embodiments, a pharmaceutically acceptable salt of valproate is magnesium valproate.
(31) The terms “administering”, “administration” and variants thereof (particularly “administering” an agent or modulator) as used herein means introducing an agent, e.g., proline modulator into the body of a subject, such as a human, in need of such treatment. In the present invention, however, administration of such a proline modulator or agent is “appropriate” only if such administration will reduce, alleviate, or eradicate at least one negative symptom as defined herein. In the present invention, based on the result of the COMT genotype analysis and/or a subject's proline levels, it may be that no treatment should be administered, that a prior treatment with a proline modulator should be reduced or discontinued, or that a different proline modulator be administered. The appropriateness of a particular treatment option is readily determined by a medical professional based on the COMT genotype analysis and/or proline determination as disclosed herein.
(32) In the present invention, an “effective amount” or a “therapeutically effective amount” of a proline modulator, an agent, a compound, or a composition disclosed herein is an amount of such material that is sufficient to effect beneficial or desired results as described herein when administered to a subject. Effective dosage forms, modes of administration, and dosage amounts may be determined empirically, and making such determinations is within the skill of the art. It is understood by those skilled in the art that the dosage amount will vary with the route of administration, the rate of excretion, the duration of the treatment, the identity of any other drugs being administered, the age, size, and species of mammal, e.g., human patient, and like factors well known in the arts of medicine and veterinary medicine. In general, a suitable dose of any active agent disclosed herein or a composition containing the same will be that amount of the active agent or composition, which is the lowest dose effective to produce the desired effect.
(33) A suitable, non-limiting example of a dosage of a proline modulator according to the present invention may be from about 1 ng/kg to about 5000 mg/kg. In general, however, doses employed for adult human treatment typically may be in the range of 0.0001 mg/kg/day to 0.0010 mg/kg/day, 0.0010 mg/kg/day to 0.010 mg/kg/day, 0.010 mg/kg/day to 0.10 mg/kg/day, 0.10 mg/kg/day to 1.0 mg/kg/day, 1.00 mg/kg/day to about 200 mg/kg/day, 200 mg/kg/day to about 5000 mg/kg/day. For example, the dosage may be about 1 mg/kg/day to about 100 mg/kg/day, such as, e.g., 2-10 mg/kg/day, 10-50 mg/kg/day, or 50-100 mg/kg/day. The dosage of the proline modulator also may be about 1 mg/kg, 5 mg/kg, 10 mg/kg, 15 mg/kg, 20 mg/kg, 25 mg/kg, 30 mg/kg, 35 mg/kg, 40 mg/kg, 45 mg/kg, 50 mg/kg, 60 mg/kg, 70 mg/kg, 80 mg/kg, 90 mg/kg, 100 mg/kg, 125 mg/kg, 150 mg/kg, 175 mg/kg, 200 mg/kg, 250 mg/kg, 300 mg/kg, 400 mg/kg, 500 mg/kg, 600 mg/kg, 700 mg/kg, 800 mg/kg, 900 mg/kg, 1000 mg/kg, 1100 mg/kg, 1200 mg/kg, 1300 mg/kg, 1400 mg/kg, 1500 mg/kg, 1600 mg/kg, 1700 mg/kg, 1800 mg/kg, 1900 mg/kg, 2000 mg/kg, 2100 mg/kg, 2200 mg/kg, 2300 mg/kg, 2400 mg/kg, 2500 mg/kg, 2600 mg/kg, 2700 mg/kg, 2800 mg/kg, 2900 mg/kg, 3000 mg/kg, 3500 mg/kg, 4000 mg/kg, 5000 mg/kg.
(34) With respect to proline modulators that are vitamin D and its analogs, the dosage of the proline modulator also may be denominated in International Units (IU) per day (IU/Day) and about 100 IU/day, 200 IU/day, 300 IU/day, 400 IU/day, 500 IU/day, 600 IU/day, 700 IU/day, 800 IU/day, 900 IU/day, 1000 IU/day, 1100 IU/day, 1200 IU/day, 1300 IU/day, 1400 IU/day, 1500 IU/day, 1600 IU/day, 1700 IU/day, 1800 IU/day, 1900 IU/day, 2000 IU/day, 2100 IU/day, 2200 IU/day, 2300 IU/day, 2400 IU/day, 2500 IU/day, 2600 IU/day, 2700 IU/day, 2800 IU/day, 2900 IU/day, 3000 IU/day, 3100 IU/day, 3200 IU/day, 3300 IU/day, 3400 IU/day, 3500 IU/day, 3600 IU/day, 3700 IU/day, 3800 IU/day, 3900 IU/day, 4000 IU/day, 4500 IU/day, 5000 IU/day, 5500 IU/day, 6000 IU/day, 6500 IU/day, 7000 IU/day, 7500 IU/day, 8000 IU/day, 9000 IU/day, 10,000 IU/day, 20,000 IU/day, 30,000 IU/day, 40,000 IU/day, 50,000 IU/day, 60,000 IU/day, 70,000 IU/day, 90,000 IU/day, 100,000 IU/day, 200,000 IU/day, 300,000 IU/day, 400,000 IU/day, 500,000 IU/day, 600,000 IU/day, 700,000 IU/day, 800,000 IU/day, 900,000 IU/day, 1,000,000 IU/day, 1,100,000 IU/day, 1,200,000 IU/day, 1,300,000 IU/day, 1,400,000 IU/day, or 1,500,000 IU/day. Preferably, the dosage of the vitamin D species and analogs range between about 1,000-1,500,000 IU administered on a periodic basis of dosing per day or per week or per month.
(35) The effective dose of the proline modulator may be administered as two, three, four, five, six or more sub-doses, administered separately at appropriate intervals throughout the day.
(36) The proline modulators, agents and compositions of the present invention may be administered in any desired and effective manner: for oral ingestion, or as an ointment or drop for local administration to the eyes, or for parenteral or other administration in any appropriate manner such as intraperitoneal, subcutaneous, topical, intradermal, inhalation, intrapulmonary, rectal, vaginal, sublingual, intramuscular, intravenous, intraarterial, intrathecal, or intralymphatic. Further, the proline modulators, agents and compositions of the present invention may be administered in conjunction with other treatments. Each proline modulator, agent and composition of the present invention may be encapsulated or otherwise protected against gastric or other secretions, if desired.
(37) Another embodiment of the present invention is a method for monitoring the treatment of a subject in need thereof, the method comprising: a) obtaining a biological sample from the subject; b) determining the genotype for the allele(s) of the COMT gene at amino acid position 158 in the biological sample; c) determining the subject's proline level; and d) modifying the course of treatment, if necessary, including administering a different proline modulator to the subject, or stopping or omitting treatment with a proline modulator, based upon the presence or absence of a Val.sup.158Met polymorphism in the COMT gene, and/or an increase or decrease in the subject's proline level.
(38) Assays for determining a subject's genotype for the allele(s) of the COMT gene have been disclosed previously herein. Assays for determining a subject's proline level are well-known in the art. See, e.g., Wu, 1993; Inoue et al., 1996; Le Boucher et al., 1997; and Grainger et al., 2004; Liang et al., 2015. Non-limiting examples of proline assays include high throughput (HTP) proline assay, liquid chromatography/mass spectrometry (LC-MS/MS), and automated ion-exchange chromatography. In addition, commercial services for such assays are also available from vendors such as ARUP Laboratories (Salt Lake City, Utah).
(39) As used herein, “modifying the course of treatment” refers to any change in the subject's treatment type and/or dosage, including administering a different proline modulator to the subject, stopping or omitting treatment with a proline modulator, adding an additional proline modulator to the treatment, and increasing or decreasing the dosage of a proline modulator. For subjects homozygous for Val, when it is determined that a subject's proline levels are not optimal, a target overnight fasting proline range after treatment onset of greater than about 158 μM is desired. Other target proline ranges of the invention include, for example, between 150 μM to 700 μM or 150 μM to 550 μM. For subjects with at least one Met allele, when it is determined that a subject's proline levels are not optimal, a target overnight fasting proline range after treatment onset below about 258 μM, such as below 170 μM, is desired. Other target proline ranges of the invention include, for example, between 80 μM to 318 μM.
(40) Another embodiment of the present invention is a diagnostic system for identifying a subject with a disorder who will benefit from an agent that increases or decreases proline levels, comprising: a) obtaining a biological sample from the subject; b) determining the identity of alleles of the Val.sup.158Met locus associated with the COMT gene in the sample; wherein the presence of Val/Val is indicative of a subject who will benefit from an agent that increases proline levels and wherein the presence of at least one Met allele is indicative of a subject who will benefit from an agent that decreases proline levels.
(41) In one aspect of the present invention, the diagnostic system may be used to assess prodromal subjects prior to onset of, e.g., psychotic symptoms, and to determine possible treatment protocols based on COMT and/or proline status.
(42) One aspect of this embodiment may further comprise c) administering, to the subject who will benefit from an agent that increases proline levels, a composition that is selected from the group consisting of valproic acid (VPA), divalproex sodium, valproate, sodium valproate, magnesium valproate, lactic acid, miR-23b, miR-23a/b, (L or D)-proline, (L or D)-arginine, (L or D)-glutamine, (L or D)-ornithine, (L or D)-glutamic acid, (L or D)-glutamate, poly(L or D)-proline, poly(L or D)-glutamine, poly(L or D)-ornithine, poly(L or D)-glutamate, poly(L or D)-arginine, analogs of any of the foregoing, and combinations thereof, including mixed polypeptides of (L or D)-proline, (L or D)-glutamine, (L or D)-ornithine, (L or D)-arginine, (L or D)-glutamic acid, or (L or D)-glutamate. Alternatively, another aspect of this embodiment may further comprise c) administering, to the subject who will benefit from an agent that decreases proline levels, a composition that is selected from the group consisting of vitamin D.sub.1, vitamin D.sub.2, vitamin D.sub.3, vitamin D.sub.4, vitamin D.sub.5, Calcitriol, curcumin, one or more thiazolidinedione compounds, colchicine, Etanercept, S26948, INT131, phentoin, analogs of any of the foregoing, and combinations thereof. In this embodiment, the obtaining and determining steps are previously disclosed herein.
(43) Another embodiment of the present invention is a kit comprising any of the diagnostic systems disclosed herein. Such kits are packaged together with instructions for its use. Such a kit may include, for example, one or more reagents for determination/identification of a COMT genotype or Val.sup.158Met polymorphism, a collection device, and one or more containers. The kit may be used in determining how to regulate proline levels in a subject to effect reduction or eradication of one or more negative symptoms of the subject. Exemplary reagents include, but are not limited to, primers, probes, antibodies, enzymes, oligonucleotides, and immunoassays.
(44) Another embodiment of the present invention is a method for predicting the clinical response of a subject with a disorder to a proline modulator comprising: a) determining the identity of the allele(s) of the Val.sup.158Met locus associated with the COMT gene using a biological sample of the subject; wherein the presence of Val/Val at the locus is indicative of a subject who will benefit from an agent that increases proline levels, and wherein the presence of at least one Met allele at the locus is indicative of a subject who will benefit from an agent that decreases proline levels; and b) administering, if appropriate based on the results of step (a), an effective amount of a proline modulator to the subject to achieve a clinically appropriate response.
The determining and administering steps as well as the proline modulators of this embodiment are as previously disclosed herein.
(45) Another embodiment of the present invention is a method for monitoring the treatment of a subject with a disorder, the method comprising: a) determining the genotype for the allele(s) of the COMT gene at amino acid position 158 in a biological sample of the subject; b) determining the proline level of the subject; and c) modifying the course of treatment of the subject, if necessary, including administering a different proline modulator to the subject or stopping or omitting treatment with a proline modulator, based upon the presence or absence of a Val.sup.158Met polymorphism in the COMT gene.
(46) Another embodiment of the present invention is a diagnostic system for identifying a subject with a disorder who will benefit from treatment with an agent that increases or decreases proline levels comprising: determining the identity of the allele(s) of the Val.sup.158Met locus associated with the COMT gene using a biological sample from the subject; wherein the presence of Val/Val at the locus is indicative of a subject who will benefit from an agent that increases proline levels and wherein the presence of at least one Met allele at the locus is indicative of a subject who will benefit from an agent that decreases proline levels.
In the last two embodiments, the determining and modifying steps, if present, and the proline modulators, are as disclosed previously herein.
(47) Another embodiment of the present invention is a method for treating or ameliorating the effects of a disorder in a subject in need thereof. The method includes: a) obtaining a biological sample from the subject; b) determining, in the biological sample, the presence or absence of a Val.sup.158Met polymorphism in the COMT gene; and c) administering to the subject, if appropriate based on the results of step (b), an effective amount of an agent that increases proline levels if the subject is determined from step (b) to have a Val/Val genotype at codon 158; or d) administering to the subject, if appropriate based on the results of step (b), an effective amount of an agent that decreases proline levels if the subject is determined from step (b) to have a Val/Met or Met/Met genotype at codon 158.
(48) In this embodiment, the obtaining, determining, and administering steps have been disclosed previously herein. As used herein, the terms “ameliorate”, “ameliorating” and grammatical variations thereof mean to decrease the severity of the symptoms, particularly negative symptoms, of a disease in a subject, preferably a human. The polymorphism, disorders, biological samples, and agents for increasing or decreasing proline levels in this embodiment are as disclosed previously herein.
(49) In one aspect of this embodiment, carrying out the method results in reducing or eradicating negative symptoms associated with the disorder. Examples of such negative symptoms include, but are not limited to, flat or blunted affect, social withdrawal, apathy, diminished emotional expression, avolition, alogia, autonomic dysfunction, impairment of executive performances, inattention, and behavioral problems. Preferred examples of negative symptoms according to the present invention include diminished emotional expression, avolition, impaired social functioning, alogia, apathy, anhedonia, or combinations thereof.
(50) In another aspect of this embodiment, numerous ways to assess negative symptoms in a subject are provided, including, e.g., a Scale for Negative Symptoms (SANS) score, a Brief Psychiatric Rating Scale (BPRS) negative symptom sub-scale score, a Positive and Negative Syndrome Scale (PANSS) negative symptom sub-scale score, a Brief Negative Symptom Scale (BNSS) score, clinical assessment interview for negative symptoms, negative assessment, or other measures of negative symptoms in the subject. Other methods for detecting negative symptoms known in the art may also be used. Such additional methods include, e.g., tests and assessments for physical, physiological, or behavioral markers, including neuroimaging, electroencephalogram (EEG), and neurophysiological tests such as mismatched negativity (MMN), P3a, P50, and P100 indices, pre-pulse inhibition (PPI), startle habituation, and antisaccade. In the present invention, however, the preferred method for assessing negative symptoms is the SANS score as disclosed in more detail in the Examples and Figures.
(51) Another embodiment of the present invention is a method for treating or ameliorating the effects of a disorder in a subject in need thereof comprising: a) determining, using a biological sample of the subject, the presence or absence of a Val.sup.158Met polymorphism in the COMT gene of the subject;
(52) and b) administering to the subject, if clinically appropriate, an effective amount of an agent that increases proline levels if the subject is determined from step a) to have a Val/Val genotype at codon 158; or c) administering to the subject, if clinically appropriate, an effective amount of an agent that decreases proline levels if the subject is determined from step a) to have a Val/Met or Met/Met genotype at codon 158.
In this embodiment, the determining and administering steps, and the agents, are as disclosed previously herein.
(53) Yet another embodiment of the present invention is a method for eradicating or reducing a negative symptom experienced by a subject who suffers from a disorder comprising: a) obtaining a biological sample from the subject; b) determining, in the biological sample, the presence or absence of a Val.sup.158Met polymorphism in the COMT gene; and c) administering to the subject, if clinically appropriate, an effective amount of an agent that increases proline levels if the subject is determined from step b) to have a Val/Val genotype at codon 158; or d) administering to the subject, if clinically appropriate, an effective amount of an agent that decreases proline levels if the subject is determined from step b) to have at least one Met allele at codon 158.
(54) In this embodiment, the negative symptoms are as described previously. Furthermore, the obtaining, determining, and, if appropriate, administering steps in this embodiment have been described previously.
(55) Below are a set of genes and variants which (individually and/or in various combinations and/or groups) may modify interaction(s) of proline and/or (glutamate, GABA, glycine, L- and/or D-serine, D-cycloserine, and molecules listed above) with COMT. They include proline and dopamine metabolism and transporter genes.
(56) COMT genotypes and/or gene-associated variants including the Val.sup.158Met polymorphism and/or rs6270 and/or rs6269 and/or rs4633 and/or rs4818 and/or rs6267 and/or rs5031015 and/or rs4986871 and/or rs4680 (including either allele and/or sequence alternative for COMT Uniprot variant Ids: VAR_013925 and/or VAR_013926 and/or VAR_020274 and/or VAR_020275 and/or VAR_005139 (both alleles (Val and/or Met)) and/or VSP_018778.
(57) PRODH variants including the rs450046 and/or rs372055 and/or rs2904552 and/or rs137852934 and/or rs4819756 and/or rs193919334 and/or rs2008720 and/or rs2904551 and/or rs3970559 and/or rs1807467 and/or rs2870983 and/or rs3970555 and/or rs2238731 and/or rs2870984 and/or (including either allele alternative for PRODH Uniprot Variant ids: VAR_029566 and/or VAR_029568 and/or VAR_029569 and/or VAR_029570 and/or VAR_029571 and/or VAR_029572 and/or VAR_029573 and/or VAR_029575 and/or VAR_029577 and/or VAR_029567 and/or VAR_029569 and/or VAR_029571 and/or VAR_029574 and/or VAR_029575 and/or VAR_029577.
(58) SLC6A7 variants and associated variants including rs1468564, and/or rs13153971 and/or rs3776083.
(59) SLC6A20 variants and associated variants including rs17279437 and/or rs2271615 and/or rs6770261 and/or rs758386 and/or rs4327428.
(60) SLC6A15 variants and associated variants including rs1545843 and/or rs12424429 and/or rs3782369 and/or rs1031681.
(61) SLC6A18 variants and associated variants including rs34469326 and/or rs7728667 and/or rs7705355 and/or rs113861454 and/or rs4073918 and/or rs147278493 and/or rs12522796 and/or rs4975623 and/or rs4975625 and/or rs7447815 and/or rs7728646.
(62) PEPD variants and associated variants including rs121917721 and/or rs121917724 and/or rs121917723 and/or rs17570 and/or rs121917722 and/or rs121917725 and/or rs267606944 and/or rs267606943 and/or rs757386104 and/or rs797045185 and/or rs794728007 and/or rs747700126 and/or rs794728008 and/or rs3786897 and/or rs4805885 and/or rs731839 and/or rs8182584 and/or rs889140 and/or (including either allele alternative for Prolidase PEPD Uniprot Variant ids:VAR_011614 and/or VAR_004404 and/or VAR_011615 and/or VAR_004405 and/or VAR_004406).
(63) MAOA variants and associated variants including rs77698881 and/or rs587777457 and/or rs1799835 and/or rs1800466 and/or rs1137070 and/or rs1465107 and/or rs2072743 and/or rs2235186 and/or rs2283725 and/or rs3027400 and/or rs3027407 and/or rs3027409 and/or rs5906883 and/or rs5906957 and/or rs5953210 and/or rs6323 and/or rs6609257 and/or rs72554632 and/or rs796065311 and/or rs796065312 and/or rs909525 and/or rs979606 and/or (including either allele and/or sequence alternative for MAOA Uniprot Variant and associated variant ids VAR_036545 and/or id VSP_045173).
(64) MAOB variants and associated variants including rs10521432 and/or rs1799836 and/or rs2283729 and/or rs3027415 and/or rs6651806 and/or (including either allele and/or sequence alternative for MAOB Uniprot Variant and associated variant ids VSP_057047 and/or VSP_057048 and/or VSP_057049).
(65) GAD1 variants and associated variants including rs121918345 and/or rs45566933 and/or rs769403 and/or rs769402 and/or rs1049736 and/or rs11542313 and/or rs12185692 and/or rs2058725 and/or rs2241165 and/or rs3749034 and/or rs3762555 and/or rs3791850 and/or rs3791851 and/or rs3791878 and/or rs3828275 and/or rs769390 and/or rs769391 and/or rs769404 and/or rs769407.
(66) GAD2 variants and associated variants including rs8190591 and/or rs8190600 and/or rs2839672 and/or rs2839673 and/or rs8190671 and/or rs2839678 and/or rs8190730 and/or rs1805398 and/or rs185649317 and/or rs2236418 and/or rs8190590 and/or rs8190748 and/or rs992990.
Additional Definitions
(67) The term “amino acid” means naturally occurring and synthetic amino acids, as well as amino acid analogs and amino acid mimetics that function similarly to the naturally occurring amino acids. Naturally occurring amino acids are those encoded by the genetic code, as well as those amino acids that are later modified, e.g., hydroxyproline, gamma-carboxyglutamate, and O-phosphoserine. An “amino acid analog” means compounds that have the same basic chemical structure as a naturally occurring amino acid, e.g., a carbon that is bound to a hydrogen, a carboxyl group, an amino group, and an R group, e.g., homoserine, norleucine, methionine sulfoxide, methionine methyl sulfonium. Such analogs may have modified R groups (e.g., norleucine) or modified peptide backbones, but retain the same basic chemical structure as a naturally occurring amino acid. Imino acids such as, e.g., proline, are also within the scope of “amino acid” as used here. An “amino acid mimetic” means a chemical compound that has a structure that is different from the general chemical structure of an amino acid, but that functions similarly to a naturally occurring amino acid.
(68) As used herein, the terms “polypeptide,” “peptide” and “protein” are used interchangeably herein to refer to a polymer of amino acid residues. The terms apply to amino acid polymers in which one or more amino acid residue is an artificial chemical mimetic of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers, those containing modified residues, and non-naturally occurring amino acid polymers.
(69) “Nucleic acid” or “oligonucleotide” or “polynucleotide” used herein mean at least two nucleotides covalently linked together. Many variants of a nucleic acid may be used for the same purpose as a given nucleic acid. Thus, a nucleic acid also encompasses substantially identical nucleic acids and complements thereof.
(70) Nucleic acids may be single stranded or double stranded, or may contain portions of both double stranded and single stranded sequences. The nucleic acid may be DNA, both genomic and cDNA, RNA, or a hybrid, where the nucleic acid may contain combinations of deoxyribo- and ribo-nucleotides, and combinations of bases including uracil, adenine, thymine, cytosine, guanine, inosine, xanthine hypoxanthine, isocytosine and isoguanine. Nucleic acids may be synthesized as a single stranded molecule or expressed in a cell (in vitro or in vivo) using a synthetic gene. Nucleic acids may be obtained by chemical synthesis methods or by recombinant methods.
(71) The nucleic acid may also be a RNA such as a mRNA, tRNA, short hairpin RNA (shRNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), transcriptional gene silencing RNA (ptgsRNA), Piwi-interacting RNA, pri-miRNA, pre-miRNA, micro-RNA (miRNA), or anti-miRNA, as described, e.g., in U.S. patent application Ser. Nos. 11/429,720, 11/384,049, 11/418,870, and 11/429,720 and Published International Application Nos. WO 2005/116250 and WO 2006/126040.
(72) The terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting. As used in the specification and the appended claims, the singular forms “a,” “an,” and “the” include plural referents unless the context clearly dictates otherwise.
(73) For recitation of numeric ranges herein, each intervening number there between with the same degree of precision is explicitly contemplated. For example, for the range of 6-9, the numbers 7 and 8 are contemplated in addition to 6 and 9, and for the range 6.0-7.0, the numbers 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, and 7.0 are explicitly contemplated.
EXAMPLES
(74) The following examples are provided to further illustrate certain aspects of the present invention. These examples are illustrative only and are not intended to limit the scope of the invention in any way.
Example 1
(75) Materials and Methods
(76) Participants:
(77) Male and female, African American, Caucasian and Hispanic patients, aged 18-65, were recruited from Bellevue Hospital Center (BHC). A diagnosis of schizophrenia or bipolar disorder was confirmed using the Structured Clinical Interview for DSM IV Disorders (SCID). After description of the study to subjects, written informed consent was obtained in accordance with IRB regulations.
(78) For schizophrenia inpatients, recruitment was cross-sectional and independent of their duration of hospitalization. Psychiatric symptoms were measured using the Scale for the Assessment of Negative Symptoms (SANS), the Scale for the Assessment of Positive Symptoms (SAPS), and the Brief Psychiatric Rating Scale (BPRS). Proline levels of a subset of the schizophrenia patients, those who did not receive treatment with VPA or divalproex, were reported previously (Clelland et al., 2011).
(79) Bipolar patients were recruited upon presentation at the BHC Comprehensive Emergency Psychiatric Program. Psychiatric symptoms in bipolar disorder patients were measured at an admission visit (visit 1), using the BPRS. At a follow-up inpatient ward visit (visit 2), fasting bloods were collected plus a repeat BPRS assessment performed. Additionally, as shown in
(80) Determination of Fasting Plasma Levels:
(81) Fasting morning blood draws were performed and proline measured in μmoles/liter as reported (Clelland et al., 2011).
(82) Genotyping:
(83) DNA was extracted from blood using the Puregene Blood Core Kit (Qiagen Inc) and the COMT fragment containing the Val.sup.158Met polymorphism amplified using the 5′-3′ primers: ACTGTGGCTACTCAGCTGTG (SEQ ID No: 4) and CCTTTTTCCAGGTCTGACAA (SEQ ID NO: 5). A step-down PCR was employed with an initial denaturation of 94° C.:15 minutes, then 12 cycles of 94° C.:30 seconds, 58° C.:45 seconds and 72° C.:30 seconds, followed by 31 cycles of 94° C.:30 seconds, 50° C.:45 seconds and 72° C.:30 seconds, with a final 72° C.:7 minute extension. Restriction enzyme N1aIII recognizes and cleaves the amplicon into Val (114 bp) or Met (96 bp) fragments, visualized following electrophoreses. To confirm genotyping accuracy, 25% of samples were repeat assayed.
(84) Statistical Analysis:
(85) Group differences were assessed using ANOVA, Kruskal-Wallis and Mann-Whitney tests (following skewness and kurtosis normality tests), χ.sup.2 or Fisher exact tests. Means±standard deviations (SD) were reported, plus Bonferroni adjusted p-values where appropriate. Genotype distributions were tested for Hardy-Weinberg equilibrium (HWE) using a χ.sup.2 or exact test.
(86) Linear regression was employed to test for an interaction between fasting plasma proline and COMT on symptoms in schizophrenia, modelling the relationships of these variables on outcomes of total SANS, SAPS and BPRS scores. Based upon the schizophrenia sample result, the primary outcome for bipolar patients was assessed using the BPRS negative symptom subscale (Kane et al., 1988), and percent reduction in negative symptoms calculated. Positive symptom subscale of the BPRS (Id.) and total BPRS scores were also investigated. When outliers in the data or leverage points were identified, a robust regression procedure was employed using an MM estimator to minimize data-point effects (SASv9.3).
(87) Significant models were investigated further: To assess utility in adjusting the dependent variable, demographic and clinical covariates were entered into a bivariate regression and terms found to have p-values of <0.10 carried forward to a multivariate model. Gender was a covariate in all models, to adjust for previously reported proline gender differences (Jacquet et al., 2005; Tomiya et al., 2007; Clelland et al., 2011). Model fit and selection was determined using the Wald test, testing the null hypothesis that non-significant (p>0.05) covariate parameters were simultaneously equal to zero in full and subsequent reduced models. Statistical analysis was performed in SASv9.3, Stata ICv12, with graphs plotted in GGplot2v1.0.1 in Rv3.1.2.
Example 2
(88) Results
(89) COMT Genotype Modifies the Relationship Between Proline and Negative Symptoms of Schizophrenia:
(90) The schizophrenia sample consisted of 95 patients. Although recruitment was not targeted by COMT genotype, patients were well matched on demographic characteristics and medication use across genotypes (Table 2).
(91) In the entire sample, fasting plasma proline was not significantly different across genotypes (range 87 μM to 502 μM). There were also no differences in BPRS total or negative symptoms (SANS total score), however positive symptoms were significantly different: Met/Met patients had lower SAPS scores than Val/Met (Mann-Whitney z=2.52, adjusted p=0.035) or Val/Val patients (z=2.92, adjusted p=0.001), as previously reported (Goghari & Sponheim, 2008). 100% accuracy was achieved from confirmatory re-genotyping and a sample of 90 control subjects were in HWE for COMT Val.sup.158Met (p>0.05, data not shown). However, COMT distributions of the schizophrenia patients deviated from HWE (χ.sup.2=8.08, df=1, p<0.05). Although deviations for this polymorphism in schizophrenia have been reported (Joober et al., 2002), this finding may represent substructure due to mixed ethnicity: when stratified by ethnicity, all groups were in HWE (p>0.05).
(92) TABLE-US-00002 TABLE 2 Demographic and Clinical Characteristics of Schizophrenic Patients (SZ), n = 95 Met/Met Val/Met Val/Val n = 21 n = 32 n = 42 Prob.sup.a Characteristic Gender, n (row %) 0.288 Female 11 (23.4) 19 (40.4) 17 (36.2) Males 10 (20.8) 13 (27.1) 25 (52.1) Ethnicity, n (row %) 0.096 African American 5 (13.5) 10 (27.0) 22 (59.5) Caucasian 10 (35.7) 10 (35.7) 8 (28.6) Hispanic 6 (20.0) 12 (40.0) 12 (40.0) Age (years), mean ± SD 40.9 ± 10.9 39.1 ± 11.5 39.9 ± 11.6 0.820 Smoking Status.sup.b, n (row %) 0.389 Current or Previous 15 (24.6) 24 (39.3) 22 (36.1) Never Smoked 6 (20.7) 8 (27.6) 15 (51.7) History of Alcoholism, n (%) 0.426 Neither 17 (23.6) 27 (37.5) 28 (38.9) Abuse 1 (10.0) 2 (20.0) 7 (70.0) Dependence 3 (23.1) 3 (23.1) 7 (53.8) Education.sup.c 3.6 ± 1.9 3.1 ± 1.0 3.4 ± 1.5 0.859 Age at First Hospitalization.sup.d, mean ± 23.5 ± 8.0 25 ± 6.5 23.7 ± 7.5 0.465 SD Hospital Duration (days).sup.e, mean ± SD 19.1 ± 17.1 21.9 ± 23.4 20.0 ± 19.6 0.998 Fasting Plasma Proline, umol/L 219.9 ± 91.6 240.5 ± 68.6 246.4 ± 91.1 0.391 Symptoms BPRS.sup.f Total Symptoms, mean ± SD 32 ± 8.5 33.6 ± 7.1 33.6 ± 8.4 0.500 SAPS.sup.g Total Symptoms, mean ± SD 10.3 ± 8.3 15.8 ± 9.6 18.2 ± 10.1 0.006* SANS.sup.h Total Symptoms, mean ± SD 24 ± 16.8 21.8 ± 13.1 17.5 ± 13.9 0.127 Neuroleptic Medications Neuroleptic Type, n (row %) 0.348 Typical only 5 (27.8) 3 (16.7) 10 (55.6) Atypical only 13 (22.4) 19 (32.8) 26 (44.8) Both 3 (16.7) 9 (50.0) 6 (33.3) None 0 1 (100) 0 Daily CPZE dose.sup.i, mean ± SD 490.6 ± 234.0 571.1 ± 418.1 526.8 ± 281.0 0.981 Mood Stabilizing Medications Total Number Administered, n (row 0.786 %) 0 15 (26.3) 19 (33.3) 23 (40.4) 1 6 (16.7) 12 (33.3) 18 (50.0) 2 0 1 (50) 1 (50) VPA Treatment, n (row %) 0.327 Yes 4 (12.9) 11 (35.5) 16 (51.6) No 17 (26.6) 21 (32.8) 26 (40.6) Other Medications Benzodiazapines, yes: n (row %) 4 (21.0) 8 (42.1) 7 (36.8) 0.641 Antidepressants, yes: n (row %) 1 (9.1) 5 (45.4) 5 (45.4) 0.596 .sup.a*= significant p-value when comparing characteristic across three COMT genotypes, calculated by one-way ANOVA, Kruskal-Wallis, or Fisher exact tests. .sup.bn = 90, five subjects not reported. .sup.cRecorded as a continuous variable from the SCID (range 2-8). n = 93, two subjects not reported. .sup.dn = 60 for whom this characteristic could be obtained. .sup.eDays in hospital prior to fasting blood draw. .sup.fBrief Psychiatric Rating Scale. .sup.gSchedule for Assessment of Positive Symptoms. .sup.hSchedule for Assessment of Negative Symptoms. .sup.iChlorpromazine (CPZ) equivalent dose, n = 94 as one subject's NL had no CPZ equivalent.
(93) Testing the primary hypothesis of effect modification, a significant interaction was observed between COMT genotype and proline on negative symptoms in schizophrenia patients (n=95, interaction β coefficient=0.082, p<0.0001). As shown in
(94) Possible confounds on this relationship were assessed (see Table 3). While there was no relationship between SANS score and either medication type, neuroleptic dose (summarized as daily chlorpromazine equivalents), or the number of days in hospital prior to blood draw and symptom assessment, covariate analysis showed that ethnicity and alcohol use were predictors of SANS score (p<0.1, Table 3), and along with gender were taken forward to a multivariate model (Table 4). Model fit was determined with the final model retaining genotype, proline, alcohol use, and the highly significant COMT-proline interaction (p<0.0001). The significant interaction also remained in a stratified analysis following removal of patients reporting alcohol abuse/dependence (p<0.001, n=72). Interestingly, there was no interaction of COMT genotype on the relationship between fasting peripheral proline and positive symptoms (interaction β=−0.005, p=0.64), or total symptoms (interaction β=−0.23, p=0.097), suggesting specificity of the relationship to negative symptoms.
(95) TABLE-US-00003 TABLE 3 Bivariate Association Between Schizophrenia Patient Demographic and Clinical Characteristics, with Total SANS Score, n = 95 Characteristic β (95% Cl) Prob Gender.sup.a −1.697 (−7.609, 4.215) 0.570 Ethnicity.sup.b African American v Caucasian 6.059 (−1.026, 13.143) 0.093* African American v Hispanic 7.028 (0.079, 13.977) 0.047* Age 0.024 (−0.239, 0.287) 0.857 Education.sup.c 0.389 (−1.660, 2.438) 0.707 Alcohol Dependence/abuse.sup.b None v Abuse −0.236 (−9.775, 9.303) 0.961 None v Dependence −9.505 (−18.023, −0.987) 0.029* Smoking Status.sup.d −0.882 (−4.112, 2.349) 0.589 Hospital Duration.sup.e 0.026 (−0.121, 0.172) 0.729 Daily CPZE dose.sup.f 0.004 (−0.005, 0.014) 0.353 Neuroleptic (NL) Type.sup.b,g Atypical v Typical 2.082 (−5.763, 9.930) 0.599 Atypical v both −1.584 (−9.430, 6.261) 0.689 Total Number of NLs −2.961 (−10.614, 4.692) 0.444 Administered.sup.h Total Number of Mood Stabilizers 1.320 (−4.886, 7.526) 0.674 Administered.sup.i VPA Treatment.sup.j −0.578 (−7.157, 6.001) 0.862 Benzodiazapines −3.342 (−10.713, 4.028) 0.370 .sup.aBinary variable: Male v female. .sup.bFor categorical analysis the reference category is the first level listed for each variable. .sup.cRecorded as a continuous variable from the SCID (range 2-8) .sup.dBinary variable: Never v current or previous smokers, n = 90 as four subjects did not report smoking status. .sup.eDays in hospital prior to fasting blood draw and symptoms assessment. .sup.fChlorpromazine (CPZ) equivalent dose, n = 93 as one subject's NL had no CPZ equivalent, and one subjects did not receive a NL. .sup.gn = 94, as one subject did not receive a NL. .sup.hBinary variable: one v two, n = 92 (as one subject did not receive a NL, and only two subjects were administered >2 different NLs). .sup.iBinary variable: no versus yes, n = 92 (as three subjects had not received <48 hours of VPA treatment). .sup.jBinary variable: none versus one, n = 93 (as only two subjects were administered >1 mood stabilizers).
(96) TABLE-US-00004 TABLE 4 Prediction of Negative Symptoms from Proline Level and COMT in Psychiatric Patients Test β Coefficient SE statistic.sup.a Prob Wald test Schizophrenia Models (DV = Total SANS Score, n = 95) Full Model.sup.b Proline −0.1050 0.0333 9.94 0.0016* COMT (ValVal, ValMet, MetMet) −13.0179 4.2452 9.40 0.0022* Interaction (Proline = COMT) 0.0744 0.0169 19.48 <.0001* Alcohol Use Alcohol Abuse v None −4.2178 4.2706 0.98 0.3233 Alcohol Dependence v None −9.0807 3.5632 6.49 0.0108* Gender −1.0466 2.3795 0.19 0.6600 Ethnicity African-American v Caucasian 3.0258 3.0258 1.14 0.2866 African-American v Hispanic 4.6703 2.8214 2.74 0.0979 p = 0.517.sup.c Final Model.sup.b Proline −0.0804 0.0321 6.28 0.0122* COMT (ValVal, ValMet, MetMet) −9.6576 4.0300 5.74 0.0166* Interaction (Proline × COMT) 0.0651 0.0161 16.39 <.0001* Alcohol Use Alcohol Abuse v None −5.1234 3.9854 1.65 0.1986 Alcohol Dependence v None −9.7478 3.3526 8.45 0.0036* p = 0.020.sup.d Bipolar Disorder Models (DV = % Change in BPRS Negative Symptoms Scale, n = 43) Full Model Proline 0.0012 0.0006 2.09 0.044* COMT (Met/Met v ValVal) 0.4281 0.1650 2.60 0.014* Interaction (Proline × COMT) −0.0017 0.0007 −2.42 0.022* Gender 0.1960 0.0656 2.99 0.005* Ethnicity African-American v Caucasian 0.0186 0.0839 0.22 0.826 African-American v Hispanic −0.1528 0.1052 −1.45 0.156 Duration (days) between Assessments 0.0049 0.0070 0.69 0.492 Neuroleptic Type Atypical Neuroleptic v None −0.0802 0.0818 −0.98 0.334 Typical Neuroleptic v None −0.1401 0.2087 −0.67 0.507 Both v None −0.1531 0.1184 −1.29 0.206 Benzodiazepines −0.0840 0.0714 −1.18 0.249 p = 0.056.sup.e Final Model Proline 0.0016 0.0006 2.55 0.015* COMT (Met/Met v ValVal) 0.5029 0.1766 2.85 0.007* Interaction (Proline × COMT) −0.0021 0.0007 −2.83 0.007* Gender 0.1856 0.0656 2.83 0.007* p = 0.0074.sup.f .sup.aχ.sup.2 (Schizophrenia models using Robust linear regression) or t (Bipolar models using linear regression) .sup.bRobust regression, MM Estimation Method (28). .sup.cRobust Wald tests canonical linear hypothesis that combined effect of non-significant covariates (Gender and Ethnicity) is zero. .sup.dRobust Wald tests hypothesis that covariate effect (Alcohol use) is zero. .sup.eWald tests canonical linear hypothesis that combined effect of non-significant covariates (Ethnicity, Duration, Neuroleptic Type and use of Benzodiazepines) is zero. .sup.fWald tests hypothesis that covariate effect (Gender) is zero.
Example 3
(97) Valproate Treated COMT ValNal Schizophrenia Patients have Significantly Lower Negative Symptoms than Met Allele Carriers:
(98) An effect of VPA on plasma proline has been reported (Jacquet et al., 2005) and VPA-treated schizophrenia patients in the current study had significantly higher proline (mean=299.29±94.76, n=28) than those who did not receive VPA (mean=215.84±63, n=64) (z=−3.97, p=0.0001). Considering the finding of an interaction between COMT and proline on negative symptoms, the hypothesis was that VPA treated Val/Val patients would respond differently to the concomitant high levels of proline, with respect to their negative symptoms, as compared to Met carriers. As shown in
Example 4
(99) COMT Genotype Modifies the Relationship Between Proline and Negative Symptom Change in in Bipolar Disorder:
(100) The hypothesis that COMT genotype modifies the relationship between proline and negative symptoms across psychiatric illnesses was explored, employing a second patient sample: 43 subjects with bipolar disorder who had completed a BPRS assessment upon admission to the psychiatric ER (visit 1) plus a second BPRS assessment and fasting blood draw during their follow-up visit (mean duration between assessments=9.5±4.6 days). Thus, for this sample the relationship between COMT and proline on the change in symptoms was calculated by the percent reduction in negative symptoms from admission to follow-up.
(101) As for the schizophrenia cohort, recruitment of the bipolar sample was not targeted by COMT genotype, but subjects were matched on demographic characteristics (Table 5) and medication use at both study visits (Table 6). The distribution of COMT genotypes was in HWE (χ.sup.2=0.387, df=1, p>0.05). Due to the finding in schizophrenia that Met allele carriers have a similar response to high proline, and because of the smaller bipolar sample size, Met/Met and Val/Met bipolar groups were pooled for further analysis.
(102) TABLE-US-00005 TABLE 5 Demographic and Clinical Characteristics of Bipolar Disorder Patients, n = 43 Met/Met Val/Met Val/Val Characteristic n = 5 n = 22 n = 16 Prob.sup.a Gender, n (row %) 0.328 Female 1 (6.2) 11 (68.8) 4 (25.0) Male 4 (14.8) 11 (40.7) 12 (44.4) Ethnicity, n (row %) 0.450 African American 0 4 (57.1) 3 (42.9) Asian 0 0 1 (100) Caucasian 3 (11.5) 13 (50.0) 10 (38.5) Hispanic 2 (22.2) 5 (55.6) 2 (22.2) Age (years), mean ± SD 34 ± 9.7 32.8 ± 8.4 33.2 ± 11.2 0.933 Smoking Status.sup.b, n (row %) 1.000 Current or Previous 4 (13.3) 15 (50.0) 11 (36.7) Never Smoked 1 (8.3) 6 (50.0) 5 (41.7) History of Alcoholism, n (row %) 1.000 Abuse 1 (7.1) 8 (57.1) 5 (35.7) Dependence 1 (12.5) 4 (50.0) 3 (37.5) Neither 3 (14.3) 10 (47.6) 8 (38.1) Education.sup.c, mean ± SD 4.2 ± 2.0 3.8 ± 1.6 4.2 ± 2.0 0.709 Fasting Plasma Proline.sup.d, umol/L 213.6 ± 72.7 205.5 ± 63.2 245.8 ± 123.4 0.669 Age at Onset, mean ± SD 25.8 ± 2.8 26.4 ± 8.3 24.1 ± 7.8 0.207 Age at First Hospitalization, mean ± SD.sup.a 26 ± 3.2 26.8 ± 9.3 22.9 ± 7.4 0.112 Days between Symptom Assessments, 10.2 ± 6.2 9.4 ± 3.7 9.5 ± 5.1 0.382 mean ± SD .sup.aP-value values when comparing Met allele carriers to Val/Val patients, calculated by Satterthwaite t-test, Mann-Whitney, Chi-Square or Fisher exact test. .sup.bn = 42, one subject not reported. .sup.cRecorded as a continuous variable from the SCID (range 2-8). .sup.dSampled at visit 2.
(103) TABLE-US-00006 TABLE 6 Clinical Characteristics of Bipolar Disorder Patients, n = 43 Admission (Visit 1) Follow-up (Visit 2) Met/Met Val/Met Val/Val MetMet Val/Met ValVal Characteristic n = 5 n = 22 n = 16 Prob.sup.a n = 5 n = 22 n = 16 Prob.sup.a Brief Psychiatric Rating Scale.sup.b Total Symptoms, 42 ± 7.3 36.3 ± 5.9 36.4 ± 4.7 0.592 34.8 ± 8.8 25.9 ± 5.8 27.4 ± 5.2 0.772 mean ± SD Negative Symptoms.sup.c, 9.0 ± 5.1 6.3 ± 2.2 6.2 ± 1.7 0.872 6.0 ± 1.4 5.6 ± 0.9 5.6 ± 1.0 0.711 mean ± SD Positive Symptoms.sup.d, 24.6 ± 5.0 18.7 ± 6.2 18.2 ± 6.2 0.457 18.4 ± 5.3 12.4 ± 4.8 13.7 ± 4.2 0.553 mean ± SD Psychosis.sup.e: yes, n 4 (13.3) 14 (46.7) 12 (40) 0.735 (row %) Neuroleptic (NL) Medications NL Type, n (row %) 1.000 0.745 Typical only 2 (22.2) 4 (44.4) 3 (33.3) 0 0 1 (100) Atypical only 1 (12.5) 4 (50.0) 3 (37.5) 3 (9.7) 17 (54.8) 11 (35.5) Both 0 3 (75) 1 (25) 2 (40.0) 1 (20.0) 2 (40.0) None 2 (9.1) 11 (50.0) 9 (40.9) 0 4 (66.7) 2 (33.3) Daily CPZE dose.sup.f, 282.3 ± 202.1 284.1 ± 109.7 239.3 ± 81.5 0.403 566.7 ± 372.1 344.4 ± 162.6 362.3 ± 202.6 0.863 mean ± SD Total number of NLs, 0.906 0.731 n (row %) 0 2 (9.1) 11 (50) 9 (40.9) 0 4 (66.7) 2 (33.3) 1 3 (17.6) 8 (47.1) 6 (35.3) 2 (7.1) 16 (57.1) 10 (35.7) 2 0 3 (75.0) 1 (25.0) 3 (37.5) 2 (25) 3 (37.5) Mood Stabilizing Medications Total number of 0.282 0.785 mood stabilizers, n (row %) 0 5 (12.5) 19 (47.5) 16 (40.0) 0 1 (100) 0 1 0 3 (100) 0 3 (8.3) 20 (55.6) 13 (36.1) 2 0 0 0 2 (33.3) 1 (16.7) 3 (50) VPA: yes, n (row %) 0 1 (100) 0 1.000 2 (9.5) 11 (52.4) 8 (38.1) 1.000 Other Medications Benzodiazapines: 3 (15.8) 10 (52.6) 6 (31.6) 0.542 4 (22.2) 4 (22.2) 10 (55.6) 0.055 yes, n (row %) Antidepressants: yes, 0 2 (66.7) 1 (33.3) 1.000 1 (5.6) 7 (38.9) 10 (55.6) 0.055 n (row %) .sup.aP-value values when comparing M allele carriers to ValVal patients, calculated by Satterthwaite t-test, Mann-Whitney, Chi-Square or Fisher exact test. .sup.bBPRS = Brief Psychiatric Rating Scale. .sup.cNegative Symptoms (BPRS items 3 + 13 + 14 + 16 + 18) .sup.dPositive Symptoms (BPRS items 4 + 7 + 8 + 10 + 11 + 12 + 15 + 17) .sup.ePsychosis determined as current or previous psychotic illness at admission only. .sup.fChlorpromazine (CPZ) equivalent dose.
(104) A significant interaction was observed between COMT and fasting peripheral proline on the percent change in negative symptoms (n=43, interaction β coefficient=−0.0017, p=0.04). As shown in
(105) As found with the schizophrenia sample, bipolar VPA-treated patients had significantly higher fasting plasma proline than those who did not receive VPA (
(106) TABLE-US-00007 TABLE 7 Bivariate Association Between Bipolar Disorder Patient Demographic and Clinical Characteristics, with Percent Change in Negative Symptoms, n = 43 Characteristic (at Visit 2) β (95% CI) Prob.sup.a Gender.sup.b 1.359 (0.003, 0.268) 0.045* Ethnicity.sup.c African American v Caucasian.sup.d −0.048 (−0.022, 0.121) 0.566 African American v Hispanic −0.272 (−0.473, −0.071) 0.009* Age 0.003 (−0.004, 0.010) 0.369 Education.sup.e 0.013 (−0.026, 0.051) 0.513 Alcohol Dependence/abuse.sup.b None v Abuse −0.020 (−0.174, 0.133) 0.790 None v Dependence −0.055 (−0.240, 0.130) 0.554 Smoking Status.sup.f −0.104 (−0.045, 0.253) 0.165 Duration (days) between 0.013 (−0.002, 0.028) 0.082* symptom assessments Daily CPZE dose.sup.g −0.000 (−0.000, 0.000) 0.607 Neuroleptic (NL) Type.sup.b None v Atypical −0.091 (−0.285, 0.103) 0.348 None v Typical −0.006 (−0.476, 0.465) 0.981 None v both −0.230 (−0.494, 0.033) 0.085* Total Number of NLs Administered.sup.h −0.074 (−0.192, 0.043) 0.209 Total Number of Mood Stabilizers −0.050 (−0.154, 0.054) 0.338 Administered.sup.i VPA Treatment −0.013 (−0.148, 0.122) 0.845 Benzodiazapines −0.120 (−0.251, 0.011) 0.072* Antidepressants 0.004 (−0.133, 0.140) 0.958 .sup.a*Taken forward into multivariate model. .sup.bBinary variable: Male v female. .sup.cFor categorical analysis the reference category is the first level listed for each variable. .sup.dIncludes n = 1 Asian subject. Parameter estimates did not change following the removal of this subject, and so they were included in all final models. .sup.eRecorded as a continuous variable from the SCID (range 2-8). .sup.fBinary variable: Never v current or previous smokers, n = 42 (as one subject did not report smoking status). .sup.gChlorpromazine (CPZ) equivalent dose, n = 37 (as six subjects did not receive a NL). .sup.hContinuous variable with three levels (none, one or two), n = 42 (as only subject was administered >two NLs). .sup.iBinary variable: one v two, n = 42 (as one subject did not receive a mood stabilizer).
Example 5
(107) Discussion
(108) The data presented herein demonstrate that fasting peripheral proline and COMT Val.sup.158Met genotype predict negative symptom severity across psychiatric diagnoses. Specifically, evidence is presented that in schizophrenia patients with the Val/Val genotype (encoding the high activity COMT enzyme), high proline was associated with lower levels of negative symptoms. As proline rose across the Val/Val patient sample, negative symptoms decreased. Conversely, Met allele carriers displayed the opposite relationship, exhibiting significantly more negative symptoms as proline levels rose. Over the range of fasting proline in the schizophrenia sample (87-502 μM), this represents a significant and clinically relevant difference in negative symptoms between COMT genotype groups.
(109) VPA upregulates circulating proline (Jacquet et al., 2005) and VPA-treated schizophrenia Val/Val patients had significantly less negative symptoms than VPA-treated Met allele patients, likely due to the impact of VPA on proline level. Interestingly, the relationship between proline, COMT and negative symptoms was consistent across the entire schizophrenia sample, whether subjects received VPA or not, suggesting that the source of circulating proline is less important than the actual level in predicting symptoms. This data has implications for treatment decisions, because proline-modulating medications such as VPA, which is very commonly used to treat bipolar disorder and also schizophrenia, may have differential benefits on negative symptoms and conversely, detrimental effects, based upon the Val.sup.158Met genotype.
(110) In a second sample, the interaction between COMT and proline on negative symptom change was explored in patients with bipolar disorder (using the BPRS negative symptom subscale). Supporting the earlier schizophrenia finding, a significant interaction was observed between proline and COMT: high proline was associated with improvement of negative symptoms in homozygous Val/Val bipolar patients, while high proline in Met allele carriers was associated with less improvement or an increase in negative symptom severity. This finding was not confounded by medication use, the duration of time between assessments, or demographic characteristics of the bipolar sample. Interestingly, the bipolar patients did not have proline levels significantly higher than controls, suggesting that proline may impact negative symptoms and their severity, but not bipolar disorder risk.
(111) The present disclosure is believed to be the first to document that proline and COMT interact to predict negative symptom outcomes in psychiatric and other disorders. The finding of a detrimental effect of high proline in combination with the COMT Met allele on schizophrenia and bipolar disorder negative symptoms, is in part supported by studies of 22q11DS patients, who have an increased risk of psychosis (albeit exhibiting positive symptoms (Raux et al., 2007)) plus a neurophysiological visual sensory deficit (Vorstman et al., 2009), when carrying the Met allele in the presence of high proline.
(112) This finding that high proline is protective in Val/Val patients with schizophrenia and bipolar disorder is novel and significant. Intriguingly, Zarchi et al. (2013), reported the protective effect of a PRODH variant (the Tryptophan (Trp) allele of the Arg.sup.185Trp polymorphism) on a neurophysiological measure (MMN) in COMT Val 22q11DS patients. Since the Trp allele exhibits decreased PDX activity in vitro (Bender et al., 2005), Zarchi et al., discussed either an opposite effect of this allele in vivo, or alternatively that the Arg.sup.185Trp polymorphism is in linkage disequilibrium with another functional SNP; in each circumstance likely resulting in increased PDX activity and low peripheral proline. The data disclosed herein suggests the opposite to that interpretation: that high proline is actually protective in hem izygous 22q11DS patients with the Val genotype, with regards to MMN.
(113) Putative CNS roles of proline have been described both in terms of its potential as a neurotransmitter, suggested by its uptake into and direct synthesis within synaptosomes and its release at the synapse after K+ induced depolarization (Phang et al., 2001; Nickolson, 1982; Yoneda and Roberts, 1982; Nadler, 1987), as well as a neuromodulator of neurotransmitter systems, suggested by the presence of high-affinity proline transporters in glutamatergic neurons (Phang et al., 2001; Renick et al., 1999; Cohen and Nadler, 1997a; Cohen and Nadler, 1997b), and the enhancements of glutamatergic and prefrontal DA transmission in the presence of Prodh deficiency and elevated proline (Paterlini et al., 2005). Although the mechanism by which proline elevation may impact neurotransmission requires further investigation, it is apparent from the Prodh null model (Gogos et al., 1999; Paterlini et al., 2005) and the human hyperprolinemias (Phang et al., 2001) that elevated proline can be detrimental in the CNS. In schizophrenia and bipolar disorder, carrying the Met allele may further accentuate proline's toxicity. In this model, enhanced DA-transmission in the PFC as a result of excess proline is exacerbated by low COMT activity and concomitant higher prefrontal DA availability, ultimately resulting in a frontal hyperdopaminergic state that mimics that of the Prodh null mouse (Paterlini et al., 2005; and as reviewed in Drew et al., 2011).
(114) A hyperdopaminergic model influencing negative symptom severity is somewhat counterintuitive, given that negative symptoms are generally considered to arise from deficient mesocortical DA stimulation. However, COMT is involved in maintaining PFC cognitive stability (Bilder et al., 2004; Turnbridge et al., 2006), and in situations of high cortical DA concentrations and D.sub.1 receptor stimulation (likely present in Met/Met and to a lesser degree Val/Met psychiatric patients), enhanced cognitive stability of neuronal network activation has been theorized by Bilder et al. (2004) to result in a cognitive rigidity that may increase the likelihood of negative symptoms. Thus, the Met allele may be less effective in alleviating the increased dopaminergic tone in schizophrenia and bipolar disorder patients with elevated proline, significantly impacting negative symptoms or at least the persistence of negative symptoms and their improvement after treatment.
(115) Conversely, as disclosed herein, proline elevation beneficially influences negative symptom severity in Val/Val patients. In a COMT Val homozygous state, high enzymatic activity in the PFC would likely reduce prefrontal DA, limiting D.sub.1 receptor-mediated excitation (Bilder et al., 2004; Turnbridge et al., 2006). Speculatively, proline elevation may increase prefrontal DA signaling, through interference with glutamatergic pathways (Paterlini et al., 2005), reducing vulnerability to a prefrontal hypodopaminergic state in Val/Val patients (Bilder et al., 2004). Taken together these models suggest that negative symptoms are significantly impacted in conditions of both hyper- or hypo-DA activity.
(116) Interestingly, no relationship was found between COMT and proline on positive symptoms. Positive symptoms are considered to arise from hyperactive subcortical mesolimbic projections, and the current finding is consistent with the action of proline in murine cortical but not striatal DA potentiation (Paterlini et al., 2005). Additionally, DA transporters are relatively sparse in the PFC (Lewis et al., 2001), and the removal of DA there may be more impacted by COMT activity and the interaction with proline, as compared to subcortical regions.
(117) Some study limitations exist: in the schizophrenia sample, proline was measured and symptoms assessed cross-sectionally. Thus the findings may be confounded by enrollment differences across genotypes. However, negative symptoms were not significantly different between genotypes, there was no significant main effect of COMT on negative symptoms, and the length of hospitalization prior to symptom assessment had no relationship with negative symptoms, suggesting that the cross-sectional nature of the study did not confound the results. Additionally, while the bipolar study allowed investigation of symptom change, the bipolar sample size was smaller and negative symptoms assessed using only a subscale of the BPRS. Further research would therefore benefit from a longitudinal approach, investigating the interaction between proline and COMT on the change in negative symptoms assessed via the SANS, in a large sample of both schizophrenia and bipolar disorder patients.
(118) Nonetheless, there are currently no medications approved for the treatment of negative symptoms in psychiatric illness, which are associated with poor functional outcomes and quality of life, are highly persistent, and are a great burden for caregivers (Blanchard et al., 2011). The finding of a beneficial effect on negative symptoms of high proline in Val/Val patients suggests that personalization of treatments based upon a patient's COMT genotype, for the purpose of up- or down-regulating proline level, holds promise as a pharmacogenomics approach to intervene and target this unaddressed symptom domain.
Example 6
(119) Relationship Between Change in Proline and Negative Symptoms:
(120) Preliminary data also suggests that a change in proline level is directly related to change in negative symptoms. Specifically, twelve bipolar disorder patients had a pre- and post-medication fasting blood draw (with proline measured), plus pre- and post-assessment. Of these, ten were Met allele carriers (Met/Met or Val/Met). Findings suggest that high proline is associated with no improvement or a worsening of symptoms in the presence of high proline. Thus, it was expected that for these subjects, an increase in proline would be related to a worsening of symptoms. Testing this hypothesis, a strong positive relationship was found between the change in proline and the percent change in negative symptoms (see
(121) Only two subjects were Val/Val homozygotes with both pre- and post-medication values. Interestingly, one subject whose proline went down (from 167 μM to 119 μM) had no change in negative symptoms. However, the other subject, whose proline went up (from 206 μM to 332 μM), had a corresponding decrease in negative symptoms (from a score of 8 to 6). Again, this supports the hypothesis that high proline is good for Val/Val homozygotes.
(122) However, valproate increases peripheral proline, so it can be assumed that all Val/Val patients treated with Valproate (n=8) had an increase in peripheral proline between blood draws (regardless of whether the blood draw at visit one was fasting). Therefore, using this subsample, there was seen a negative relationship between the change in proline and symptoms (spearman's rho=−0.4), although this result again did not reach significance likely due to the small sample size (p=0.3).
Example 7
(123) Proline and COMT in Other Disorders:
(124) Pomara et al. (1992) showed elevated cerebrospinal fluid (CSF) proline level in Alzheimers disease (AD). Patients with AD are also known to display negative symptoms. Treatment to modulate proline levels based upon COMT Val.sup.158Met genotype would be beneficial to control those symptoms in AD.
(125) Ethanol increases circulating proline levels, and comorbid alcohol use disorder is the most common comorbidity in schizophrenia (Drake and Mueser, 2002), and is also common in bipolar disorder (Sonne and Brady, 2002). Up- or down-regulation of proline level may exacerbate negative symptoms or conversely improve them, depending on COMT genotype. Alcohol use may be a form of self-medication that could be replaced by other proline modulation methods/treatments. Recently, differential effects were found of alcohol abuse or dependence frequency based on genotype (COMT Val/Val subjects were 2.4 times more likely to report alcohol abuse and/or dependence than Met allele patients, p=0.09, unpublished).
(126) Susceptibility to alcohol abuse and/or dependence may be related to differential effects on mood and/or pleasure-ability based upon proline level and COMT genotype. Treatments to alter proline level based on COMT genotype may be useful for the treatment of alcohol use disorders and potentially for gambling disorders (Guillot et al., 2015).
Example 8
(127) Proline and COMT in Alcohol Use Disorder (AUD):
(128) Comorbidity of Alcohol Use Disorder (AUD) with schizophrenia (SZ) is highly prevalent at over 33% of SZ patients. Comorbidity is associated with particularly unfavorable outcomes including raising mortality risk and treatment non-adherence. Of particular relevance, some SZ patients have reported a decrease of symptoms, including negative symptoms, following alcohol ingestion. This is important because the negative symptoms of SZ (loss of motivation, flattening of emotional responses, decreased speech and activity, and social withdrawal), are disabling and persistent, and significantly contribute to the immense personal and economic costs of SZ. No medications are FDA-approved for treatment of negative symptoms in SZ.
(129) Proline is a precursor of the neurotransmitter glutamate and may function as a CNS neuromodulator. Elevated proline stimulates dopamine signaling in murine models. Catechol-O-methyltransferase (COMT) catalyzes deactivation of neurotransmitters including dopamine. In our recent, replicated, study we found that fasting plasma proline levels (which reflect CNS levels) and the COMT Val158Met functional polymorphism (high/low enzyme activity) significantly interact, predicting negative symptom outcomes in patients with severe psychiatric illness. Specifically, in Val/Val patients, high proline is protective with low negative symptom severity or a greater negative symptom reduction over time. Conversely, COMT Met carriers demonstrated the opposite: significantly more negative symptoms or less symptom improvement as proline increased.
(130) Alcohol ingestion upregulates circulating proline, in those with a current or past AUD, and thus we hypothesized that comorbid patients self-medicate with alcohol to relieve their negative symptoms; predicting more frequent comorbid AUD in Val/Val SZ patients. In a preliminary study we indeed found a strong trend as compared to Met allele carriers for whom alcohol-induced proline elevation would be detrimental (p=0.06, 2-tailed). This finding is important because sodium valproate (VPA), prescribed to ˜35% of SZ inpatients, is also a strong up-regulator of proline levels. We found a strong trend towards significance for an interaction between VPA treatment and AUD on cross-sectional proline levels (interaction p=0.050); with VPA vastly boosting proline levels in Val/Val patients with AUD, but not significantly in VPA-treated patients without an AUD (data not shown). We propose personalized VPA treatment or treatment with proline or modulators that increase proline levels, for negative symptoms in comorbid AUD and neuropsychiatric disorders including schizophrenia patients who carry the Val/Val genotype, to relieve negative symptoms and assist in maintaining abstinence.
Example 9
(131) Proline and COMT in Alzheimer's Disease (AD)/Traumatic Brain Injury (TBI):
(132) Neuropsychiatric symptoms such as apathy are frequently described in patients with Alzheimer's disease (AD), as well as those who have sustained a traumatic brain injury (TBI). In fact, reports have suggested that close to one half of all AD and TBI patients' exhibit apathy (Brodaty et al. 2015; Karttunen et al. 2011; Hwang et al. 2004; Lyketsos et al. 2011), which is characterized by the loss of motivation to participate in activities, social withdrawal, and emotional indifference and these symptoms often present in incipient AD (including MCI) (Leoutsakos et al. 2015; Van Dam et al. 2016) or within the first year after brain injury (Stefan et al. 2016). Apathy and related symptoms contribute substantially to the huge personal and economic costs for individuals living with AD and TBI: Apathy can disrupt patients' participation in family life and social integration, and can lead to more intensive utilization of health care services (Arnould et al. 2015; Cattelani et al. 2008). Furthermore, apathy in AD is associated with a rapid course of functional and cognitive decline (Benoit et al. 2008; Lechowski et al. 2009; Landes et al. 2005; Leoutsakos et al. 2015), and in TBI patients, negatively impacts rehabilitation (Starkstein et al. 2014). Of relevance, substantial caregiver burden and distress have been significantly associated with the presence and severity of apathy (Karttunen et al. 2011; Lyketsos et al. 2011; Starkstein et al. 2014; Arnould et al. 2015; Fauth et al. 2014).
(133) Apathy is a “negative” neuropsychiatric symptom. Although commonly considered a major symptom domain of psychiatric illness, the full spectrum of negative symptoms can also present in patients with dementia (Reichman et al. 1996; Galynker et al. 1997; Negron et al. 2000; Galynker et al. 2000; Vercelletto et al. 2002; de Jonghe et al. 2003) and constitutes an independent behavioral dimension that is not an outcome of depression and/or cognitive status (Reichman et al. 1996; Galynker et al. 1997; de Jonghe et al. 2003).
(134) Intriguingly, it has been suggested that targeting of these symptoms in AD may extend the time to conversion from MCI (Ismail et al. 2016) and possibly positively alter the trajectory of the disease process (Forlenza et al. 2017). However, there are no approved treatments for negative symptoms in AD or TBI, and thus there is clearly a need for new research into interventions that target neuropsychiatric symptoms of AD and TBI, in particular negative symptoms, to improve the quality of life for individuals living with TBI and AD, and also to alleviate the burden on their caregivers.
(135) There is evidence of increased CNS and peripheral proline levels in patients with AD (Pomara et al. 1992; Molina et al. 1998; Trushina et al. 2013). We propose and will investigate that the proline x COMT interaction and its impact on negative symptoms, either beneficial or detrimental, as previously observed in psychiatric disorders, is generalizable across neuropsychiatric diseases including AD and TBI.
Example 10
(136) Relationship Between Negative Symptoms and VPA Level:
(137) The relationship between blood levels of VPA and negative symptoms was investigated by COMT genotype. It was hypothesized that those with the Met allele and high levels of blood VPA would have a lower % negative symptom change, i.e. a positive % change, indicating increased negative symptoms, due to exacerbation by increased proline level. Conversely, Val/Val patients would be expected to have a greater % decrease in negative symptoms as levels of VPA rose. As hypothesized, and as shown in
Example 11
(138) Proline may function as a neuromodulator via stimulation or alteration of neuronal glutamate and/or GABA signaling, which may underlie its effect on negative and other neuropsychiatric symptoms (Clelland et al., 2016; Crabtree et al., 2016). Molecules that can modulate neuronal glutamate signaling including NMDA receptor and/or glutamatergic signaling functions, and have been considered and/or tested in clinical trials in psychiatric disorders include glycine, D-serine, D-cycloserine and bitopterin (Roche RG1678; RO-4917838), sarcosine, SSR103800, Org 25935 and betaine. These are thought to alter glutamate receptor activity or function either directly or indirectly via modulation of the concentration of glycine and/or function of the glycine binding site.
(139) Considering that clinical studies of molecules also thought to influence glutamate signaling have had mixed results, an initial exploratory analysis was performed of fasting plasma glycine and 1-serine and an interaction with COMT genotype on negative symptoms of schizophrenia. Plasma glycine concentrations reflect CNS levels (Jiménez-Jiménez et al., 1998; Scholl-Bürgi et al., 2008; Luykx et al., 2013) and CSF D-serine, which is derived from L-serine via serine racemase, is significantly correlated with plasma L-serine (Luykx et al., 2013; Hashimoto et al., 2003).
(140) In a sample of schizophrenia patients (n=95), fasting plasma glycine and 1-serine significantly predicted increased negative symptoms in those subjects with the COMT Val/Met or Met/Met genotypes (glycine r=0.48, p=0.0003, n=53; 1-serine r=0.32, p=0.02, n=53), but not in Val/Val carriers (glycine r=−0.05, p=0.78, n=42; 1-serine r=−0.12, p=0.46, n=42). Following on from this, in regression analysis any significant effect of glycine was tested for after adjusting for the potential confounding effect of proline. A significant effect of glycine on negative symptoms remained (p=0.013) with medium effect size (partial eta.sup.2=0.116). As for proline, as glycine increased, so did negative symptoms in Met allele carrier patients.
(141) In addition, analysis of valproate versus non-valproate-treated subjects indicated that valproate significantly upregulates fasting glycine levels (268 uM no valp n=64, 361 uM valp n=31, p=0.0007) and L-serine levels (103 uM no valp n=64, 117 uM valp n=31, p=0.004).
(142) Given these findings of glycine and serine interactions with COMT, the interaction of COMT Val.sup.158Met genotype with glycine on negative symptoms therefore also likely occurs when glycine modulators, including those listed above, are used in psychiatric and neuropsychiatric disorders.
(143) As some of the molecules listed above have been extensively tested in clinical trials, reanalysis of the trial data and/or new trials accounting for COMT genotype when determining efficacy, may lead to evidence of therapeutic efficacy that has been previously undetected.
(144) Trials of the molecules listed above for the treatment of psychiatric, neuropsychiatric, psychotic, mood and personality disorders, and symptoms thereof such as negative symptoms, should therefore be analyzed to account for the interaction of individuals' COMT Val.sup.158Met genotype with glycine and (L- and/or D-) serine levels (and/or with potentially glutamate and/or GABA), with the expectation that COMT Val/Val genotype individuals will respond differently from Met allele carriers, and the failure of clinical trials to achieve efficacy may be due to patients not being chosen based on their COMT genotype (and thus whether they would benefit or be harmed by such treatment). In recent studies, we have identified that the proline modulator, LX6171, an SLC6A7 (PROT) transporter inhibitor, may be useful for treatment of COMT Val.sup.158/Val, or for COMT Met.sup.158Met or COMT Val.sup.158Met carriers, and may act via increased synaptic proline and/or decreased gamma-aminobutyric acid (GABA) synthesis (data not shown).
(145) TABLE-US-00008 TABLE S1 Molecules that regulate genes or gene products relevant to proline transport and metabolism. A1. Molecules that upregulate PRODH: gefitinib harman Dimethylformamide Pyrilamine Fluocinolone Acetonide cephalonium Phenacetin Methylnitrosourea Ketoconazole dexibuprofen Cortisone Ceftriaxone aristolochic acid I Mycophenolic Acid GW 501516 Betamethasone Rifabutin Caffeine Methotrexate Fluphenazine dihydroquinghaosu piperaquine Isotretinoin Naproxen leflunomide bromodichloromethane Itraconazole Roxarsone Dicumarol fluvastatin Hydrocortisone diindolylmethane cyclonite Gliclazide cerivastatin Digoxin Doxorubicin Hexachlorophene Ifosfamide meloxicam Melatonin Malathion Triiodothyronine Sulfacetamide Tacrolimus Fluoxetine Desoxycorticosterone chloroxylenol genipin Trenbolone Acetate, (17beta)-isomer phenacemide erlotinib Chlorpropamide arsenic trioxide decitabine Terfenadine Paraquat Dantrolene Cymarine quelamycin Maprotiline 2,2-bis(bromomethyl)-1,3-propanediol Ethamsylate Dexamethasone AICA ribonucleotide methyl salicylate Doxazosin Methylprednisolone loxoprofen pipenzolate Epirubicin monobenzone Valproic Acid fluticasone naphthalene Ofloxacin enrofloxacin Hemicholinium 3 Acrolein 4-dichlorobenzene 4,4′-diaminodiphenylmethane depudecin 1,3-dichlorobenzene riddelliine halofuginone Ethyl Methanesulfonate Clioquinol p-Aminohippuric Acid Antipyrine N-benzyladenine Oxprenolol Diflunisal Cyclosporine Bithionol loracarbef ebastine Chlorpyrifos oxiconazole Sulindac Amoxapine Oxyquinoline Thioguanine Pyrethrins phenethyl isothiocyanate Ultraviolet Rays amprenavir Cisapride Bromisovalum oxcarbazepine Thioctic Acid blebbistatin trichlorofluoromethane Methyldopa Clemastine Altretamine Gold Hydrochloric Acid 9-(2-hydroxy-3-nonyl)adenine torsemide Etidronic Acid Bisacodyl Sulfisoxazole Clobetasol Erythromycin 1-Methyl-4-phenyl-1,2,3,6- Pimozide Ethylsuccinate tetrahydropyridine Betahistine Iproniazid sodium arsenite valdecoxib oxybutynin Promazine letrozole 4′-N-benzoylstaurosporine Trichloroethylene 4-octylphenol naringin Hydralazine dibenzazepine Gallamine Triethiodide Flavoxate Xylazine Terazosin Chlorpromazine acetylleucine Meclofenoxate N-Methyl-3,4- methylenedioxyamphetamine Acetazolamide Calcium Cephalexin Saquinavir Etoposide Sulpiride nabumetone Luteolin Metyrapone Glipizide Trimetazidine Foscarnet hexachlorobutadiene adiphenine lapatinib n-hexanal Trichlormethiazide lamotrigine benoxinate 8-Bromo Cyclic Adenosine Nitrazepam Monophosphate Moxisylyte N-(2-cyclohexyloxy-4- fipexide nitrophenyl)methanesulfonamide Y 27632 Interleukins Mianserin Amiloride Sulfadimethoxine Amikacin 1,1,1-trichloroethane Lactic Acid Rolipram Tobramycin oxaliplatin Buspirone Lithium Chloride carbinoxamine Cisplatin gabapentin Choline Naphazoline Cefuroxime Flurbiprofen anisindione oxaprozin Cholecalciferol Dexfenfluramine rescinnamine Pivampicillin Plicamycin Dicyclomine laudanosine Antibodies, Monoclonal trichostatin A Daunorubicin vesamicol Ketoprofen oxolamine Captopril Atovaquone Fluorouracil Furosemide 2-amino-1-methyl-6- Neomycin carbetapentane phenylimidazo(4,5-b)pyridine Isoflurophate Prochlorperazine Alprenolol olanzapine Oxymetazoline Acarbose Metaraminol Levamisole Trifluridine oltipraz arsenic acid candesartan Sulfamethoxazole vorinostat Metoclopramide Prazosin Dizocilpine Maleate 2-(4-morpholinyl)-8-phenyl- 4H-1-benzopyran-4-one Metoprolol Angiotensin-Converting Enzyme Inhibitors imatinib Phenelzine Risperidone Terbutaline Harmaline Fluspirilene chelidonine irinotecan 6-thioguanosine Imipramine Vincristine Atenolol Haloperidol 2,2′-Dipyridyl Puromycin Aminonucleoside Domperidone Fenoprofen Dobutamine Norfloxacin 3,3′,4′,5-tetrachlorosalicylanilide Hydroxyurea Diltiazem Dichlorvos Felodipine N-Methylaspartate Dyphylline Zidovudine sodium selenate Clarithromycin Nystatin Azacitidine Trihexyphenidyl ONO 2235 Aspirin Busulfan Nocodazole Amlodipine Nimodipine 1-Methyl-3-isobutylxanthine dasatinib Nortriptyline Losartan Verapamil Mebendazole Loratadine Baclofen Piroxicam Ionomycin Zalcitabine Flunarizine Guanethidine Deoxyglucose Levodopa 8-((4-chlorophenyl)thio)cyclic-3′,5′-AMP triptolide Lorazepam Sarin Cyclophosphamide Chlorambucil Methyl Methanesulfonate Ascorbic Acid A2. Molecules that downregulate PRODH: Aminosalicylic Acid Ursodeoxycholic Acid Miconazole anastrozole Clotrimazole Nafenopin Thioacetamide Tinidazole Salicylates Spironolactone rabeprazole Hexachlorobenzene Carbon Tetrachloride bromfenac Fenofibrate Lovastatin Praziquantel Bezafibrate pirinixic acid Methapyrilene Ethylestrenol Fluconazole Theobromine Indomethacin 7,8-Dihydro-7,8-dihydroxybenzo(a)pyrene Isoniazid Dipyrone 9,10-oxide celecoxib Stavudine geraniol Dimethylnitrosamine Ketorolac Simvastatin Aminoglutethimide pantoprazole ferulic acid Cyproterone Acetate Stanozolol Econazole N-nitrosomorpholine vinylidene chloride Chloroform Diethylstilbestrol Ecdysterone Mestranol Benzbromarone naftopidil beta-Naphthoflavone temafloxacin atorvastatin Ticlopidine Aphidicolin Ticrynafen Piperonyl Butoxide rosiglitazone TO-901317 Estriol Proglumide Cyproterone Ibuprofen bromobenzene artemisinine Ethinyl Estradiol Chlormezanone Gemfibrozil Ajmaline benziodarone Diethylhexyl Phthalate Diethylnitrosamine Clonazepam Clofibrate beta-cyclodextrin-benzaldehyde Pravastatin Chloramphenicol Phenobarbital tranilast Dehydroepiandrosterone piclamilast Bupropion Pentobarbital Fendiline cetraxate terbinafine Danazol Clonidine Vinblastine Ethylnitrosourea carvedilol pioglitazone abacavir Clofibric Acid Cefixime Shiga Toxin Disulfiram 2-Acetylaminofluorene Carisoprodol ipriflavone Spectinomycin irbesartan perfluorooctanoic acid Flutamide methylformamide lornoxicam Mifepristone bendazolic acid ciprofibrate Finasteride Neostigmine Methylcholanthrene nimesulide zileuton Vitamin K 3 2-nitrofluorene Metronidazole amitraz closantel 4-nonylphenol Oxytetracycline penciclovir Secobarbital Cinnarizine Ethambutol Colchicine salicylamide zopiclone desloratadine Methyltestosterone Tetrachlorodibenzodioxin Granisetron Safrole trovafloxacin 2-dichlorobenzene Doxepin Gonadotropins eperisone Carbamazepine Roflumilast N-methylolacrylamide Azathioprine hydrazine Parathion Ondansetron Monocrotaline Pyrogallol Estradiol balsalazide Carmustine phenothiazine sparfloxacin triadimefon Clofazimine 1-hydroxycholecalciferol pristane bortezomib Mefloquine Fonofos Clomipramine Tretinoin systhane coumarin amineptin naphthalenediimide Acetaminophen Enoxacin Omeprazole telmisartan 4-(5-benzo(1,3)dioxol-5-yl- 4-pyridin-2-yl-1H-imidazol-2-yl)benzamide Zimeldine Isoproterenol Benzalkonium Compounds Dimercaprol Bicuculline tenofovir tenidap hydroxytamoxifen norethindrone acetate sulfathiazole Erythromycin Tolazamide Galantamine Minoxidil Sertraline Trimethadione Dactinomycin perfluorooctane sulfonic acid Ethionine Progesterone Vanadates venlafaxine Tetracycline rofecoxib graveoline tazobactam lactacystin Glycerol Amitriptyline Diclofenac Griseofulvin Naloxone Caerulein benoxaprofen urapidil Benzethonium Megestrol Floxuridine quintozene shikonin Buthionine Sulfoximine Prednisone Lamivudine Propylthiouracil ranolazine Protoveratrines oxfendazole Cefotetan Aflatoxin B1 Amantadine Capsaicin Megestrol Acetate Todralazine Amiodarone ibufenac sunitinib Nifedipine Norethindrone meropenem 1,10-phenanthroline Ethionamide Phenylephrine compactin Lasalocid oxalylglycine esmolol lansoprazole homatropine Penicillamine Lead Nitroprusside bambuterol Bleomycin Diphenhydramine etofylline Benzo(a)pyrene Lomustine methylparaben Ouabain etiracetam idebenone cilostazol ochratoxin A isoconazole guanadrel Nickel 1-ethyl-2-benzimidazolinone Rifampin Raloxifene Thiabendazole Benzydamine indole-3-carbinol Hydroxyzine Astemizole Diazepam Vitamin B 12 Chitosan Nisoldipine Alprazolam Aconitine 4-hydroxytamoxifen Oxazepam Bacitracin Dipyridamole Citalopram Atropine efavirenz Sotalol Genistein dironyl Soman U 0126 deferiprone pralidoxime Propranolol Camptothecin Tolazoline HI 6 resveratrol Cytarabine Allopurinol Quercetin Clozapine sildenafil Labetalol Albendazole valsartan Famotidine Ciprofloxacin Gentamicins Tacrine Amphetamine Nadolol Chlorpheniramine Mitomycin MRK 003 Netilmicin Paroxetine Pregnenolone Carbonitrile 6-bromoindirubin-3′-oxime doxofylline Azauridine Paclitaxel benzyloxycarbonylleucyl- NG-Nitroarginine Methyl leucyl-leucine aldehyde Ester N,N′-diphenyl-4- Calcitriol Enalapril phenylenediamine SB 203580 bisphenol A Inosine Monophosphate Perhexiline cyanoginosin LR gemcitabine Kainic Acid Pentylenetetrazole 6-Mercaptopurine Promethazine B1. Molecules that upregulate COMT: Sulbactam 6-methoxy-2-naphthylacetic acid Cefuroxime Diazoxide Stanozolol Lead 2,4-Dinitrophenol tenidap Norfloxacin Cephalexin rosiglitazone pirinixic acid Vanadates Levobunolol lorglumide Metoprolol Trimetazidine oltipraz Omeprazole Methylcholanthrene Quinpirole chloroxylenol Pyridoxine tropisetron Noscapine Inosine Monophosphate Nitroprusside beta-Naphthoflavone Clomipramine Netilmicin Fluphenazine Itraconazole bromodichloromethane 4-dichlorobenzene Benserazide nabumetone apramycin Altretamine butenafine tomatidine Econazole Pemoline NG-Nitroarginine Methyl Ester Epirubicin tazobactam Diethylnitrosamine etofenamate Mitoxantrone graveoline betulinic acid arsenic trioxide Cortisone Sotalol Promethazine temsirolimus Dimethylformamide Progesterone sulfathiazole beta-cyclodextrin-benzaldehyde Galantamine oxaliplatin Trichloroethylene vinorelbine pentachlorobenzene riddelliine Ethacrynic Acid Neomycin Ethionine valsartan gefitinib Terazosin Mifepristone Acarbose bestatin 1-Methyl-4-phenyl-1,2,3,6- tetrahydropyridine Iproniazid 3,3′,4′,5 tetrachlorosalicylanilide Warfarin Benzethonium Chloroquine Citalopram Vitamin K 2 gabapentin Sulindac Roxithromycin oxfendazole letrozole Chitosan N-Methyl-3,4- Azithromycin methylenedioxyamphetamine Clindamycin Cytochalasin B Sulfinpyrazone pristane Simazine Cholecalciferol Doxapram erlotinib Tetracycline marimastat Atropine fenbufen Tetrachlorodibenzodioxin Flunarizine Niacin PK 11195 Polychlorinated Biphenyls Clonidine homosalate spiradoline Phentolamine Ethamsylate Scopolamine Hydrobromide Chlorambucil 1,1,1-trichloroethane asperflavin zomepirac Selenomethionine N-(2-aminophenyl)-4-(N-(pyridin-3- Benzo(a)pyrene ylmethoxycarbonyl)aminomethyl)benzamide clebopride Concanavalin A Lovastatin mebeverine Doxorubicin Lorazepam Simvastatin 6-bromoindirubin-3′-oxime sorafenib rofecoxib U 0126 celecoxib SU 5402 sildenafil imatinib anastrozole 2-(4-morpholinyl)-8-phenyl- adiphenine 4H-1-benzopyran-4-one methantheline clemizole olanzapine fluvastatin chelidonine lansoprazole ebastine cyanoginosin LR clopidogrel bromfenac alfuzosin carvedilol dihydroquinghaosu idebenone vitexin fragment C, human serum albumin closantel cobaltous chloride bromopride ceforanide ascorbate-2-phosphate ciclopirox 2,4-diaminotoluene 9-(2-hydroxy-3-nonyl)adenine cineole tolfenamic acid 6-thioguanosine hexylcaine pimethixene 5-fluorouridine triptolide Cardiotoxins Dichlororibofuranosylbenzimidazole Antibodies, Monoclonal Caerulein Ionomycin Streptomycin Bleomycin Chorionic Gonadotropin Beclomethasone Cyproterone Acetate Chlormadinone Acetate Finasteride Colistin Alpha-Amanitin Rifampin Amoxapine Mianserin Clozapine Dactinomycin Enoxacin Ciprofloxacin 1-Methyl-3-isobutylxanthine Acyclovir 8-Bromo Cyclic Adenosine Monophosphate Allopurinol Melatonin Cytochalasin D gamma-Tocopherol alpha-Tocopherol Vitamin E Acenocoumarol Astemizole Diltiazem Nitrazepam Diazepam Apazone Cotinine Kainic Acid Fluorouracil Risperidone Zidovudine Stavudine Cytarabine Chlorpheniramine Nevirapine Nicardipine Trazodone Amiodarone Fluconazole Clotrimazole Nicotine Pilocarpine Lobeline Reserpine Vinblastine Quinidine Papaverine Apomorphine Dacarbazine Acetazolamide Thiethylperazine Bithionol Isoflurophate Auranofin Ethylnitrosourea Dimethylnitrosamine Erythromycin Haloperidol Ifosfamide Cyclophosphamide Chloroform 7,8-Dihydro-7,8- Naproxen Demeclocycline dihydroxybenzo(a)pyrene 9,10-oxide Loratadine Amitriptyline Losartan Ketamine Isoniazid Ketoprofen Ibuprofen Fenoprofen Diflunisal Mefenamic Acid Diethylcarbamazine Aminocaproic Acids Gemfibrozil Clofibric Acid Azoxymethane Azauridine Methapyrilene Dobutamine Amrinone Guanethidine Amoxicillin Cefotaxime Dibucaine Sulpiride Busulfan Isoxsuprine Bismuth Calcium B2. Molecules that down regulate COMT: Tin Fluorides Tobramycin Phenacetin dexibuprofen bendazolic acid 3-hydroxyacetanilide Cyclosporine flubendazole Acrolein cephalonium Fluoxetine valdecoxib Hesperidin nimetazepam Niacinamide Diethylstilbestrol ajmalicine Trichlorfon 2-nitrofluorene clinafloxacin Ethinyl Estradiol methiazole Gentamicins Cyproheptadine Chlorpropamide Iornoxicam Bezafibrate Methoxsalen 4-hydroxyestradiol-17 beta Suprofen Piperonyl Butoxide norethindrone acetate Clomiphene Nizatidine 4-acetylaminofluorene DDT Meptazinol Trioxsalen Carmustine acidocin CH5, Lactobacillus Cymarine Acetylmuramyl-Alanyl- acidophilus Isoglutamine Tiletamine atorvastatin salicylamide cilostazol vinylidene chloride ferulic acid Cyclizine ifenprodil hydroquinone Dyphylline Procarbazine Ampicillin Estriol Propylthiouracil Fursultiamin Cloxacillin fipronil Theophylline apicidin Coumaphos ONO 2235 meloxicam lomefloxacin phosphonoacetamide oxiconazole fulvestrant Podophyllotoxin Acetaminophen cinchonine Aspirin Atractyloside penciclovir Cinnarizine Terfenadine Ketorolac Raloxifene trichostatin A Tretinoin Natamycin Mestranol Estradiol Nystatin 2-chloropyrazine Azathioprine Flufenamic Acid picrotoxinin Aminosalicylic Acid asiaticoside daidzein Tiapamil Hydrochloride Valproic Acid Diquat Carboplatin Tacrolimus ranolazine piperacetazine Curcumin pramoxine Idoxuridine Ethylestrenol Todralazine boldine sparfloxacin Cetylpyridinium Nafenopin abamectin Canrenoate Potassium Dantrolene Cisapride bisphenol A Dihydroergocristine Calcitriol decitabine Diethylhexyl Phthalate Budesonide 2-dichlorobenzene Okadaic Acid eperisone Carbimazole Genistein Hymecromone biphenylylacetic acid Ampyrone canadine U 54494A syrosingopine tetrahydrotriamcinolone blebbistatin phenacemide Hydralazine Propranolol Oxazepam terbinafine Pyrantel Leucovorin Mustard Gas nimesulide Acetohexamide Propanil pioglitazone benfluorex Pregnenolone 1,2-dithiol-3-thione Dinoprostone Phenobarbital Thioctic Acid Propantheline Protriptyline Clofibrate Cytokines bis(tri-n-butyltin)oxide Sulfaphenazole Piribedil hydrazine Aztreonam tosufloxacin Oxymetazoline 4-biphenylamine Lomustine 1-hydroxycholecalciferol ubiquinol Doxylamine Levamisole scriptaid phenylhydrazine hydroxyhydroquinone Betamethasone Pheniramine Tolnaftate 4-(5-benzo(1,3)dioxol-5-yl-4- direct black 3 Dipyridamole pyridin-2-yl-1H-imidazol-2-yl)benzamide repaglinide naphthalenediimide rimexolone Thiostrepton Sulfamethazine Timolol Tacrine acetovanillone Trichloroepoxypropane eticlopride 8-aminohexylamino cAMP Streptozocin HC toxin vorinostat genipin dibenzazepine 4-methyl-N-(3-(4-methylimidazol-1-yl)-5- LBH589 (trifluoromethyl)phenyl)-3-((4-pyridin-3- ylpyrimidin-2-yl)amino)benzamide lapatinib dasatinib bevacizumab CPG-oligonucleotide bortezomib 17-(allylamino)-17- demethoxygeldanamycin Y 27632 1-ethyl-2-benzimidazolinone azacyclonol tenofovir benzyloxycarbonylvalyl-alanyl-aspartyl bexarotene fluoromethyl ketone daboiatoxin piclamilast cerivastatin telmisartan irbesartan colforsin benzyloxycarbonylleucyl- zardaverine zileuton leucyl-leucine aldehyde 2,3-dioxo-6-nitro-7-sulfamoylbenzo(f)quinoxaline dorzolamide resveratrol 1,2-dilinolenoyl-3-(4- gemcitabine aceclofenac aminobutyryl)propane-1,2,3-triol levocabastine buparvaquone leflunomide vanoxerine 1,3-dichlorobenzene oxalylglycine monorden ozagrel artemether lysophosphatidic acid bromobenzene beta-glycerophosphoric acid artemisinine doxofylline sulmazole dexamisole ochratoxin A perfluorooctanoic acid 2-methoxyestradiol 4-O-methyl-12-O-tetradecanoylphorbol 13- ciprofibrate acetate sodium arsenite 4-hydroxytamoxifen 8-((4- chlorophenyl)thio)cyclic-3′,5′-AMP lycorine dipivefrin amitraz tranilast compactin benoxaprofen acadesine halofuginone diphenylpyraline wortmannin 4,4′-diaminodiphenylmethane alginic acid naringin isoascorbic acid benzothiazide geldanamycin Shiga Toxin Cholera Toxin BCG Vaccine Ribavirin Phytohemagglutinins Antigen-Antibody Complex Enalapril Captopril Phenylalanine Palmitic Acid Alprostadil Deoxyglucose Clobetasol Dexamethasone Danazol Vecuronium Bromide Dihydrotestosterone Androsterone Viomycin Bacitracin Clofazimine Carbamazepine Quinacrine Oxolinic Acid Clioquinol Oxyquinoline Amodiaquine Thioguanine Bucladesine Vidarabine Methotrexate Saquinavir Indomethacin Dicumarol Rotenone Quercetin Luteolin Aflatoxin B1 Nocodazole Atrazine Rolipram Clemastine Triprolidine 2,2′-Dipyridyl Nifedipine Trihexyphenidyl Aminoglutethimide Cycloheximide Paroxetine Domperidone Ketoconazole Betazole Miconazole Pentylenetetrazole Caffeine Dextromethorphan Vincristine Ajmaline Harmaline Dihydroergotamine Pergolide Colchicine Cam ptothecin Fusaric Acid Hydroxyurea Allantoin Dimethyl Sulfoxide Hydrochlorothiazide 6-Mercaptopurine Triflupromazine Thioridazine Promazine Perphenazine Mesoridazine Chlorpromazine Acetylcysteine Mitomycin Diazinon Dichlorvos Pregnenolone Carbonitrile Clarithromycin Brefeldin A Melphalan Carbon Tetrachloride Pravastatin Vitamin K 3 Plicamycin Daunorubicin Aclarubicin Meclizine Thapsigargin Paclitaxel Amantadine Methyl Methanesulfonate Phenelzine Doxepin Diclofenac Dicyclomine Puromycin Ascorbic Acid Dextropropoxyphene Disulfiram Mycophenolic Acid Butyric Acid Vigabatrin Baclofen Azacitidine Ipratropium Granisetron Edrophonium Gallamine Triethiodide Benzalkonium Compounds Aminophylline Fluvoxamine Verapamil Mephentermine Methamphetamine Amphetamine Methyldopa Levodopa Bromhexine Furosemide Ceftazidime Cephaloridine Cephalothin Cefazolin 2-Acetylaminofluorene Nadolol Metaproterenol Midodrine Isoproterenol Epinephrine Clenbuterol Choline Cisplatin Lithium Carbonate C1. Molecules that upregulate PYCR1: Ethionamide halofuginone coumarin Asbestos Hyaluronic Acid methylformamide Teriparatide Phenylephrine Carbon Tetrachloride Mannitol Ethambutol 1,3-dichloro-2-propanol artemisinine clebopride 4-(4-fluorophenyl)-2-(4- hydroxyphenyl)-5-(4- pyridyl)imidazole Methimazole Hypericum extract LI 160 Carbimazole Riluzole bromobenzene 6-bromoindirubin-3′-oxime Methapyrilene Chlormezanone U 0126 Trimethadione Chloroform Tunicamycin Nafcillin Cloxacillin hydrazine crotamiton Ticlopidine Procyclidine ceforanide estradiol 3-benzoate 4-methyl-N-(3-(4- methylimidazol-1-yl)-5- (trifluoromethyl)phenyl)- 3-((4-pyridin-3-ylpyrimidin-2- yl)amino)benzamide Okadaic Acid ascorbate-2-phosphate GW 3965 Azoxymethane Estriol Propylthiouracil Trenbolone Acetate, (17beta)-isomer 4-dichlorobenzene Estradiol Cymarine 3-nitropropionic acid Molindone Tryptophan Trichlormethiazide Propoxycaine graveoline Glycocholic Acid Mestranol 4,5-dianilinophthalimide N-(2-aminophenyl)-4-(N-(pyridin-3- Thioctic Acid ylmethoxycarbonyl)aminomethyl)benzamide Thiabendazole Insulin Clodronic Acid 2-dichlorobenzene Disulfiram Cephapirin Doxycycline Carbamazepine anastrozole Acetaminophen Cephalexin Cyproterone Acetate shogaol Stavudine 2,4-Dinitrophenol Dihydrotestosterone Carcinogens Bromocriptine iodoform Thapsigargin Danazol Dimethylformamide arcaine vanoxerine fosfosal Thioacetamide Canavanine Piromidic Acid pantoprazole KCB-1 protein, recombinant epidermal growth factor (1-45) oltipraz Omeprazole diisopropyl methylphosphonate Hydrogen Peroxide Clonazepam acetylleucine Reserpine Dapsone Fluconazole Ethinyl Estradiol Sulfadimethoxine Nalidixic Acid Estrogens Azacitidine etofenamate Erythromycin Sulindac epoxomicin sulconazole Methylene Chloride Pipemidic Acid Cefazolin Bleomycin Trimipramine Ultraviolet Rays tolfenamic acid Spiperone Todralazine Phenobarbital Allopurinol Isoniazid 1,2-dithiol-3-thione oxaliplatin Equilin Orphenadrine Amphotericin B N-(2-cyclohexyloxy-4- zaprinast nitrophenyl)methanesulfonamide apicidin BCG Vaccine closantel Roxithromycin kavain dironyl tracazolate Methyltestosterone Ionomycin Amanitins Lasalocid withaferin A Pentolinium Tartrate pristane Hexachlorobenzene oxolamine Hydroflumethiazide Hydroxyzine Stanozolol sodium nitrate Triflupromazine Oxyquinoline Roflumilast Thiethylperazine Gossypol phenothiazine Fursultiam in Muromonab-CD3 Ibuprofen Trimethoprim cerivastatin N-benzyladenine Tetrachlorodibenzodioxin X-Rays Diazepam Phenazopyridine Cyproheptadine Selegiline salmeterol bromperidol Clioquinol Pizotyline Ketorolac acetorphan Cefaclor verteporfin Phenelzine Khellin (melle-4)cyclosporin Nifedipine Isoproterenol Diethylstilbestrol Vitamin E Diquat Prenylamine Deoxyglucose gibberellic acid Cinnarizine Azathioprine Acetazolamide Carmustine butoconazole Diclofenac Domperidone abamectin Benzocaine famprofazone Particulate Matter Progesterone Gentamicins Desoxycorticosterone Monensin Remoxipride sodium arsenite Benzethonium Genistein hydrastinine Phenylalanine Felodipine Glycerol Captopril fulvestrant Acetohexamide nifuroxazide hydroxyachillin Tobramycin bisphenol A Astemizole rituximab Folic Acid methylbenzethonium enterotoxin B, staphylococcal Hydrogel Cyclosporine Caerulein Mesalamine Naproxen bicalutamide fragment C, human serum albumin tibolone Antibodies, Monoclonal LBH589 phorbolol myristate acetate Soman Niclosamide Tiapamil Hydrochloride Clotrimazole SC 514 Mitomycin Dactinomycin Quercetin Flecainide Ketoconazole N-nitrosomorpholine sunitinib Aminoglutethimide irinotecan Apomorphine thymoglobulin HC toxin methyleugenol Anti-Retroviral Agents Dipyridamole Berberine mometasone furoate Promethazine ethotoin 4-hydroxytamoxifen HI 6 Diazinon Flutamide 8-Bromo Cyclic Adenosine Monophosphate beta-Naphthoflavone Cardiotoxins Piracetam Dantrolene Lithium arsenic trioxide Itraconazole Ozone scriptaid N-Methylaspartate methylatropine Econazole nimesulide Diphenhydramine acadesine mono-(2-ethylhexyl)phthalate vorinostat Selenomethionine Mebendazole Choline Iproniazid Indomethacin Dichlororibofuranosylbenzimidazole Furosemide Altretamine bortezomib Enoxacin Citalopram Sotalol atorvastatin Pregnenolone Aspirin valdecoxib Carbonitrile olanzapine meloxicam Clozapine Risperidone Perphenazine Chlorpromazine Amitriptyline C2. Molecules that downregulate PYCR1: 1 -(5-Isoquinolinesulfonyl)-2- Aphidicolin Methylnitrosourea Methylpiperazine monastrol Aclarubicin geldanamycin mafosfamide blebbistatin Ornidazole N-methylpyrrolidone 4-(N-methyl-N- Dimethyl Sulfoxide nitrosamino)-1-(3-pyridyl)-1-butanone Disopyramide Metaproterenol gefitinib sesamin Immunoglobulin M Lithium Carbonate Mycophenolic Acid Clofibric Acid benziodarone Idarubicin enzastaurin 2-(1H-indazol-4-yl)-6-(4- methanesulfonylpiperazin- 1-ylmethyl)-4-morpholin-4- ylthieno(3,2-d)pyrimidine edelfosine Doxorubicin Puromycin Aminonucleoside bendazolic acid Daunorubicin Mycotoxins Camptothecin imatinib MRK 003 nickel sulfate Synephrine Etoposide naringenin Clofibrate Coumaphos Cycloheximide Sirolimus ethaverine Gemfibrozil trichostatin A Idoxuridine imiquimod Cisplatin Vincristine Protriptyline CEP 14083 Paroxetine decitabine Benzbromarone Potassium Dichromate hydrastine tetrahydrozoline 17-(allylamino)-17- demethoxygeldanamycin Diethylhexyl Phthalate Fonofos Dexamethasone Minocycline Streptozocin pronethalol Dihydroergotamine bamipine perfluorooctane sulfonic acid Dilazep Ethyl Methanesulfonate eticlopride levocabastine Santonin CD 437 Ceftriaxone Sulfapyridine Gonadotropins cidofovir 4-acetylaminofluorene wortmannin troglitazone Hemin 1-Methyl-3-isobutylxanthine zardaverine Simvastatin Vinblastine Prazosin sulforafan Fenofibrate Mafenide 2-(4-morpholinyl)-8-phenyl- Curcumin 4H-1-benzopyran-4-one clinafloxacin Benzo(a)pyrene buparvaquone cyanopindolol Caffeine Zimeldine Fenoterol everolimus 2-Acetylaminofluorene minaprine pioglitazone 1-ethyl-2- benzimidazolinone Dichlorphenamide methiazole TO-901317 8-((4- Chitosan 4-(5-benzo(1,3)dioxol-5-yl- chlorophenyl)thio)cyclic- 4-pyridin-2-yl-1H-imidazol- 3′,5-AMP 2-yl)benzamide Doxepin alpha-Amino-3-hydroxy-5- Tretinoin methyl-4-isoxazolepropionic Acid Bezafibrate colforsin Phalloidine Diltiazem Deferoxamine flubendazole biphenylylacetic acid Oxolinic Acid SB 203580 3,3′,5-triiodothyroacetic acid carcinine Luteinizing Hormone Plicamycin Phenylbutazone lapatinib 15-deoxy-delta(12, 14)-prostaglandin J2 Enalapril Allantoin diloxanide furoate Etidronic Acid Metribolone chelidonine marimastat Chorionic Gonadotropin fenspiride Valproic Acid Clonidine dibenzazepine gabazine Corticosterone vinylidene chloride Thioguanine Ethionine Isoetharine Vidarabine LPS 9 letrozole salsolidine Betazole Oxymetazoline Ethylnitrosourea Dextran Sulfate linalool NG-Nitroarginine Methyl Ester Pyrantel Zinc Oxide Fusaric Acid Tetradecanoylphorbol Acetate Ranitidine Dexfenfluramine canadine mycophenolate mofetil rosiglitazone AICA ribonucleotide Metolazone Tolazoline Alprostadil Oxazepam Colchicine Mefenamic Acid dexchlorpheniramine alginic acid Sulpiride Dinoprost Acetylcysteine systhane Finasteride vinorelbine Fluphenazine gemcitabine erlotinib Raloxifene 1,2-dilinolenoyl-3-(4- bis(tri-n-butyltin)oxide Pergolide aminobutyryl)propane-1,2,3-triol Ascorbic Acid Monocrotaline Papaverine Imipramine Trifluoperazine Phenol Metformin benzyloxycarbonylleucyl- triadimefon leucyl-leucine aldehyde Rifampin leflunomide nimetazepam Methyl Methanesulfonate Dimethylnitrosamine Ajmaline Tetracycline Cefuroxime monorden cobaltous chloride Paraquat Chlorambucil naphthalan Chlorpheniramine Emetine terbinafine lansoprazole Methotrexate Nicotine Cyclophosphamide Diethylnitrosamine Prochlorperazine Haloperidol Quinidine Digoxin Losartan fluvastatin Puromycin Cytarabine Paclitaxel pirinixic acid Tranylcypromine dasatinib resveratrol carvedilol Ribavirin Calcitriol Ofloxacin Rolipram Amiodarone Thioridazine Lovastatin Fluoxetine D1. Molecules that upregulate ALDH18A1: halofuginone bestatin Tunicamycin Ecdysterone beta-cyclodextrin- Methapyrilene benzaldehyde Vanadates Captopril Dimethylnitrosamine ONO 2235 Azathioprine Thapsigargin Loratadine acodazole Biperiden Stanozolol 3-nitropropionic acid Clodronic Acid Naloxone enterotoxin B, rifapentine staphylococcal 1,3-dichloro-2-propanol sildenafil Glycocholic Acid Hypericum extract LI 160 irbesartan sulconazole apicidin Paroxetine Lomustine balsalazide Cyclosporine U 0126 cetraxate amineptin Ethambutol ascorbate-2-phosphate Levodopa Capsaicin Calcium 4,4′-diaminodiphenylmethane Etodolac Cardiotoxins Carmustine Allopurinol Acetaminophen Indinavir SB 203580 Piracetam valdecoxib Niridazole Altretamine lornoxicam Ethylnitrosourea Ethionamide Diflunisal 6-Mercaptopurine Hyaluronic Acid Busulfan Doxepin Fluphenazine cyanoginosin LR Salicylic Acid Isoproterenol Promazine Clomipramine Rifampin Thioacetamide tetrandrine amprenavir LG 268 Ketoconazole pristane Ampicillin Albendazole Itraconazole Triiodothyronine Muromonab-CD3 fulvestrant nimesulide meloxicam telmisartan Raloxifene Bromisovalum Terbutaline Nitrofurazone tracazolate 6-bromoindirubin-3′-oxime Bleomycin vinylidene chloride valsartan geraniol Progesterone lacidipine tropisetron 4-(4-fluorophenyl)-2-(4- hydroxyphenyl)-5-(4- pyridyl)imidazole Sulindac enterotoxin I, staphylococcal eperisone Stavudine estradiol 3-benzoate testosterone 17 beta-cypionate Thiorphan Podophyllotoxin Doxapram ferulic acid Ethinyl Estradiol ovalicin Pentobarbital Ethionine Tetracycline Cyproterone Acetate desloratadine Vinblastine olanzapine lead acetate Chloroform Isotretinoin artemisinine pirenperone Aspirin Diethylstilbestrol Diclofenac N-(2-aminophenyl)-4-(N-(pyridin-3- Estradiol Mebendazole ylmethoxycarbonyl)aminomethyl)benzamide Valproic Acid pantoprazole Ticrynafen Isoflurophate Lithium Carbonate Labetalol lansoprazole Carbon Tetrachloride Particulate Matter 1-amino-2,4-dibromoanthraquinone clorsulon Pentylenetetrazole Lead tris(2,3-dibromopropyl)phosphate Pregnenolone Carbonitrile alginic acid ciclopirox Phenylephrine Teriparatide Glipizide thymoglobulin Folic Acid Ozone linezolid Oxyquinoline Clotrimazole fazarabine 8-Bromo Cyclic Adenosine Serotonin Caerulein Monophosphate Neostigmine Lithium Proglumide Morantel Saquinavir CpG ODN 2216 Dipyrone Tinidazole Cisapride Glycerol Mannitol Chlormadinone Acetate Memantine Minoxidil Tetracaine 1,5-naphthalenediamine Monensin nateglinide bromodichloromethane Phytohemagglutinins Insulin erlotinib Trifluridine zomepirac Aminosalicylic Acid Amitriptyline Hydrogen Peroxide 2,4-diaminotoluene Triacetin Mestranol Ethanol 4′-N-benzoylstaurosporine ferric nitrilotriacetate Nortriptyline Thiamphenicol Metformin benzyloxycarbonylleucyl-leucyl-leucine Risperidone Calcitriol aldehyde Pyrethrins Melphalan BCG Vaccine R 848 4-acetylaminofluorene bortezomib Diphenhydramine procyanidin Soman Tranexamic Acid Atovaquone Cyclophosphamide Pempidine Luteolin Metaraminol Indomethacin HI 6 Citric Acid Omeprazole anastrozole Diethylnitrosamine N-acetylsphingosine Imipramine Curcumin Ritonavir Lobeline Ipratropium Digitoxin temsirolimus Ionomyin Metoprolol flavopiridol 1-Methyl-4-phenyl-1,2,3,6- tetrahydropyridine Promethazine Lamivudine Streptomycin Tubocurarine Vitamin E Nitrendipine Riluzole Glycine 2,2′-Dipyridyl Enalapril Doxazosin Aphidicolin Amlodipine Ketoprofen benazepril Hydrochlorothiazide Vincristine dexchlorpheniramine Nisoldipine Lisinopril Alpha-Amanitin doxofylline Piroxicam Dimenhydrinate Amphetamine Cimetidine Naproxen Ketorolac Citalopram tenidap efavirenz Sulpiride 4-(5-benzo(1,3)dioxol-5-yl-4- pyridin-2-yl-1H-imidazol-2- yl)benzamide candesartan gemcitabine ochratoxin A Ribavirin Deoxyglucose Chitosan Nevirapine Miconazole Nicotine Hydroxyurea Ticlopidine Sarin Nafenopin Atropine D2. Molecules that downregulate ALDH18A1: neuropeptide Y (18-36) Platelet Activating Factor Chloroquine sodium chromate(VI) GW 501516 Methylnitronitrosoguanidine troglitazone Natriuretic Peptide, C-Type scriptaid 1-hydroxycholecalciferol amitraz Perhexiline Terfenadine Amiodarone hexachloroethane Prostaglandins E Gentian Violet Rolipram Zalcitabine Vecuronium Bromide HC toxin Ethylestrenol vinorelbine AICA ribonucleotide torsemide sodium selenate Mephentermine 8-aminohexylamino cAMP artemether Idarubicin Fluocinolone Acetonide Thioguanine Humic Substances monastrol trovafloxacin insulin-like growth factor I (57-70) Hexachlorophene benoxaprofen rofecoxib rosiglitazone Chlorpyrifos Shiga Toxin Methylnitrosourea Fluoxetine Cyclandelate Etoposide methyl salicylate Tolazoline Acrolein Benzocaine zardaverine Roflumilast parbendazole Methyl Methanesulfonate CPG-oligonucleotide zopiclone ibufenac carvedilol Methylcholanthrene benzyloxycarbonylvalyl-alanyl- aspartyl fluoromethyl ketone quintozene 4-dichlorobenzene Sulfadiazine Clofibrate Puromycin Aminonucleoside hydrastine Metronidazole Menthol beta-Naphthoflavone Sirolimus Dexfenfluramine sodium arsenite Cisplatin Daunorubicin 2-Acetylaminofluorene Phenobarbital Simvastatin Camptothecin Niacin Tacrine Sotalol Nifedipine nitrosobenzylmethylamine Alprazolam fenspiride Immunoglobulin M mafosfamide Doxorubicin Dichlorvos Dihydrostreptomycin Sulfate Clofazimine Ceftazidime Niacinamide Emodin naphthalan clinafloxacin naphthalenediimide rabeprazole Diazinon Propantheline Pergolide 6-methoxy-2- naphthylacetic acid Digoxin Probenecid Pimozide Carboplatin benfluorex terbinafine Tetrachlorodibenzodioxin Ampyrone Mafenide tetrahydrozoline Lindane phosphonoacetamide Maprotiline Neomycin infliximab 2-methoxyestradiol Finasteride Dexamethasone Methylene Chloride Cycloheximide 1-(5-Isoquinolinesulfonyl)- 2-Methylpiperazine Flavoxate Hydralazine Etidronic Acid Poly I-C Mercuric Chloride zileuton trichostatin A DDT Methotrexate atorvastatin Bismuth oxcarbazepine tosufloxacin piclamilast Vidarabine Anti-Retroviral Agents Benzo(a)pyrene cerivastatin cobaltous chloride Propylthiouracil Erythromycin Hydrocortisone Bepridil Caffeine Benserazide LBH589 Amikacin Trifluoperazine Harmaline Fenofibrate tranilast chromium hexavalention Aflatoxin B1 gabapentin lomefloxacin fomepizole Metoclopramide Chlorpropamide Phenol Histidinol Chlorpromazine chelidonine myricetin Bezafibrate letrozole phenacemide everolimus edelfosine Clonidine imatinib celecoxib Pravastatin Prochlorperazine nifenazone Granisetron oxiconazole Isoniazid phorbolol myristate acetate Suloctidil Albuterol Acetazolamide Diethylhexyl Phthalate Ethosuximide Halothane tenofovir 1,2,3-trichloropropane Metaproterenol N-(2-cyclohexyloxy-4- Fusaric Acid nitrophenyl)methanesulfonamide beta-1,3-glucan ipriflavone Fluconazole 2-(1H-indazol-4-yl)-6-(4- Inosine Monophosphate hydrazine methanesulfonylpiperazin-1-ylmethyl)-4- morpholin-4-ylthieno(3,2-d)pyrimidine Betamethasone isoconazole Cyproheptadine Gonadotropins Sumatriptan Dihydroergotamine Furosemide Fluspirilene Ciprofloxacin Azaguanine Mifepristone Clarithromycin Gentamicins arsenic trioxide Dihydroergocristine decitabine Ultraviolet Rays Genistein Sertraline Ethylene Glycol Zinc Oxide Sulfaphenazole Rifabutin 4-octylphenol hydroquinone Paclitaxel Foscarnet lingzhi tazobactam Bithionol Furazolidone calycanthine Thioridazine 2-(4-morpholinyl)-8-phenyl-4H-1- Iproniazid Flutamide benzopyran-4-one diphenylpyraline Chorionic Gonadotropin 2-dichlorobenzene 15-deoxy-delta(12, 14)- Dinoprost hexachlorobutadiene prostaglandin J2 Clozapine CEP 14083 pioglitazone betulinic acid Fludrocortisone Lovastatin Pyridoxine Sulfadoxine Acetylcysteine glycidol isocorydine blebbistatin 1,3-dichlorobenzene Clofibric Acid X-Rays 1-ethyl-2-benzimidazolinone Troleandomycin boldine Tretinoin Amoxapine Pregnenolone Tolazamide Ethacrynic Acid Coumaphos 5-episisomicin oxaliplatin Cefadroxil pyrvinium Monocrotaline Tramadol harmol Phenelzine fluvastatin ethotoin Puromycin Ergocalciferols oltipraz Penicillamine acemetacin dexibuprofen Piperonyl Butoxide Topotecan Choline PI103 dorzolamide Dantrolene Norethindrone Bromocriptine Gossypol bisphenol A Alprostadil Carbachol repaglinide Melatonin Clonazepam Quinacrine Moxalactam Domperidone Bisacodyl Prednisolone phenethyl isothiocyanate Butyric Acid ebastine Malathion Azacitidine Lorazepam Ethyl Methanesulfonate Nitric Oxide 1-Methyl-3-isobutylxanthine geldanamycin Nimodipine Colchicine Fluvoxamine Nystatin monorden Mitomycin Atenolol vorinostat Chlorambucil NG-Nitroarginine Methyl Ester Metergoline irinotecan Netilmicin gefitinib 3-deazaneplanocin Benperidol Deferoxamine Y 27632 canadine Losartan Dizocilpine Maleate Cytarabine Haloperidol Clemastine resveratrol dibenzazepine Enoxacin Rotenone Amiloride Prazosin Terazosin Quercetin 17-(allylamino)-17- mono-(2-ethylhexyl)phthalate Gemfibrozil demethoxygeldanamycin SU 5402 Emetine Flunarizine Plicamycin Vitamin K 3 4-hydroxy-2-nonenal Nocodazole Fenoprofen Zidovudine Ranitidine Dicyclomine Mycophenolic Acid compactin dasatinib leflunomide Econazole Galantamine Diazepam lysophosphatidic acid 8-((4-chlorophenyl)thio)cyclic- Dactinomycin 3′,5′-AMP Ofloxacin Fluorouracil Oxymetazoline Papaverine Ifosfamide Amantadine Disulfiram Methyldopa E1. Molecules that upregulate OAT: Forskolin LBH589 fipronil sorafenib riddelliine Sirolimus trichostatin A decitabine tetra(4-N- methylpyridyl)porphine testosterone 17 beta-cypionate Sodium Benzoate Aphidicolin Diquat bevacizumab ellipticine Amitrole benzimidazole Ecdysterone marimastat Copper Sulfate dasatinib Sulpiride Cantharidin erlotinib Meptazinol 4,4′-diaminodiphenylmethane Aclarubicin Idoxuridine Diethylhexyl Phthalate Tolnaftate sulforafan 2-nitrofluorene thermozymocidin fludarabine Theophylline suxibuzone Valproic Acid beta-Naphthoflavone HC toxin Methylnitrosourea 1-ethyl-2-benzimidazolinone vorinostat Molindone Triiodothyronine cidofovir Pyrethrins Fenoterol Aflatoxins butamben diisopropyl Paraquat methylphosphonate Thapsigargin Mannitol geldanamycin monastrol Hycanthone Pregnenolone Carbonitrile Ofloxacin Thiostrepton bafilomycin A tripterine tenidap 4-cyclododecyl-2,6- dimethylmorpholine acetate senecionine Vincristine Benzalkonium Compounds Methyldopa zardaverine Phenylmercuric Acetate Papaverine Isoniazid Fenofibrate sanguinarine Haloperidol Pregnenolone Metribolone 2-methoxyestradiol phenethyl isothiocyanate imatinib Cam ptothecin Ozone blebbistatin Gabexate 4-nonylphenol Amphetamine Clodronic Acid Methylprednisolone VX Cytokines Dihydrotestosterone Tretinoin doxofylline Thioctic Acid Fenoprofen oxaprozin cerivastatin Yellow Fever Vaccine Hemin N-methylpyrrolidone Zidovudine Etidronic Acid tenofovir Diflunisal isoconazole trilinolein Methanol Folic Acid Clofibrate nimesulide Fluphenazine Quercetin Botulinum Toxins, Type A Prostaglandins E Acrolein Cefuroxime Chlorpheniramine Tetanus Toxin Ribavirin bis(tri-n-butyltin)oxide Methylcholanthrene heliotrine triptolide ciclopirox Bupropion Clenbuterol Dicyclomine Strophanthidin gefitinib Hydrogen Peroxide gedunin Caffeine Trenbolone Acetate, (17beta)-isomer atorvastatin romidepsin Hydroxyurea Flurbiprofen Nevirapine Moxisylyte Cytochalasin B pristane bicalutamide Cholera Toxin Zalcitabine gamma-Tocopherol 8-Bromo Cyclic Adenosine Anti-Retroviral Agents Phenylbutazone Monophosphate 8-((4- 1-(5-Isoquinolinesulfonyl)-2- Corticosterone chlorophenyl)thio)cyclic- Methylpiperazine 3′,5-AMP thymoglobulin Insulin cathelicidin antimicrobial peptide everolimus BCG Vaccine X-Rays letrozole Mycophenolic Acid Doxepin Enalapril NG-Nitroarginine Methyl Dimethyl Sulfoxide Ester Metoprolol Methotrexate Furosemide Enoxacin alpha-Tocopherol Cyclosporine Phenylephrine 4-methyl-N-(3-(4- Deferoxamine methylimidazol-1-yl)-5- (trifluoromethyl)phenyl)-3- ((4-pyridin-3-ylpyrimidin-2- yl)amino)benzamide Rifampin Vinblastine Amitriptyline Quinidine oxybutynin Dactinomycin lysophosphatidic acid Atropine resveratrol Terbutaline Paroxetine 17-(allylamino)-17- demethoxygeldanamycin Losartan Albendazole Diphenhydramine Fluoxetine Fluorouracil bisphenol A acetopyrrothine 1-Methyl-3-isobutylxanthine Cytarabine Vitamin K 3 Paclitaxel Benomyl E2. Molecules that downregulate OAT Thioacetamide Ticlopidine bendazolic acid Dimethylnitrosamine Hexachlorobenzene methylformamide Chlormezanone coumarin bromobenzene Flutamide Ethambutol lornoxicam Piperonyl Butoxide Clonazepam nitrosobenzylmethylamine N-nitrosomorpholine Propylthiouracil Diethylnitrosamine 1,3-dichloro-2-propanol pantoprazole Methimazole Am inoglutethim ide Hexamethonium Carbamazepine artemisinine 1,2-dithiol-3-thione oltipraz Chloroform Monocrotaline 4-dichlorobenzene Ethionamide Stavudine Asbestos hydroxytamoxifen Carbimazole Phenobarbital ochratoxin A Pyrogallol Disopyramide Gemfibrozil alachlor Carbon Tetrachloride 2-dichlorobenzene Acetaminophen Cinnarizine Chloramphenicol 2-Acetylaminofluorene terbinafine Naproxen Colchicine Lorazepam gentamicin C salicylamide Econazole estradiol 3-benzoate Omeprazole bambuterol Phenacetin garcinol Gentian Violet Okadaic Acid Phenytoin Clotrimazole Testosterone iodoform Trimethadione Citrinin Hydroxyzine nimetazepam Polychlorinated Biphenyls crotamiton benziodarone iturelix Dehydroepiandrosterone Mestranol Methyltestosterone Etodolac Miconazole Dantrolene PI103 Safrole Estriol Niclosamide Ibuprofen Malathion Penicillamine Calcium Chloride Carmustine Methapyrilene lead tetraacetate vanadyl sulfate Benperidol dexamisole Procarbazine hexachlorobutadiene Benzbromarone Methylene Chloride Cymarine ranolazine Azathioprine Chromium Famotidine Tryptophan Lead Ketanserin Atovaquone Phleomycins Trypsin Inhibitor, Bowman- Birk Soybean Amanitins meloxicam Sulfasalazine Mifepristone Salicylates Dinoprostone Sulindac 5′-methylthioadenosine Patulin Danazol Doxorubicin Metolazone pioglitazone zileuton Canavanine Dizocilpine Maleate Urethane Tacrine sodium chromate(VI) Estradiol Disulfiram fosfosal 4-(5-benzo(1,3)dioxol-5-yl- fenamiphos 4-pyridin-2-yl-1H-imidazol- 2-yl)benzamide Vancomycin Dimethylformamide Lomustine Luteolin Lasalocid naphthalene Diazepam perfluorooctanoic acid 2,4-Dinitrophenol phenothiazine Nitrazepam acetovanillone acadesine Gentamicins Diltiazem Ketorolac shikonin Edrophonium Isotretinoin rabeprazole Fursultiamin Lidocaine Fluocinolone Acetonide Genistein Minocycline syrosingopine GW 3965 Thiabendazole Ethinyl Estradiol Itraconazole Fluorometholone 3-deazaneplanocin Fluconazole Diethylstilbestrol Cyproterone Acetate Promethazine rosiglitazone aristolochic acid 1 Cisplatin scriptaid Ganciclovir Emetine Diclofenac lingzhi ferric nitrilotriacetate Ethionine Khellin hydrazine Canrenoate Potassium Nystatin 9-(2-hydroxy-3- nonyl)adenine Tunicamycin systhane Caerulein Phenylalanine Calcium Clofibric Acid arsenic trioxide Hemicholinium 3 Ethylnitrosourea sodium arsenite Remoxipride Oxazepam Dexamethasone Hydrocortisone dirithromycin homatropine U 0126 Clobetasol triadimefon Melphalan Zimeldine Antigen-Antibody Complex Nitrofurazone Ethanol cephaelin apratoxin A Aspirin arsenic acid Betamethasone furaltadon flunixin 1,3-dichlorobenzene anastrozole nifuroxazide Lovastatin Pivampicillin Nifedipine Tolazoline Nocodazole tropisetron Orotic Acid Simvastatin Carcinogens CpG ODN 2216 isoxicam naftopidil leflunomide Nicotine Dihydroergotamine acidocin CH5, Lactobacillus Bezafibrate acidophilus Serotonin Allopurinol Spironolactone Piribedil Glyburide Clomiphene temozolomide Nordefrin Niacinamide Primidone Lobeline Ethylestrenol Tetrachlorodibenzodioxin Carnitine 4-(4-fluorophenyl)-2-(4- hydroxyphenyl)-5-(4- pyridyl)imidazole Trichloroethylene Clonidine sevoflurane Immunoglobulin M motexafin gadolinium Pilocarpine Deoxycholic Acid dihydroquinghaosu piperaquine Amiodarone Ajmaline Amantadine picrotoxinin versipelostatin Mephentermine Calcitriol tracazolate gatifloxacin nilutamide securinine Azaguanine Ampicillin Epitestosterone Y 27632 Nicergoline Isoproterenol 16-ketoestradiol mycophenolate mofetil Aminocaproic Acids Epirubicin fulvestrant Immunoglobulins, Amphotericin B Intravenous Shiga Toxin Pemoline balsalazide Chlortetracycline Inosine Monophosphate Pimozide Betaxolol MF59 oil emulsion Nimodipine enterotoxin B, Nitrofurantoin pirinixic acid staphylococcal carvedilol Methazolamide Azacitidine Indomethacin Rotenone Rolipram Propranolol Albuterol Dichlorvos Sotalol enzastaurin Nitric Oxide N-Ac-CHAVC-NH2 Tranylcypromine Cyclophosphamide Puromycin mono-(2-ethylhexyl)phthalate Neomycin Plicamycin phosphonoacetamide Ascorbic Acid bortezomib rofecoxib Mitomycin Chlorpromazine fluvastatin Clindamycin Palm itic Acid Deoxyglucose Kainic Acid Alpha-Amanitin Pergolide Oxymetazoline Vitamin E Mebendazole Ketoconazole Ciprofloxacin Clomipramine isoascorbic acid Ionomyin Thioguanine Cycloheximide Methyl Methanesulfonate F1. Molecules that upregulate ALDH4A1: Cyclopenthiazide Sulfadimethoxine Mephenesin Tiletamine Methotrimeprazine Trimethoprim tomatidine Pilocarpine citiolone Bisoprolol butacaine Glycopyrrolate Bufexamac chloropyramine pipenzolate Meclizine Zimeldine acetylleucine Albuterol amylocaine Methoxamine bacampicillin Etanidazole Riluzole Propranolol zaprinast telenzepine Azathioprine Cefixime Buspirone Bemegride 4-acetylaminofluorene Sulfisoxazole ajmalicine pelargonic acid trimethobenzamide naringin sulfanilamide Oxyquinoline Dihydrostreptomycin triadimefon Hydralazine Sulfate oxaliplatin Norethindrone Chlorpheniramine Procaine Aclarubicin diflorasone diacetate Felodipine Tolmetin Sulfacetamide Amiloride Bromocriptine harman Propidium TO-901317 benzothiazide Propylthiouracil Remoxipride efavirenz Cefazolin tridihexethyl Aristolochic Acids Dipyrone Moricizine Dihydrotestosterone 1-(2-cyano-3,12- Etoposide Pargyline dioxooleana-1,9-dien-28-oyl)imidazole triptolide diisopropyl Ethylnitrosourea methylphosphonate Hymecromone Josamycin Methylnitrosourea clopidogrel Heptaminol Orphenadrine Tobramycin 4-(N-methyl-N- nitrosamino)-1-(3-pyridyl)-1-butanone Nalidixic Acid eperisone Moxisylyte Ondansetron arcaine Spironolactone trichostatin A fenhexamid Doxorubicin monastrol Cyclopentolate clidinium Hydrocortisone artemisinine lorglumide Forskolin troglitazone 8-(3-Chlorostyryl)-1,3,7-trimethylxanthine geldanamycin Cromolyn Sodium Selenomethionine 2-nitrofluorene 4,4′-diaminodiphenylmethane Glutamic Acid Vecuronium Bromide Guanfacine vorinostat Streptozocin Ethambutol Diethylnitrosamine Mephenytoin Azaperone diperodon Allantoin fomepizole Lamivudine Etilefrine Sulfasalazine VX oxolamine 1-Methyl-3-isobutylxanthine Enalapril carbinoxamine Hydroxyzine Dilazep Cisplatin Glycocholic Acid Sulfameter clemizole apicidin ethotoin decitabine Levodopa isopyrin Aminopyrine Ticlopidine salicylamide enzastaurin chloroacetaldehyde butenafine fenspiride gefitinib Acetaminophen 2-Acetylaminofluorene Kinetin Clarithromycin Practolol Cortisone Thiabendazole Nisoldipine Aflatoxin B1 HC toxin discretamine Thiethylperazine Ketanserin 3-nitropropionic acid tris(2,3- Mianserin Megestrol Acetate dibromopropyl)phosphate Aflatoxins Ultraviolet Rays vinorelbine pyrithyldione pirenperone Daunorubicin LBH589 lapatinib asiaticoside Methacholine Chloride oxcarbazepine Ipratropium 8-((4- Etidronic Acid Tin Fluorides chlorophenyl)thio)cyclic- 3′,5-AMP Sulfamethazine rosiglitazone 3,3′,4′,5- tetrachlorosalicylanilide amitraz romidepsin ascorbate-2-phosphate Corticosterone Pyrazinamide vinpocetine Ethamsylate Minocycline Ketamine Rolipram Ronidazole Curcumin Pinacidil Trichlormethiazide Mitomycin Luteolin lomefloxacin Dexamethasone piclamilast 1,3-dichlorobenzene tranilast Carboplatin Glafenine diphemanil methylsulfate Sulfadiazine Testosterone Verapamil velnacrine Phorbol Esters Zalcitabine Zidovudine butamben Atrazine Ciprofloxacin Sumatriptan Tacrine fazarabine Cytochalasin B Carbimazole Botulinum Toxins, Type A Mustard Gas Carbamazepine Amphotericin B Dipyridamole Furosemide lead tetraacetate Mannitol cefepime Sorbitol letrozole Serotonin Tolbutamide Androsterone abacavir blebbistatin Cisapride Flunarizine Ritodrine Pentoxifylline scriptaid Camptothecin Bupropion picrotoxinin delsoline Hydroxyurea 4-hydroxy-2-nonenal Valproic Acid Amoxapine Metaraminol Oxazepam Theophylline marimastat Citric Acid Podophyllotoxin Altretamine Mycophenolic Acid candesartan Paclitaxel Fenoprofen Gentamicins Vincristine versipelostatin erlotinib Nitric Oxide Phenoxybenzamine Prochlorperazine 8-Bromo Cyclic Adenosine Monophosphate Enoxacin Chlortetracycline Choline Pregnenolone Carbonitrile Phenobarbital Chloramphenicol Vitamin E Clofibrate Busulfan sodium selenate Methotrexate Trifluoperazine Physostigmine Dimethyl Sulfoxide benazepril imatinib Galantamine Azauridine Diflunisal Fluorouracil 4-(5-benzo(1,3)dioxol-5-yl- 4-pyridin-2-yl-1H-imidazol- 2-yl)benzamide Phenylephrine sodium arsenite Aspirin Neomycin Iproniazid Saquinavir Melphalan 1-Methyl-4-phenyl-1,2,3,6- dasatinib tetrahydropyridine Ascorbic Acid Nocodazole Soman U 0126 HI 6 Captopril Ionomyin Chitosan Digoxin Dactinomycin Cycloheximide Amitrole Nicotine Chlorpyrifos Dichlorvos Cyclophosphamide Azacitidine F2. Molecules that downregulate ALDH4A1: spiradoline alfuzosin Buthionine Sulfoximine hydroxytamoxifen Oxolinic Acid Nialamide tianeptine am ineptin homosalate 9-(2-hydroxy-3- Vinblastine Lidoflazine nonyl)adenine Gliclazide althiazide Isosorbide Isotretinoin sunitinib enrofloxacin telmisartan Cefuroxime doxofylline Estradiol Quinidine Ursodeoxycholic Acid piretanide ubiquinol daidzein Aminosalicylic Acid Colchicine Genistein fulvestrant Imipramine Probenecid Amantadine desloratadine Pheniramine Fluoxetine Disopyramide Ecdysterone Simvastatin Methylergonovine ebselen betulinic acid repaglinide Anti-Retroviral Agents naringenin Reserpine nickel chloride Lithocholic Acid N-acetylsphingosine bisphenol A vinylidene chloride valdecoxib Tetracycline beta-Naphthoflavone Cinoxacin bendazolic acid Diclofenac Cytochalasin D Ethinyl Estradiol venlafaxine Lovastatin Mestranol moroxydine Cephapirin alachlor Chloroquine norethindrone acetate Erythromycin Sparteine Labetalol 2-dichlorobenzene Clonidine lacidipine Indomethacin Gold Sulindac Etodolac Clemastine 4-hydroxytamoxifen Diethylstilbestrol Ranitidine Oxytetracycline Zinc Sulfate Natamycin etofylline isopropamide iodide olanzapine Estriol triflusal Canrenoate Potassium Methapyrilene Lobeline Alprazolam Pergolide pioglitazone Ethionamide hydrastinine Clozapine Pravastatin calycanthine N-(2-cyclohexyloxy-4- nitrophenyl)methanesulfonamide Sertraline Naproxen Digitoxin Carbon Tetrachloride estradiol 3-benzoate bicalutamide Roflumilast suxibuzone acetorphan Viomycin Dichlorphenamide aluminum sulfate Acetohexamide carvedilol Vincamine Thioacetamide Metoprolol Raloxifene Doxepin Promethazine geraniol Niridazole Nafenopin Antigen-Antibody Complex dexchlorpheniramine Nitrendipine Isoflurophate Amitriptyline Miconazole Biotin Betamethasone Glycine Phenelzine Sotalol Trihexyphenidyl Tacrolimus famciclovir Isoniazid 4-dichlorobenzene Cimetidine Bumetanide Dinitrophenols benziodarone Paroxetine Fluocinolone Acetonide Dimethylformamide sulfathiazole Danazol Rifampin Phenindione boldine Pirenzepine Fluphenazine Naloxone Ethionine sorafenib Pemoline Amiodarone Capsaicin Disulfiram motexafin gadolinium Hydrogel oxfendazole Antimycin A prochloraz sildenafil ipriflavone Deoxycholic Acid N-Methylscopolamine gabapentin dexibuprofen Cyclosporine Brefeldin A Secobarbital anastrozole rabeprazole Meclofenamic Acid Diphenhydramine oxybutynin Phenytoin atorvastatin canadine biphenylylacetic acid Dobutamine pantoprazole Diltiazem Risperidone Astemizole Methylcholanthrene aceclofenac genipin Rotenone idebenone cobaltous chloride Diazinon titanium dioxide Estrogens deferiprone alpha-Amino-3-hydroxy-5- methyl-4-isoxazolepropionic Acid Sirolimus Ifosfamide 1,1,1 -trichloroethane halofuginone pristane Chloroform sulforafan Flutamide phenylhydrazine 5′-methylthioadenosine lysophosphatidic acid Ecdysone quetiapine Acyclovir Finasteride epoxomicin Indapamide Nalbuphine Gemfibrozil Azlocillin beta-cyclodextrin-benzaldehyde modafinil rifapentine 4-octylphenol Nortriptyline Ofloxacin Dantrolene efalizumab Diethylhexyl Phthalate Poly I-C tazobactam sparfloxacin nimesulide Citalopram Phentolamine 4-nonylphenol Bacitracin Tiapamil Hydrochloride Nimodipine Bezafibrate Chlorpromazine Metyrapone benfluorex Chlormadinone Acetate Coumaphos Potassium Dichromate 6-Mercaptopurine Clomipramine leflunomide Thioridazine Chlorambucil cyanoginosin LR Thapsigargin 2-(4-morpholinyl)-8-phenyl-4H- 1-benzopyran-4-one Clonazepam meloxicam 2-methoxyestradiol cilostazol Quinacrine Ibuprofen fluvastatin phenethyl isothiocyanate chlorcyclizine Vanadates lactacystin Ketoconazole Itraconazole Econazole Isoproterenol Tocainide benzamil Floxuridine Thioguanine Tranexamic Acid temsirolimus Concanavalin A Aminoglutethimide Deoxyglucose Clotrimazole Terazosin resveratrol SB 203580 Nadolol cerivastatin Fluconazole Tinidazole Promazine Allopurinol lansoprazole Perhexiline linezolid Pentylenetetrazole ONO 2235 Deferoxamine Loratadine bortezomib ferulic acid Sulpiride Tropicamide Cytarabine Baclofen Nifedipine acadesine Fluvoxamine Melatonin Haloperidol Methazolamide Streptomycin Omeprazole Clindamycin terbinafine Terfenadine Diazepam Ramipril Caffeine Cinnarizine Calcitriol Quercetin Granisetron Phenylalanine valsartan Dicyclomine Ketorolac Lisinopril Cyproheptadine Nevirapine Pyrogallol Piroxicam Stavudine rofecoxib benzyloxycarbonylleucyl- zileuton leucyl-leucine aldehyde gemcitabine irinotecan pirinixic acid isoascorbic acid Oxymetazoline Papaverine Acetazolamide Hydrochlorothiazide Lomustine Carmustine Clofibric Acid Amphetamine G1. Molecules that upregulate SLC36A1: pridinol Talampicillin N(1)-methyl-2-lysergic acid diethylamide Piperacillin sertaconazole Theobromine isopyrin Sulfaquinoxaline adrenosterone iturelix troglitazone Salicylates CpG ODN 2216 Grape Seed pioglitazone Proanthocyanidins 4-hydroxy-2-nonenal Insulin tripterine lenalidomide Erythromycin Pentolinium Tartrate Ethylsuccinate Aclarubicin SC 514 cryptoxanthin tridihexethyl Cromolyn Sodium Mycotoxins Endotoxins Glafenine SB 203580 Yellow Fever Vaccine Vitamin E withaferin A Botulinum Toxins, Type A lorglumide flumequine Propanil rosiglitazone Albuterol CD 437 Fluorometholone 1,3-dichlorobenzene MF59 oil emulsion Inosine Monophosphate Trimethoprim Methoxamine romidepsin Didanosine diphemanil methylsulfate sodium chlorate 15-deoxy-delta(12,14)- prostaglandin J2 gefitinib Trimeprazine fazarabine Valproic Acid Tetrachloroethylene 1,5-naphthalenediamine decitabine procyanidin monobenzone indole-3-carbinol Mexiletine direct black 3 Biotin Metribolone mefexamide trichostatin A Quercetin GW 3965 2-dichlorobenzene 4-dichlorobenzene alginic acid Roxarsone rilmenidine Nefopam Fludrocortisone lapatinib Dexamethasone midecamycin Hycanthone Monocrotaline caffeic acid zaprinast Dihydrotestosterone blebbistatin monastrol enzastaurin Calcitriol pristane vesamicol geldanamycin Pempidine cyanopindolol Trifluoperazine Cytochalasin B Lincomycin fragment C, human serum albumin LPS 9 Thioridazine Dimethylnitrosamine Epirizole Cefuroxime Perhexiline N-nitrosomorpholine Octopamine Dichlororibofuranosylbenzimidazole Paclitaxel Metoclopramide Bleomycin Acetylcysteine Vincristine ajmalicine Gonadotropins Simazine Pipemidic Acid homatropine daboiatoxin lomefloxacin Rifabutin Amiloride Heparin Chlorpromazine celecoxib homochlorocyclizine quintozene Lynestrenol Carcinogens Ascorbic Acid Immunoglobulin M Carbachol Oxyquinoline Doxepin Malathion vorinostat Rolipram kavain Vitamin K 3 16-ketoestradiol 4-amino-6-hydrazino-7-beta-D- Apomorphine Phenoxybenzamine ribofuranosyl-7H-pyrrolo(2,3-d)- pyrimidine-5-carboxamide imatinib Dinoprost sapphyrin benzyloxycarbonylleucyl-leucyl- Doxorubicin Disulfiram leucine aldehyde sulfathiazole triadimefon LBH589 Diltiazem Hydroxyzine Aztreonam adalimumab Benzo(a)pyrene heliotrine resveratrol Methylnitrosourea rituximab Ethacrynic Acid Propylthiouracil Diazinon fluticasone Tetradecanoylphorbol Acetate Methotrexate Sulfasalazine Clomipramine fulvestrant copolymer 1 Piperonyl Butoxide Levonorgestrel 4-hydroxytamoxifen bromodichloromethane dasatinib Acetaminophen Tretinoin Azathioprine Hemin Chorionic Gonadotropin Labetalol Fluoxetine Nifedipine Iproniazid testosterone 17 beta- Aflatoxin B1 Phenacetin cypionate Ergocalciferols HI 6 Topotecan irinotecan Mycophenolic Acid Methyl Methanesulfonate colforsin bortezomib Hydrogen Peroxide 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl- methylatropine Nitric Oxide 1H-im idazol-2-yl)benzamide pantoprazole Pregnenolone Carbonitrile Immunotoxins sulforafan Ethosuximide Promazine Methylene Chloride Colchicine Nortriptyline Particulate Matter Medroxyprogesterone Acetate torsemide rabeprazole Risperidone Nocodazole Puromycin ochratoxin A Tacrine Penicillamine Enalapril Atropine Caffeine Indomethacin Camptothecin fluvastatin sodium arsenite Diazepam Fluorouracil Clotrimazole Amitriptyline Azacitidine G2. Molecules that downregulate SLC36A1: carbetapentane Methoxsalen lonidamine Alpha-Amanitin genipin quinethazone Betaxolol clemizole Bisoprolol verteporfin Prenylamine Nafronyl fenspiride ciclopirox ascorbate-2-phosphate Indapamide GW 501516 Cholera Toxin Dihydroergotamine Methamphetamine parbendazole harmol Trioxsalen BCG Vaccine Eugenol Benserazide Apigenin moxonidine Immunoglobulin G naphthalene enterotoxin I, staphylococcal Bethanechol Curcumin Mesalamine Famotidine Growth Hormone Santonin mebhydroline Cisapride Coumarins Platelet Activating Factor Mannitol Tetrachlorodibenzodioxin 2-nitrofluorene Ambroxol Aflatoxins Ganciclovir hydroxyachillin Ethambutol MK 0591 Tolmetin flunixin Acetohexamide phthalylsulfathiazole Thapsigargin Tunicamycin Sulfadimethoxine rauwolscine-OHPC lobelanidine acidocin CH5, Lactobacillus acidophilus infliximab Glipizide Concanavalin A chelidonine Clorgyline Antigen-Antibody Complex 2,2′-(hydroxynitrosohydrazono)bis- Practolol Azoxymethane ethanamine Oxytocin skimmianine Ethisterone shikonin Minocycline 1-Methyl-3-isobutylxanthine Flutamide Primaquine Mafenide Diethylhexyl Phthalate Acepromazine Cyclophosphamide Harmine Protoveratrines solasodine Dinoprostone 17-(allylamino)-17- Prednisolone demethoxygeldanamycin Corticosterone Ceftazidime CPG-oligonucleotide Palmitic Acid Selenomethionine Cholecalciferol halofuginone Beclomethasone beta-cyclodextrin-benzaldehyde amlexanox trilinolein amylocaine Staurosporine Deoxycholic Acid Gemfibrozil Atrazine Isoniazid sangivamycin triptolide Enterotoxins Rifampin titanium dioxide ellipticine AICA ribonucleotide nifuroxazide Estriol Paroxetine Dextran Sulfate Pyrazinamide Procainamide Dilazep Imipramine TO-901317 Clonidine salsolidine Estradiol 6-azathymine 4-acetylaminofluorene Chlorprothixene Niclosamide Methyltestosterone Ethanol 8-Bromo Cyclic Adenosine Propofol Poly I-C Monophosphate Immunoglobulins, Intravenous Hydralazine sanguinarine Dextromethorphan Piracetam Acrolein Cyclosporine Vincamine Lovastatin Cycloheximide ciprofibrate Luteinizing Hormone Penicillin G vinclozolin emtricitabine bis(tri-n-butyltin)oxide Benzbromarone Folic Acid bicalutamide Pyrogens Bicuculline Doxazosin Deoxyglucose docetaxel R 848 Phenobarbital tenofovir arsenic trioxide Luteolin Pentylenetetrazole Mitoxantrone Norfloxacin poly ICLC lead acetate Diethylstilbestrol cobaltous chloride Hydroxyurea fasudil piclamilast dibenzazepine Sirolimus X-Rays 2-(4-morpholinyl)-8-phenyl- enterotoxin B, trovafloxacin 4H-1-benzopyran-4-one staphylococcal Cisplatin Cytokines Dinitrofluorobenzene Cephalothin quelamycin Epitestosterone Albendazole Anti-Retroviral Agents salicylamide Niacinamide Chlormadinone Acetate Guanethidine Amoxicillin versipelostatin Ionomyin Metform in Papaverine mycophenolate mofetil pirinixic acid balsalazide Bezafibrate Trimethadione Sulpiride Haloperidol Forskolin Ticlopidine Ultraviolet Rays Tacrolimus Methapyrilene Chloroform Nicotine Procarbazine Dactinomycin Phytohemagglutinins bisphenol A erlotinib nimesulide Cytarabine Carmustine Naproxen Diclofenac Aspirin Clofibrate H1. Molecules that upregulate SLC36A2: Ascorbic Acid Teriparatide aluminum sulfate Gonadotropins Bismuth Salicylates acodazole Enterotoxins rosiglitazone beta-Naphthoflavone Tretinoin Chorionic Gonadotropin Azacitidine Hyaluronic Acid 4-(5-benzo(1,3)dioxol-5-yl- 4-pyridin-2-yl-1H-imidazol- 2-yl)benzamide Cycloheximide Metronidazole bisphenol A Heparin MF59 oil emulsion pioglitazone Tetracycline Phenobarbital blebbistatin Niacinamide CPG-oligonucleotide Trenbolone Acetate, (17beta)-isomer 4-hydroxytamoxifen Dimethylnitrosamine Hemin Insulin Azoxymethane imatinib Quercetin Doxorubicin Immunotoxins Clomipramine Dinoprostone Sulindac gefitinib Tetrachlorodibenzodioxin Genistein Indomethacin Dactinomycin bortezomib Diethylstilbestrol Methotrexate Sirolimus H2. Molecules that downregulate SLC36A2: ubiquinol BRL 37344 Bleomycin Trichloroepoxypropane ranolazine Nandrolone chlorinated dibenzofurans pristane withaferin A Berberine lysophosphatidic acid Ouabain Melphalan 1,5-naphthalenediamine vanadium pentoxide Ozone quintozene resveratrol Chitosan R 848 Dinitrofluorobenzene Anti-Retroviral Agents Estradiol dexibuprofen sulforafan Cytokines enterotoxin B, staphylococcal Megestrol Acetate Isoproterenol acidocin CH5, Lactobacillus acidophilus Hydralazine Antigen-Antibody Complex Betamethasone Growth Hormone Vitamin E Dexamethasone Methylene Chloride Fluoxetine Estriol Cyclophosphamide Phenytoin Captopril Progesterone Kainic Acid Tetradecanoylphorbol Acetate Calcitriol Colchicine Valproic Acid Bezafibrate Cisplatin I1. Molecules that upregulate SLC36A4: Glutamic Acid Phytohemagglutinins Cymarine daidzein Brefeldin A Caffeine 2,2-bis(bromomethyl)-1,3- Ergocalciferols Patulin propanediol Deferoxamine Cefuroxime 1-ethyl-2- benzimidazolinone Dihydrotestosterone Methylnitrosourea Tretinoin 8-Bromo Cyclic Adenosine 25-hydroxycholesterol Lithium Monophosphate Ecdysone bisphenol A Eugenol Medroxyprogesterone Acetate R 848 fragment C, human serum albumin Genistein Malathion alpha-Tocopherol Potassium Dichromate N-Methylaspartate infliximab bafilomycin A 6-bromoindirubin-3′-oxime Estradiol 4-biphenylamine tenofovir Dinoprostone 2,2′-(hydroxynitrosohydrazono)bis- DDT Enterotoxins ethanamine Diethylstilbestrol benzyloxycarbonylleucyl- interferon alfa-2b leucyl-leucine aldehyde gamma-Tocopherol cyanoginosin LR Glycerol Folic Acid Azacitidine vorinostat sorafenib procyanidin Progesterone Tunicamycin Pregnenolone Carbonitrile Cardiotoxins Dexamethasone Calcitriol Nifedipine Captopril Piperonyl Butoxide Plicamycin Acetaminophen indole-3-carbinol Levonorgestrel Vincristine Cholecalciferol Thapsigargin Ranitidine pristane quintozene Theophylline triadimefon Doxepin Choline 2-(4-morpholinyl)-8-phenyl- Azoxymethane 4H-1-benzopyran-4-one Y 27632 rosiglitazone letrozole Enalapril Dactinomycin Acetylcysteine Cisplatin Phosphorylcholine cobaltous chloride Aflatoxin B1 Propylthiouracil colforsin Cadmium Insulin Ecdysterone lead acetate 4-hydroxytamoxifen Paclitaxel Promethazine Chlorpromazine Cam ptothecin Ionomyin Amitrole Ethanol Isoniazid sodium arsenite Pyrazinamide Chlorambucil Ultraviolet Rays 4-(5-benzo(1,3)dioxol-5- yl-4-pyridin-2-yl-1H- imidazol-2-yl)benzamide bortezomib imatinib gefitinib Ethinyl Estradiol Vitamin K 3 Hydroxyurea I2. Molecules that downregulate SLC36A4: chromium hexavalention 3-deazaneplanocin 1-(2-cyano-3,12- dioxooleana-1,9-dien-28- oyl) imidazole Metformin Inosine Monophosphate Am 580 cryptoxanthin lapatinib 1-(5-lsoquinolinesulfonyl)- 2-Methylpiperazine SC 514 4-cyclododecyl-2,6- 4-dichlorobenzene dimethylmorpholine acetate Histidinol Aphidicolin N-(2-aminophenyl)-4-(N- (pyridin-3- ylmethoxycarbonyl)aminomethyl) benzamide trichostatin A Hemin blebbistatin Sirolimus Quercetin N-nitrosomorpholine Azithromycin decitabine Methylene Chloride Cycloheximide TO-901317 Poly I-C lactacystin Polychlorinated Biphenyls Benzo(a)pyrene fulvestrant romidepsin Diethylhexyl Phthalate bicalutamide Dinitrofluorobenzene enzastaurin monastrol fluticasone salmeterol Doxycycline Bucladesine 2-dichlorobenzene Calcium 2-(1H-indazol-4-yl)-6-(4- Calcium Chloride methanesulfonylpiperazin-1- ylmethyl)-4-morpholin-4- ylthieno(3,2-d)pyrimidine halofuginone 4-acetylaminofluorene CPG-oligonucleotide geldanamycin Cyproterone Acetate Phenobarbital withaferin A Hydrogen Peroxide Raloxifene bexarotene Dimethyl Sulfoxide Curcum in atorvastatin Doxorubicin erlotinib dihydroquinghaosu piperaquine fasudil sapphyrin BCG Vaccine acidocin CH5, Lactobacillus acidophilus Antigen-Antibody Complex Lactic Acid Vitamin E bromobenzene troglitazone Zinc Oxide Tacrine phorbolol myristate acetate pioglitazone Ribavirin Papaverine Bleomycin LBH589 X-Rays Ascorbic Acid Cyclosporine Daunorubicin bevacizumab Pyrogens beta-Naphthoflavone Ozone 1-Methyl-3-isobutylxanthine gatifloxacin Methimazole 2-Acetylaminofluorene peginterferon alfa-2a Tetradecanoylphorbol Acetate Etoposide docetaxel beta-glycerophosphoric acid leflunomide Indomethacin Diclofenac Formaldehyde Cyclophosphamide Methotrexate Valproic Acid J1. Molecules that upregulate SLC6A20: Sulfamerazine sodium selenate gefitinib dibenzazepine Hemin N,N-dimethylarginine aluminum sulfate fingolimod 7-aminocephalosporanic acid 1-Methyl-4-phenyl-1,2,3,6- MRK 003 everolimus tetrahydropyridine acodazole SB 203580 carbinoxamine Curcumin Pizotyline Cephalexin picrotoxinin trichlorofluoromethane Chlorhexidine bis(tri-n-butyltin)oxide Perhexiline picotamide Tetradecanoylphorbol Acetate Particulate Matter naphthalan thioperamide Fursultiamin levocabastine erlotinib isocorydine ochratoxin A Cyclopenthiazide SEW2871 esculetin Atractyloside Dihydrostreptomycin lobelanidine Sulfate acetorphan Vehicle Emissions Naltrexone Loxapine medrysone Pancuronium Ultraviolet Rays cyanoginosin LR Dichlororibofuranosylbenzimidazole N-(2-cyclohexyloxy-4- Pentetic Acid iodoform nitrophenyl)methanesulfonamide Pheniramine Indapamide Meptazinol Flutamide Acebutolol Edrophonium Spiramycin Etiocholanolone Alprostadil boldine asiaticoside Loperamide Sulfamethazine gibberellic acid citiolone vanoxerine Cefotaxime Bicuculline pyrvinium hesperetin Isradipine Tiapamil Hydrochloride Suloctidil Ganciclovir Paraquat Selegiline Mesalamine diphenidol Clodronic Acid decitabine Dilazep Bleomycin Hexetidine Meclofenoxate clemizole Paclitaxel bicalutamide Gabexate Enterotoxins Heparin Am iloride triptolide Cytokines Metribolone enzastaurin Tranylcypromine Am 580 enterotoxin B, staphylococcal flunisolide Carboplatin Zinc Oxide Methylnitrosourea trichostatin A pramoxine Sirolimus Phenelzine Hydrogen Peroxide Reserpine Genistein phosphonoacetamide Primaquine Dihydrotestosterone Flurbiprofen Clonidine glimepiride Carbimazole Fenoprofen Fluorouracil Chlorambucil Naproxen Roxithromycin Valproic Acid Chloroquine Probenecid geldanamycin Ergocalciferols Cortisone Phenobarbital Acyclovir Nitrofurantoin Pyrogens Calcium Neomycin Ifosfamide R 848 X-Rays imatinib gatifloxacin resveratrol Cyclosporine Quercetin Nifedipine Ranitidine Azithromycin Benzo(a)pyrene Doxorubicin Diethylstilbestrol Tretinoin Methyl Methanesulfonate Lactic Acid Azacitidine Methapyrilene Acetaminophen Cisplatin J2. Molecules that downregulate SLC6A20: Go 6976 Progesterone Parathion testosterone 17 beta- Apomorphine Fonofos cypionate Alpha-Amanitin Shiga Toxin Grape Seed Proanthocyanidins shikonin Malathion sulfanilamide Fusaric Acid polidocanol Teriparatide Doxylamine tibolone Ethylene Oxide mefexamide infliximab quintozene Arecoline Dextran Sulfate caffeic acid Gonadotropins Estradiol acyline gabapentin Puromycin chlorcyclizine sodium arsenite 3-deazaneplanocin Hydrochloric Acid estradiol 3-benzoate Isoniazid Folic Acid nilutamide Eugenol imiquimod Levodopa Rifampin Diethylhexyl Phthalate Chorionic Gonadotropin Epitestosterone Deoxyglucose Luteinizing Hormone Cocaine Zinc rosiglitazone Anti-Retroviral Agents bromodichloromethane Captopril Azoxymethane bisphenol A Choline Methylene Chloride Tetrachlorodibenzodioxin efavirenz Deferoxamine Cholecalciferol bortezomib vorinostat Dexamethasone Clomipramine Lamivudine Etoposide Diclofenac Fluoxetine Metformin K1. Molecules that upregulate SLC6A13: sapphyrin 1-(5- Furosemide Isoquinolinesulfonyl)-2- Methylpiperazine Diethylhexyl Phthalate Chitosan triptolide Clofibrate Ethyl Methanesulfonate monastrol Digitoxin Isoflurane Carteolol phosphonoacetamide Zinc Oxide fosfosal topiramate Mexiletine Carbarson 2-nitrofluorene flunisolide tiaprofenic acid sildenafil Estradiol Sulfameter Proglumide Cytokines butenafine deferiprone hexachloroethane Ethylene Glycol Lidoflazine sulforafan cefepime carcinine Amiodarone tenoxicam prednicarbate Meclofenamic Acid Acetaminophen lead tetraacetate midecamycin myricetin Clarithromycin Lithium Chloride trovafloxacin Propranolol Amprolium Simvastatin shikonin glycidol ochratoxin A scriptaid sodium chlorate Puromycin Aminonucleoside VX sulfathiazole Talampicillin Isoflurophate Diclofenac Auranofin torsemide bendazolic acid Hymecromone Busulfan Deoxycholic Acid sparfloxacin phenylhydrazine Vidarabine Ibuprofen Dichlororibofuranosylbenzimidazole Lomustine Clofibric Acid Mianserin troglitazone picotamide Pantothenic Acid Quercetin Penicillamine Polychlorinated Biphenyls Niacinamide sodium nitrate ponasterone A Valproic Acid Indomethacin Fenofibrate oltipraz Meclofenoxate benoxaprofen Dexamethasone erlotinib Xylazine Minoxidil Finasteride Sulfachlorpyridazine Aspirin diindolylmethane amitraz Chlorzoxazone tropisetron Doxorubicin Captopril Meptazinol vinylidene chloride benphothiamine Azaguanine Perhexiline compactin phenethyl isothiocyanate Diquat Mitomycin Neomycin zaleplon trichostatin A Testosterone balsalazide alitretinoin hesperetin Kinetin Cycloheximide rofecoxib chloroxylenol Lindane Dimethylformamide sesam in Ciprofloxacin Staurosporine Vincristine Cefixime fluvastatin aplidine Oxyquinoline Ticrynafen Azacitidine Spironolactone venlafaxine Sulfadoxine Tocainide Pregnenolone ibufenac graveoline 1-hydroxycholecalciferol Amlodipine Carmustine phenothiazine Prednisolone romidepsin bromfenac Procarbazine Thiabendazole CPG-oligonucleotide tranilast sodium selenate Methyl Methanesulfonate Aristolochic Acids terbinafine carbinoxamine Digoxin Gliclazide Pivampicillin leflunomide oxcarbazepine Gentamicins Fenbendazole rosiglitazone decitabine Methylcholanthrene lead acetate Megestrol Acetate Chlorambucil Pravastatin homatropine dioxybenzone Betamethasone 6-methoxy-2- naphthylacetic acid Promethazine Ritonavir modafinil dexibuprofen Lovastatin Kanamycin Naproxen Nevirapine hydrastinine Etoposide Thioguanine Triamterene Cyproterone Acetate Ofloxacin 4-dichlorobenzene Deferoxamine nabumetone sodium arsenite R 848 bisphenol A sangivamycin Epirubicin Benzocaine wortmannin Netilmicin Nitrofurantoin 1,2,3-trichloropropane Raloxifene Cisplatin BCG Vaccine Canavanine lamotrigine hydroxyachillin Antibodies, Monoclonal Nitrofurazone famciclovir Mercuric Chloride Triiodothyronine Droperidol irinotecan Acetazolamide Maprotiline Tacrine Thiostrepton Lithium cerivastatin Tretinoin Dibucaine Domperidone Rifabutin Benzethonium Camptothecin Azoxymethane Imipramine Disopyramide Pregnenolone Losartan Carbonitrile Ketoprofen Methotrexate Baclofen SU 5402 Vitamin K 3 Diflunisal alpha-Tocopherol vorinostat Sulpiride Luteolin Cyclosporine valsartan Genistein phenacemide 1-Methyl-3- isobutylxanthine Ascorbic Acid N,N′-diphenyl-4- 2-(4-morpholinyl)-8- phenylenediamine phenyl-4H-1- benzopyran-4-one Reserpine Erythromycin Pergolide Streptomycin Nitric Oxide Lorazepam Chlorpyrifos lapatinib Melphalan efavirenz atorvastatin bortezomib Enalapril Dactinomycin Fluorouracil Lamivudine Hydroxyurea Isoproterenol K2. Molecules that down regulate SLC6A13: Aroclors ferric nitrilotriacetate Ethionine Aminosalicylic Acid Methapyrilene amineptin tianeptine carvedilol Labetalol Paclitaxel Itraconazole Yohimbine desloratadine sulconazole Sotalol Methiocarb Amantadine coumarin Chloroquine Colchicine cyanoginosin LR TO-901317 Hexachlorobenzene Doxepin Omeprazole tenidap Methylcellulose piperidolate Monocrotaline Estriol beta-Naphthoflavone Ethinyl Estradiol Safrole norethindrone acetate Chloroform lansoprazole Bacitracin Tinidazole Fluoxetine Zidovudine Ketoconazole Tacrolim us Clomipramine Isotretinoin gibberellic acid Etodolac Sulfisoxazole Granisetron lobelanidine Loratadine Dicumarol Citalopram Cyproterone Hypericum extract LI 160 methylparaben N-nitrosomorpholine Nortriptyline Clozapine Trimethadione Metronidazole KCB-1 protein, recombinant epidermal growth factor (1-45) Ethisterone meloxicam 2-Acetylaminofluorene sunitinib Tetracycline Fursultiamin Carbenoxolone Desipramine Carbon Tetrachloride N-acetylsphingosine Miconazole Naloxone gefitinib Amphetamine Secobarbital bromobenzene valdecoxib Bretylium Tosylate Chlorpromazine Atropine nimesulide Amitriptyline Doxapram Ifosfamide Lithium Carbonate Acebutolol Khellin Cinnarizine Thioctic Acid Diethylstilbestrol piperacetazine mebeverine pralidoxime Ethambutol Mestranol Clotrimazole flubendazole Methyltestosterone Sarin eticlopride aristolochic acid I Diethylnitrosamine Fonofos Mycotoxins Fluphenazine Guanfacine oxolamine Metformin Stavudine Teriparatide apicidin Stanozolol Mephentermine pantoprazole Isoniazid Deoxyglucose naringin Diazepam Rifampin 6-Mercaptopurine crotamiton norflurane 4-octylphenol Sirolimus Sulbactam Cytarabine Ramipril Bicuculline Vinblastine Nifedipine Paroxetine Chlortetracycline sulfabenzamide Allopurinol Cortisone 1,2-dithiol-3-thione HC toxin rabeprazole Sertraline harman acetovanillone Mebendazole Melatonin Danazol Hexamethonium letrozole Choline marimastat Aflatoxin B1 Cetylpyridinium pristane Chlormezanone Carbamazepine 2,3-dioxo-6-nitro-7- sulfamoylbenzo(f)quinoxaline Mifepristone Tamoxifen Roxithromycin 4-nonylphenol DDT dexamisole Ajmaline Promazine Folic Acid cineole pioglitazone Propylthiouracil Phenobarbital Bezafibrate testosterone 17 beta- cypionate Abscisic Acid olanzapine 4-biphenylamine salicylamide Phalloidine Azithromycin beta-cyclodextrin- Ethionamide Clonazepam benzaldehyde Vancomycin ferulic acid Tolazamide tetrahydrotriamcinolone Cytochalasin B Benzo(a)pyrene Cyclophosphamide Azauridine amlexanox Fluocinolone Acetonide Haloperidol temozolomide Minocycline nimetazepam Norethindrone sorafenib nateglinide Dihydrotestosterone 2-dichlorobenzene Tetrachlorodibenzodioxin Fluconazole Alpha-Amanitin idebenone Amoxicillin Vitamin E Gemfibrozil Bromisovalum ascorbate-2-phosphate Catechin tosufloxacin Ampicillin Nafenopin Nitrazepam Chlormadinone Acetate anastrozole Spectinomycin Glipizide Econazole Clomiphene Sulindac Azathioprine quetiapine Dinitrofluorobenzene Dimenhydrinate Clonidine Amrinone Thioacetamide Levobunolol Cephaloridine Vanadates Neostigmine quintozene Enoxacin bromodichloromethane diflorasone diacetate Altretamine Phenacetin Phenelzine Amoxapine Streptozocin Procainamide artemisinine lomefloxacin enterotoxin B, direct black 3 Oxazepam staphylococcal Lead estradiol 3-benzoate alginic acid Levonorgestrel Phenol Phenformin mono-(2-ethylhexyl)phthalate Chlorpheniramine LBH589 Methylnitrosourea pirinixic acid Ethacrynic Acid Chloramphenicol Saquinavir versipelostatin Calcitriol imatinib 6-bromoindirubin-3′-oxime doxofylline Bupropion perfluorooctanoic acid Diltiazem Caffeine Disulfiram Zalcitabine Nicotine Hydroxyzine celecoxib Theophylline tenofovir Perphenazine Shiga Toxin Rolipram Ticlopidine L1. Molecules that upregulate SLC6A14: infliximab moroxydine Diethylhexyl Phthalate Progesterone N-methylolacrylamide quintozene Calcium Trichloroepoxypropane naphthalenediimide bisphenol A Lithium Carbonate naphthalan 8-Bromo Cyclic Vincamine Vitamin K 2 Adenosine Monophosphate Methylene Chloride cidofovir Pyrogens Dimethylnitrosamine pipenzolate Bismuth Practolol dipropizine Penicillin G Ticlopidine 4-hydroxyestradiol-17 8-(3-Chlorostyryl)-1,3,7- beta trimethylxanthine Pivampicillin Quinidine Ethinyl Estradiol Idoxuridine Terbutaline BW B70C 4,5-dianilinophthalimide Enterotoxins Netilmicin CD 437 1-Methyl-3-isobutylxanthine Amrinone Cefotetan 4′-N-benzoylstaurosporine N-Methylscopolamine vanadium pentoxide Pregnenolone Poly I-C Hydrochloric Acid picrotoxinin Ethynodiol Diacetate fenbufen Hymecromone Tetracycline Pyocyanine Spectinomycin Pentamidine Ultraviolet Rays Dibucaine Cyclopenthiazide Tetradecanoylphorbol Bleomycin irinotecan Acetate mycophenolate mofetil lobelanidine Proscillaridin letrozole canadine Metronidazole benfluorex Clobetasol daidzein Cytochalasin B Antimycin A vinclozolin Lactic Acid Estrogens 4-methyl-N-(3-(4-methylimidazol-1- yl)-5-(trifluoromethyl)phenyl)-3-((4- pyridin-3-ylpyrimidin-2- yl)amino)benzamide wortmannin Flecainide Dexamethasone Minoxidil decitabine Folic Acid Vehicle Emissions Piperonyl Butoxide Podophyllotoxin Dantrolene Zalcitabine Dichlororibofuranosylbenzimidazole blebbistatin Ascorbic Acid Phosgene Bupropion Finasteride Insulin U 0126 Disopyramide 4-nonylphenol docetaxel Epitestosterone celecoxib Particulate Matter colforsin acidocin CH5, Lactobacillus acidophilus Tetrachlorodibenzodioxin pralidoxime quelamycin 4-(5-benzo(1,3)dioxol-5- Methapyrilene Ribavirin yl-4-pyridin-2-yl-1H- imidazol-2-yl)benzamide Dactinomycin Carboplatin L2. Molecules that downregulate SLC6A14: 1-amino-2,4- fulvestrant trimethobenzamide dibromoanthraquinone Fluocinonide gefitinib tetrafluoroethylene 4-amino-6-hydrazino-7- iodoform Norethynodrel beta-D-ribofuranosyl-7H- pyrrolo(2,3-d)-pyrimidine-5- carboxamide Dihydroergotamine solasodine Benzo(a)pyrene Milrinone Thyroxine 4-acetylaminofluorene Estradiol Levonorgestrel Dilazep Curcumin Genistein tris(2,3- dibromopropyl)phosphate Thiostrepton verteporfin 15-deoxy-delta(12, 14)- prostaglandin J2 Corticosterone withaferin A Diethylstilbestrol Azoxymethane Reserpine 2-methoxyestradiol phthalylsulfathiazole Oxytocin Apigenin Scopolamine Hydrobromide medrysone 4-biphenylamine meropenem Carbachol Niridazole Chloroquine 4-hydroxytamoxifen diindolylmethane Diazinon Ethisterone Isradipine Alcuronium chlorinated dibenzofurans Trimipramme tribenoside Oxyphenbutazone tyrphostin AG 1478 Luteolin Furazolidone Atovaquone Halcinonide salmeterol ergocryptine Bromocriptine ebselen Clioquinol Sulfisoxazole Promegestone Am 580 polidocanol chloropyramine Trimethoprim fluticasone Phenoxybenzamine rottlerin piperlonguminine lansoprazole mometasone furoate hydrastine flunisolide Zimeldine Amoxicillin Equilin Cotinine everolimus skimmianine 17-(dimethylaminoethylamino)- 17-demethoxygeldanamycin harpagoside bromperidol Isosorbide prednicarbate rosiglitazone Theobromine Etidronic Acid Flavoxate Clofazimine sapphyrin LBH589 Fludrocortisone Gossypol resveratrol cephaelin Felodipine Malathion Imipenem 1-(5-Isoquinolinesulfonyl)-2- Natamycin imatinib Methylpiperazine epitiostanol zardaverine Catechin phenethyl isothiocyanate Atenolol securinine 17-(allylamino)-17- 6-thioguanosine Prenylamine demethoxygeldanamycin sanguinarine Propidium discretamine Androsterone Lindane ciclopirox Methylergonovine dironyl Betahistine Budesonide famprofazone Ethacrynic Acid Clonidine tripterine Metaraminol acacetin Dextran Sulfate Quercetin nifuroxazide Astemizole oltipraz Dinitrofluorobenzene Sulfamerazine methylbenzethonium Vancomycin triptolide Vitamin K 3 Tolbutamide buparvaquone Cadmium sulconazole enzastaurin Bucladesine Betaxolol Griseofulvin Bepridil cinchonine geldanamycin Azathioprine Vitamin E Sulfamethoxazole sulforafan Trifluoperazine Paclitaxel vanoxerine monorden Diclofenac Doxorubicin Tretinoin parthenolide Mefloquine Tunicamycin torsemide Thapsigargin Lithium Promazine monastrol GW 3965 Selenomethionine Aflatoxin B1 Primaquine Hydrocortisone Raloxifene Mexiletine dibenzazepine Dipyrone Dipyridamole Freund's Adjuvant Papaverine 2-(4-morpholinyl)-8-phenyl- Cyclosporine Hydrogen Peroxide 4H-1-benzopyran-4-one trichostatin A Valproic Acid Triiodothyronine 1-Methyl-4-phenyl-1,2,3,6- enterotoxin B, Puromycin tetrahydropyridine staphylococcal Isotretinoin Pyrazinamide Cycloheximide benzyloxycarbonylleucyl- Estriol vorinostat leucyl-leucine aldehyde erlotinib Testosterone Nifedipine Carbamazepine dasatinib Chlorpromazine Amiodarone Hemin Ketoconazole Fluphenazine Vincristine Omeprazole Sirolimus Cyclophosphamide Simvastatin Lovastatin Tamoxifen Acetaminophen Thioacetamide Ethanol Cisplatin M1. Molecules that upregulate SLC6A15: flavanone PI103 alginic acid Ethylene Dibromide Oxymetholone Hydroxyzine Azacitidine Cefixime Cymarine 4-octylphenol Dimethadione Doxycycline Megestrol Acetate Alprazolam nimesulide Diflunisal nifenazone versipelostatin Finasteride Diethylstilbestrol Miconazole Calcium temsirolimus Idarubicin Ethisterone Mephenytoin Valproic Acid Chorionic Gonadotropin edelfosine Carboplatin Diethylhexyl Phthalate vanadyl sulfate Bromisovalum Hydrochloric Acid Norethindrone X-Rays Econazole Chlorambucil leflunomide Simvastatin Trichloroepoxypropane Chlorpromazine Ascorbic Acid cefepime Plicamycin 2-(1H-indazol-4-yl)-6-(4- LBH589 Ibuprofen methanesulfonylpiperazin- 1-ylmethyl)-4-morpholin-4- ylthieno(3,2-d)pyrimidine Caerulein Ethamsylate Deoxyglucose quintozene pioglitazone Pargyline flumequine Clopenthixol gefitinib Lactic Acid amprenavir N-methylolacrylamide Rifampin Enterotoxins clemizole Ivermectin Acetylmuramyl-Alanyl- Nadolol Isoglutamine Cytokines Clotrimazole oxaliplatin picotamide Carbon Tetrachloride Secobarbital bromfenac beta-cyclodextrin- Chloroquine benzaldehyde Rolitetracycline Niacinamide MRK 003 Cytarabine Equilin Glycocholic Acid Cyclopenthiazide suxibuzone tranilast Metform in Isocarboxazid Hydrocortisone ovalicin vinclozolin Ethylene Glycol Sulindac dexamisole Hexestrol Aztreonam Epirizole Practolol tetrahydrotriamcinolone furaltadon Carbamazepine Nafronyl 3-hydroxyacetanilide Butyric Acid vorinostat naftopidil flunisolide Sirolimus Clofibrate bromobenzene Ultraviolet Rays Acetylcysteine Methylene Chloride atorvastatin 2-m ethoxyestradiol Zidovudine Cholecalciferol Guanfacine gatifloxacin bortezomib Puromycin repaglinide 6-Mercaptopurine phthalylsulfathiazole Mifepristone Spectinomycin candesartan olanzapine beta-glycerophosphoric acid Ondansetron Dimenhydrinate Kainic Acid Acepromazine N-nitrosomorpholine Bezafibrate Tunicamycin Carbachol Deoxycholic Acid rimexolone Tobramycin Mesalamine Acetohexamide Ethosuximide Fluorometholone Piroxicam Diazepam Cyclosporine Heparin Naloxone Propafenone Aphidicolin Bacitracin isoascorbic acid Glyburide cyclonite Baclofen Methyl Methanesulfonate Amoxapine Gliclazide Dicumarol Hydralazine Cromolyn Sodium Clomipramine Amphetamine naphthalan vinorelbine sodium arsenite Amikacin Formaldehyde oxcarbazepine Insulin Levonorgestrel Amiloride Follicle Stimulating Nitrendipine Phenacetin Hormone Asbestos scriptaid Particulate Matter cerivastatin 4-methyl-N-(3-(4- sulconazole methylimidazol-1-yl)-5- (trifluoromethyl)phenyl)-3- ((4-pyridin-3-ylpyrimidin-2- yl)amino)benzamide quetiapine celecoxib Thalidomide Trenbolone Acetate, Alpha-Amanitin Perhexiline (17beta)-isomer Sulfisoxazole 2-Acetylaminofluorene Camptothecin Zalcitabine Ergocalciferols Methylcholanthrene Dantrolene Nortriptyline Fenofibrate Griseofulvin Amiodarone Sparteine Iproniazid fomepizole Ethinyl Estradiol torsemide Luteinizing Hormone Citalopram Lithium Indomethacin Methyldopa Hydrochlorothiazide Clofibric Acid Lovastatin Progesterone zomepirac Fluorouracil Oxymetazoline Bupropion meloxicam pralidoxime Danazol Calcitriol Clozapine Dactinomycin Ketoconazole Colchicine Hydroxyurea Ticlopidine Azathioprine Chlorpropamide Bithionol Tacrolimus Azithromycin Tetradecanoylphorbol Acetate Vitamin K 3 Isoniazid Gemfibrozil Atropine Methapyrilene Dimethylformamide Terbutaline Isoproterenol M2. Molecules that downregulate SLC6A15: tianeptine Rotenone polidocanol Enalapril 3-deazaneplanocin Hydrogel Ranitidine geldanamycin Botulinum Toxins Antimycin A 1-ethyl-2-benzimidazolinone epoxomicin Mitomycin Corticosterone Estriol lactacystin Tretinoin U 0126 Vitamin A 4-(4-fluorophenyl)-2-(4- Gonadotropins hydroxyphenyl)-5-(4- pyridyl)imidazole Amphotericin B Thioguanine Fluoxetine fasudil decitabine Gentamicins trichostatin A Estradiol 1-amino-2,4- dibromoanthraquinone temozolomide Pyrazinamide Cadmium Promegestone Chlorpyrifos clopidogrel Ouabain mycophenolate mofetil Diethylnitrosamine Timolol bisphenol A Ceftriaxone 25-hydroxycholesterol Genistein Tubocurarine alpha-Amino-3-hydroxy-5- Doxorubicin Etoposide methyl-4- isoxazolepropionic Acid Ifosfamide Poly I-C Sumatriptan 4-(5-benzo(1,3)dioxol-5-yl- cyanopindolol bafilomycin A 4-pyridin-2-yl-1H-imidazol- 2-yl)benzamide Ketamine Paclitaxel Sarin Sotalol Procarbazine Atrazine harman Procainamide Dexamethasone lacidipine n-hexanal SB 203580 Phenylephrine Chitosan Quercetin 17-(allylamino)-17- Propranolol lead tetraacetate demethoxygeldanamycin 2-(4-morpholinyl)-8-phenyl- Streptomycin Cisplatin 4H-1-benzopyran-4-one efavirenz Lidocaine cidofovir Carbimazole sildenafil Acrolein Acyclovir enterotoxin B, staphylococcal Y 27632 Losartan Lead Loratadine blebbistatin Bleomycin 4-hydroxytamoxifen Dimethyl Sulfoxide sulforafan ciprofibrate Vecuronium Bromide N-Methyl-3,4- linalool methylenedioxyamphetamine fulvestrant Immunotoxins Lamivudine Oxazepam sodium selenate 1-Methyl-3- isobutylxanthine famciclovir Folic Acid Pyrogens Anti-Retroviral Agents Diphenhydramine triptolide Deferoxamine Metribolone sanguinarine Triiodothyronine Monocrotaline gabapentin Phenobarbital Tranylcypromine erlotinib Captopril Phenytoin Ozone Daunorubicin Ethanol Penicillamine docetaxel Tetrachlorodibenzodioxin imatinib Cyclophosphamide Benzo(a)pyrene Thapsigargin cobaltous chloride infliximab rituximab rosiglitazone Dihydrotestosterone Methotrexate Nicotine Forskolin Epirubicin Levodopa Choline N1. Molecules that upregulate SLC6A17: alpha-Amino-3-hydroxy-5-methyl-4- Deoxycholic Acid alpha-Tocopherol isoxazolepropionic Acid gamma-Tocopherol 2-tert-butylhydroquinone Enterotoxins Dactinomycin Tretinoin Polychlorinated Biphenyls trichostatin A BCG Vaccine LBH589 Dichlororibofuranosylbenzimidazole Hydrocortisone 8-aminohexylamino cAMP cobaltous chloride Oxazepam buparvaquone Bicuculline vinclozolin SEW2871 Epitestosterone Lithium Chloride AICA ribonucleotide Cholecalciferol enzastaurin Bupropion SU 5402 Immunoglobulins, Diethylhexyl Phthalate Intravenous pirinixic acid Plicamycin Bucladesine Insulin Vincristine 1-Methyl-3- isobutylxanthine Methylene Chloride Ethanol Hydroxyurea Oxyquinoline Cycloheximide Fluoxetine Hydrogen Peroxide decitabine Growth Hormone Cyclosporine R 848 Deferoxamine vorinostat Methimazole Quercetin Nifedipine Cisplatin Testosterone Acetaminophen Doxorubicin Hemin Phenobarbital N2. Molecules that down regulate SLC6A17: Tranylcypromine fasudil Ouabain 4-hydroxy-2-nonenal Phorbol Esters Forskolin Pyrazinamide Ethambutol Tetrahydrocannabinol Rifampin imiquimod Lithium Staurosporine Isoniazid Zinc monastrol HC toxin lactacystin N-Methylaspartate Dimethyl Sulfoxide Pentachlorophenol Coumaphos Clodronic Acid 4-biphenylamine SB 203580 Levodopa 1-(5-Isoquinolinesulfonyl)-2- Methylpiperazine Methamphetamine Hydroxyzine blebbistatin Bleomycin quintozene bis(tri-n-butyltin)oxide 1,2-dilinolenoyl-3-(4- Camptothecin scriptaid aminobutyryl)propane- 1,2,3-triol phosphonoacetamide Cefuroxime Glycerol Y 27632 apicidin Luteinizing Hormone bromodichloromethane Freund's Adjuvant Niacinamide naphthalene Ultraviolet Rays Immunotoxins Mycophenolic Acid Estradiol resveratrol Phytohemagglutinins Fluorouracil troglitazone Captopril Azoxymethane Ozone Estriol Dexamethasone Rotenone gefitinib CPG-oligonucleotide quelamycin pioglitazone bisphenol A rosiglitazone Benzo(a)pyrene Alpha-Amanitin Methotrexate Tamoxifen Amiodarone Cyclophosphamide Etoposide Paclitaxel Tunicamycin bortezomib erlotinib X-Rays Tetradecanoylphorbol Diethylstilbestrol Carbon Tetrachloride Acetate Progesterone Valproic Acid O1. Molecules that upregulate SLC6A19: 4-hydroxy-2-nonenal imatinib pelargonic acid neuropeptide Y (18-36) Paclitaxel Fenretinide Carboplatin Testosterone lysophosphatidic acid Tetrachlorodibenzodioxin Platelet Activating Factor Inosine Monophosphate Nicotine TO-901317 4′-N-benzoylstaurosporine 5′-methylthioadenosine fulvestrant gefitinib dihydroquinghaosu piperaquine Oxyquinoline Doxorubicin monastrol sulforafan 2-methoxyestradiol SU 5402 sangivamycin Sodium Dodecyl Sulfate decitabine Nitric Oxide Perhexiline SC 514 imiquimod Immunoglobulin G dibenzazepine enzastaurin Reserpine Cisplatin bicalutamide testosterone 17 beta- Cefuroxime Dactinomycin cypionate blebbistatin Methylnitrosourea vorinostat Azacitidine Estradiol efavirenz Alpha-Amanitin Enterotoxins geldanamycin Mannitol Ethanol Tolbutamide Vitamin E 1-Methyl-3-isobutylxanthine Metformin Hydrogen Peroxide Theophylline trichostatin A Lamivudine Amphotericin B 2-Acetylaminofluorene BCG Vaccine beta-glycerophosphoric acid Dexamethasone Phenobarbital Diethylnitrosamine Cyclosporine Methapyrilene Indomethacin Colchicine Benzo(a)pyrene nimesulide Gentamicins Sirolimus Fluorouracil Doxycycline X-Rays Tretinoin Acetaminophen O2. Molecules that downregulate SLC6A19: Fonofos beta-cyclodextrin- Parathion benzaldehyde cyclonite motexafin gadolinium 8-aminohexylamino cAMP phorbolol myristate acetate R 848 Beclomethasone Concanavalin A alpha-Amino-3-hydroxy-5- Folic Acid methyl-4-isoxazolepropionic Acid Ionomyin alitretinoin Choline Epitestosterone Cholecalciferol Ascorbic Acid Tetradecanoylphorbol shikonin direct black 3 Acetate Am 580 Anti-Retroviral Agents Deoxyglucose sodium arsenite Freund′s Adjuvant Brefeldin A Palmitic Acid aluminum sulfate Poly I-C Bicuculline infliximab Chloroquine Dinitrofluorobenzene pioglitazone Cycloheximide Phytohemagglutinins Kainic Acid CPG-oligonucleotide Tamoxifen Captopril bisphenol A Insulin rituximab Dihydrotestosterone Methotrexate Ribavirin Carbon Tetrachloride P1. Molecules that upregulate SLC38A2: 2-tert-butyl-9-fluoro-3,6-dihydro-7H- apratoxin A 1-hydroxycholecalciferol benz(h)imidazo(4,5-f)isoquinoline-7-one Niacin 2-Acetylaminofluorene Zalcitabine pyrvinium eseroline Clomipramine N,N′-diphenyl-4- Tranylcypromine Ethionamide phenylenediamine motexafin gadolinium Dichlorvos closantel Phenacetin Aspirin methylparaben Sotalol phenylhydrazine methyl salicylate ferulic acid salicylamide Clarithromycin Chlorpromazine Caffeine compactin lactacystin Niclosamide Nitrofurantoin ibufenac trovafloxacin Bromhexine temafloxacin Praziquantel Rolipram Shiga Toxin Methazolamide Fenbendazole Cinnarizine Thioridazine Mianserin Ergocalciferols Carbamazepine Theophylline Baclofen Monensin Cholecalciferol Foscarnet chloropyramine Gentian Violet Norepinephrine vinylidene chloride coumarin ipriflavone Trimeprazine Buthionine Sulfoximine Ticrynafen zaleplon Fluphenazine Chloramphenicol Acetaminophen butenafine Chlorhexidine Doxepin Aflatoxin B1 piclamilast tranilast dimethisoquin Megestrol balsalazide romidepsin Yellow Fever Vaccine Methanol nateglinide Sulindac Digoxin Methotrimeprazine glimepiride Nitrazepam Prednisolone Phosgene bendazolic acid Methocarbamol Bisacodyl cyanoginosin LR Dimaprit Disulfiram Glutamic Acid PI103 Dimethylformamide Cephalothin methylbenzethonium hydrazine Strophanthidin zileuton Mefenamic Acid alclometasone dipropionate Methyltestosterone profenamine Vecuronium Bromide troglitazone Halcinonide GW 3965 Metronidazole oxfendazole wortmannin Dequalinium Lindane Pemoline Lasalocid ONO 2235 Cymarine 1,3-dichloro-2-propanol Stanozolol Amantadine Thioacetamide amitraz Morphine Gossypol cloperastine Chlorambucil Budesonide Verapamil Safrole Fluocinolone Acetonide Chloroform Capsaicin Amiodarone Isoniazid beta-cyclodextrin-benzaldehyde bromfenac Lithocholic Acid Cyclophosphamide Pizotyline Clofibric Acid methixene Colchicine Domperidone Albendazole Fluocinonide U 54494A lysophosphatidic acid Zinc Oxide benzamil amlexanox Bupropion Trimipramine CEP 14083 Digitoxigenin homochlorocyclizine Diquat Dicyclomine Tolazamide thioperamide Estradiol Methyl Methanesulfonate Dimethylnitrosamine Chlormadinone Acetate Fludrocortisone Amphetamine Inosine Monophosphate Proglumide Altretamine Methiothepin systhane Aldosterone Chloroquine Niacinamide Naproxen Desipramine Proadifen rimexolone Lidoflazine Pyrilamine cetraxate cerivastatin Ibuprofen Gentamicins Deoxycholic Acid Pyrazinamide Minocycline Azaperone Methapyrilene Tunicamycin Amlodipine CPG-oligonucleotide Clomiphene nebivolol phenothiazine Amoxicillin hydroquinidine estradiol 3-benzoate Propafenone Albuterol amineptin Folic Acid Cyclosporine Estriol 2-(4-morpholinoanilino)- Tacrine 6-cyclohexylaminopurine olanzapine tetrandrine Epirubicin Enalapril Dexamethasone Neostigmine Histidinol Trihexyphenidyl triadimefon Pregnenolone eperisone irinotecan piperacetazine Indomethacin Isoflurophate Prenylamine Spironolactone Diethylnitrosamine Fluvoxamine Sirolimus 3-hydroxyacetanilide Mustard Gas alpha-Amino-3-hydroxy- 5-methyl-4-isoxazolepropionic Acid MF59 oil emulsion bisphenol A Rifabutin Fluspirilene meloxicam anastrozole Proscillaridin Berberine N-acetylsphingosine leflunomide Roflumilast Bepridil Benzo(a)pyrene Mesoridazine Oxprenolol letrozole hydroquinone halofuginone flunisolide ubiquinol Aflatoxins piperlonguminine halofantrine Ethyl Methanesulfonate lanatoside C Ethambutol Protriptyline bromobenzene calmidazolium Monocrotaline Etodolac Thiorphan nimesulide Triprolidine acemetacin Spiperone Triiodothyronine Prednisone tenidap Prochlorperazine Melatonin Methyldopa cobaltous chloride direct black 3 Alprazolam monobenzone KCB-1 protein, recombinant epidermal growth factor (1-45) Ciprofloxacin 2-dichlorobenzene gefitinib Triamterene Trifluoperazine Zidovudine diflorasone diacetate Choline chlorcyclizine Carmustine Hydralazine Finasteride Thapsigargin valsartan medrysone Beclomethasone geraniol Tetradecanoylphorbol Acetate Itraconazole Erythromycin Imipramine Fendiline Lovastatin Astern izole Dihydrotestosterone 4-acetylaminofluorene Methylprednisolone mometasone furoate Puromycin Ceftriaxone venlafaxine Aminonucleoside nickel chloride Chlorprothixene pantoprazole TO-901317 Proguanil Phenylbutazone Tranexamic Acid Clemastine pramoxine Danazol R 848 Cisapride Diclofenac parbendazole oxidized-L-alpha-1-palmitoyl-2- arachidonoyl-sn-glycero-3- phosphorylcholine Pyrogens Vanadates lansoprazole Azathioprine Mycophenolic Acid Ethylene Glycol Nefopam Norethynodrel clemizole tripterine nisoxetine Tamoxifen Chlormezanone Nitrofurazone Mefloquine eticlopride Tetracycline Omeprazole vanoxerine Thiethylperazine marimastat dibenzazepine lingzhi prednicarbate Desoxycorticosterone Oxyquinoline Cyproheptadine tetrahydrotriamcinolone Hexetidine 4-hydroxy-2-nonenal bortezomib Captopril Promethazine Diazinon Iproniazid pimethixene Propranolol Vinblastine doxofylline Brefeldin A Hydroxyzine asperflavin ursolic acid Enoxacin Acetazolamide Nocodazole 1-Methyl-4-phenyl- Saquinavir 1,2,3,6-tetrahydropyridine Ouabain Metergoline Sumatriptan boldine Stavudine N-(2-cyclohexyloxy-4- nitrophenyl)methanesulfonamide Pravastatin Nystatin chelidonine Diazepam N, N-dimethylarginine Perphenazine dasatinib Pergolide Podophyllotoxin Orphenadrine Haloperidol Ketorolac Palmitic Acid Promazine Dizocilpine Maleate Tinidazole sodium arsenite Furosemide Diphenhydramine Loxapine bafilomycin A Maprotiline Propylthiouracil Isoproterenol Clopenthixol Methamphetamine Perhexiline 4-(5-benzo(1,3)dioxol-5-yl- rabeprazole Oxymetazoline 4-pyridin-2-yl-1H-imidazol- 2-yl)benzamide Pimozide 2-methoxyestradiol Nafenopin Thioguanine 2-(4-morpholinyl)-8-phenyl-4H-1- Penicillamine benzopyran-4-one 6-Mercaptopurine phenacemide Labetalol Loratadine Nordihydroguaiaretic Ethacrynic Acid Acid Nicotine Lobeline Phenoxybenzamine Mephentermine candesartan fluvastatin acadesine idebenone 6-methoxy-2-naphthylacetic acid Chitosan Fluconazole Meclizine Citalopram Ifosfamide Acetylcysteine desloratadine Nevirapine Nitric Oxide fragment C, human serum albumin Risperidone resveratrol Amiloride Soman benzyloxycarbonylleucyl-leucyl- leucine aldehyde Chlorpyrifos Puromycin Quinidine HI 6 alpha-Tocopherol Streptomycin 2-(1H-indazol-4-yl)-6-(4- Rifampin carvedilol methanesulfonylpiperazin- 1-ylmethyl)-4-morpholin-4- ylthieno(3,2-d)pyrimidine Staurosporine 1-Methyl-3-isobutylxanthine Moxisylyte lamotrigine Ketoprofen perfluorooctanoic acid MRK 003 Vitamin K 3 Nifedipine erlotinib Aminoglutethimide Phytohemagglutinins Methotrexate Fluorouracil Diltiazem Ribavirin Clozapine P2. Molecules that downregulate SLC38A2: ellipticine Mitoxantrone 4′-epidaunomycin N(1)-methyl-2-lysergic midecamycin triptolide acid diethylamide Echinomycin Paraoxon quelamycin Busulfan Dactinomycin sapphyrin Buformin Deoxyglucose Chlortetracycline Phenformin Papaverine Alpha-Amanitin Econazole cephaelin versipelostatin Coumarins perfosfamide Aclarubicin Polychlorinated Biphenyls Diamide Adenosine-5′-(N- ethylcarboxamide) sesamin Metformin Terfenadine Antazoline Cyproterone Acetate CpG ODN 2216 iodoform Butyric Acid Deferoxamine Nisoldipine Cortisone Cyclandelate oltipraz Emetine tenofovir flavopiridol insulin-like growth factor I (57-70) 8-aminohexylamino cAMP Ketoconazole Hycanthone verteporfin neuropeptide Y (18-36) amprenavir 1-(2-cyano-3,12-dioxooleana- 1,9-dien-28-oyl) imidazole Guanethidine apicidin Ultraviolet Rays Methylcholanthrene Dinoprostone Sulpiride Atovaquone Ceftazidime aluminum sulfate Zinc Sulfate dihydroquinghaosu piperaquine beta-Naphthoflavone Methylnitronitrosoguanidine Bezafibrate Ganciclovir Fenofibrate Testosterone tropisetron pirinixic acid Paclitaxel trichostatin A Triacetin Secobarbital vanadium pentoxide Doxorubicin Cantharidin Apigenin Mifepristone rosiglitazone Phenobarbital anisindione hydrastine gatifloxacin isoconazole Lorazepam Amoxapine acidocin CHS, Hemin Lactobacillus acidophilus Tretinoin Carotenoids Grape Seed Proanthocyanidins fasudil Dimenhydrinate fipexide Immunoglobulin M grepafloxacin Oxazepam Mebendazole Trimethadione blebbistatin daboiatoxin X-Rays 3-nitropropionic acid N-Methyl-3,4- edelfosine Metribolone methylenedioxyamphetamine Piperonyl Butoxide trilinolein Flurbiprofen Cycloheximide cineole Y 27632 Camptothecin Luteolin gabapentin Pentobarbital Rotenone Lidocaine Hydrogen Peroxide Natriuretic Peptide, C-Type Azithromycin Insulin Nadolol Ipratropium 7,8-Dihydro-7,8- rofecoxib pioglitazone dihydroxybenzo(a)pyrene 9,10- oxide senecionine Paroxetine Ethionine Clonazepam Ethisterone Poly I-C Miconazole shikonin Dehydrocholic Acid Flunarizine Tacrolimus imatinib Valproic Acid naphthalene Benzalkonium Compounds Azacitidine valdecoxib atorvastatin Clofibrate bis(tri-n-butyltin)oxide Genistein calycanthine ethaverine lacidipine alginic acid Doxapram 4-nonylphenol decitabine Platelet Activating Factor Timolol Chlordiazepoxide Glyburide Ranitidine vorinostat 2,2′-(hydroxynitrosohydrazono) Dichlororibofuranosylbenzimidazole bis-ethanamine 4-(4-fluorophenyl)-2-(4- Clotrimazole Dobutamine hydroxyphenyl)-5-(4- pyridyl)imidazole Benserazide 4-methyl-N-(3-(4- Amitriptyline methylimidazol-1-yl)-5- (trifluoromethyl)phenyl)-3- ((4-pyridin-3-ylpyrimidin-2- yl)amino)benzamide Dimethyl Sulfoxide Nitroarginine Malathion Metaproterenol Dacarbazine Sarin Acepromazine acacetin Tiapamil Hydrochloride discretamine Concanavalin A Droperidol 3-deazaneplanocin Benperidol Quinacrine Digitoxin Neomycin LBH589 procyanidin Zimeldine 8-Bromo Cyclic Adenosine Monophosphate Quercetin Atropine U 0126 dexchlorpheniramine 2,2′-Dipyridyl Simvastatin Plicamycin Ticlopidine HC toxin sildenafil 1-(5-lsoquinolinesulfonyl)- Famotidine 2-Methylpiperazine ochratoxin A Vitamin E Calcitriol Phenylephrine oxybutynin Mitomycin Lomustine Terazosin Ethylnitrosourea Azauridine Cytarabine salmeterol efavirenz scriptaid Clonidine Gemfibrozil Ascorbic Acid SU 5402 17-(allylamino)-17- SB 203580 Vincristine demethoxygeldanamycin Clindamycin Pregnenolone Carbonitrile Anisomycin Losartan Lamivudine Ionomyin Ramipril Ofloxacin Kainic Acid NG-Nitroarginine Methyl Atenolol gemcitabine Ester Hydroxyurea geldanamycin Terbutaline Levodopa sorafenib Probucol Melphalan Tocainide Q1. Molecules that upregulate SLC38A4: 2-methoxyestradiol 4-acetylaminofluorene Captopril N-(2-cyclohexyloxy-4- Hydrocortisone Sulfaguanidine nitrophenyl)methanesulfonamide ascorbate-2-phosphate Isoniazid 6-bromoindirubin-3′-oxime Ascorbic Acid Rifampin Ethylene Glycol Trichloroepoxypropane SEW2871 sparfloxacin Mitomycin troglitazone N-Methylaspartate Penicillamine Clarithromycin 8-aminohexylamino cAMP vinclozolin Dihydrotestosterone Ozone Nitrendipine lapatinib Sulfisoxazole Ergocalciferols Zalcitabine Sirolimus Dexamethasone Calcium Cetylpyridinium Mannitol Dextran Sulfate Aflatoxin B1 Ibuprofen Benzethonium Theophylline 4-nonylphenol aluminum sulfate ibufenac benoxaprofen Rifabutin Ciprofloxacin meloxicam Nimodipine temsirolimus methyl salicylate Azoxymethane cidofovir cryptoxanthin U 0126 hydrazine lead tetraacetate torsemide Gentian Violet Lomustine Tryptophan Valproic Acid boldine trovafloxacin Probenecid Aspirin flavopiridol Dimethylnitrosamine Doxorubicin 4′-N-benzoylstaurosporine Procarbazine amprenavir pristane tosufloxacin butenafine 5-fluorouridine Fluocinolone Acetonide arsenic acid Busulfan Amphotericin B rofecoxib Hydralazine phenethyl isothiocyanate Atenolol 2-tert-butylhydroquinone Diethylhexyl Phthalate Ethylestrenol Niacin Choline cilostazol vinorelbine Epirubicin chloroxylenol Thioguanine Chlorambucil Chorionic Gonadotropin ferric nitrilotriacetate Physostigmine Diethylnitrosamine Indomethacin Bithionol Camptothecin Caffeine Nafenopin Tiapamil Hydrochloride Sparteine Citalopram Forskolin diphenidol Gentamicins pramoxine Oxyquinoline Roxithromycin Didanosine Fenofibrate Betamethasone Octopamine valsartan Phenacetin 1-Methyl-3-isobutylxanthine LPS 9 gefitinib diloxanide furoate estradiol 3-benzoate Daunorubicin sildenafil Itraconazole Acetazolamide arsenic trioxide Nortriptyline Digitoxin efavirenz Clofibrate 3,3′,4′,5-tetrachlorosalicylanilide Chlorpromazine Felodipine ebastine Gonadotropins Mexiletine ifenprodil Phosgene Carbimazole Zidovudine Sulfadiazine Monocrotaline Diethylstilbestrol Etomidate coumarin Clomiphene Methylcholanthrene Ouabain Bezafibrate harmol Dexfenfluramine Rolipram sorafenib Tolazamide Meclofenoxate Heparin Promazine lomefloxacin Acyclovir Amoxicillin wortmannin 4-octylphenol Dimethylformamide Chloramphenicol Mercuric Chloride Methyldopa Lamivudine fluvastatin Vitamin K 3 Levonorgestrel Ketoconazole zileuton glimepiride phenothiazine Vincristine methyleugenol Thalidomide Fluoxetine Simvastatin zomepirac Cefuroxime flubendazole N-nitrosomorpholine Progesterone Melatonin Altretamine dihydroquinghaosu piperaquine Phenytoin 1,2,3-trichloropropane Lithocholic Acid Levodopa Mefenamic Acid nabumetone tranilast idebenone Etoposide Aclarubicin Neomycin Methotrexate 1-(5-lsoquinolinesulfonyl)-2- Chlormezanone buflomedil Methylpiperazine Moxisylyte artemether Cocaine Bupropion SU 5402 monastrol Sotalol Pyrazinamide Methyl Methanesulfonate Dicyclomine Clomipramine Trimethadione Doxycycline acidocin CH5, Dichlorvos Lactobacillus acidophilus acemetacin Nystatin dexibuprofen Dinitrofluorobenzene Nevirapine Stanozolol 2-Acetylaminofluorene Ethambutol Dactinomycin Naproxen Terbutaline Naloxone Fluconazole Fluorouracil Amoxapine Ultraviolet Rays Sulfadoxine Tocainide Lactic Acid 6-Mercaptopurine Stavudine Ribavirin erlotinib Deoxyglucose Spironolactone R 848 Norethindrone olanzapine Atropine Q2. Molecules that downregulate SLC38A4: bicalutamide apicidin Tolbutamide 1-amino-2,4- scriptaid 17-(allylamino)-17- dibromoanthraquinone demethoxygeldanamycin Go 6976 LBH589 cobaltous chloride vorinostat Chitosan Cycloheximide Clonidine Tetanus Toxin HC toxin Cholera Toxin DDT 2,4-diaminotoluene Diazinon Colchicine 8-Bromo Cyclic Adenosine Monophosphate infliximab senecionine triadimefon Risperidone Hexachlorobenzene Okadaic Acid Sulindac Omeprazole Tubocurarine Lindane GW 501516 Simazine trichostatin A Ethylnitrosourea Cyclosporine Coumaphos Thapsigargin Danazol Tretinoin pioglitazone trilinolein quintozene Insulin cetraxate rabeprazole 25-hydroxycholesterol 4′-epidaunomycin Sulpiride Cyclophosphamide Carmustine Propylthiouracil Nisoldipine Glycerol Noscapine Lead Tetradecanoylphorbol Acetate Cardiotoxins ovalicin Medroxyprogesterone Acetate testosterone 17 beta- Norepinephrine Tinidazole cypionate Azathioprine hexachlorobutadiene mono-(2-ethylhexyl)phthalate Plicamycin Disopyramide Ranitidine Labetalol Perhexiline ranolazine Eugenol Alpha-Amanitin Benzbromarone famciclovir beta-Naphthoflavone Bromocriptine Benzo(a)pyrene cathelicidin antimicrobial peptide rosiglitazone Vecuronium Bromide Hexachlorophene Papaverine trichlorofluoromethane (melle-4)cyclosporin Cisplatin clopidogrel ipriflavone bendazolic acid Beclomethasone doxofylline Diclofenac Erythromycin Flutamide Nifedipine cortisone acetate Phenobarbital atorvastatin Bleomycin Tunicamycin geraniol Pyrogens Promethazine Etidronic Acid Tacrine crotamiton Caerulein Dipyrone celecoxib Primidone vanadium pentoxide sodium selenate sodium arsenite Cyproterone Acetate Ethionine Terazosin Bromhexine Acetaminophen Sulbactam Miconazole Malathion Ticlopidine Phenol Tetrachlorodibenzodioxin Cadmium nitrosobenzylmethylamine Carbamazepine Estradiol terbinafine Paclitaxel Haloperidol Aminoglutethimide Mestranol Vinblastine Methyltestosterone Palmitic Acid Carbon Tetrachloride Ketorolac Fenbendazole Aminosalicylic Acid ciprofibrate Lovastatin Chlormadinone Acetate Cholecalciferol Tetracaine genipin lead acetate sulforafan Nitrofurantoin Dantrolene ferulic acid Methapyrilene Tamoxifen sulconazole Clotrimazole quetiapine Isoproterenol Idarubicin Hydroxyzine Ethinyl Estradiol Dimenhydrinate Azacitidine Nizatidine Clonazepam Procaine bromfenac Pyocyanine artemisinine anastrozole nimesulide Isotretinoin Tetracycline Particulate Matter decitabine heliotrine Furosemide Cyproheptadine MF59 oil emulsion Bacitracin Finasteride Vitamin E Salicylic Acid Ethanol Fluphenazine Acrolein Loratadine Netilmicin AICA ribonucleotide acadesine lansoprazole Hydrogen Peroxide Gemfibrozil Cytarabine Melphalan Mitoxantrone Streptomycin compactin Diazepam Y 27632 pantoprazole Quercetin Lithium Chlorzoxazone Mifepristone carvedilol Deoxycholic Acid SB 203580 1,2-dilinolenoyl-3-(4- bromobenzene aminobutyryl)propane-1,2,3-triol Acarbose fulvestrant Doxapram Metform in Piperonyl Butoxide leflunomide Sulfadimethoxine Poly I-C irinotecan 3-hydroxyacetanilide acyline bisphenol A Ticrynafen Dobutamine Kainic Acid 2-(4-morpholinyl)-8-phenyl- Nitrofurazone Imipramine 4H-1-benzopyran-4-one Minoxidil norethindrone acetate Calcitriol Tranylcypromine Chloroform NG-Nitroarginine Methyl Ester Lorazepam Methimazole Amiodarone Chloroquine Diltiazem Doxepin Sertraline Amlodipine Dinoprostone Estriol Ifosfamide Amantadine benzyloxycarbonylleucyl- 2-dichlorobenzene Genistein leucyl-leucine aldehyde Carboplatin pralidoxime imatinib Thioacetamide Enalapril Amitriptyline R1. Molecules that upregulate SLC6A7: Canavanine Lithium sodium arsenite Theobromine amprenavir aceclofenac Digitoxin Nomifensine diindolylmethane Ribostamycin telenzepine nabumetone Nitrendipine N-Methyl-3,4- Hydroxyzine methylenedioxyamphetamine valsartan Dimethylformamide tetrahydrotriamcinolone Sulindac Glycopyrrolate Clopamide Capsaicin Trichloroacetic Acid Secobarbital Pentobarbital Nadolol Aminophylline Mitomycin Aminopyrine sildenafil triptolide Ketoprofen trovafloxacin 4-octylphenol alverine Simvastatin Diflunisal Cefmetazole Ouabain Chlorambucil Hesperidin Bisacodyl phenethyl isothiocyanate cephalonium lead acetate Clofibrate Salicylates moxonidine Ticrynafen Ibuprofen Dyphylline tranilast Erythromycin Ethylsuccinate Bithionol Progesterone Digoxin Sparteine buflomedil Methacycline esculetin 4-(N-methyl-N- olanzapine Amantadine nitrosamino)-1-(3-pyridyl)- 1-butanone Lovastatin Clarithromycin carcinine oxybutynin benazepril Mexiletine benoxaprofen Probucol Azathioprine Gliclazide Foscarnet Rifabutin Metoprolol Methyldopa Finasteride Norethindrone amylocaine Hydrocortisone Hydrochlorothiazide Econazole Megestrol Acetate Diethylstilbestrol leflunomide Sulfadoxine Ethamsylate nimesulide bromperidol Clomiphene Podophyllotoxin Chlordiazepoxide Citric Acid Mifepristone Didanosine Canrenoate Potassium Chlorpromazine Clonidine 4-methyl-N-(3-(4-methylimidazol-1-yl)-5- Flurbiprofen Stavudine (trifluoromethyl)phenyl)-3-((4-pyridin-3- ylpyrimidin-2-yl)amino)benzamide gabapentin temafloxacin Ethisterone tenidap compactin Procainamide Chloroquine Ranitidine Aconitine Fluconazole famciclovir Sulfameter ibufenac Amlodipine Tetracaine diphenidol vinylidene chloride Ethanol Valproic Acid flunisolide clinafloxacin Theophylline Pantothenic Acid sulforafan Fursultiamin Cisapride tracazolate 2-chloropyrazine Meptazinol verteporfin 4′-N-benzoylstaurosporine eperisone atorvastatin estradiol 3-benzoate Acetaminophen tropisetron gibberellic acid oxolamine Etoposide Propidium phenothiazine Tropicamide Nafenopin Carbon Tetrachloride Nimodipine Noscapine Amitriptyline pramoxine Clomipramine Roxarsone pantoprazole Tetracycline Thiamphenicol Ondansetron Dicyclomine anastrozole oltipraz Tetanus Toxin Tiapamil Hydrochloride Miconazole Fluocinolone Acetonide acacetin heliotrine oxfendazole Hydroxyurea wortmannin Paroxetine bisphenol A dexibuprofen Etidronic Acid Nortriptyline Droperidol Ergocalciferols pioglitazone Lamivudine Metolazone Physostigmine Betaxolol Metoclopramide Raloxifene mycophenolate mofetil marimastat Cyclosporine Cholera Toxin Dexfenfluramine Cisplatin candesartan Y 27632 Flupenthixol Chlorpheniramine Phenobarbital Doxazosin TO-901317 Immunoglobulin M Chlortetracycline Kainic Acid Sulpiride Estradiol phenacemide Minoxidil ochratoxin A Luteolin Cimetidine Cholecalciferol Netilmicin Lithium Chloride Methimazole Trifluoperazine Bacitracin Amiloride Prazosin Fluphenazine Saquinavir Colchicine gefitinib Itraconazole Flavoxate Vincamine vanoxerine Triacetin Pemoline N,N′-diphenyl-4-phenylenediamine Gentamicins oxcarbazepine Losartan rabeprazole Azithromycin Clobetasol Clonazepam Thioacetamide nateglinide Asbestos Warfarin Amiodarone valdecoxib Altretamine Ramipril N-nitrosomorpholine lamotrigine rituximab zomepirac Furosemide Hydralazine Puromycin pirinixic acid Paclitaxel bromfenac Diethylhexyl Phthalate Aflatoxin B1 Dexamethasone Ketoconazole Vinblastine Thioguanine Methylprednisolone U 0126 Calcitriol bromobenzene Ethinyl Estradiol irinotecan Haloperidol Alpha-Amanitin Dactinomycin Vincristine Cycloheximide isoascorbic acid fluvastatin Tetradecanoylphorbol Acetate R2. Molecules that downregulate SLC6A7: Nisoldipine Ethylene Glycol Nevirapine Promethazine Benzocaine PK 11195 solasodine Hexachlorophene Penicillin G Benzathine Alprazolam Atenolol graveoline Ciprofloxacin lomefloxacin Mebendazole Nitrofurantoin Cyproterone Sulfinpyrazone Cefaclor flubendazole Melatonin Urethane N-Methylaspartate 3,3′,4′,5-tetrachlorosalicylanilide Ifosfamide zopiclone Aminoglutethimide lead tetraacetate Glipizide Oxymetazoline Clofibric Acid sparfloxacin Chromium balsalazide Gentian Violet Etiocholanolone minaprine Mesna Penicillamine Thioctic Acid Trimethadione Promazine Omeprazole citiolone Hexetidine Indomethacin ipriflavone alpha-Amino-3-hydroxy-5- methyl-4-isoxazolepropionic Acid Aspirin methyl salicylate fenbufen Vecuronium Bromide Benzethonium levocabastine Acetazolamide closantel glimepiride chlorinated dibenzofurans Succinylcholine Busulfan Niacin Sulfamethoxazole Clotrimazole Carmustine Fonofos Procarbazine Cefotaxime Propylthiouracil Primaquine modafinil Tramadol Isoproterenol sodium selenate rofecoxib resveratrol Neomycin Enterotoxins artemether Clofazimine Acyclovir Rifampin Griseofulvin Methyltestosterone salicylamide chloroxylenol Pempidine letrozole celecoxib 6-methoxy-2-naphthylacetic acid Diethylnitrosamine Ticlopidine Bromisovalum Atropine Isoflurophate torsemide Isoniazid dexchlorpheniramine Loratadine Carboplatin Cromolyn Sodium Ritonavir Mannitol Lomustine Vitamin E Sulfaphenazole Tocainide Iproniazid Tetrachlorodibenzodioxin Phenacetin tazobactam Cyclophosphamide Terazosin norethindrone acetate 2-methoxyestradiol abamectin Azacitidine meloxicam geraniol 2,3-dioxo-6-nitro-7- Soman sulfamoylbenzo(f)quinoxaline Debrisoquin Verapamil Methocarbamol acemetacin Amikacin ubiquinol Beclomethasone oxiconazole Biperiden Doxorubicin troglitazone Kanamycin Mefenamic Acid ozagrel enrofloxacin 7-aminocephalosporanic acid Fenofibrate HI 6 Chloroform Aminosalicylic Acid Cytarabine SC 514 Tubocurarine nifuroxazide Zidovudine ONO 2235 Praziquantel Chlorzoxazone Astemizole Safrole valacyclovir Fluoxetine Dipyridamole Bezafibrate 4-nonylphenol Oxytetracycline clopidogrel lansoprazole Bleomycin venlafaxine telmisartan methylatropine idebenone Citalopram Gossypol Erythromycin 1,5-naphthalenediamine meropenem Cinnarizine diphemanil methylsulfate Albendazole phthalylsulfathiazole Tranexamic Acid Estriol Cortisone artemisinine 1-hydroxycholecalciferol tianeptine ethotoin Piperonyl Butoxide Norfloxacin Oxazepam Riluzole bromodichloromethane Aztreonam Nystatin Ethambutol 2,2′-(hydroxynitrosohydrazono)bis- Spironolactone ethanamine 4,4′-diaminodiphenylmethane Sertraline Naproxen Azlocillin gatifloxacin imiquimod Metronidazole Labetalol Diazepam zaleplon Nicotine Daunorubicin Azoxymethane Vancomycin Tranylcypromine enzastaurin Fludrocortisone lactacystin Maprotiline Pilocarpine Tacrine Mitoxantrone Cyproterone Acetate parthenolide Hydrogen Peroxide Methylcholanthrene Sirolimus quelamycin Pyrazinamide Pyrogallol Freund′s Adjuvant Poly I-C Doxepin Tamoxifen Prochlorperazine Piroxicam Diphenhydramine fomepizole Mestranol Tolbutamide Tolazamide Roxithromycin Genistein Triamterene imatinib Prednisone Carbimazole pralidoxime Fluorouracil Forskolin 17-(allylamino)-17- demethoxygeldanamycin Tretinoin Thioridazine Levodopa Bupropion CPG-oligonucleotide Streptozocin Imipramine Ultraviolet Rays Melphalan rosiglitazone beta-Naphthoflavone quintozene Methotrexate Caffeine Epirubicin 4-(5-benzo(1,3)dioxol-5-yl- Diclofenac 4-pyridin-2-yl-1H-imidazol-2-yl)benzamide S1. Molecules that upregulate DTNBP1: SC 514 PK 11195 Paraoxon Go 6976 decitabine X-Rays Emetine Prostaglandins E Azacitidine Paclitaxel Dinoprostone norflurane benzyloxycarbonylleucyl- emtricitabine tetrafluoroethylene leucyl-leucine aldehyde shogaol procyanidin Promegestone Cytochalasin D temsirolimus Moxisylyte Mianserin iodoform Ethanol Levodopa Carcinogens Immunoglobulin M (melle-4)cyclosporin gatifloxacin tenofovir Staurosporine Antibodies, Monoclonal sapphyrin Ethionine bortezomib enrofloxacin Ecdysterone lenalidomide Sodium Dodecyl Sulfate 2-(1H-indazol-4-yl)-6-(4- epoxomicin Estradiol methanesulfonylpiperazin- 1-ylmethyl)-4-morpholin-4- ylthieno(3,2-d)pyrimidine Hemin Azithromycin Buspirone Carboplatin motexafin gadolinium BCG Vaccine monastrol Isoproterenol Disopyramide Inosine Monophosphate Cytochalasin B Antimycin A Ajmaline Sulpiride Amitriptyline 1,3-dichlorobenzene systhane ascorbate-2-phosphate vorinostat 8-((4-chlorophenyl)thio)cyclic-3′,5-AMP Ethionamide Spironolactone Nifedipine Tetrachlorodibenzodioxin Poly I-C Immunoglobulin G Methamphetamine mycophenolate mofetil Daunorubicin Tretinoin Doxepin Piperonyl Butoxide dasatinib acidocin CH5, Lactobacillus GW 3965 4-(5-benzo(1,3)dioxol-5-yl- acidophilus 4-pyridin-2-yl-1H-imidazol- 2-yl)benzamide gefitinib CPG-oligonucleotide erlotinib U 0126 everolimus peginterferon alfa-2a rituximab rosiglitazone cerivastatin letrozole atorvastatin benziodarone troglitazone gemcitabine bicalutamide norethindrone acetate HI 6 nimesulide withaferin A lead acetate methylatropine arsenic trioxide geldanamycin Enalapril NG-Nitroarginine Methyl Bleomycin Triiodothyronine Ester Chitosan Cortisone Methylprednisolone Fluocinolone Acetonide Danazol Norethindrone Cyclosporine Imipramine Carbamazepine Methotrexate Genistein Quercetin Aflatoxin B1 Rolipram Propylthiouracil Phenobarbital Tunicamycin Hydralazine Paroxetine Flunarizine Ranitidine Benzbromarone Clonidine Reserpine Quinidine Tolbutamide Chlorpropamide Acetylcysteine Pyrogallol Sarin Nitrofurantoin Haloperidol Ifosfamide Minocycline Doxycycline Idarubicin Sulindac Thapsigargin Amantadine Isotretinoin Diethylhexyl Phthalate Ascorbic Acid Azoxymethane Methapyrilene Metformin Flutamide Atenolol Cadmium S2. Molecules that downregulate DTNBP1: N (1)-methyl-2-lysergic acid diethylamide lysophosphatidic acid triptolide Nickel Diquat Terbutaline alpha-Amino-3-hydroxy-5-methyl- Nerve Growth Factors Propanil 4-isoxazolepropionic Acid ubiquinol Melphalan bis(tri-n-butyltin)oxide Aphidicolin 2-amino-1-methyl-6- Acetylmuramyl-Alanyl- phenylimidazo(4,5-b)pyridine Isoglutamine CEP 14083 Topotecan 4-acetylaminofluorene Triazolam coumarin Ethambutol Camptothecin Ceftriaxone Theophylline R 848 indole-3-carbinol Platelet Activating Factor 8-aminohexylamino cAMP trichostatin A Alpha-Amanitin 4-hydroxytamoxifen Pentachlorophenol 7,8-Dihydro-7,8- dihydroxybenzo(a)pyrene 9,10- oxide 1-(5-Isoquinolinesulfonyl)-2- Cisplatin Zinc Oxide Methylpiperazine n-hexanal Dihydrotestosterone Ibuprofen sangivamycin Acrolein Dactinomycin sulforafan naphthalan Growth Hormone Doxorubicin 4-biphenylamine cobaltous chloride Cytokines shikonin Curcumin Colchicine cidofovir Sirolimus Tacrine Estrogens 8-Bromo Cyclic Adenosine Monophosphate bevacizumab Cholera Toxin Acetaminophen Phosphorylcholine 3-deazaneplanocin Phenacetin Dichlororibofuranosylbenzimidazole Potassium Dichromate Plicamycin quintozene CpG ODN 2216 4-amino-6-hydrazino-7- beta-D-ribofuranosyl-7H- pyrrolo(2,3-d)-pyrimidine-5- carboxamide fasudil penciclovir Benzo(a)pyrene Dantrolene Vincristine ferric nitrilotriacetate Chorionic Gonadotropin Testosterone phenethyl isothiocyanate Hydrogel Insulin Acetazolamide N-nitrosomorpholine Pyrazinamide Isoniazid Caffeine Ultraviolet Rays Methyltestosterone Cephapirin SB 203580 Lithium Brefeldin A N-methylpyrrolidone Rifampin 1,2-dilinolenoyl-3-(4- Vehicle Emissions Tetradecanoylphorbol am inobutyryl)propane-1,2,3-triol Acetate imatinib Dexamethasone Penicillamine Vancomycin Methylene Chloride Deferoxamine lapatinib dibenzazepine sunitinib Roflumilast 17-(allylamino)-17- demethoxygeldanamycin infliximab lactacystin fluvastatin phosphonoacetamide 2,3-dioxo-6-nitro-7- pioglitazone resveratrol sulfamoylbenzo(f)quinoxaline irinotecan 4-nonylphenol terbinafine bromobenzene enterotoxin B, phenothiazine staphylococcal beta-glycerophosphoric acid AICA ribonucleotide oxaliplatin pralidoxime ochratoxin A bromodichloromethane closantel quelamycin sodium arsenite testosterone 17 beta-cypionate bisphenol A crotamiton Pyrogens Cardiotoxins Anti-Retroviral Agents Ribavirin Immunoglobulins, Antigen-Antibody Intravenous Complex N-Methylaspartate Ionomyin Dinoprost Medroxyprogesterone Acetate Progesterone Prednisolone Cyproterone Acetate Chlormadinone Acetate Ergocalciferols Ciprofloxacin Oxyquinoline Indomethacin Luteolin beta-Naphthoflavone Diazepam Cycloheximide Hydroxyzine Fluconazole Miconazole Econazole Monocrotaline Azathioprine Chlormezanone Omeprazole Fluphenazine Chlorpromazine Mitomycin Bithionol Diethylnitrosamine Cyclophosphamide Chlorambucil Chloroform Carbon Tetrachloride Vitamin K 3 Tetracycline Epirubicin Raloxifene Tamoxifen Diethylstilbestrol Lactic Acid Diclofenac Puromycin Aminonucleoside Aspirin Valproic Acid Disulfiram Mycophenolic Acid Fenofibrate Clofibrate Bezafibrate Atropine Tranylcypromine Methyldopa Guanethidine Sulfisoxazole Thioacetamide 2-Acetylaminofluorene Formaldehyde Glycerol Lead Hydrogen Peroxide T1. Molecules that upregulate NDN: neuropeptide Y (18-36) perfosfamide decitabine naphthalene norflurane dibenzazepine trichostatin A Papaverine Cytochalasin D tyloxapol Methionine Sulfoximine mycophenolate mofetil Okadaic Acid Parathyroid Hormone beta-cyclodextrin-benzaldehyde Pivampicillin pelargonic acid Nocodazole Clodronic Acid lonidamine Tryptophan trichlorofluoromethane Botulinum Toxins, Type A fazarabine Edrophonium acodazole Tranylcypromine Dibucaine Riboflavin Tetanus Toxin Norepinephrine Tretinoin Ergocalciferols velnacrine diindolylmethane tetrahydrozoline Mianserin 2,4-diaminotoluene amylocaine 1-(2-cyano-3,12-dioxooleana-1,9-dien-28- tris(2,3-dibromopropyl)phosphate tetrafluoroethylene oyl) imidazole Puromycin telenzepine Isoproterenol Aminonucleoside Betazole midecamycin Cholera Toxin N-Methylscopolamine Rolitetracycline temsirolimus Triprolidine Fursultiamin CPG-oligonucleotide Talampicillin Triflupromazine LPS 9 1-amino-2,4- Glycerol dironyl dibromoanthraquinone Isoxsuprine Vitamin B 12 hydrocotarnine Estrone Khellin Dextran Sulfate Cardiotoxins solasodine Doxorubicin Sirolimus oltipraz iodoform 2-methoxyestradiol letrozole Dimethyl Sulfoxide dasatinib Hydrogen Peroxide Epirubicin sertaconazole Bupropion gram me Pregnenolone Amitriptyline 1-ethyl-2-benzimidazolinone Cinnarizine delsoline Spiramycin MF59 oil emulsion Triamterene Lynestrenol ferric nitrilotriacetate Cyclophosphamide Bisoprolol sulforafan fenbufen Tacrine Propidium efavirenz sunitinib phenethyl isothiocyanate docetaxel Roxarsone 17-(dimethylaminoethylamino)- Vitamin E Azacitidine 17-demethoxygeldanamycin Albuterol Calcitriol Imipramine Rifampin aluminum sulfate Heparin Sulfamerazine Bacitracin resveratrol acemetacin bis(tri-n-butyltin)oxide heliotrine Ethambutol cinchonine acidocin CH5, Lactobacillus acidophilus Diethylhexyl Phthalate Atropine Diazinon N-methylpyrrolidone Lamivudine Allopurinol Dapsone Nicotine fulvestrant phosphonoacetamide Cytokines Paclitaxel Amoxapine Progesterone Allantoin Fenbendazole GW 3965 Mifepristone Dimethylnitrosamine Betahistine Flavoxate Fenoprofen fluticasone lapatinib Androsterone Cisplatin Hydralazine diflorasone diacetate Alpha-Amanitin Ethanol Acetaminophen Galantamine N-nitrosomorpholine gemcitabine sulconazole Pergolide 2-(4-morpholinyl)-8-phenyl- Propylthiouracil Sulfadiazine 4H-1-benzopyran-4-one Pregnenolone Carbonitrile Methimazole Dactinomycin Tetracycline aristolochic acid I Isotretinoin Inosine Monophosphate Doxycycline Fluorouracil Ultraviolet Rays gefitinib Dinoprostone Norethindrone Cytarabine Carboplatin Etoposide Sulindac Raloxifene Tamoxifen Metformin T2. Molecules that upregulate NDN: scriptaid apicidin X-Rays shikonin Cefoperazone Natriuretic Peptide, C-Type quintozene Methylene Chloride monophosphoryl lipid A Pindolol 2,2′-Dipyridyl 2,4-Dinitrophenol Enterotoxins Ethylene Oxide naphthalan vanadium pentoxide Estrogens, Conjugated (USP) vorinostat ranolazine Emodin TO-901317 4,4′-diaminodiphenylmethane Pyrazinamide Etidronic Acid Piperonyl Butoxide N-Methylaspartate Anti-Retroviral Agents Cymarine Fusidic Acid Ozone Ethylene Dibromide enterotoxin B, staphylococcal VX Butyric Acid Fonofos Deoxycholic Acid testosterone 17 beta-cypionate Rotenone 1,2,3-trichloropropane Thiethylperazine Ampicillin Shiga Toxin Trichloroepoxypropane 1-Methyl-3-isobutylxanthine Parathion chlorinated dibenzofurans isoconazole ceforanide Phenobarbital Immunoglobulins, Intravenous Abscisic Acid Fluocinolone Acetonide alpha-Amino-3-hydroxy-5- Methylnitrosourea methyl-4-isoxazolepropionic Acid Phosgene direct black 3 perfluorooctane sulfonic acid iturelix Dexfenfluramine Hydrocortisone beta-glycerophosphoric acid infliximab lactacystin valdecoxib rosiglitazone Creatine Ranitidine Risperidone 1-Methyl-4-phenyl-1,2,3,6- tetrahydropyridine Benzo(a)pyrene benzyloxycarbonylleucyl- everolimus leucyl-leucine aldehyde Acrolein Terfenadine R848 ubiquinol Thapsigargin Insulin Chitosan Metolazone temozolomide Chorionic Gonadotropin Azoxymethane Phytohemagglutinins Isoniazid cyclobenzaprine Cyproterone Acetate 4-biphenylamine Bleomycin Y 27632 6-methoxy-2-naphthylacetic acid Paroxetine Calcium Dexamethasone Ascorbic Acid 4-O-methyl-12-O- tetradecanoylphorbol 13-acetate halofuginone Testosterone Hydrochloric Acid Cyproheptadine Enalapril Ouabain Urethane Chlorpropamide Gonadotropins Moclobemide Diethylstilbestrol linezolid Dinitrofluorobenzene Vehicle Emissions Corticosterone LBH589 dexchlorpheniramine Valproic Acid mono-(2-ethylhexyl)phthalate imatinib Lithium Pyrogens 4-dichlorobenzene alginic acid Medroxyprogesterone Acetate Carbamazepine Deoxyglucose Benzethonium Cefuroxime Lactic Acid 4-hydroxy-2-nonenal Mitoxantrone isoascorbic acid Captopril Propofol Estradiol Tolbutamide Tetrachlorodibenzodioxin U 0126 Methylprednisolone Phenacetin Loratadine tenofovir Dinoprost Forskolin Quercetin Tetradecanoylphorbol Acetate glimepiride 4-(5-benzo(1,3)dioxol-5-yl- Vancomycin Cycloheximide 4-pyridin-2-yl-1H-imidazol- 2-yl)benzamide Azauridine Caffeine Methyl Methanesulfonate Tunicamycin Monocrotaline Fluoxetine Chlormadinone Acetate Metronidazole Betamethasone Ethinyl Estradiol Methotrexate Bucladesine Ethionine Folic Acid atorvastatin Amiodarone sodium arsenite hydrazine Prednisolone Genistein Lovastatin Trimethadione gatifloxacin Diazepam bortezomib Fenofibrate Nitrofurantoin Diethylnitrosamine Neomycin BCG Vaccine Ethionamide fluvastatin pioglitazone troglitazone leflunomide bisphenol A Poly I-C Ionomyin Epitestosterone Cyclosporine Indomethacin Miconazole Vincristine Colchicine Chlorpromazine Azithromycin Carbon Tetrachloride Ibuprofen Diclofenac Gemfibrozil Bezafibrate Thioacetamide U1. Molecules that upregulate TP53: sangivamycin 4-amino-6-hydrazino-7- Curcumin beta-D-ribofuranosyl-7H- pyrrolo(2,3-d)-pyrimidine-5-carboxamide pirlindole Paclitaxel Piroxicam Ethionine Mannitol versipelostatin Caerulein 2-Acetylaminofluorene Ethylene Oxide Dimethylnitrosamine Acetylmuramyl-Alanyl-Isoglutamine sapphyrin Foscarnet Sulfisoxazole Dicloxacillin 4-(N-methyl-N- Cefmetazole Diclofenac nitrosamino)-1-(3-pyridyl)-1-butanone isoxicam Go 6976 thiocolchicoside Oxytocin Plicamycin tranilast alphaxalone Moricizine Fluorouracil 1-hydroxycholecalciferol 1-Methyl-4-phenyl-1,2,3,6- Diethylhexyl Phthalate tetrahydropyridine Idoxuridine Mitomycin hexachlorobutadiene Viomycin phenoclor Gentamicins benoxaprofen Zalcitabine Isoniazid Estradiol lead tetraacetate Midodrine Pyrazinamide naphthalene Nickel Spironolactone Amiodarone Emetine Ethynodiol Diacetate Phenobarbital Oxyquinoline Thioacetamide bisphenol A PI103 flumequine estradiol 3-benzoate Methylene Chloride Vecuronium Bromide apratoxin A Phytohemagglutinins Benzo(a)pyrene glycitein lornoxicam motexafin gadolinium Benzethonium Y 27632 Yellow Fever Vaccine fasudil Netilmicin flavanone Nifedipine Histidinol (melle-4)cyclosporin Ethambutol Naproxen Ketorolac eseroline testosterone 17 beta-cypionate Megestrol Acetate Acrolein hydrastine pipenzolate Methylcholanthrene Aristolochic Acids Cyclosporine Diethylnitrosamine Furosemide Methimazole Nordefrin aceclofenac Oxytetracycline Sulfaphenazole phenacemide Aconitine Ethionamide Methyldopa Molsidomine Botulinum Toxins Orotic Acid 1,3-dichlorobenzene Malathion phenothiazine daidzein Cephapirin temafloxacin artemisinine Botulinum Toxins, Type A Tunicamycin piclamilast Didanosine Roflumilast Epitestosterone Soman Metformin Cefoxitin Nom ifensine hexachloroethane sulfathiazole 4-octylphenol Methotrexate deferiprone Mebendazole quintozene Nitrofurazone Dihydrotestosterone sodium arsenite Sulfadoxine Betamethasone ethamivan monophosphoryl lipid A Lomustine erlotinib Enalapril Ranitidine Clotrimazole triptolide Rifampin Bupropion Acetylcysteine lactacystin direct black 3 HI 6 nateglinide 1,5-naphthalenediamine tris(2,3-dibromopropyl)phosphate Quinpirole sildenafil Captopril Vitamin E nimesulide lead acetate Ribostamycin sodium selenate Methapyrilene Disulfiram Tetradecanoylphorbol Acetate Monocrotaline Tryptophan Forskolin Mifepristone Risperidone Ganciclovir polidocanol Remoxipride beta-cyclodextrin-benzaldehyde N-Ac-CHAVC-NH2 Abscisic Acid isopyrin Metribolone 6-azathymine Azacitidine benazepril Bethanechol Famotidine Vancomycin diisopropyl methylphosphonate Ethylene Dibromide Fluspirilene atorvastatin iodoform 7,8-Dihydro-7,8- Oxyphenisatin Acetate 1-amino-2,4- dihydroxybenzo(a)pyrene 9,10-oxide dibromoanthraquinone Ionidamine Pinacidil methylatropine Estriol Melphalan cephaelin Pirenzepine Altretamine beta-Naphthoflavone alpha-Amino-3-hydroxy-5- Cadmium Mesna methyl-4-isoxazolepropionic Acid Bithionol Ibuprofen Nafronyl Tolazoline Sotalol Muromonab-CD3 Calcitriol amitraz Amphotericin B Cholecalciferol Sulbactam Insulin Beclomethasone Cardiotoxins Azlocillin SU 5416 Selenomethionine oxcarbazepine Kanamycin Lithium Etodolac 1,2,3-trichloropropane Mephenytoin Clarithromycin Carboplatin Chlorpromazine Enoxacin Azithromycin modafinil Cyproterone Acetate hydroxytamoxifen Moxalactam Ciprofloxacin Milrinone Miconazole rituximab Ethinyl Estradiol Aminosalicylic Acid 6-Mercaptopurine Freund′s Adjuvant CpG ODN 2216 Methyltestosterone Cyclophosphamide Busulfan nabumetone Harmaline Diflunisal Lincomycin Azathioprine Cyclopenthiazide Stavudine N, N′-diphenyl-4- Rolipram Phenylalanine phenylenediamine ONO 2235 celecoxib 4-hydroxy-2-nonenal Sulindac lamotrigine Ketoprofen Indomethacin Digoxin Cytarabine Baclofen fluvastatin cilostazol Nordihydroguaiaretic Acid Amphetamine Penicillamine Nystatin temozolomide dibenzazepine linezolid lacidipine flavopiridol acadesine olanzapine Hydroxyurea Nevirapine Chlorpyrifos Acetazolamide Streptomycin Niacin ciprofibrate Flupenthixol Econazole Allopurinol 17-(allylamino)-17-demethoxygeldanamycin Amlodipine 2,2′-Dipyridyl Nicotine Nitrendipine Neomycin edelfosine Mycophenolic Acid Fluphenazine Sumatriptan canadine Edrophonium acetovanillone Doxazosin Domperidone Atropine N-Methylaspartate Fluconazole Lovastatin mono-(2-ethylhexyl)phthalate U 0126 Dexfenfluramine alpha-Tocopherol Methazolamide Ketoconazole desloratadine Aphidicolin Quercetin Citalopram Nadolol Podophyllotoxin Perhexiline leflunomide ferulic acid lansoprazole MRK 003 pirinixic acid Omeprazole Papaverine Vinblastine Kainic Acid Luteolin 4-(5-benzo(1,3)dioxol-5-yl- Lisinopril Staurosporine 4-pyridin-2-yl-1H-imidazol-2-yl)benzamide Nimodipine NG-Nitroarginine Methyl Ester tenofovir Finasteride Levodopa Paroxetine carvedilol Aminoglutethimide Terbutaline Imipramine Clonazepam Pregnenolone Carbonitrile anastrozole pralidoxime U2. Molecules that downregulate TP53: Cycloserine monastrol JM 3100 nilutamide Aclarubicin 1-(5-Isoquinolinesulfonyl)-2- Methylpiperazine blebbistatin Vincristine LBH589 geldanamycin N-benzyladenine tridihexethyl Dimethyl Sulfoxide cyanoginosin LR buflomedil 4-acetylaminofluorene trichostatin A apicidin Coumaphos Cefotiam PK 11195 Prilocaine HC toxin Biotin scriptaid Butyric Acid Deoxycholic Acid Piracetam 4,4′-diam inodiphenylmethane Immunoglobulin M Histamine decitabine Suppressor Factors, Immunologic Doxycycline Amikacin Primaquine bafilomycin A Debrisoquin 7-aminocephalosporanic acid DDT phenylhydrazine Etiocholanolone Simazine 4-biphenylamine Asbestos Mycotoxins 3-deazaneplanocin 8-aminohexylamino cAMP 9-(2-hydroxy-3-nonyl)adenine Chlordiazepoxide Theophylline anisindione Reserpine geraniol Bromhexine Dobutamine 2-(4-morpholinoanilino)-6- cyclohexylaminopurine Piperonyl Butoxide kavain abamectin pimethixene bromodichloromethane Sirolimus halofuginone Probucol Clorgyline Vitamin B 12 Tetanus Toxin ochratoxin A Procainamide diphenidol cidofovir compactin Growth Hormone Promegestone Antibodies, Monoclonal Bismuth Ofloxacin Eugenol Ergocalciferols Citric Acid 1-ethyl-2-benzimidazolinone N-Methyl-3,4-methylenedioxyamphetamine Doxapram Sparteine adiphenine Aflatoxin B1 Valproic Acid Sulfamonomethoxine Cholera Toxin Amoxapine Cycloheximide Acetaminophen cineole Phenol Doxorubicin Hydrocortisone quelamycin doxofylline Sodium Dodecyl Sulfate vinclozolin Antimycin A Lamivudine Nitric Oxide Fluoxetine Ethacrynic Acid Flavoxate Guanethidine Dactinomycin Lindane vorinostat Zinc Oxide Triacetin Methylnitrosourea clinafloxacin rifapentine CPG-oligonucleotide phensuximide Disopyramide benfluorex Methoxsalen Flufenamic Acid Fusaric Acid Carcinogens irinotecan 4-dichlorobenzene Tacrine Chlorpropamide Tetracycline Anti-Retroviral Agents Azaperone eburnamonine methiazole Cam ptothecin Carbimazole Buspirone aluminum sulfate Erythromycin vinylidene chloride Diltiazem tosufloxacin rauwolscine-OHPC Buform in pioglitazone temsirolimus Chloroquine Colchicine Ethyl Methanesulfonate Lidocaine Prochlorperazine Nitrofurantoin Etidronic Acid Caffeine Terazosin Prednisolone Dexamethasone Moxisylyte Amiloride dexamisole Alprazolam Medroxyprogesterone Daunorubicin Fenbendazole Deoxyglucose methyl salicylate Zidovudine Ticlopidine Fluocinolone Acetonide enzastaurin Procaine Chlorambucil oxybenzone Lactic Acid 1,1,1-trichloroethane Diazinon Flunarizine Genistein interferon alfa-2b Pyrilamine Clomipramine romidepsin oxiconazole Clofibric Acid 4-methyl-N-(3-(4-methylimidazol-1-yl)-5- meloxicam Clemastine (trifluoromethyl)phenyl)-3-((4-pyridin-3- ylpyrimidin-2-yl)amino)benzamide Haloperidol bis(tri-n-butyltin)oxide Dothiepin Metoprolol shogaol Aminocaproic Acids 8-Bromo Cyclic Adenosine Monophosphate n-hexanal Clofibrate Chlorpheniramine Etoposide hexylcaine Dantrolene Methylprednisolone resveratrol Alpha-Amanitin epoxomicin colforsin Ascorbic Acid Folic Acid Safrole loxoprofen Dimethylformamide securinine letrozole ranolazine adalimumab X-Rays Atenolol Clonidine naringin Verapamil Phenacetin vinpocetine gabapentin Topotecan Dipyridamole Nifurtimox Pergolide Losartan Alendronate Gemfibrozil Promazine tianeptine Hexachlorophene Loratadine bortezomib 1,10-phenanthroline Oxymetazoline candesartan Azaguanine Inosine Monophosphate pantoprazole Granisetron Pentolinium Tartrate efavirenz Ifosfamide Methyl Methanesulfonate sorafenib Doxepin cerivastatin 2-(4-morpholinyl)-8-phenyl-4H-1- Phenylephrine benzopyran-4-one Propidium Mesoridazine ebselen Aspirin Dichlororibofuranosylbenzimidazole Deferoxamine VX Gallamine Triethiodide Isoflurophate Clozapine imatinib Norepinephrine Nocodazole Metergoline Rotenone tropisetron Simvastatin Mianserin ebastine Sarin Sulpiride Propranolol Gabexate Thioridazine Clindamycin 3,3′,4′,5-tetrachlorosalicylanilide Indinavir Dimenhydrinate 1-Methyl-3-isobutylxanthine Ribavirin Brefeldin A Pravastatin zaleplon Dicumarol valdecoxib Terfenadine Phenelzine Timolol Melatonin Carmustine fragment C, human serum albumin Diazepam Chloramphenicol Nitrazepam Shiga Toxin Isoproterenol 2-methoxyestradiol Amitriptyline Fluvoxamine phosphonoacetamide isoascorbic acid clopidogrel 2,3-dioxo-6-nitro-7- Albendazole sulfamoylbenzo(f)quinoxaline Labetalol Maprotiline Choline Trihexyphenidyl zileuton Propylthiouracil rofecoxib venlafaxine Ionomyin SU 5402 Tocainide Ramipril Bezafibrate Flurbiprofen oxybutynin dasatinib gemcitabine gefitinib Tranylcypromine Sertraline Thioguanine Vitamin K 3 Promethazine V1. Molecules that upregulate PPAR-y: rosiglitazone 1,5-naphthalenediamine 2-(4-morpholinyl)-8-phenyl- 4H-1-benzopyran-4-one N, N′-diphenyl-4-phenylenediamine Dimaprit Lithocholic Acid Ethylestrenol Tolazamide benphothiamine 1,3-dichlorobenzene compactin artemether Spironolactone Brom hexine amineptin eperisone Halcinonide 5-fluorouridine Erythromycin Chlorzoxazone Cinnarizine Mycotoxins Tretinoin Azaguanine Clioquinol acemetacin artemisinine geraniol Carbamazepine Am 580 ONO 2235 Tinidazole Isosorbide Praziquantel nateglinide Niacinamide GW 3965 SU 5416 Dipyridamole trimethylcolchicinic acid 3,3,4,5-tetrachlorosalicylanilide Staurosporine Danazol Stavudine Pyrazinamide Tropicamide Curcumin Raloxifene 4-acetylaminofluorene Pentolinium Tartrate Colchicine Dipyrone zileuton ipriflavone Methyltestosterone salicylamide Thioridazine Warfarin diphenidol Metoclopramide 1-Methyl-3-isobutylxanthine Hemin Atractyloside nabumetone 9-(2-hydroxy-3-nonyl)adenine Apomorphine Monensin Nisoldipine Buthionine Sulfoximine cetraxate 4,5-dianilinophthalimide Prochlorperazine Hydralazine Oxyquinoline Loperamide Propylthiouracil N-acetylsphingosine daboiatoxin anisindione ponasterone A Citric Acid Alprazolam Estriol pantoprazole Phytohemagglutinins diisopropyl methylphosphonate Isocarboxazid Clomipramine dibenzazepine Ticrynafen norethindrone acetate Granisetron Lithium Carbonate Sulfaphenazole cyclazosin Triacetin Amoxapine 3-nitropropionic acid Mestranol Ofloxacin Bupropion hydrazine Penicillin G Ifosfamide Floxuridine Tranexamic Acid Bendroflumethiazide idebenone Mianserin flavanone Malathion Neomycin Aminosalicylic Acid tosufloxacin 4-(4-fluorophenyl)-2-(4-hydroxyphenyl)-5-(4- Cyproterone Acetate Ciprofloxacin pyridyl)imidazole benoxaprofen dexchlorpheniramine Fludrocortisone Methapyrilene Guaifenesin Flurandrenolone Fluocinonide trichlorofluoromethane Terazosin Histamine 6-methoxy-2-naphthylacetic acid Concanavalin A Metformin Ticlopidine amitraz Primidone Idarubicin lansoprazole epigallocatechin gallate desloratadine Lasalocid Flavoxate doxifluridine zopiclone Sertraline Clonazepam Dimenhydrinate Cyclosporine Tacrolimus Clotrimazole Sulfisoxazole bisphenol A Cytochalasin D mycophenolate mofetil Albuterol lactacystin Triamterene Nitrazepam Glycine Carboplatin Vincamine Omeprazole Gossypol Amlodipine Nitrofurazone 8-Bromo Cyclic Adenosine Monophosphate 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin- romidepsin 2-yl-1H-imidazol-2-yl)benzamide Hexachlorophene oxfendazole gabapentin Insulin Promazine Dinitrofluorobenzene resveratrol Acetazolamide quetiapine beta-1,3-glucan Metribolone Neostigmine Merbromin neuropeptide Y (18-36) Chlorthalidone Paraquat Methimazole Epinephrine methyl salicylate flunisolide Bezafibrate doxofylline Aspirin glimepiride 2-Acetylaminofluorene 1,1,1-trichloroethane 2-(4-morpholinoanilino)-6- cyclohexylaminopurine Milrinone Ganciclovir Gemfibrozil Phenylephrine phorbolol myristate acetate Glipizide Mefenamic Acid Chlormezanone leflunomide Oxymetholone abamectin Metronidazole Chlordiazepoxide terbinafine Triiodothyronine Tamoxifen 1-hydroxycholecalciferol Immunotoxins rabeprazole Cadmium cyanoginosin LR Minoxidil oxaliplatin Budesonide Fluoxetine Safrole lamotrigine Nafcillin Endotoxins Epirubicin Sotalol Terfenadine sodium arsenite Trifluoperazine Benzo(a)pyrene MK 0591 diflorasone diacetate Diethylhexyl Phthalate Oxymetazoline Ritonavir decitabine Griseofulvin clopidogrel Bretylium Tosylate 6-Mercaptopurine loxoprofen Etidronic Acid Aflatoxins CD 437 4-dichlorobenzene Rifabutin Nafenopin vanoxerine 4,4′-diaminodiphenylmethane Bleomycin Daunorubicin Phenobarbital 4-nonylphenol Carbimazole olmesartan flubendazole Losartan sildenafil salsolidine blebbistatin Methotrimeprazine Calcitriol ibufenac Rolipram iturelix Folic Acid Loratadine Tiapamil Hydrochloride candesartan Desipramine Norepinephrine bromobenzene Cholecalciferol parbendazole Ethionamide venlafaxine 8-((4-chlorophenyl)thio)cyclic-3′,5-AMP Tolazoline bromperidol Cefoxitin Aflatoxin B1 Timolol Anisomycin Labetalol Phalloidine Ethacrynic Acid trovafloxacin Amantadine Bromisovalum bephenium hydroxynaphthoate Protriptyline Camptothecin valdecoxib Doxapram Clemastine Doxepin Diethylnitrosamine Procarbazine tranilast Gallamine Triethiodide sulconazole letrozole diloxanide furoate Phosphorylcholine Phenacetin marimastat Clenbuterol Lorazepam Sulfachlorpyridazine fomepizole Amanitins Streptozocin Aminoglutethimide Escin Cromolyn Sodium phenethyl isothiocyanate Ketoprofen Cefoperazone Thioacetamide Cobalt trilinolein 1-(5-Isoquinolinesulfonyl)-2-Methylpiperazine Penicillamine lapatinib Isoniazid rofecoxib Quinacrine bafilomycin A Clonidine Trihexyphenidyl 4′-N-benzoylstaurosporine Tetracycline Triazolam Quercetin Flunarizine Clozapine Betazole Fluspirilene Sulpiride Nordihydroguaiaretic Acid oltipraz celecoxib Cyclophosphamide Clofibric Acid SB 203580 Atenolol Diazepam Catechin benzamil Dihydroergotamine Perhexiline Propranolol cephaelin Y 27632 Alprostadil Deoxyglucose Nizatidine Cycloserine Alprenolol Metaproterenol Captopril Vincristine wortmannin Nortriptyline imatinib Clarithromycin Choline Famotidine Rotenone Carbachol Vidarabine Nocodazole Phenelzine Moxisylyte gemcitabine Paroxetine Cocaine Verapamil Ionomyin Deferoxamine Haloperidol olanzapine Ramipril Levodopa Melatonin Emetine Podophyllotoxin Maprotiline Azacitidine Amitriptyline Nitric Oxide Thapsigargin Nevirapine U 0126 Dichlorvos Allopurinol Ascorbic Acid triptolide Atropine Perphenazine ochratoxin A Ribavirin Vitamin K 3 Kainic Acid Gentamicins Chitosan V2. Molecules that downregulate PPAR-y: troglitazone pioglitazone tomatidine ebastine N-Methylaspartate Diphenhydramine nifuroxazide Betaxolol imazalil Prostaglandins E titanium dioxide Benzethonium chloroxylenol Mycophenolic Acid Hydrogel oxiconazole 8-(3-Chlorostyryl)-1,3,7- 15-deoxy-delta(12,14)- trimethylxanthine prostaglandin J2 Thiostrepton Methylcholanthrene Dinoprostone Ibuprofen lycorine Gentian Violet 1,2,3-trichloropropane Itraconazole Isoproterenol Etodolac Ketoconazole Acetylmuramyl-Alanyl- Isoglutamine Sulindac Zidovudine Hydrocortisone pramoxine Vinblastine telmisartan Estradiol Fenoprofen Adenosine-5′-(N- ethylcarboxamide) Phenoxybenzamine Isotretinoin Fluocinolone Acetonide Droperidol atorvastatin Foscarnet Topotecan arsenic trioxide MRK 003 Hemicholinium 3 Ethylnitrosourea Immunoglobulins, Intravenous Acetaminophen Valproic Acid Methylnitrosourea BCG Vaccine carvedilol Primaquine Chlorhexidine Chlorambucil Ketorolac gliquidone Ceftazidime ranolazine Apazone withaferin A Dexamethasone Finasteride Thioguanine Methyldopa Cholera Toxin Coumarins 4-hydroxytamoxifen Ethylene Glycol Antigen-Antibody Complex zardaverine Nitrendipine Methotrexate Chorionic Gonadotropin Dichlororibofuranosylbenzimidazole Cetylpyridinium Growth Hormone Nystatin Cortisone Indomethacin Carbon Tetrachloride Chlorpromazine Methoxsalen fazarabine Ambroxol Busulfan Fluconazole Cytarabine Digoxin infliximab lornoxicam Diclofenac cinchonine Enoxacin Naproxen Monocrotaline monobenzone Remoxipride Lovastatin nimesulide Cefuroxime Ultraviolet Rays Dobutamine 4-octylphenol riddelliine fluvastatin Pyrilamine indole-3-carbinol Dinoprost monophosphoryl lipid A sapphyrin Roflumilast Albendazole Baclofen Norethindrone benazepril phenothiazine irbesartan Azithromycin cerivastatin phosphonoacetamide Disulfiram Tocainide marinobufagenin Vanadates Tetrachlorodibenzodioxin Dexfenfluramine Betamethasone tenidap sparfloxacin Poly I-C 4-(N-methyl-N-nitrosamino)-1-(3- Mebendazole 3,3′,5-triiodothyroacetic acid pyridyl)-1-butanone Debrisoquin Strophanthidin senecionine Ethinyl Estradiol lanatoside C Ethoxyquin Fluphenazine meloxicam Hydroxyurea shikonin Diflunisal alginic acid Glafenine Zalcitabine Palmitic Acid Prednisone Simvastatin 2-(1H-indazol-4-yl)-6-(4- methanesulfonylpiperazin- 1-ylmethyl)-4-morpholin-4- ylthieno(3,2-d)pyrimidine sunitinib erlotinib Azathioprine Fenoterol Mifepristone geldanamycin Hyaluronic Acid Gonadotropins Trimetazidine Cimetidine Tetrahydrocannabinol Pravastatin 1,10-phenanthroline trichostatin A lomefloxacin beta-Naphthoflavone Econazole Estrogens piperlonguminine Ergocalciferols tracazolate Doxorubicin Bisacodyl Lamivudine glycidol Forskolin acidocin CH5, Lactobacillus acidophilus NSC 652287 Cisplatin pepstatin Spiperone Tryptophan Kanamycin vorinostat valsartan Lithium hydroquinone Streptomycin 17-(allylamino)-17- demethoxygeldanamycin sodium selenate Amiodarone Dicumarol Carmustine Metoprolol acadesine Genistein gefitinib Tubocurarine Papaverine Methyl Methanesulfonate Physostigmine Clofibrate Doxazosin Risperidone Ranitidine apicidin Citalopram fasudil 4-methyl-N-(3-(4-methylimidazol-1-yl)- Betahistine 5-(trifluoromethyl)phenyl)-3-((4-pyridin-3- ylpyrimidin-2-yl)amino)benzamide ellipticine Miconazole Digitoxin Diltiazem Thiethylperazine Chlorpyrifos Furazolidone LBH589 diphenylpyraline dasatinib Dactinomycin Puromycin Furosemide Promethazine Lomustine hesperetin Mitomycin Pyrogallol Altretamine linezolid N-Methyl-3,4- methylenedioxyamphetamine Tranylcypromine Vitamin E monorden Ouabain Paclitaxel Caffeine isoascorbic acid ciprofibrate Netilmicin Azauridine Nimodipine pirinixic acid Chloramphenicol lysophosphatidic acid Enalapril mono-(2-ethylhexyl)phthalate Dicyclomine Cycloheximide Imipramine Buspirone Alpha-Amanitin Theophylline Probucol pralidoxime Fluorouracil irinotecan sorafenib bortezomib W1. Molecules that upregulate TMEM27: Mitomycin resveratrol cidofovir NG-Nitroarginine Methyl Ester Neomycin Neostigmine Lorazepam flubendazole Methocarbamol Methylnitrosourea hydrazine Fenbendazole fluvastatin Cetylpyridinium geraniol PK 11195 Promazine Cymarine Oxytetracycline PI103 testosterone 17 beta-cypionate atorvastatin Mycophenolic Acid Famotidine norethindrone acetate salicylamide diphenidol Nitrendipine Enterobactin Clomipramine Poly I-C Doxorubicin closantel artemisinine ipriflavone Bromisovalum nateglinide Daunorubicin Clotrimazole Alprazolam Verapamil oxcarbazepine pralidoxime Galantamine balsalazide Nizatidine sulfathiazole Diazepam benazepril Moclobemide 3-hydroxyacetanilide Testosterone Labetalol Flunarizine Baclofen Ethinyl Estradiol Tramadol Cisplatin Piracetam 4,4′-diaminodiphenylmethane Tranexamic Acid Diethylstilbestrol Aflatoxin B1 gabapentin Methimazole Benzo(a)pyrene Hemin Paroxetine Clofibrate olanzapine oxybutynin Zinc Oxide 6-Mercaptopurine Aclarubicin Pentoxifylline Finasteride Clofibric Acid 2-(1H-indazol-4-yl)-6-(4- methanesulfonylpiperazin- 1-ylmethyl)-4-morpholin-4- ylthieno(3,2-d)pyrimidine Prazosin Stanozolol Cimetidine Busulfan nimesulide Simvastatin Metoprolol Secobarbital Benzalkonium Compounds Tamoxifen Mifepristone Amlodipine Sulindac anastrozole Sotalol Propranolol Chloroform Clemastine Clarithromycin Amitriptyline quetiapine geldanamycin Prednisolone Thiabendazole moxonidine cerivastatin valsartan Captopril Alpha-Amanitin Procaine Spironolactone motexafin gadolinium Itraconazole Miconazole Econazole Cytokines leflunomide Dimethyl Sulfoxide erlotinib Calcium Acetaminophen Hydroxyurea Etoposide Ethylene Glycol Bezafibrate Clobetasol Indomethacin Diethylhexyl Phthalate Clonidine Methotrexate Enterotoxins 2-amino-1-methyl-6- Mercuric Chloride Glycine phenylimidazo(4,5-b)pyridine Ketoconazole Sumatriptan Aspirin Pemoline Chlorambucil Fenoprofen Equilin Cyproheptadine dibenzazepine Lovastatin Griseofulvin Diclofenac Cyclosporine decitabine Zinc zomepirac Carmustine aceclofenac Chlormadinone Acetate Ibuprofen Aminocaproic Acids meloxicam Fluphenazine Ergocalciferols Clomiphene ochratoxin A dexibuprofen Roxarsone Chloramphenicol Norethindrone Ribavirin withaferin A Diflunisal Ritonavir Azacitidine Sulfadimethoxine enrofloxacin Fenofibrate monastrol trichostatin A vinylidene chloride blebbistatin Doxycycline Vincristine Naproxen Dantrolene Ethanol Ramipril Piroxicam Carbamazepine Tretinoin Bromhexine 17-(allylamino)-17- fulvestrant demethoxygeldanamycin Gemfibrozil Carboplatin Hydrochloric Acid candesartan Soman Dinoprost Cycloheximide Netilmicin Folic Acid HI 6 Sirolimus Dimethylformamide zileuton Hydrochlorothiazide bevacizumab methylatropine Tetracycline pantoprazole lapatinib Quercetin Thapsigargin rofecoxib Carbon Tetrachloride oxaliplatin Rotenone valdecoxib Azathioprine Nicotine Tacrine Lactic Acid Epirubicin vorinostat bortezomib quelamycin Fluconazole Penicillamine U 0126 Progesterone infliximab Acetazolamide Isotretinoin Risperidone Chlorpromazine 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl- X-Rays 1H-imidazol-2-yl)benzamide Bleomycin W2. Molecules that downregulate TMEM27: oxfendazole Oxyquinoline Estriol meropenem chloroxylenol Cyproterone Acetate sorafenib cyclonite Nystatin Trichloroacetic Acid Aztreonam pramoxine Atropine daidzein Gentamicins Menthol Am 580 bromodichloromethane Melphalan Fonofos Promegestone bisphenol A Acyclovir Bacitracin sulconazole Noscapine Estradiol Allopurinol gefitinib Lead VX Acetylmuramyl-Alanyl-Isoglutamine chlorinated dibenzofurans Valproic Acid famciclovir Fluocinolone Acetonide lead acetate 4′-N-benzoylstaurosporine 2-dichlorobenzene Genistein Diethylnitrosamine Aphidicolin hydroquinone beta-cyclodextrin-benzaldehyde sodium arsenite SU 5402 shikonin Paclitaxel Cephaloridine tianeptine compactin CPG-oligonucleotide 1,2,3-trichloropropane 3-deazaneplanocin fragment C, human serum albumin Pravastatin Theophylline Ifosfamide Acetylcysteine enzastaurin linalool Thioguanine triadimefon gatifloxacin oxaprozin penciclovir Dexamethasone Ouabain Perhexiline Chorionic Gonadotropin Vancomycin lead tetraacetate Metribolone Trichloroethylene trovafloxacin Benzethonium pioglitazone Insulin 4-nonylphenol Flurbiprofen Colchicine Fluoxetine Cam ptothecin Cadmium Cyclophosphamide sulforafan Monocrotaline Papaverine Danazol Luteinizing Hormone Trimethadione Omeprazole Fluorouracil Medroxyprogesterone Acetate Isoniazid Disopyramide aristolochic acid I Ultraviolet Rays Dihydrotestosterone Flutamide Methylprednisolone rosiglitazone Triiodothyronine Bithionol Caffeine Amiodarone Rifampin Phenacetin Tetradecanoylphorbol Acetate Phenobarbital Tetrachlorodibenzodioxin X1. Molecules that upregulate ACE2: Oxytetracycline Ethylene Dibromide erlotinib Calcium diperodon N-methylolacrylamide Y 27632 Fursultiamin hydroxyachillin Sulfisoxazole Bendroflumethiazide Terbutaline Aflatoxins Trichlormethiazide quintozene althiazide naphthalan Pyrogens Poly I-C acetylleucine epitiostanol 2-(4-morpholinoanilino)-6- Cytarabine Colistin cyclohexylaminopurine 2-dichlorobenzene Cytochalasin D cidofovir Trichloroepoxypropane Pregnenolone Demeclocycline apratoxin A Sulfamethazine Humic Substances Piperacillin 4-dichlorobenzene Dequalinium Cefmetazole ethaverine SC 514 fosfosal vinpocetine carbetapentane Ozone canadine diphemanil methylsulfate 1,2-dilinolenoyl-3-(4-aminobutyryl)propane- Doxorubicin Reserpine 1,2,3-triol 4-hydroxy-2-nonenal Cinoxacin cinchonine Testosterone Methylene Chloride bromobenzene Captopril N-nitrosomorpholine tyloxapol Ethambutol oxybutynin Ipratropium sertaconazole Isoflurane Tetradecanoylphorbol Acetate Tranylcypromine Monocrotaline solasodine Oxytocin Cefotaxime citiolone flunisolide Tamoxifen Propidium Amrinone Ethanol gefitinib Biotin Daunorubicin Sulfamethoxypyridazine Thioacetamide Gossypol monobenzone carcinine Ribavirin Roxithromycin bevacizumab Phentolamine Lobeline Bromocriptine wortmannin Flunarizine vorinostat medrysone 16-ketoestradiol Ampicillin Dextran Sulfate dexibuprofen Clobetasol Mitomycin Alpha-Amanitin Tretinoin Sulfamethoxazole Paroxetine aluminum sulfate oxidized-L-alpha-1-palmitoyl-2- Dehydroepiandrosterone arachidonoyl-sn-glycero-3- phosphorylcholine vinclozolin triptolide decitabine Dexamethasone peginterferon alfa-2a Epitestosterone 4-hydroxytamoxifen Nitrofurantoin Cholecalciferol blebbistatin trichostatin A Azacitidine Diquat Procainamide Forskolin Cyclophosphamide 1-Methyl-4-phenyl-1,2,3,6- torsemide tetrahydropyridine mycophenolate mofetil Hydroxyzine Aflatoxin B1 Mycophenolic Acid Oxyquinoline Hydralazine LBH589 Hemin pralidoxime Mebendazole Cephalothin celecoxib Hydrochloric Acid fulvestrant docetaxel pioglitazone Enalapril Chitosan Rifampin Carbamazepine Dactinomycin Genistein Diazepam Nifedipine Cycloheximide Lactic Acid Diethylhexyl Phthalate Bezafibrate Atropine Promethazine Metformin Formaldehyde Isoproterenol Asbestos X2. Molecules that downregulate ACE2: sunitinib polidocanol VX sorafenib ubiquinol Dichlorvos naphthalene 2-methoxyestradiol Azoxymethane Ganciclovir shikonin 1,5-naphthalenediamine 6-bromoindirubin-3′-oxime 1-amino-2,4-dibromoanthraquinone Tacrolimus Benzalkonium Compounds Hydrogel Niacinamide Bleomycin ferric nitrilotriacetate Malathion Shiga Toxin Folic Acid tris(2,3-dibromopropyl)phosphate Lead bromodichloromethane Clodronic Acid Furosemide heliotrine Quercetin enrofloxacin perfluorooctane sulfonic acid Choline Norfloxacin valdecoxib Lindane testosterone 17 beta-cypionate Allopurinol DDT Tetrachloroethylene Ultraviolet Rays Cadmium Acrolein lead tetraacetate 4′-N-benzoylstaurosporine Cyclosporine imatinib Propylthiouracil Sulindac SB 203580 versipelostatin Dihydrotestosterone Diazinon Cisplatin sulmazole Methapyrilene Eugenol Terfenadine Enterotoxins Diethylstilbestrol Fluocinolone Acetonide R 848 Methimazole enterotoxin B, Theophylline Netilmicin staphylococcal aristolochic acid I cyclonite Flurbiprofen chlorinated dibenzofurans SU 5402 infliximab Estradiol Tacrine oxaprozin Bromisovalum Ethylnitrosourea Papaverine Tetrachlorodibenzodioxin Dinitrofluorobenzene Deoxyglucose Prednisolone Capsaicin Sirolimus Praziquantel Acetaminophen fluvastatin atorvastatin Phosgene Fluoxetine CPG-oligonucleotide Bacitracin 4-(4-fluorophenyl)-2-(4- hydroxyphenyl)-5-(4- pyridyl)imidazole Ethionine Paclitaxel rosiglitazone U 0126 trovafloxacin Valproic Acid Carboplatin lapatinib Isotretinoin Azathioprine Epirubicin Naproxen leflunomide Lovastatin bicalutamide Isoniazid Particulate Matter Methotrexate 17-(allylamino)-17-demethoxygeldanamycin Colchicine Vinblastine Insulin X-Rays 2-(4-morpholinyl)-8-phenyl- 4H-1-benzopyran-4-one irinotecan oxaliplatin bisphenol A arsenic trioxide Cardiotoxins Progesterone Hydrocortisone Cortisone Danazol Mifepristone 1-Methyl-3-isobutylxanthine Risperidone Phenobarbital Trimethadione Omeprazole Ifosfamide Chlorambucil Benzo(a)pyrene Etoposide Doxycycline Diclofenac Gemfibrozil Hydrogen Peroxide Y1. Molecules that upregulate PPAR-a: Fenofibrate N-Ac-CHAVC-NH2 ferulic acid ibufenac Teicoplanin 1-hydroxycholecalciferol N, N′-diphenyl-4-phenylenediamine eperisone tranilast temafloxacin cetraxate bromfenac Ciprofloxacin Fludrocortisone sparfloxacin Zalcitabine Sotalol amitraz benoxaprofen Amlodipine Dipyrone piclamilast trovafloxacin 1,1,1-trichloroethane oxfendazole Safrole Acetylcysteine Nafenopin Butyric Acid Rifabutin rabeprazole Spironolactone Ketorolac sodium arsenite 1-(2-cyano-3,12-dioxooleana-1,9- methylparaben dien-28-oyl)imidazole Ethylestrenol Cinnarizine methyl salicylate Sulindac Ibuprofen zomepirac Erythromycin Ethylsuccinate Cefsulodin ONO 2235 pantoprazole Lomustine Bromisovalum Citric Acid ipriflavone Melatonin phenylhydrazine anastrozole Omeprazole Busulfan zileuton 2-Acetylaminofluorene Roflumilast beta-Naphthoflavone Bupropion hydrazine sulfathiazole troglitazone Ergocalciferols Sulfaphenazole bromodichloromethane Disulfiram Azathioprine geraniol rosiglitazone Carbamazepine Rolipram Cetylpyridinium Perhexiline Ethanol Tacrine Stanozolol Amiodarone Fenbendazole Thioguanine phenothiazine Raloxifene Erythromycin Methylcholanthrene Diethylnitrosamine 2-nitrofluorene flubendazole bisphenol A Ticrynafen Methyldopa Digoxin Auranofin zopiclone sildenafil balsalazide Praziquantel Diclofenac Clomipramine Propanil pioglitazone rofecoxib Promethazine Amantadine lead acetate Acetaminophen Clofibric Acid Pravastatin Epitestosterone Norethindrone harman Phenacetin Nevirapine Valproic Acid Foscarnet oxcarbazepine deferiprone Acetazolamide Clonazepam Neomycin lead tetraacetate imiquimod Epirubicin Niacinamide Thiabendazole erlotinib Tocainide zaleplon 6-Mercaptopurine Lovastatin salicylamide Mefenamic Acid Ethylene Glycol Aminoglutethimide hexachloroethane Alprazolam Fluphenazine 1,2-dilinolenoyl-3-(4- Clotrimazole aminobutyryl)propane-1,2,3-triol Clarithromycin Indomethacin Lidocaine Methapyrilene Griseofulvin torsemide Etoposide 4,4′-diaminodiphenylmethane Bithionol nimesulide Triacetin Nisoldipine Dexamethasone Ketoconazole 3-hydroxyacetanilide terbinafine Finasteride Mifepristone imatinib Neostigmine lamotrigine MRK 003 Citalopram 4-biphenylamine Oxymetazoline Bezafibrate Naproxen Ofloxacin gefitinib Estradiol Nifedipine Sulfisoxazole Trichloroethylene fipronil Albendazole cryptoxanthin Dimethylformamide norethindrone acetate Carmustine Fluconazole celecoxib Dicloxacillin Pyrogallol Enoxacin Bromhexine Tolazamide geldanamycin Oxytetracycline aluminum sulfate Nitrofurantoin Itraconazole Aclarubicin gamma-Tocopherol Minoxidil Chloroform Choline Caffeine 4-nonylphenol Simazine Acyclovir Streptomycin cornpactin Moxisylyte tenofovir Pyrazinamide dexamisole irinotecan Ticlopidine bicalutamide Ivermectin garcinol Practolol Econazole Chlorpromazine ovalicin Gemfibrozil closantel Simvastatin mosapride Morphine Sertraline tosufloxacin Gliclazide Dexfenfluramine Indinavir Fenoprofen trilinolein fluvastatin Curcumin vinylidene chloride Doxycycline leflunomide Menthol diisopropyl methylphosphonate diloxanide furoate abamectin Roxarsone artemisinine Staurosporine Levamisole bromobenzene phenacemide crotamiton Metoclopramide Propylthiouracil Cytarabine Mannitol Miconazole Gentamicins Isoproterenol 1-methyl-6-methoxy- dihydro-beta-carboline Metronidazole Diethylhexyl Phthalate Pentoxifylline Dichlorvos Cefaclor Tetrachlorodibenzodioxin Benzocaine dexchlorpheniramine 4,5-dianilinophthalimide Luteinizing Hormone Niacin Trichloroepoxypropane ergocryptine ponasterone A diindolylmethane ciprofibrate Brefeldin A Chlorambucil Diazepam Megestrol Acetate Rolitetracycline Carbon Tetrachloride alpha-Tocopherol Azithromycin Quercetin Thalidomide Dimethylnitrosamine Concanavalin A Carbimazole Trimethadione Fluoxetine Progesterone Prednisone nateglinide fomepizole Cobalt Pemoline Phenol venlafaxine Ketoprofen dironyl Chlorpyrifos pimecrolimus meloxicam Cefuroxime Nitrazepam benziodarone Lincomycin acyline valdecoxib Cefotetan 1,2,3-trichloropropane 4-dichlorobenzene Mexiletine 17-(allylamino)-17-demethoxygeldanamycin Ethambutol Halothane laudanosine fazarabine Cephalexin Methylnitrosourea Clofibrate Am 580 Aspirin quetiapine 2,4-diaminotoluene bevacizumab Mesna Carboplatin Eugenol 2-(4-morpholinyl)-8-phenyl- Hydroxyurea 4H-1-benzopyran-4-one 1-(5-Isoquinolinesulfonyl)-2- bafilomycin A Bisoprolol Methylpiperazine N-(2-cyclohexyloxy-4- Ritodrine Ranitidine nitrophenyl)methanesulfonamide atorvastatin Dicyclomine Levobunolol Dipyridamole Diazinon Genistein HC toxin desloratadine Puromycin Labetalol Zidovudine scriptaid 2-(1H-indazol-4-yl)-6-(4- lansoprazole Amitriptyline methanesulfonylpiperazin-1-ylmethyl)-4- morpholin-4-ylthieno(3,2-d)pyrimidine Captopril 2,2′-(hydroxynitrosohydrazono)bis- Doxepin ethanamine bromopride vorinostat gabapentin CEP 14083 Cimetidine Enalapril Diltiazem Methyl Methanesulfonate phenethyl isothiocyanate chlorcyclizine tenidap Lam ivudine hydroquinone efavirenz Isocarboxazid Colchicine 6-hydroxy-2,5,7,8-tetramethylchroman- Clindamycin 2-carboxylic acid Carbachol pirinixic acid Diflunisal Cisapride Cyclophosphamide Flurbiprofen Pentobarbital Bromocriptine Rifampin 8-Bromo Cyclic Adenosine Monophosphate benzyloxycarbonylleucyl- Zimeldine leucyl-leucine aldehyde LBH589 Norfloxacin Lisinopril Atovaquone Iproniazid Isoniazid letrozole N-acetylsphingosine Promazine Vidarabine Heparin 8-aminohexylamino cAMP Propranolol Flupenthixol Fluorouracil Droperidol Amanitins marimastat Netilmicin Cyproheptadine Pergolide 1-Methyl-4-phenyl-1,2,3,6-tetrahydropyridine Ethionamide apicidin Losartan Atropine Mebendazole Secobarbital Saquinavir Topotecan Sulpiride Azauridine Clonidine sorafenib Oxyquinoline Terbutaline Hydrochlorothiazide dasatinib gemcitabine Calcitriol Y2. Molecules that downregulate PPAR-a: Primidone Trichloroacetic Acid Proglumide Tinidazole tropisetron Naloxone Streptozocin Capsaicin artemether Etodolac Hexachlorophene Ethisterone Gentian Violet bestatin Phenobarbital glimepiride Tetracycline vinorelbine Okadaic Acid Carotenoids paricalcitol Shiga Toxin valacyclovir Cortisone isopyrin versipelostatin marinobufagenin Altretamine oxiconazole Salicylic Acid Ifosfamide Cyproterone Acetate Sulfamethoxazole Cardiotoxins Caerulein Dextran Sulfate fludarabine senecionine Methylcellulose Amoxapine idebenone aceclofenac Aminosalicylic Acid Paclitaxel Doxapram Tunicamycin arsenic trioxide Cyclosporine Methiocarb Antipyrine Phenformin Benzethonium olanzapine anisindione lacidipine Heptachlor Epoxide 3-deazaneplanocin Nystatin Phalloidine 4-octylphenol Buformin pristane n-hexanal Rotenone Aflatoxins Lithium Carbonate Ethylnitrosourea Papaverine sunitinib decitabine Chloroquine blebbistatin Dimenhydrinate lomefloxacin Piperonyl Butoxide famciclovir doxofylline nimetazepam Isotretinoin Norepinephrine shikonin Stavudine Methoxsalen Plicamycin Vinblastine Kinetin Clemastine trichostatin A Deoxyglucose Cholecalciferol Glycine enterotoxin I, staphylococcal Allopurinol Tranexamic Acid bamipine Tacrolimus MF59 oil emulsion Azacitidine cerivastatin Tretinoin 4-hydroxy-2-nonenal beta-glycerophosphoric acid Chlormadinone Acetate Dihydrotestosterone Mestranol candesartan Glycerol Canavanine benazepril Vancomycin Estriol Furosemide Phytohemagglutinins Benzo(a)pyrene Botulinum Toxins Nadolol Mitomycin monastrol Azoxymethane Aminocaproic Acids picotamide Immunoglobulin M polidocanol Ondansetron Methotrexate Bacitracin Insulin procyanidin loxoprofen isoascorbic acid Chlorhexidine Antimycin A Tetradecanoylphorbol Acetate naphthalene Lead infliximab Nimodipine adalimumab cineole Theophylline Bleomycin buflomedil Aflatoxin B1 Mianserin bis(tri-n-butyltin)oxide Glipizide cilostazol Lorazepam Vecuronium Bromide carvedilol Dimethyl Sulfoxide Amiloride Malathion Ascorbic Acid Vincristine Tiapamil Hydrochloride Ethionine 4-amino-6-hydrazino-7-beta-D- Buthionine Sulfoximine ribofuranosyl-7H-pyrrolo(2,3-d)- pyrimidine-5-carboxamide valsartan Echinomycin Phenylephrine Cycloheximide Y 27632 Reserpine Isradipine Digitoxin Melphalan cyanoginosin LR Pregnenolone Carbonitrile tenoxicam SU 5402 Penicillamine Acarbose Dactinomycin fasudil clopidogrel Palmitic Acid Paroxetine U 0126 Loratadine Nitrendipine Chlordiazepoxide Prochlorperazine SC 514 Terfenadine Nitric Oxide Ritonavir Gallamine Triethiodide Emetine Ramipril Tubocurarine Guanethidine Verapamil Prazosin Luteolin Buspirone enzastaurin Inosine Monophosphate Diphenhydramine Flunarizine Camptothecin resveratrol Galantamine Vitamin E Haloperidol Clozapine Kainic Acid SB 203580 Atenolol pralidoxime Vitamin K 3 Ionomyin Deferoxamine 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin- bortezomib 2-yl-1H-imidazol-2-yl)benzamide Nocodazole
(146) All patents, patent applications, and publications cited herein are incorporated herein by reference in their entirety as if recited in full herein.
(147) The invention being thus described, it will be obvious that the same may be varied in many ways. Such variations are not to be regarded as a departure from the spirit and scope of the invention and all such modifications are intended to be included within the scope of the following claims.
CITED DOCUMENTS
(148) 1. Allen N C, et al. Systematic meta-analyses and field synopsis of genetic association studies in schizophrenia: the SzGene database. Nat Genet 2008; 40(7):827-34 2. Arnould A, Rochat L, Azouvi P, Van der Linden M. (2015) Apathetic symptom presentations in patients with severe traumatic brain injury: Assessment, heterogeneity and relationships with psychosocial functioning and caregivers' burden. Brain Inj. 29(13-14): 1597-603. 3. Baker K D, Skuse D H. Adolescents and young adults with 22q11 deletion syndrome: psychopathology in an at-risk group. Br J Psychiatry 2005; 186:115-20 4. Baxter C F, et al. High proline levels in the brains of mice as related to specific learning deficits. Pharmacol Biochem Behav 1985; 22(6):1053-9 5. Bender H U, et al. Functional consequences of PRODH missense mutations. Am J Hum Genet 2005; 76:409-20 6. Benoit M, Andrieu S, Lechowski L, Gillette-Guyonnet S, Robert P H, Vellas B; REAL-FR group. (2008) Apathy and depression in Alzheimer's disease are associated with functional deficit and psychotropic prescription. Int J Geriatr Psychiatry. 23(4):409-14. 7. Bilder R M, et al. The catechol-O-methyltransferase polymorphism: relations to the tonic-phasic dopamine hypothesis and neuropsychiatric phenotypes. Neuropsychopharmacology 2004; 29(11):1943-61 8. Blanchard J J, et al. Toward the next generation of negative symptom assessments: the collaboration to advance negative symptom assessment in schizophrenia. Schizophr Bull 2011; 37(2):291-9 9. Brodaty H, Connors M H, Xu J, Woodward M, Ames D. (2015) The course of neuropsychiatric symptoms in dementia: a 3-year longitudinal study. J Am Med Dir Assoc. 16(5):380-7. 10. Cattelani R, Roberti R, Lombardi F. (2008) Adverse effects of apathy and neurobehavioral deficits on the community integration of traumatic brain injury subjects. Eur J Phys Rehabil Med. September; 44(3):245-51. 11. Chen J, et al. Functional analysis of genetic variation in catechol-O-methyltransferase (COMT): effects on mRNA, protein, and enzyme activity in postmortem human brain. Am J Hum Genet 2004; 75(5):807-21 12. Clelland C L, et al. Evidence for association of hyperprolinemia with schizophrenia and a measure of clinical outcome. Schizophr Res 2011; 131(1-3):139-45 13. Clelland C L, et al. Evidence that COMT genotype and proline interact on negative-symptom outcomes in schizophrenia and bipolar disorder. Translational Psychiatry 2016. In press 14. Cohen S M, Nadler J V. Proline-induced inhibition of glutamate release in hippocampal area CA1. Brain Res 1997; 769:333-9 15. Cohen S M, Nadler J V. Proline-induced potentiation of glutamate transmission. Brain Res 1997; 761:271-82 16. Crabtree G W, et al. Cytosolic Accumulation of L-Proline Disrupts GABA-Ergic Transmission through GAD Blockade. Cell Rep 2016 Oct. 4; 17(2):570-582 17. de Jonghe J F, Goedhart A W, Ooms M E, Kat M G, Kalisvaart K J, van Ewijk W M, Ribbe M W. (2003) Negative symptoms in Alzheimer's disease: a confirmatory factor analysis. Int J Geriatr Psychiatry; 18(8):748-53. 18. Dingman W, Sporn M B. The penetration of proline and proline derivatives into brain. J Neurochem 1959; 4(2):148-53 19. Drake R E, Mueser K T. Co-occurring alcohol use disorder and schizophrenia. Alcohol Research & Health 2002; 26(2): 99-102 20. Drew L J, et al. The 22q11.2 microdeletion: fifteen years of insights into the genetic and neural complexity of psychiatric disorders. Int J Dev Neurosci 2011; 29(3):259-81 21. Efrom M L. Familial hyperprolinemia. Report of a second case, associated with congenital renal malformations, hereditary hematuria and mild mental retardation, with demonstration of an enzyme defect. N Engl J Med 1965; 272:1243-54 22. Fauth E B, Gibbons A. (2014) Which behavioral and psychological symptoms of dementia are the most problematic? Variability by prevalence, intensity, distress ratings, and associations with caregiver depressive symptoms. Int J Geriatr Psychiatry. 29(3):263-71. 23. Fernandez-Garcimartin H, et al. Is it possible to combine different psychotic symptom scales in bipolar disorder? Psychiatry Res 2014; 220(3):1090-3 24. Fine S E, et al. Autism spectrum disorders and symptoms in children with molecularly confirmed 22q11.2 deletion syndrome. J Autism Dev Disord 2005; 35(4):461-70 25. Forlenza O V, Loureiro J C, Pais M V, Stella F. (2017) Recent advances in the management of neuropsychiatric symptoms in dementia. Curr Opin Psychiatry. 2017 March; 30(2): 151-158. 26. Galynker I, leronimo C, Miner C, Rosenblum J, Vilkas N, Rosenthal R. (1997) Methylphenidate treatment of negative symptoms in patients with dementia. J Neuropsychiatry Clin Neurosci. 9(2):231-9. Review. 27. Galynker I I, Dutta E, Vilkas N, Ongseng F, Finestone H, Gallagher R, Serseni D, Rosenthal R N. (2000) Hypofrontality and negative symptoms in patients with dementia of Alzheimer type. Neuropsychiatry Neuropsychol Behav Neurol. 13(1):53-9. 28. Goghari V M, Sponheim S R. Differential association of the COMT Va1158Met polymorphism with clinical phenotypes in schizophrenia and bipolar disorder. Schizophr Res 2008; 103(1-3):186-91 29. Gogos J A, et al. The gene encoding proline dehydrogenase modulates sensorimotor gating in mice. Nat Genet 1999; 21(4):434-9 30. Gothelf D, et al. Obsessive-compulsive disorder in patients with velocardiofacial (22q11 deletion) syndrome. Am J Med Genet B Neuropsychiatr Genet. 2004; 126B(1):99-105 31. Grainger D J, Aitken S. A microtitre format assay for proline in human serum or plasma. Clin Chim Acta. 2004; 343(1-2):1 13-8 32. Guillot C R, et al. COMT Associations with Disordered Gambling and Drinking Measures. J Gambl Stud. 2015 June; 31(2): 513-524 33. Hashimoto K, et al. Decreased serum levels of D-serine in patients with schizophrenia: evidence in support of the N-methyl-D-aspartate receptor hypofunction hypothesis of schizophrenia. Arch Gen Psychiatry 2003 June; 60(6):572-6 34. Hwang T J, Masterman D L, Ortiz F, Fairbanks L A, Cummings J L. (2004) Mild cognitive impairment is associated with characteristic neuropsychiatric symptoms. Alzheimer Dis Assoc Disord. 18(1):17-21. 35. Inoue H, et al. Determination of total hydroxyproline and proline in human serum and urine by HPLC with fluorescence detection. Biol Pharm Bull. 1996; 19(2):163-6 36. Ismail Z, Smith E E, Geda Y, Sultzer D, Brodaty H, Smith G, AgUera-Ortiz L, Sweet R, Miller D, Lyketsos C G; ISTAART Neuropsychiatric Symptoms Professional Interest Area. (2016) Neuropsychiatric symptoms as early manifestations of emergent dementia: Provisional diagnostic criteria for mild behavioral impairment. Alzheimers Dement. February; 12(2): 195-202. 37. Jacquet H, et al. Hyperprolinemia is a risk factor for schizoaffective disorder. Mol Psychiatry 2005; 10(5):479-85 38. Jiménez-Jiménez F J, et al. Neurotransmitter amino acids in cerebrospinal fluid of patients with Alzheimer's disease. J Neural Transm (Vienna) 1998; 105(2-3):269-77 39. Joober R, et al. Catechol-O-methyltransferase Val-108/158-Met gene variants associated with performance on the Wisconsin Card Sorting Test. Arch Gen Psychiatry 2002; 59(7):662-3 40. Kane J, et al. Clozapine for the treatment-resistant schizophrenic. A double-blind comparison with chlorpromazine. Arch Gen Psychiatry 1988; 45(9):789-96 41. Karayiorgou M, et al. 22q11.2 microdeletions: linking DNA structural variation to brain dysfunction and schizophrenia. Nat Rev Neurosci 2010; 11:402-16 42. Karttunen K, Karppi P, Hiltunen A, Vanhanen M, Välimäki T, Martikainen J, Valtonen H, Sivenius J, Soininen H, Hartikainen S, Suhonen J, Pirttilä T. (2011) Neuropsychiatric symptoms and quality of life in patients with very mild and mild Alzheimer's disease. Int J Geriatr Psychiatry. 26(5):473-82. 43. Lachman H M, et al. Human catechol-O-methyltransferase pharmacogenetics: description of a functional polymorphism and its potential application to neuropsychiatric disorders. Pharmacogenetics 1996; 6(3):243-50 44. Landes A M, Sperry S D, Strauss M E. (2005) Prevalence of apathy, dysphoria, and depression in relation to dementia severity in Alzheimer's disease. J Neuropsychiatry Clin Neurosci. 17(3):342-9. 45. Le Boucher J, Charret C, Coudray-Lucas C, Giboudeau J, Cynober L. Amino acid determination in biological fluids by automated ion-exchange chromatography: performance of Hitachi L-8500A. Clin Chem. 1997; 43(8 Pt 1):1421-8 46. Lechowski L, Benoit M, Chassagne P, Vedel I, Tortrat D, Teillet L, Vellas B. (2009) Persistent apathy in Alzheimer's disease as an independent factor of rapid functional decline: the REAL longitudinal cohort study. Int J Geriatr Psychiatry. 24(4):341-6. 47. Leoutsakos J M, Forrester S N, Lyketsos C G, Smith G S. (2015) Latent Classes of Neuropsychiatric Symptoms in NACC Controls and Conversion to Mild Cognitive Impairment or Dementia. J Alzheimers Dis. 48(2):483-93. doi: 10.3233/JAD-150421. 48. Lewis D A, et al. Dopamine transporter immunoreactivity in monkey cerebral cortex: regional, laminar, and ultrastructural localization. J Comp Neurol 2001; 432(1):119-36 49. Liang S, et al. Determination of proline in human serum by a robust LC-MS/MS method: application to identification of human metabolites as candidate biomarkers for esophageal cancer early detection and risk stratification. Biomed. Chromatogr. 2015, 29: 570-577 50. Lindenmayer J P, et al. Dimensions of psychosis in patients with bipolar mania as measured by the positive and negative syndrome scale. Psychopathology 2008; 41(4):264-70 51. Luykx J J, et al. D-amino acid aberrations in cerebrospinal fluid and plasma of smokers. Neuropsychopharmacology 2013 September; 38(10):2019-26 52. Luykx J J, et al. Genome-wide association study of NMDA receptor coagonists in human cerebrospinal fluid and plasma. Mol Psychiatry. 2015; doi: 10.1038/mp.2014.190 53. Lyketsos C G, Carrillo M C, Ryan J M, Khachaturian A S, Trzepacz P, Amatniek J, Cedarbaum J, Brashear R, Miller D S. (2011) Neuropsychiatric symptoms in Alzheimer's disease. Alzheimers Dement. 7(5):532-9. 54. Molina J A, Jiménez-Jiménez F J, Vargas C, Gómez P, de Bustos F, Orti-Pareja M, Tallón-Barranco A, Benito-León J, Arenas J, Enriquez-de-Salamanca R. (1998) Cerebrospinal fluid levels of non-neurotransmitter amino acids in patients with Alzheimer's disease. J Neural Transm (Vienna); 105(2-3):279-86. 55. Nadler J V. Sodium-dependent proline uptake in the rat hippocampal formation: association with ipsilateral-commissural projections of CA3 pyramidal cells. J Neurochem 1987; 49:1155-60 56. Negrón A E, Reichman W E. (2000) Risperidone in the treatment of patients with Alzheimer's disease with negative symptoms. Int Psychogeriatr. 12(4):527-36. 57. Nickolson V J. “On” and “off” responses of K+-induced synaptosomal proline release: involvement of the sodium pump. J Neurochem 1982; 38:289-92 58. Orešič, et al. Metabolome in schizophrenia and other psychotic disorders: a general population-based study. Genome Med 2011; 3(3):19 59. Paterlini M, et al. Transcriptional and behavioral interaction between 22q11.2 orthologs modulates schizophrenia-related phenotypes in mice. Nat Neurosci 2005; 8(11):1586-94 60. Phang J M, et al. Disorders of proline and hydroxyproline metabolism, in Metabolic and molecular basis of inherited disease. New York, McGraw-Hill Press, 2001, pp 1821-1838 61. Pomara N, et al. Glutamate and other CSF amino acids in Alzheimer's disease. Am J Psychiatry 1992 February; 149(2):251-4 62. Pomara N, Singh R, Deptula D, Chou J C, Schwartz M B, LeWitt P A. (1992) Glutamate and other CSF amino acids in Alzheimer's disease. Am J Psychiatry. 149(2):251-4. 63. Raux G, et al. Involvement of hyperprolinemia in cognitive and psychiatric features of the 22q11 deletion syndrome. Hum Mol Genet 2007; 16(1):83-91 64. Reichman W E, Coyne A C, Amirneni S, Molino B Jr, Egan S. (1996) Negative symptoms in Alzheimer's disease. Am J Psychiatry. 153(3):424-6. 65. Renick S E, et al. The mammalian brain high-affinity L-proline transporter is enriched preferentially in synaptic vesicles in a subpopulation of excitatory nerve terminals in rat forebrain. J Neurosci 1999; 19:21-33 66. Scholl-Bürgi S, et al. The relation of cerebrospinal fluid and plasma glycine levels in propionic acidaemia, a ‘ketotic hyperglycinaemia’. J Inherit Metab Dis 2008 June; 31(3):395-8 67. Shifman S, et al. A highly significant association between a COMT haplotype and schizophrenia. Am J Hum Genet 2002; 71(6):1296-302 68. Shifman S, et al. COMT: a common susceptibility gene in bipolar disorder and schizophrenia. Am J Med Genet B Neuropsychiatr Genet 2004; 128B(1):61-4 69. Sonne S C, Brady K T. Bipolar Disorder and Alcoholism. NIAAA publication 2002 November; http://pubs.niaaa.nih.gov/publications/arh26-2/103-108.htm 70. Starkstein S E, Pahissa J. (2014) Apathy following traumatic brain injury. Psychiatr Clin North Am. 37(1):103-12. Review. 71. Stefan A, Mathé J F; SOFMER group. (2016) What are the disruptive symptoms of behavioral disorders after traumatic brain injury? A systematic review leading to recommendations for good practices. Ann Phys Rehabil Med. February; 59(1):5-17. 72. Tomiya M, et al. Alterations in serum amino acid concentrations in male and female schizophrenic patients. Clin Chim Acta 2007; 380(1-2):186-90 73. Trushina E, Dutta T, Persson X M, Mielke M M, Petersen R C. (2013) Identification of altered metabolic pathways in plasma and CSF in mild cognitive impairment and Alzheimer's disease using metabolomics. PLoS One. May 20; 8(5):e63644. doi: 10.1371/journal.pone.0063644. 74. Tunbridge E M, et al. Catechol-o-methyltransferase, cognition, and psychosis: Va1158Met and beyond. Biol Psychiatry 2006; 60:141-151 75. Van Dam D, Vermeiren Y, Dekker A D, Naudé P J, Deyn P P. (2016)Neuropsychiatric Disturbances in Alzheimer's Disease: What Have We Learned from Neuropathological Studies? Curr Alzheimer Res. 13(10):1145-64. 76. Vercelletto M, Martinez F, Lanier S, Magne C, Jaulin P, Bourin M. (2002) Negative symptoms, depression and Alzheimer's disease. Int J Geriatr Psychiatry. 17(4):383-7. 77. Vorstman J A, et al. Proline affects brain function in 22q11DS children with the low activity COMT 158 allele. Neuropsychopharmacology 2009; 34(3):739-46 78. Wu, G. Determination of proline by reversed-phase high-performance liquid chromatography with automated pre-column o-phthaldialdehyde derivatization. Journal of Chromatography A. Volume 641, Issue 1, 1993, Pages 168-175. 79. Yoneda Y, Roberts E. A new synaptosomal biosynthetic pathway of proline from ornithine and its negative feedback inhibition by proline. Brain Res 1982; 239:479-88 80. Zarchi 0, et al. Schizophrenia-like neurophysiological abnormalities in 22q11.2 deletion syndrome and their association to COMT and PRODH genotypes. J Psychiatr Res 2013; 47(11):1623-9