Application of high flavonoid elite germplasm ‘CSR6R6-777’ in breeding for functional apple

Abstract

The present invention discloses an application of high-flavonoid elite germplasm CSR6R6-777 in apple breeding. The present invention seeks to protect use of an apple (Malus domestica) CSR6R6-777 in apple breeding. The deposition number of the apple (Malus domestica) CSR6R6-777 is CGMCC NO. 12468. The purpose of the breeding is to obtain an apple germplasm with excellent traits. The apple germplasm with excellent traits is an apple plant that meets the (a) and/or (b) and/or (c) and/or (d): (a) fully red-fleshed; (b) high-flavonoid content in the flesh; (c) high anthocyanin content in the flesh; (d) high antioxidant capacity of the flesh. The present application has great value for functional apple breeding.

Claims

1. A method for breeding apple elite germplasm, comprising: (a) obtaining a hybrid F1 population by crossing a M. sieversii f. niedzwetzkyana red flesh apple as a parent plant with a Red Fuji white flesh apple, (b) identifying the apple elite germplasm from the hybrid F1 population based on phenotypes and a genotype, wherein the apple elite germplasm is identified as apple Malus domestica germplasm CSR6R6-777, of which a representative sample was deposited with the China General Microbiological Culture Collection Center under accession number CGMCC NO. 12468.

2. A method for breeding apple plants, comprising the steps: a) crossing an apple variety A with an apple variety B to obtain hybrid seeds; wherein the apple variety A is apple Malus domestica germplasm CSR6R6-777, of which a representative sample is deposited with the China General Microbiological Culture Collection Center under accession number CGMCC NO. 12468, and the apple variety B is an apple variety other than the apple variety A; b) sowing the hybrid seeds obtained in step (a) to obtain seedlings; c) transplanting the seedlings obtained in the step (b) to a field, skipping bagging after fruiting, and after screening, obtaining a target plant.

3. The method according to claim 2, wherein in the fourth year after transplanting, the trunk of each of the seedlings is girdled 20 cm away from the ground, and the width of the girdling is 0.5-1.0 cm, and reaching the xylem.

4. The method according to claim 2, wherein in the fifth year after transplanting, the following operations are carried out in the full flowering phase of the seedling: only the central flower among 5 flowers of each of inflorescences is retained, and the rest are all removed.

5. The method according to claim 2, wherein the apple variety B is ‘Gala’ apple or ‘Red Fuji’ apple.

6. The method according to claim 2, wherein the apple variety B is an apple variety with R1R1 genotype, wherein the R1R1 genotype is determined as follows: obtaining an apple from an apple plant to be tested, extracting genomic DNA from the apple flesh, performing a PCR amplification on the extracted genomic DNA by using a specific primer pair F1 and R1 having the nucleotide sequences as set forth in SEQ ID NO: 1 and SEQ ID NO: 2, respectively; wherein the presence of a 386 bp PCR fragment and not a 497 bp PCR fragment in the amplified PCR product indicates that the apple plant to be tested is one with R1R1 genotype.

7. The method according to claim 2, wherein the apple variety B is an apple variety with R1R1 genotype, wherein the R1R1 genotype is determined as follows: obtaining an apple from an apple plant to be tested, extracting genomic DNA from the apple flesh, performing a PCR amplification on the extracted genomic DNA by using a specific primer pair F1 and R1 having the nucleotide sequences as set forth in SEQ ID NO: 1 and SEQ ID NO: 2, respectively; wherein the presence of a 386 bp PCR fragment in the amplified PCR product indicates that the apple plant to be tested is one with R1R1 genotype.

8. The method according to claim 2, wherein the target plant is a fully red-fleshed plant.

9. The method according to claim 2, wherein the target plant is a fully red fleshed plant with R6R1 genotype, wherein the R6R1 genotype is determined as follows: obtaining an apple from an apple plant to be tested, extracting genomic DNA from the apple flesh, performing a PCR amplification on the extracted genomic DNA by using a specific primer pair F1 and R1 having the nucleotide sequences as set forth in SEQ ID NO: 1 and SEQ ID NO: 2, respectively; wherein the presence of a 497 bp PCR fragment and a 386 bp PCR fragment in the amplified PCR product indicates that the apple plant to be tested is one with R6R1 genotype.

10. The method according to claim 2, wherein the target plant obtained from step (c) has one or more of the following characteristics: (a) fully red-fleshed; (b) high-flavonoid content in the flesh; (c) high anthocyanin content in the flesh; and (d) high antioxidant capacity of the flesh.

11. A method for manufacturing food with apple fruit used as raw material, said method comprising obtaining a plant or a part thereof of apple Malus domestica germplasm CSR6R6-777, of which a representative sample was deposited with the China General Microbiological Culture Collection Center under accession number CGMCC NO. 12468.

12. The method of claim 11, wherein a food processing product is manufactured.

13. The method of claim 1, wherein when genomic DNA from the apple Malus domestica germplasm CSR6R6-777 is amplified by polymerase chain reaction (PCR) using F1 primer having sequence 5′-GGTGGTCAAAGATGTGTGTTGT-3′ (SEQ ID NO: 1) and R1 primer having sequence 5′-TTTGCCTGCTACCCACTTCA-3′ (SEQ ID NO: 2), there is one band for the PCR amplified product with a size of 497 bp.

Description

DESCRIPTION OF THE DRAWINGS

(1) The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.

(2) FIG. 1 shows phenotype comparison of the fruits from Xinjiang red flesh apple, ‘Red Fuji’ and ‘CSR6R6-777’.

(3) FIG. 2 shows the relative expressions of each gene.

(4) FIG. 3 shows the content of flavanol and leucocyanidin, the content of proanthocyanidin, the content of flavanone, the content of chalcone and dihydrochalcone, the content of flavonol, and the content of cyanidin in apple flesh.

(5) FIG. 4 shows the results of precise identification of the flavonol in apple flesh.

(6) FIG. 5 is a photo of apple fruits from some progeny plants.

(7) FIG. 6 is a photo of apple fruits from some progeny plants.

(8) FIG. 7 is a photo of apple fruits from some progeny plants.

(9) FIG. 8 shows the results of genotype identification of ‘Hongxin 11’, ‘Hongxin 16’, ‘Zixia 1’, ‘Zixia 2’, ‘Zixia 3’ and ‘Gala’.

THE BEST MODE FOR CARRYING OUT THE INVENTION

(10) The following examples will provide a better understanding of the present invention, but do not limit the present invention. The experimental methods in the following examples, unless otherwise specified, are conventional methods. The test materials used in the following examples, unless otherwise specified, are purchased from conventional biochemical reagents stores. Three times of repeated experiments are set for the quantitative test in the following examples, and the results are averaged. The structural formula of rutin is as follows:

(11) ##STR00001##

(12) The structural formula of Trolox is as follows:

(13) ##STR00002##

(14) A method for preparing 0.5% hydrochloric acid methanol solution is: 0.5 parts by volume of 35% concentrated hydrochloric acid is mixed with 99.5 parts by volume of methanol.

(15) A method for preparing 1% hydrochloric acid methanol solution is: 1 part by volume of 35% concentrated hydrochloric acid is mixed with 99 parts by volume of methanol.

(16) A method for preparing 80% acetone solution: 4 parts by volume of acetone is mixed with 1 part by volume of water.

(17) A method for identifying apple plants to be R1R1 genotype, R6R6 genotype or R6R1 genotype is as follows: taking an apple from an apple plants to be tested, extracting genomic DNA from the apple flesh, carrying out PCR amplification by using primers consisting of F1 and R1 with the genomic DNA as a template, and then judging the genotype according to the following criterion: if there is one band for the PCR amplified product with a size of 497 bp, the apple plant to be tested is one with R6R6 genotype; if there is one band for the PCR amplified product with a size of 386 bp, the apple plant to be tested is one with R1R1 genotype; if there are two bands for the PCR amplified product with a size of 497 bp and 386 bp respectively, the apple plant to be tested is one with R6R1 genotype.

(18) TABLE-US-00001 F1 (SEQ ID NO: 1): 5′-GGTGGTCAAAGATGTGTGTTGT-3′; R1 (SEQ ID NO: 2): 5′-TTTGCCTGCTACCCACTTCA-3′.

(19) Reference to ‘Red Fuji’ apple and ‘Gala’ apple: Chen Xuesen, Xin Peigang et al., Effect of Delicious and golden Delicious on the breeding and selection of new apple varieties, Journal of Shandong Agricultural University, 1994, 25(2): 236-248. After testing, both ‘Red Fuji’ apple and ‘Gala’ apple are the ones with R1R1 genotype.

(20) Reference to ‘RedLove’ apple: Zheng Jiwen, Yao Shaoqun, Liu Shuzhen, red-fleshed apple new variety “RedLove”, Northwest Horticulture, 201304.

Example 1. Identification of Apple Elite Germplasm ‘CSR6R6-777’

I. Acquirement of ‘CSR6R6-777’

(21) Xinjiang red flesh apple as a parent plant was crossed with white flesh apple cultivars such as ‘Red Fuji’. According to the Mendel's law, Xinjiang red flesh apple (R6R1 genotype) was crossed with white flesh apple cultivars such as ‘Red Fuji’ (R1R1 genotype), the progeny population should have red flesh phenotype (R6R1 genotype):white flesh phenotype (R1R1 genotype)=1:1. However, three single plants with R6R6 genotype were found in the hybrid F1 population (868 plants).

(22) The three single plants all had the following phenotypes: leaves, flowers, peels and flesh were amaranth in all developmental stages. The stem of one single plant was also amaranth, and this single plant was named as ‘CSR6R6-777’. The stems of the other two plants were light red, and they were named as control plant I and control plant II, respectively.

(23) A single plant with R1R1 genotype (named as control plant A) and a single plant with R6R1 genotype plant (named as control plant B) was randomly selected from the hybrid F1 population.

(24) Comparison of phenotypes of fruits from Xinjiang red flesh apple, ‘Red Fuji’ and ‘CSR6R6-777’ was shown FIG. 1.

II. Deposit of ‘CSR6R6-777’

(25) ‘CSR6R6-777’, also called apple (Malus domestica) CSR6R6-777, was deposited in the China General Microbiological Culture Collection Center (CGMCC, address: No. 3, Courtyard No. 1, Beichenxi Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences) on Dec. 8, 2016, the accession number was CGMCC NO. 12468.

III. Analysis of Expression of Flavonoid Biosynthesis Related Genes

(26) ‘CSR6R6-777’, control plant A and control plant B were used as plants to be tested. Apples were taken from the plants to be tested, and total RNA was extracted from the apple flesh. Expression of genes (CHS gene, F3H gene, ANS gene, LAR gene, FLS gene) of key enzymes and a gene (MYB10 gene) of key transcription factor in flavonoid synthesis pathway were detected by real-time quantitative RT-PCR. Primer pairs used to detect CHS gene were as follows:

(27) TABLE-US-00002 (SEQ ID NO: 3) CHS-F: 5′- GGAGACAACTGGAGAAGGACTGGAA-3′; (SEQ ID NO: 4) CHS-R: 5′- CGACATTGATACTGGTGTCTTC-3′.

(28) Primer pairs used to detect F3H gene were as follows:

(29) TABLE-US-00003 (SEQ ID NO: 5) F3H-F: 5′- TGGAAGCTTGTGAGGACTGGGGT-3′; (SEQ ID NO: 6) F3H-R: 5′- CTCCTCCGATGGCAAATCAAAGA-3′.

(30) Primer pairs used to detect ANS gene were as follows:

(31) TABLE-US-00004 (SEQ ID NO: 7) ANS-F: 5′- CCAAGTGAAGCGGGTTGTGCT-3′; (SEQ ID NO: 8) ANS-R: 5′- CAAAGCAGGCGGACAGGAGTAGC -3′.

(32) Primer pairs used to detect LAR gene were as follows:

(33) TABLE-US-00005 (SEQ ID NO: 9) LAR-F: 5′- CACCGTCAAGTCCTTCAA-3′; (SEQ ID NO: 10) LAR-R: 5′- ACCTCTTAACTGTACCAACTG -3′.

(34) Primer pairs used to detect FLS gene were as follows:

(35) TABLE-US-00006 (SEQ ID NO: 11) FLS-F: 5′- AACCACTGTGAACAAGGATA-3′; (SEQ ID NO: 12) FLS-R: 5′- CATAGTCGCCGTACTTCTT-3′.

(36) Primer pairs used to detect MYB10 gene were as follows:

(37) TABLE-US-00007 (SEQ ID NO: 13) MYB10-F: 5′-TGCCTGGACTCGAGAGGAAGACA-3′; (SEQ ID NO: 14) MYB10-R: 5′- CCTGTTTCCCAAAAGCCTGTGAA-3′.

(38) MdActin was used as an internal control; data analysis was performed using 2.sup.−ΔΔCT method (Livak & Schmittgen, 2001).

(39) Relative expression of each of genes was shown in FIG. 2. The expression of each of genes in ‘CSR6R6-777’ was significantly higher than that of the corresponding genes in control plant A and control plant B. The results showed that ‘CSR6R6-777’ had a strong ability to synthesize flavonoid.

IV. Analysis of Flavonoid Content

(40) ‘CSR6R6-777’, control plant A and control plant B were used as plants to be tested.

(41) 1. Taking apples from the plants to be tested, and taking flesh from the apples.

(42) 2. Grinding the fleshes obtained in step 1 in liquid nitrogen to obtain powder.

(43) 3. Weighing 2 g of powder obtained in step 2, adding 5 mL of 0.5% hydrochloric acid methanol solution, keeping the mixture stand and extracting it at 4° C. for 2 hours, then centrifugating the mixture at 8000 rpm for 20 mins, collecting the supernatant and the residue, respectively.
4. Adding 5 mL of 0.5% hydrochloric acid methanol solution to the residue obtained in step 3, keeping the mixture stand and extracting it at 4° C. for 1 h, then performing centrifugation at 8000 rpm for 20 mins, collecting the supernatant.
5. Mixing the supernatant obtained in Step 3 and the supernatant obtained in Step 4 to obtain a mixed solution.
6. Removing methanol from the mixed solution obtained in step 5 by rotary evaporation at 37° C., dissolving the residue with 2-3 ml methanol, and then performing centrifugation at 8000 rpm for 20 mins, collecting the supernatant.
7. Adding methanol to the supernatant obtained in step 6 to make the volume to be 5 ml, and then filtering the solution with 0.45 μm filter membrane, collecting the filtrate.
8. Subjecting the filtrate obtained in step 7 to HPLC-MS analysis.

(44) Conditions for Liquid Chromatography:

(45) WATERS ACQUITY UPLC chromatography was used, with a chromatographic column of BEH C18 column (100 mm×2.1 mm), a particle size of filler of 1.7 μm; column temperature 45° C.; injection volume of 1 μL;

(46) the mobile phase was a mixture of liquid A and liquid B, the flow rate was 0.3 mL/min; liquid A was acetonitrile, liquid B was 0.2% (volume fraction) formic acid in water; the volume fraction of liquid A in the mobile phase was 5% at 0-0.1 min;

(47) the volume fraction of liquid A in the mobile phase increased linearly from 5% to 20% at 0.1-20 mins; the volume fraction of liquid A in the mobile phase increased linearly from 20% to 80% at 20-22 mins; the volume fraction of liquid A in the mobile phase decreased linearly from 80% to 5% at 22-22.1 mins; the volume fraction of liquid A in the mobile phase was 5% at 22.1-25 mins.

(48) Conditions Mass Spectrometry

(49) Mass spectrometer WATERS MALDI SYNAPT Q-TOF MS, ESI ionization source, electrospray ionization positive ion acquisition mode (ESI+); scan range 100-1500 m/z; capillary voltage 3.5 kV, cone voltage 30 V; source temperature 100° C., desolventizing temperature 300° C.; desolvation gas flow is 500 L/h.

(50) The content of flavanol and leucocyanidin, the content of proanthocyanidin, the content of flavanone, the content of chalcone and dihydrochalcone, the content of flavonol, the content of cyanidin per gram of fresh weight of the apple flesh were shown in FIG. 3. The content of proanthocyanidin, the content of chalcone and dihydrochalcone, the content of flavonol, the content of cyanidin in the flesh of apple ‘CSR6R6-777’ were significantly higher than those in control plant A and control plant B.

(51) Flavonol in the apple flesh was accurately identified, and the results were shown in FIG. 4. The flesh of apple ‘CSR6R6-777’ comprises 41 flavonol substances, 9 substances of which were characteristic and absent in apple flesh of control plant A and control plant B. The 9 flavonol substances characteristic for the flesh of apple ‘CSR6R6-777’ were shown in Table 1. Detection methods for the 9 flavonol substances in Table 1 all belonged to the detection methods of component and content of flavonoids (reference: Chen Xuesen, Zhang Jing, Liu Daliang, et al., Genetic Variation of F1 Population Between Malus sieversii f. neidzwetzkyana and Apple Varieties and Evaluation on Fruit Characters of Functional Apple Excellent Strains [J]. Scientia Agricultura Sinica, 2014, 47 (11): 2193-2204).

(52) TABLE-US-00008 TABLE 1 Content (μg/g Substances fresh weight) 6″′-(3-Hydroxy-3-methylglutaroyl)isoviolanthin 55.25422315 Luteorin 7-(2″-sulfatoglucoside) 12.83562724 6-Hydroxyluteolin 3′-methyl ether 25.20263117 7-[6″-(3-hydroxy-3-methylglutaryl)glucoside] 3,7,8,4′-Tetrahydroxyflavone 517.7717278 Kaempferol 3-(3″-p-coumarylglucoside) 55.32757109 8-C-Methylquercetin 3-xyloside 3905.558993 Quercetin 3-(4″-malonylrhamnoside) 21.48360807 Patuletin 3-xyloside 94.37930534 5,7-Dihydroxy-3,6,8,4′-tetramethoxyflavone 68.8005295 7-glucosyl-(1−>3)-galactoside

(53) The above result showed that ‘CSR6R6-777’ had a strong ability to synthesize flavonoids, the flesh was rich in flavonoid and contained special flavonols components. ‘CSR6R6-777’ was an elite germplasm for breeding functional apple varieties.

Example 2. Fully Red-Fleshed Plants were Obtained by a Cross Using ‘CSR6R6-777’ as a Parental Plant

(54) I. Breeding Fully Red-Fleshed Plants from Hybrid Progeny

(55) 1. Backcross (in Muping District, Yantai, Shandong Province)

(56) In April 2011, ‘Gala’ apple after removal of stamens was pollinated with pollen of ‘CSR6R6-777’, and BC1 hybrid seeds were harvested. The BC1 hybrid seeds were washed and stored in a fresh-keeping chamber at 1-3° C. for stratification for about 60 days (which aims at breaking seed dormancy by meeting chilling requirement).

(57) 2. Greenhouse Seedling (in Tai'an, Shandong Province)

(58) In December 2011, the BC1 hybrid seeds obtained in step 1 were sowed and cultivated in a nutrient bowl (3-5 seeds in each nutrient bowl) with cultivation matrix until the seedlings was 8-15 cm in height and lignified at the root collar (usually 2-3 months after sowing), and then the seedlings were transplanted to a new nutrient bowl (one transplant per nutrient bowl) for cultivation. Conditions for the cultivation in this step were: 25° C., 12 hours of illumination per day (intensity of illumination 3000 1×), and nutrient solution (a large quantity of elements stock solution of MS minimal medium was diluted with water to 10 times to be the nutrient solution) was poured once every 7-10 days from the seed germination, 40-50 ml per nutrient bowl each time.

(59) 3. Planting the Hybrid Seedlings (in Guan County, Shandong Province)

(60) In February 2012, the selective nursery (the field) for planting the seedlings was applied with 6000 kg of organic fertilizer (fully-matured cow dung used in this Example) per mu in and watered to be sunk. In April 2012, 3,600 seedlings obtained in step 2 were planted in the selective nursery. In April 2012, the selective nursery in which the seedlings were planted was applied with 6000 kg of organic fertilizer (fully-matured cow dung used in this Example) per mu again and watered in time.

(61) 4. Girdling Treatment for the Hybrid Seedlings

(62) In May 2015, a trunk of each of the seedlings was girdled 20 cm away from the ground, and the width of the girdling was 0.5-1.0 cm, reaching the xylem. The purpose of this operation was to promote the accumulation of nutrients and flower bud differentiation, so as to shorten the juvenile phase and fruit early.

(63) 5. Flower and Fruit Management

(64) From April to May, 2016, flowers were thinned in the full flowering phase of each of seedlings (only the central flower among 5 flowers of each of inflorescences was retained, and the rest were all removed). Young fruits were skipping bagged and subjected to routine management.

(65) 6. Obtaining Fully Red-Fleshed Plant

(66) In August 2016, five fully red-fleshed plants were screened and bred from backcross progeny population: ‘Zixia 1’, ‘Zixia 2’, ‘Zixia 3’, ‘Hongxin11’ and ‘Hongxin16’.

(67) II. Phenotype Characteristic

(68) The fruit characteristics of the apples grown on the 5 plants were shown in FIGS. 5, 6 and 7.

(69) III. Genotype

(70) The genotypes of the 5 plants were as follows:

(71) ‘Hongxin 11’, R6R1 genotype;

(72) ‘Hongxin 16’, R6R1 genotype;

(73) ‘Zixia 1’, R6R1 genotype;

(74) ‘Zixia 2’, R6R1 genotype;

(75) ‘Zixia 3’, R6R1 genotype.

(76) Identification map was shown in FIG. 8.

(77) The results showed that fully red-fleshed plants with the R6R1 genotype could be selected from the segregating population of ‘CSR6R6-777’ hybrid progeny.

(78) IV. Analysis for flavonoid content, anthocyanin content and antioxidant capacity Materials to be tested: apples grown on ‘Hongxin 11’, apples grown on ‘Hongxin16’, apples grown on ‘Zixia 1’, apples grown on ‘Zixia 2’, apples grown on ‘Zixia 3’, apples grown on ‘CSR6R6-777’, and apples grown on ‘Gala’.

(79) 1. Determination of Flavonoid Content

(80) (1) Grinding 1 g flesh in liquid nitrogen, then adding 10 ml of 65% (volume percentage) ethanol aqueous solution pre-cooled at 4° C. and mixing them well, keeping the mixture stand and extracting it in dark at 4° C. for 4 h, then perfoming centrifugation at 12000 rpm for 20 mins, and collecting the supernatant.

(81) (2) Adding 0.5 ml supernatant obtained in step (1) to a test tube, then adding sequently 1 mL 5 g/100 ml NaNO.sub.2 aqueous solution, 1 ml 10 g/100 ml AL(NO.sub.3).sub.3 aqueous solution, 4 mL 2 M NaOH aqueous solution and mixing them well, keeping the mixture stand for 15 mins and centrifuging it at 8000 rpm for 10 mins, collecting the supernatant and then measuring the absorbance at 510 nm.

(82) Standard curve was plotted using rutin (Sigma chemical, ST, Loiuis, USA) as a standard sample.

(83) 2. Determination of Anthocyanin Content

(84) (1) Grinding 0.5 g flesh in liquid nitrogen, then adding 5 ml 1% hydrochloric acid methanol solution pre-cooled at 4° C., keeping the mixture stand and extracting it in the dark at 4° C. for 24 hours.

(85) (2) Adding 4 ml KCl buffer or 4 ml NaAC buffer to 1 ml extract obtained in step (1) and mixing them well, keeping the mixture stand and extracting it in the dark at 4° C. for 15 mins, then performing centrifugationg at 8000 r/min for 10 mins, collecting the supernatant.

(86) KCl buffer (pH=1, 0.025 M): 1.86 g KCl was dissolved in 980 ml distilled water, pH was adjusted to 1.0 with concentrated hydrochloric acid, the solution was transferred to a 1 L volumetric flask, and distilled water was added to make the volume to be 1 L.

(87) NaAC buffer (pH=4.5, 0.4 M): 54.43 g NaAC was dissolved in 960 ml distilled water, pH was adjusted to 4.5 with concentrated hydrochloric acid, the solution was transferred to a 1 L volumetric flask, and distilled water was added to make the volume to be 1 L.

(88) (3) Taking the supernatant obtained in step (2) and measuring the absorbance at 510 nm and 700 nm, respectively.
Anthocyanin content(mg/g)=ΔA*5*0.005*1000*449.2/(26900*0.5);
ΔA=(A.sub.510 nm−A.sub.700 nm).sub.pH 1.0−(A.sub.510 nm−A.sub.700 nm).sub.pH 4.5.
3. Determination of Antioxidant Capacity

(89) (1) Grinding the flesh in liquid nitrogen to obtain powder.

(90) (2) Weighing 10 g powder obtained in step (1), adding 50 mL 80% acetone solution, keeping the mixture stand and extracting it at 4° C. for 1 h, then performing centrifugation at 8000 rpm for 10 mins, and collecting the supernatant.

(91) (3) Adding 50 mL 80% acetone solution to the residue of step (2), keeping the mixture stand and extracting it at 4° C. for 1 h, then performing centrifugation at 8000 rpm for 10 mins, and collecting the supernatant.

(92) (4) Combining the supernatant obtained in step (2) and the supernatant obtained in step (3) to obtain a mixed solution.

(93) (5) Removing acetone from the mixed solution obtained in step (4) by rotary evaporation at 40° C., centrifuguing the residue at 5000 rpm, collecting the supernatant, and adding the deionized water to make a volume to be 20 mL, so as to obtain a test sample.

(94) (6) mixing 10 parts by volume of acetic acid buffer, 1 part by volume of 20 mM FeCl.sub.3.6H.sub.2O aqueous solution and 1 part by volume of TPTZ solution, and placing the mixture in water bath at 37° C. for 5 mins.

(95) Acetic acid buffer (pH 3.6, 300 mM): 16.8 g of glacial acetic acid and 0.8 g of sodium hydroxide were mixed with water to prepare a 1 liter solution.

(96) TPTZ solution: an aqueous solution containing 10 mM 2,4,6-tripyridyltriazine and 40 mM hydrochloric acid.

(97) (7) After the completion of step (6), mixing 4 mL of the solution and 30 μL sample to be tested, the mixture was placed for reaction at 37° C. for 120 mins, then measuring absorbance at 593 nm. Standard curve was made using Trolox as a standard sample.

(98) The detection results of flavonoid content, anthocyanin content and antioxidant capacity (also known as antioxidant content) of each of the materials to be tested were shown in Table 2. The results showed that the flavonoid content, anthocyanin content and antioxidant capacity of the flesh of fully red-fleshed plants bred by a cross with ‘CSR6R6-777’ as a parental plant were significantly higher than those of their parental plant ‘Gala’. ‘Hongxin 11’ and ‘Hongxin 16’ were sour and sweet, crisp and juicy, fresh, and had good quality. ‘Zixia 1’, ‘Zixia 2’ and ‘Zixia 3’ could be used as raw materials for deep processing. Therefore, ‘CSR6R6-777’ is a valuable germplasm for functional apple breeding.

(99) TABLE-US-00009 TABLE 2 Flavonoid Anthocyanin Antioxidant content content capacity (mg/kg) (mg/kg) (μmol/g) Zixia 1 5055.4 218.9 4.73 Zixia 2 4772.0 215.4 3.69 Zixia 3 1895.2 273.4 2.66 Hongxin 16 8523.3 449.4 4.30 Hongxin 11 349.3 46.3 1.38 CSR6R6-777 7555.1 536.6 3.89 Gala 74.6 5.2 0.16

Comparative Example

(100) The ‘CSR6R6-777’ was replaced with control plant I and the procedure of step I in Example 2 was performed. In August 2016, no fully red-fleshed plant was obtained from the backcross progeny, and only one plant with red and white flesh (tested as R6R1 genotype) was obtained and named as ‘Hongza No. 1’.

(101) The ‘CSR6R6-777’ was replaced with control plant II and the procedure of Step I in Example 2 was performed. In August 2016, no fully red-fleshed plant was obtained from the backcross progeny, and only one plant with red and white flesh (tested as R6R1 genotype) was obtained and named as ‘Hongza No. 2’.

(102) The flavonoid content, anthocyanin content and antioxidant capacity of ‘Hongza No. 1’ and ‘Hongza No. 2’ were detected in accordance with the method of step IV in Example 2, and the results were shown in Table 3.

Example 3. Fully Red-Fleshed Plants were Obtained by a Cross Using ‘CSR6R6-777’ as a Parental Plant

(103) Apple ‘Gala was replaced with apple ‘Red Fuji’ and the procedure of step I in Example 2 was performed.

(104) In August 2016, four fully red-fleshed plants were selected and cultivated from the backcross progeny population: ‘Zixia 4’, ‘Zixia 5’, ‘Zixia 6’ and ‘Hongxin 35’. After detection, ‘Zixia 4’, ‘Zixia 5’, ‘Zixia 6’ and ‘Hongxin 35’ all had R6R1 genotype.

(105) The flavonoid content, anthocyanin content and antioxidant capacity of ‘Zixia 4’, ‘Zixia 5’, ‘Zixia 6’ and ‘Hongxin 35’ were detected in accordance with the method of step IV in Example 2, and the results were shown in Table 3.

(106) TABLE-US-00010 TABLE 3 Flavonoid Anthocyanin Antioxidant content content capacity (mg/kg) (mg/kg) (μmol/g) Zixia 4 4685.6 248.3 4.57 Zixia 5 4589.2 238.1 3.86 Zixia 6 3976.8 275.4 2.71 Hongxin 35 8213.3 452.1 4.26 Red Fuji 81.2 6.1 0.18 Hongza No. 1 136.1 10 0.25 Hongza No. 2 187.6 26 0.29

INDUSTRY APPLICATION

(107) The invention provides apple CSR6R6-777, the flavonoid content and anthocyanin content are high and antioxidant capacity is strong in the flesh of the produced apple fruit, which adds functional health-care effect on basis of the eating quality of the common apple, and may have beneficial effect on the health of people who eats the apple for a long time. The apple fruit produced by apple CSR6R6-777 is used as a raw material to produce apple wine/apple vinegar and the like, which makes the apple wine and the apple vinegar have higher content of flavonoid and anthocyanin, so the health care effect is achieved. The apple CSR6R6-777 provided by the present invention can also be used as a parental plant to cross with other varieties, so that more new high-flavonoid apple germplasm may be obtained, which has great value for high-flavonoid apple breeding.