1. Patent Search
  2. Details

COMPOUNDS AND COMPOSITIONS FOR TREATING CONDITIONS ASSOCIATED WITH NLRP ACTIVITY

20210171477 · 2021-06-10

    Inventors

    Cpc classification

    International classification

    Abstract

    In one aspect, compounds of Formula AA, or a pharmaceutically acceptable salt thereof, are featured. The variables shown in Formula AA are as defined in the claims. The compounds of formula AA are NLRP3 activity modulators and, as such, can be used in the treatment of metabolic disorders (e.g. Type 2 diabetes, atherosclerosis, obesity or gout), a disease of the central nervous system (e.g. Alzheimer's disease, multiple sclerosis, Amyotrophic Lateral Sclerosis or Parkinson's disease), lung disease (e.g. asthma, COPD or pulmonary idiopathic fibrosis), liver disease (e.g. NASH syndrome, viral hepatitis or cirrhosis), pancreatic disease (e.g. acute pancreatitis or chronic pancreatitis), kidney disease (e.g. acute kidney injury or chronic kidney injury), intestinal disease (e.g. Crohn's disease or Ulcerative Colitis), skin disease (e.g. psoriasis), musculoskeletal disease (e.g. scleroderma), a vessel disorder (e.g. giant cell arteritis), a disorder of the bones (e.g. osteoarthritis, osteoporosis or osteopetrosis disorders), eye disease (e.g. glaucoma or macular degeneration), a disease caused by viral infection (e.g. HIV or AIDS), an autoimmune disease (e.g. Rheumatoid Arthritis, Systemic Lupus Erythematosus or Autoimmune Thyroiditis), cancer or aging.

    ##STR00001##

    Claims

    1.-122. (canceled)

    123. A compound of Formula AA ##STR01457## wherein m=0, 1, or 2; n=0, 1, or 2; o=1 or 2; p=0, 1, or 3, wherein A is a 5- to 10-membered monocyclic or bicyclic heteroaryl or a C.sub.6-C.sub.10 monocyclic or bicyclic aryl; B is a 5-membered heteroaryl, a 7-10 membered monocyclic or bicyclic heteroaryl, or a C.sub.6-C.sub.10 monocyclic or bicyclic aryl; wherein at least one R.sup.6 is ortho to the bond connecting the B ring to the NH(CO) group of Formula AA; R.sup.1 and R.sup.2 are each independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO—C.sub.6-C.sub.10 aryl; CO (5- to 10-membered heteroaryl); CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.2-C.sub.6 alkynyl, NHCOOCC.sub.1-C.sub.6 alkyl, NH—(C═NR.sup.13)NR.sup.11R.sup.12, CONR.sup.8R.sup.9, SF.sub.5, SC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, S(O)C.sub.1-C.sub.6 alkyl, S(O.sub.2)NR.sup.11R.sup.12, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl, wherein the C.sub.3-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein each C.sub.1-C.sub.6 alkyl substituent and each C.sub.1-C.sub.6 alkoxy substituent of the R.sup.1 or R.sup.2 C.sub.3-C.sub.7 cycloalkyl or of the R.sup.1 or R.sup.2 3- to 7-membered heterocycloalkyl is further optionally independently substituted with one to three hydroxy, halo, NR.sup.8R.sup.9, or oxo; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl) and NHCO (3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl; or at least one pair of R.sup.1 and R.sup.2 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.8 carbocyclic ring or at least one 5- to 8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9 wherein the C.sub.1-C.sub.6 alkyl and C.sub.1-C.sub.6 alkoxy are optionally substituted with hydroxy, halo, oxo, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9; R.sup.6 and R.sup.7 are each independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.10 cycloalkyl and 3- to 10-membered heterocycloalkyl, and a C.sub.2-C.sub.6 alkenyl, wherein R.sup.6 and R.sup.7 are each optionally substituted with one or more substituents independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.2-C.sub.6 alkynyl, C.sub.6-C.sub.10 aryloxy, and S(O.sub.2)C.sub.1-C.sub.6 alkyl; and wherein the C.sub.1-C.sub.6 alkyl or C.sub.1-C.sub.6 alkoxy that R.sup.6 or R.sup.7 is substituted with is optionally substituted with one or more hydroxyl, C.sub.6-C.sub.10 aryl or NR.sup.8R.sup.9, or wherein R.sup.6 or R.sup.7 is optionally fused to a five- to -seven-membered carbocyclic ring or heterocyclic ring containing one or two heteroatoms independently selected from oxygen, sulfur and nitrogen; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl) and NHCO (3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl; or at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.8 carbocyclic ring or at least one 5- to 8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, hydroxymethyl, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, CH.sub.2NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9; each of R.sup.4 and R.sup.5 is independently selected from hydrogen and C.sub.1-C.sub.6 alkyl; R.sup.10 is C.sub.1-C.sub.6 alkyl; each of R.sup.8 and R.sup.9 at each occurrence is independently selected from hydrogen, C.sub.1-C.sub.6 alkyl, (C═NR.sup.13)NR.sup.11R.sup.12, S(O.sub.2)C.sub.1-C.sub.6 alkyl, S(O.sub.2)NR.sup.11R.sup.12, COR.sup.13, CO.sub.2R.sup.13 and CONR.sup.11R.sup.12; wherein the C.sub.1-C.sub.6 alkyl is optionally substituted with one or more hydroxy, halo, C.sub.1-C.sub.6 alkoxy, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.7 cycloalkyl or 3- to 7-membered heterocycloalkyl; or R.sup.8 and R.sup.9 taken together with the nitrogen they are attached to form a 3- to 7-membered ring optionally containing one or more heteroatoms in addition to the nitrogen they are attached to; R.sup.13 is C.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, or 5- to 10-membered heteroaryl; each of R.sup.11 and R.sup.12 at each occurrence is independently selected from hydrogen and C.sub.1-C.sub.6 alkyl; R.sup.3 is selected from hydrogen, cyano, hydroxy, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 alkyl, and ##STR01458## wherein the C.sub.1-C.sub.2 alkylene group is optionally substituted by oxo; and R.sup.14 is hydrogen, C.sub.1-C.sub.6 alkyl, 5- to 10-membered monocyclic or bicyclic heteroaryl or C.sub.6-C.sub.10 monocyclic or bicyclic aryl, wherein each C.sub.1-C.sub.6 alkyl, aryl or heteroaryl is optionally independently substituted with 1 or 2 R.sup.6, or a pharmaceutically acceptable salt thereof.

    124. The compound of claim 123, wherein A is a 5- to 6-membered monocyclic heteroaryl optionally substituted with 1 or 2 R.sup.1 and optionally substituted with 1 or 2 R.sup.2.

    125. The compound of claim 123, wherein A is any one of: furanyl optionally substituted with 1 or 2 R.sup.1 and optionally substituted with 1 or 2 R.sup.2; thiophenyl optionally substituted with 1 or 2 R.sup.1 and optionally substituted with 1 or 2 R.sup.2; oxazolyl optionally substituted with 1 or 2 R.sup.1 and optionally substituted with 1 or 2 R.sup.2; thiazolyl optionally substituted with 1 or 2 R.sup.1 and optionally substituted with 1 or 2 R.sup.2; phenyl optionally substituted with 1 or 2 R.sup.1 and optionally substituted with 1 or 2 R.sup.2.

    126. The compound of claim 123, wherein m=1 n=0; and wherein A is any one of: ##STR01459## ##STR01460##

    127. The compound of claim 123, wherein m=1 and n=1; and wherein A is any one of: ##STR01461##

    128. The compound of claim 123, wherein m=2 and n=1; and wherein A is any one of: ##STR01462##

    129. The compound of claim 123, wherein each of R.sup.1 and R.sup.2, when present, is independently selected from the group consisting of C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, halo, oxo, C.sub.1-C.sub.6 alkoxy, or NR.sup.8R.sup.9; C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, halo, oxo, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 alkyl, or NR.sup.8R.sup.9 wherein the C.sub.1-C.sub.6 salkoxy or C.sub.1-C.sub.6 alkyl is further optionally substituted with one to three hydroxy, halo, NR.sup.8R.sup.9, or oxo; 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, or NR.sup.8R.sup.9 wherein the C.sub.1-C.sub.6 alkoxy or C.sub.1-C.sub.6 alkyl is further optionally substituted with one to three hydroxy, halo, NR.sup.8R.sup.9, or oxo; C.sub.1-C.sub.6 haloalkyl; C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 haloalkoxy; halo; CN; CO—C.sub.1-C.sub.6 alkyl; CO—C.sub.6-C.sub.10 aryl; CO (5- to 10-membered heteroaryl); CO.sub.2C.sub.1-C.sub.6 alkyl; CO.sub.2C.sub.3-C.sub.8 cycloalkyl; OCOC.sub.1-C.sub.6 alkyl; OCOC.sub.6-C.sub.10 aryl; OCO (5- to 10-membered heteroaryl); OCO (3- to 7-membered heterocycloalkyl); C.sub.6-C.sub.10 aryl; 5- to 10-membered heteroaryl; NH.sub.2; NHC.sub.1-C.sub.6 alkyl; N(C.sub.1-C.sub.6 alkyl).sub.2; CONR.sup.8R.sup.9; SF.sub.5; S(O.sub.2)NR.sup.11R.sup.12; S(O)C.sub.1-C.sub.6 alkyl; and S(O.sub.2)C.sub.1-C.sub.6 alkyl.

    130. The compound of claim 123, wherein R.sup.1 is selected from the group consisting of 1-hydroxy-2-methylpropan-2-yl; methyl; isopropyl; 2-hydroxy-2-propyl; hydroxymethyl; 1-hydroxyethyl; 2-hydroxyethyl; 1-hydroxy-2-propyl; 1-hydroxy-1-cyclopropyl; 1-hydroxy-1-cyclobutyl; 1-hydroxy-1-cyclopentyl; 1-hydroxy-1-cyclohexyl; morpholinyl; 1,3-dioxolan-2-yl; COCH.sub.3; COCH.sub.2CH.sub.3; 2-methoxy-2-propyl; (dimethylamino)methyl; 1-(dimethylamino)ethyl; fluoro; chloro; phenyl; pyridyl; pyrazolyl; S(O.sub.2)CH.sub.3; and S(O.sub.2)NR.sup.11R.sup.12.

    131. The compound of claim 129, wherein R.sup.2 is selected from the group consisting of fluoro, chloro, cyano, methyl; methoxy; ethoxy; isopropyl; 1-hydroxy-2-methylpropan-2-yl; 2-hydroxy-2-propyl; hydroxymethyl; 1-hydroxyethyl; 2-hydroxyethyl; 1-hydroxy-2-propyl; 1-hydroxy-1-cyclopropyl; COCH.sub.3; COPh; 2-methoxy-2-propyl; (dimethylamino)methyl; S(O.sub.2)CH.sub.3; and S(O.sub.2)NR.sup.11R.sup.12.

    132. The compound of claim 123, wherein B is phenyl substituted with 1 or 2 R.sup.6 and optionally substituted with 1, 2, or 3 R.sup.7.

    133. The compound of claim 132, wherein B is any one of: ##STR01463##

    134. The compound of claim 123, wherein R.sup.3 is hydrogen.

    135. A compound selected from the group consisting of the compounds below: TABLE-US-00040 Compound Structure 101′ embedded image 101 embedded image 102 embedded image 103′ embedded image 103 embedded image 104 embedded image 105 embedded image 106 embedded image 107 embedded image 108 embedded image 109 embedded image 110 embedded image 111 embedded image 112 embedded image 113 embedded image 114 embedded image 115 embedded image 116 embedded image 117 embedded image 118 embedded image 119 embedded image 120 embedded image 121 embedded image 122 embedded image 123 embedded image 124 embedded image 125 embedded image 126 embedded image 127 embedded image 128 embedded image 129 embedded image 130 embedded image 131 embedded image 132 embedded image 133 embedded image 134 embedded image 135 embedded image 136 embedded image 137 embedded image 138 embedded image 139 embedded image 140 embedded image 141 embedded image 142 embedded image 143 embedded image 144 embedded image 145 embedded image 146 embedded image 147 embedded image 148 embedded image 149 embedded image 150 embedded image 151 embedded image 152 embedded image 153 embedded image 154 embedded image 155 embedded image 156 embedded image 157 embedded image 158 embedded image 159 embedded image 160 embedded image 161 embedded image 163 embedded image 164 embedded image 165 embedded image 166 embedded image 167 embedded image 168 embedded image 169 embedded image 170 embedded image 171 embedded image 172 embedded image 172a embedded image 172b embedded image 173 embedded image 173a embedded image 173b embedded image 174 embedded image 175 embedded image 176 embedded image 176a embedded image 176b embedded image 177 embedded image 177a embedded image 177b embedded image 178 embedded image 178a embedded image 178b embedded image 179 embedded image 179a embedded image 179b embedded image 180 embedded image 180a embedded image 180b embedded image 181 embedded image 181a embedded image 181b embedded image 182 embedded image 182a embedded image 182b embedded image 183 embedded image 183a embedded image 183b embedded image 184 embedded image 185 embedded image 185a embedded image 185b embedded image 186 embedded image 186a embedded image 186b embedded image 187 embedded image 187a embedded image 187b embedded image 188 embedded image 188a embedded image 188b embedded image 189 embedded image 189a embedded image 189b embedded image 190 embedded image 190a embedded image 190b embedded image 191 embedded image 192 embedded image 192a embedded image 192b embedded image 193 embedded image 193a embedded image 193b embedded image 105a embedded image 105b embedded image 106a embedded image 106b embedded image 107a embedded image 107b embedded image 108a embedded image 108b embedded image 109a embedded image 109b embedded image 110a embedded image 110b embedded image 112a embedded image 112b embedded image 116a embedded image 116b embedded image 120a embedded image 120b embedded image 121a embedded image 121b embedded image 122a embedded image 122b embedded image 125a embedded image 125b embedded image 129a embedded image 129b embedded image 130a embedded image 130b embedded image 131a embedded image 131b embedded image 134a embedded image 134b embedded image 135a embedded image 135b embedded image 136a embedded image 136b embedded image 143a embedded image 143b embedded image 144a embedded image 144b embedded image 145a embedded image 145b embedded image 148 embedded image 148b embedded image 149a embedded image 149b embedded image 151a′ embedded image 151b′ embedded image 151a embedded image 151b embedded image 152a embedded image 152b embedded image 153a embedded image 153b embedded image 154a embedded image 154b embedded image 157a embedded image 157b embedded image 158a embedded image 158b embedded image 161a embedded image 161b embedded image 165a embedded image 165b embedded image 167a embedded image 167b embedded image 168a embedded image 168b embedded image 170a embedded image 170b embedded image 171a embedded image 171b embedded image 174a embedded image 174b embedded image 191a embedded image 191b embedded image 195 embedded image 195a embedded image 195ba embedded image 195bb embedded image 196 embedded image 197 embedded image 198 embedded image 200 embedded image 202 embedded image 202a embedded image 202b embedded image 205 embedded image 205a embedded image 205b embedded image 206 embedded image 206a embedded image 206b embedded image 207 embedded image 207a embedded image 207b embedded image 208 embedded image 209 embedded image 211 embedded image 212 embedded image 212a embedded image 212b embedded image 213 embedded image 216 embedded image 220 embedded image 220a embedded image 220b embedded image 221 embedded image 223a embedded image 223b embedded image 225a embedded image 225b embedded image 270 embedded image 113a embedded image 113b embedded image 137a embedded image 137b embedded image 138a embedded image 138b embedded image 139a embedded image 139b embedded image 159a embedded image 159ba embedded image 159ab embedded image 195e embedded image 207bb embedded image 207aa embedded image 207c embedded image 303 embedded image 303a embedded image 303b embedded image 306 embedded image 307 embedded image 308 embedded image 308a embedded image 308b embedded image 309 embedded image 310 embedded image 311 embedded image 312 embedded image 313 embedded image 314 embedded image 315 embedded image 315b embedded image 315a embedded image 316 embedded image 316b embedded image 317 embedded image 317ab embedded image 317aa embedded image 317bb embedded image 317ba embedded image 318 embedded image 318a embedded image 318b embedded image 319 embedded image 319ab embedded image 319ba embedded image 319aa embedded image 319bb embedded image 320 embedded image 320a embedded image 320b embedded image 321 embedded image 321b embedded image 321a embedded image 322 embedded image 323 embedded image 323ab embedded image 323aa embedded image 323bb embedded image 323ba embedded image 324 embedded image 325 embedded image 325a embedded image 325b embedded image 326 embedded image 326b embedded image 326a embedded image 327 embedded image 328b embedded image 328a embedded image 329 embedded image 329a embedded image 329b embedded image 330 embedded image 330a embedded image 330b embedded image 331 embedded image 332 embedded image 332a embedded image 332b embedded image 333 embedded image 333a embedded image 333b embedded image 334 embedded image 334ba embedded image 334bb embedded image 334aa embedded image 334ab embedded image 334b embedded image 334a embedded image 335 embedded image 335b embedded image 335a embedded image 336 embedded image 336a embedded image 336b embedded image 337 embedded image 337b embedded image 338 embedded image 338a embedded image 339 embedded image 339a embedded image 340 embedded image 340a embedded image 340b embedded image 341 embedded image 341b embedded image 342 embedded image 343 embedded image 343a embedded image 343b embedded image 344 embedded image 345 embedded image 346 embedded image 347 embedded image 348 embedded image 349 embedded image 350 embedded image 351 embedded image 352 embedded image 352b embedded image 352a embedded image 353 embedded image 354 embedded image 354a embedded image 354b embedded image 355 embedded image 356 embedded image 357 embedded image 357a embedded image 357b embedded image 358 embedded image 359 embedded image 359a embedded image 360ba embedded image 360bb embedded image 361b embedded image 363b embedded image 363a embedded image 364a embedded image 364b embedded image 365a embedded image 365b embedded image 366a embedded image 366b embedded image 367a embedded image 367b embedded image 369a embedded image 369b embedded image 371b embedded image 372b embedded image 373b embedded image 375 embedded image 375a embedded image 375b embedded image 376 embedded image 376a embedded image 376b embedded image 377 embedded image 378 embedded image 279 embedded image 379a embedded image 379b embedded image 380 embedded image 380a embedded image 380b embedded image 380c embedded image 380d embedded image 382 embedded image 382a embedded image 382b embedded image 383 embedded image 383a embedded image 383b embedded image 384a embedded image 384b embedded image 387a embedded image 387b embedded image and pharmaceutically acceptable salts thereof.

    136. The compound according to claim 123, wherein the sulfur in the moiety S(═O)(NHR.sup.3)═N— has (S) stereochemistry.

    137. The compound according to claim 123, wherein the sulfur in the moiety S(═O)(NHR.sup.3)═N— has (R) stereochemistry.

    138. A pharmaceutical composition comprising a compound or salt as claimed in claim 123 and one or more pharmaceutically acceptable excipients.

    139. A method of treating a subject in need thereof having a disease, disorder or condition in which NLRP3 signaling contributes to the pathology and/or symptoms and/or progression of the disease disorder or condition, comprising administering to the subject an effective amount of a compound according to claim 123.

    140. The method according to claim 139, wherein the disease, disorder or condition is a metabolic disorder, selected from the group consisting of Type 2 diabetes, atherosclerosis, obesity and gout; a disease of the central nervous system, selected from the group consisting of Alzheimer's disease, multiple sclerosis, Amyotrophic Lateral Sclerosis and Parkinson's disease; lung disease, selected from the group consisting of asthma, COPD and pulmonary idiopathic fibrosis; liver disease, selected from the group consisting of NASH syndrome, viral hepatitis and cirrhosis; pancreatic disease, selected from the group consisting of acute pancreatitis and chronic pancreatitis; kidney disease, selected from the group consisting of acute kidney injury and chronic kidney injury; intestinal disease, selected from the group consisting of Crohn's disease and Ulcerative Colitis; skin disease, that is psoriasis; musculoskeletal disease, that is scleroderma; a vessel disorder, that is giant cell arteritis; a disorder of the bones, selected from the group consisting of osteoarthritis, osteoporosis and osteopetrosis disorders; eye disease, selected from the group consisting of glaucoma, macular degeneration, and a disease caused by viral infection, optionally wherein the diseases caused by viral infection is HIV or AIDS; an autoimmune disease, selected from the group consisting of Rheumatoid Arthritis, Systemic Lupus Erythematosus, Autoimmune Thyroiditis cancer, and aging, optionally wherein the disorder or condition that is cancer is selected from the group consisting of: myelodysplastic syndromes (MDS); non-small cell lung cancer; acute lymphoblastic leukemia (ALL); Langerhan's cell histiocytosis (LCH); multiple myeloma; promyelocytic leukemia; acute myeloid leukemia (AML); chronic myeloid leukemia (CML); gastric cancer; and lung cancer metastasis.

    141. The method according to claim 139, further comprising administering a therapeutically effective amount of an anti-TNFα agent to the subject; optionally wherein: the NLRP3 antagonist is administered to the subject prior to administration of the anti-TNFα agent to the subject; or wherein the anti-TNFα agent is administered to the subject prior to the administration of the NLRP3 antagonist to the subject; or wherein the NLRP3 antagonist and the anti-TNFα agent are administered to the subject at substantially the same time.

    Description

    DESCRIPTION OF DRAWINGS

    [0053] FIG. 1 depicts ball-and-stick representations of two crystallographically independent molecules of compound 181a in the asymmetrical unit.

    [0054] FIG. 2 depicts ball-and-stick representations of two crystallographically independent molecules of compound 181b in the asymmetrical unit.

    [0055] FIG. 3 depicts the layout of the microplate used in an hTHP-1 assay.

    DETAILED DESCRIPTION

    [0056] In some embodiments, provided herein is a compound of Formula AA

    ##STR00013##

    wherein
    m=0, 1, or 2;
    n=0, 1, or 2;
    o=1 or 2;
    p=0, 1, 2, or 3;
    wherein
    A is a 5-10-membered heteroaryl or a C.sub.6-C.sub.10 aryl;
    B is a 5-10-membered heteroaryl or a C.sub.6-C.sub.10 aryl;
    wherein
    at least one R.sup.6 is ortho to the bond connecting the B ring to the NR.sup.3(CO) group of Formula AA;
    R.sup.1 and R.sup.2 are each independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO—C.sub.6-C.sub.10 aryl, CO-(5- to 10-membered heteroaryl), CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.2-C.sub.6 alkynyl, NHCOOC.sub.1-C.sub.6 alkyl, NH—(C═NR.sup.13)NR.sup.11R.sup.12, CONR.sup.8R.sup.9, SF.sub.5, SC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, S(O.sub.2)NR.sup.11R.sup.12, S(O)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl, and 3- to 7-membered heterocycloalkyl,
    wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl, and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, COOC.sub.1-C.sub.6 alkyl, NR.sup.8R.sup.9, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), and OCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; [0057] wherein each C.sub.1-C.sub.6 alkyl substituent and each C.sub.1-C.sub.6 alkoxy substituent of the R.sup.1 or R.sup.2 C.sub.3-C.sub.7 cycloalkyl or of the R.sup.1 or R.sup.2 3- to 7-membered heterocycloalkyl is further optionally independently substituted with one to three hydroxy, halo, or oxo; [0058] wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, or 5- to 10-membered heteroaryl, of the R.sup.1 or R.sup.2 C.sub.1-C.sub.6 alkyl, the R.sup.1 or R.sup.2 C.sub.1-C.sub.6 haloalkyl, the R.sup.1 or R.sup.2 C.sub.3-C.sub.7 cycloalkyl, or the R.sup.1 or R.sup.2 3- to 7-membered heterocycloalkyl are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, oxo, and OC.sub.1-C.sub.6 alkyl;
    or at least one pair of R.sup.1 and R.sup.2 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.8 carbocyclic ring or at least one 5- to-8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9, wherein the C.sub.1-C.sub.6 alkyl and C.sub.1-C.sub.6 alkoxy are optionally substituted with hydroxy, halo, oxo, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9;
    R.sup.6 and R.sup.7 are each independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SF.sub.5, SC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.10 cycloalkyl, 3- to 10-membered heterocycloalkyl, and C.sub.2-C.sub.6 alkenyl,
    wherein R.sup.6 and R.sup.7 are each optionally substituted with one or more substituents independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.2-C.sub.6 alkynyl, C.sub.6-C.sub.10 aryloxy, and S(O.sub.2)C.sub.1-C.sub.6 alkyl; and wherein the C.sub.1-C.sub.6 alkyl or C.sub.1-C.sub.6 alkoxy that R.sup.6 or R.sup.7 is substituted with is optionally substituted with one or more hydroxyl, halo, C.sub.6-C.sub.10 aryl or NR.sup.8R.sup.9, or wherein R.sup.6 or R.sup.7 is optionally fused to a five- to -seven-membered carbocyclic ring or heterocyclic ring containing one or two heteroatoms independently selected from oxygen, sulfur and nitrogen; [0059] wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl) and NHCO (3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
    or at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.8 carbocyclic ring or at least one 4- to 8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, NR.sup.20, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, hydroxymethyl, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, CH.sub.2NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9; each of R.sup.4 and R.sup.5 is independently selected from hydrogen and C.sub.1-C.sub.6 alkyl;
    R.sup.10 is C.sub.1-C.sub.6 alkyl;
    each of R.sup.8 and R.sup.9 at each occurrence is independently selected from hydrogen, C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, (C═NR.sup.13)NR.sup.11R.sup.12, S(O.sub.2)C.sub.1-C.sub.6 alkyl, S(O.sub.2)NR.sup.11R.sup.12, COR.sup.13, CO.sub.2R.sup.13 and CONR.sup.11R.sup.12; wherein the C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, or C.sub.2-C.sub.6 alkynyl is optionally substituted with one or more hydroxy, halo, oxo, C.sub.1-C.sub.6 alkoxy, C.sub.2-C.sub.6 alkynyl, CO.sub.2R.sup.13, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.7 cycloalkyl, or 3- to 7-membered heterocycloalkyl; or
    R.sup.8 and R.sup.9 taken together with the nitrogen they are attached to form a 3- to 7-membered ring optionally containing one or more heteroatoms in addition to the nitrogen they are attached to;
    R.sup.13 is C.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, or 5- to 10-membered heteroaryl;
    each of R.sup.11 and R.sup.12 at each occurrence is independently selected from hydrogen and C.sub.1-C.sub.6 alkyl;
    each R.sup.3 is independently selected from hydrogen, cyano, hydroxy, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, and

    ##STR00014##

    wherein the C.sub.1-C.sub.2 alkylene group is optionally substituted with oxo; and
    R.sup.11 is hydrogen, C.sub.1-C.sub.6 alkyl, 5-10-membered monocyclic or bicyclic heteroaryl or C.sub.6-C.sub.10 monocyclic or bicyclic aryl, wherein each C.sub.1-C.sub.6 alkyl, aryl or heteroaryl is optionally independently substituted with 1, 2, or 3 R.sup.6;
    or a pharmaceutically acceptable salt thereof.

    [0060] In some embodiments, provided herein is a compound of Formula AA

    ##STR00015##

    wherein
    m=0, 1, or 2;
    n=0, 1, or 2;
    o=1 or 2;
    p=0, 1, 2, or 3;
    wherein
    A is a 5-10-membered heteroaryl or a C.sub.6-C.sub.10 aryl;
    B is a 5-10-membered heteroaryl or a C.sub.6-C.sub.10 aryl;
    wherein
    at least one R.sup.6 is ortho to the bond connecting the B ring to the NR.sup.3(CO) group of Formula AA; R.sup.1 and R.sup.2 are each independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO—C.sub.6-C.sub.10 aryl, CO-(5- to 10-membered heteroaryl), CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.2-C.sub.6 alkynyl, NHCOOC.sub.1-C.sub.6 alkyl, NH—(C═NR.sup.13)NR.sup.11R.sup.12, CONR.sup.8R.sup.9, SF.sub.5, SC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, S(O.sub.2)NR.sup.11R.sup.12, S(O)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl, and 3- to 7-membered heterocycloalkyl,
    wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl, and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, COOC.sub.1-C.sub.6 alkyl, NR.sup.8R.sup.9, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), and OCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; [0061] wherein each C.sub.1-C.sub.6 alkyl substituent and each C.sub.1-C.sub.6 alkoxy substituent of the R.sup.1 or R.sup.2 C.sub.3-C.sub.7 cycloalkyl or of the R.sup.1 or R.sup.2 3- to 7-membered heterocycloalkyl is further optionally independently substituted with one to three hydroxy, halo, or oxo; [0062] wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, or 5- to 10-membered heteroaryl, of the R.sup.1 or R.sup.2 C.sub.1-C.sub.6 alkyl, the R.sup.1 or R.sup.2 C.sub.1-C.sub.6 haloalkyl, the R.sup.1 or R.sup.2 C.sub.3-C.sub.7 cycloalkyl, or the R.sup.1 or R.sup.2 3- to 7-membered heterocycloalkyl are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, oxo, and OC.sub.1-C.sub.6 alkyl;
    or at least one pair of R.sup.1 and R.sup.2 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.8 carbocyclic ring or at least one 5- to-8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9, wherein the C.sub.1-C.sub.6 alkyl and C.sub.1-C.sub.6 alkoxy are optionally substituted with hydroxy, halo, oxo, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9;
    R.sup.6 and R.sup.7 are each independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SF.sub.5, SC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.10 cycloalkyl, 3- to 10-membered heterocycloalkyl, and C.sub.2-C.sub.6 alkenyl,
    wherein R.sup.6 and R.sup.7 are each optionally substituted with one or more substituents independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.2-C.sub.6 alkynyl, C.sub.6-C.sub.10 aryloxy, and S(O.sub.2)C.sub.1-C.sub.6 alkyl; and wherein the C.sub.1-C.sub.6 alkyl or C.sub.1-C.sub.6 alkoxy that R.sup.6 or R.sup.7 is substituted with is optionally substituted with one or more hydroxyl, halo, C.sub.6-C.sub.10 aryl or NR.sup.8R.sup.9, or wherein R.sup.6 or R.sup.7 is optionally fused to a five- to -seven-membered carbocyclic ring or heterocyclic ring containing one or two heteroatoms independently selected from oxygen, sulfur and nitrogen; [0063] wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl) and NHCO (3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
    or at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.8 carbocyclic ring or at least one 5- to 8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, hydroxymethyl, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, CH.sub.2NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9;
    R.sup.10 is C.sub.1-C.sub.6 alkyl;
    each of R.sup.8 and R.sup.9 at each occurrence is independently selected from hydrogen, C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, (C═NR.sup.13)NR.sup.11R.sup.12, S(O.sub.2)C.sub.1-C.sub.6 alkyl, S(O.sub.2)NR.sup.11R.sup.12, COR.sup.13, CO.sub.2R.sup.13 and CONR.sup.11R.sup.12; wherein the C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, or C.sub.2-C.sub.6 alkynyl is optionally substituted with one or more hydroxy, halo, oxo, C.sub.1-C.sub.6 alkoxy, C.sub.2-C.sub.6 alkynyl, CO.sub.2R.sup.13, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.7 cycloalkyl, or 3- to 7-membered heterocycloalkyl; or
    R.sup.8 and R.sup.9 taken together with the nitrogen they are attached to form a 3- to 7-membered ring optionally containing one or more heteroatoms in addition to the nitrogen they are attached to;
    R.sup.13 is C.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, or 5- to 10-membered heteroaryl;
    each of R.sup.11 and R.sup.12 at each occurrence is independently selected from hydrogen and C.sub.1-C.sub.6 alkyl;
    each R.sup.3 is independently selected from hydrogen, cyano, hydroxy, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, and

    ##STR00016##

    wherein the C.sub.1-C.sub.2 alkylene group is optionally substituted with oxo; and
    R.sup.14 is hydrogen, C.sub.1-C.sub.6 alkyl, 5-10-membered monocyclic or bicyclic heteroaryl or C.sub.6-C.sub.10 monocyclic or bicyclic aryl, wherein each C.sub.1-C.sub.6 alkyl, aryl or heteroaryl is optionally independently substituted with 1, 2, or 3 R.sup.6;
    or a pharmaceutically acceptable salt thereof.

    [0064] In some embodiments, provided herein is a compound of Formula AA

    ##STR00017##

    wherein
    m=0, 1, or 2;
    n=0, 1, or 2;
    o=1 or 2;
    p=0, 1, 2, or 3;
    wherein
    A is a 5-10-membered heteroaryl or a C.sub.6-C.sub.10 aryl;
    B is a 5-10-membered heteroaryl or a C.sub.6-C.sub.10 aryl;
    wherein
    at least one R.sup.6 is ortho to the bond connecting the B ring to the NR.sup.3(CO) group of Formula AA;
    R.sup.1 and R.sup.2 are each independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO—C.sub.6-C.sub.10 aryl, CO-(5- to 10-membered heteroaryl), CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.2-C.sub.6 alkynyl, NHCOOC.sub.1-C.sub.6 alkyl, NH—(C═NR.sup.13)NR.sup.11R.sup.12, CONR.sup.8R.sup.9, SF.sub.5, SC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, S(O.sub.2)NR.sup.11R.sup.12, S(O)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl, and 3- to 7-membered heterocycloalkyl,
    wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl, and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), and OCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; [0065] wherein each C.sub.1-C.sub.6 alkyl substituent and each C.sub.1-C.sub.6 alkoxy substituent of the R.sup.1 or R.sup.2 C.sub.3-C.sub.7 cycloalkyl or of the R.sup.1 or R.sup.2 3- to 7-membered heterocycloalkyl is further optionally independently substituted with one to three hydroxy, halo, NR.sup.8R.sup.9, or oxo; [0066] wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl) and NHCO (3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
    or at least one pair of R.sup.1 and R.sup.2 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.8 carbocyclic ring or at least one 5- to-8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9, wherein the C.sub.1-C.sub.6 alkyl and C.sub.1-C.sub.6 alkoxy are optionally substituted with hydroxy, halo, oxo, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9;
    R.sup.6 and R.sup.7 are each independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SF.sub.5, SC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.10 cycloalkyl, 3- to 10-membered heterocycloalkyl, and C.sub.2-C.sub.6 alkenyl,
    wherein R.sup.6 and R.sup.7 are each optionally substituted with one or more substituents independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.2-C.sub.6 alkynyl, C.sub.6-C.sub.10 aryloxy, and S(O.sub.2)C.sub.1-C.sub.6 alkyl; and wherein the C.sub.1-C.sub.6 alkyl or C.sub.1-C.sub.6 alkoxy that R.sup.6 or R.sup.7 is substituted with is optionally substituted with one or more hydroxyl, halo, C.sub.6-C.sub.10 aryl or NR.sup.8R.sup.9, or wherein R.sup.6 or R.sup.7 is optionally fused to a five- to -seven-membered carbocyclic ring or heterocyclic ring containing one or two heteroatoms independently selected from oxygen, sulfur and nitrogen and optionally substituted with halo; [0067] wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl) and NHCO (3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
    or at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.8 carbocyclic ring or at least one 5- to 8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, hydroxymethyl, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, CH.sub.2NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9;
    R.sup.10 is C.sub.1-C.sub.6 alkyl;
    each of R.sup.8 and R.sup.9 at each occurrence is independently selected from hydrogen, C.sub.1-C.sub.6 alkyl, (C═NR.sup.13)NR.sup.11R.sup.12, S(O.sub.2)C.sub.1-C.sub.6 alkyl, S(O.sub.2)NR.sup.11R.sup.12, COR.sup.13, CO.sub.2R.sup.13 and CONR.sup.11R.sup.12; wherein the C.sub.1-C.sub.6 alkyl is optionally substituted with one or more hydroxy, halo, C.sub.1-C.sub.6 alkoxy, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.7 cycloalkyl or 3- to 7-membered heterocycloalkyl; or
    R.sup.8 and R.sup.9 taken together with the nitrogen they are attached to form a 3- to 7-membered ring optionally containing one or more heteroatoms in addition to the nitrogen they are attached to; R.sup.13 is C.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, or 5- to 10-membered heteroaryl;
    each of R.sup.11 and R.sup.12 at each occurrence is independently selected from hydrogen and C.sub.1-C.sub.6 alkyl; R.sup.3 is selected from hydrogen, cyano, hydroxy, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, and

    ##STR00018##

    wherein the C.sub.1-C.sub.2 alkylene group is optionally substituted with oxo; and
    R.sup.14 is hydrogen, C.sub.1-C.sub.6 alkyl, 5-10-membered monocyclic or bicyclic heteroaryl or C.sub.6-C.sub.10 monocyclic or bicyclic aryl, wherein each C.sub.1-C.sub.6 alkyl, aryl or heteroaryl is optionally independently substituted with 1, 2, or 3 R.sup.6;
    or a pharmaceutically acceptable salt thereof.

    [0068] In some embodiments, provided herein is a compound of Formula AA

    ##STR00019##

    wherein
    m=0, 1, or 2;
    n=0, 1, or 2;
    o=1 or 2;
    p=0, 1, 2, or 3;
    wherein
    A is a 5- to 10-membered monocyclic or bicyclic heteroaryl or a C.sub.6-C.sub.10 monocyclic or bicyclic aryl;
    B is a 5- to 10-membered monocyclic or bicyclic heteroaryl or a C.sub.6-C.sub.10 monocyclic or bicyclic aryl;
    wherein
    at least one R.sup.6 is ortho to the bond connecting the B ring to the NR.sup.3(CO) group of Formula AA; R.sup.1 and R.sup.2 are each independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO—C.sub.6-C.sub.10 aryl, CO (5- to 10-membered heteroaryl), CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.2-C.sub.6 alkynyl, NHCOOCC.sub.1-C.sub.6 alkyl, NH—(C═NR.sup.13)NR.sup.11R.sup.12, CONR.sup.8R.sup.9, SF.sub.5, SC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, S(O.sub.2)NR.sup.11R.sup.12, S(O)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl,
    wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10 COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; [0069] wherein each C.sub.1-C.sub.6 alkyl substituent and each C.sub.1-C.sub.6 alkoxy substituent of the R.sup.1 or R.sup.2 C.sub.3-C.sub.7 cycloalkyl or of the R.sup.1 or R.sup.2 3- to 7-membered heterocycloalkyl is further optionally independently substituted with one to three hydroxy, halo, NR.sup.8R.sup.9, or oxo; [0070] wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl) and NHCO (3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
    or at least one pair of R.sup.1 and R.sup.2 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.8 carbocyclic ring or at least one 5- to-8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9, wherein the C.sub.1-C.sub.6 alkyl and C.sub.1-C.sub.6 alkoxy are optionally substituted with hydroxy, halo, oxo, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9;
    R.sup.6 and R.sup.7 are each independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SF.sub.5, SC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.10 cycloalkyl and 3- to 10-membered heterocycloalkyl, and C.sub.2-C.sub.6 alkenyl,
    wherein R.sup.6 and R.sup.7 are each optionally substituted with one or more substituents independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.2-C.sub.6 alkynyl, C.sub.6-C.sub.10 aryloxy, and S(O.sub.2)C.sub.1-C.sub.6 alkyl; and wherein the C.sub.1-C.sub.6 alkyl or C.sub.1-C.sub.6 alkoxy that R.sup.6 or R.sup.7 is substituted with is optionally substituted with one or more hydroxyl, C.sub.6-C.sub.10 aryl or NR.sup.8R.sup.9, or wherein R.sup.6 or R.sup.7 is optionally fused to a five- to -seven-membered carbocyclic ring or heterocyclic ring containing one or two heteroatoms independently selected from oxygen, sulfur and nitrogen; [0071] wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl) and NHCO (3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
    or at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.8 carbocyclic ring or at least one 5- to 8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, hydroxymethyl, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, CH.sub.2NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9;
    R.sup.10 is C.sub.1-C.sub.6 alkyl;
    each of R.sup.8 and R.sup.9 at each occurrence is independently selected from hydrogen, C.sub.1-C.sub.6 alkyl, (C═NR.sup.13)NR.sup.11R.sup.12, S(O.sub.2)C.sub.1-C.sub.6 alkyl, S(O.sub.2)NR.sup.11R.sup.12, COR.sup.13, CO.sub.2R.sup.13 and CONR.sup.11R.sup.12; wherein the C.sub.1-C.sub.6 alkyl is optionally substituted with one or more hydroxy, halo, C.sub.1-C.sub.6 alkoxy, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.7 cycloalkyl or 3- to 7-membered heterocycloalkyl; or R.sup.8 and R.sup.9 taken together with the nitrogen they are attached to form a 3- to 7-membered ring optionally containing one or more heteroatoms in addition to the nitrogen they are attached to;
    R.sup.13 is C.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, or 5- to 10-membered heteroaryl;
    each of R.sup.11 and R.sup.12 at each occurrence is independently selected from hydrogen and C.sub.1-C.sub.6 alkyl; and
    R.sup.3 is selected from hydrogen, cyano, hydroxy, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 alkyl, and

    ##STR00020##

    wherein the C.sub.1-C.sub.2 alkylene group is optionally substituted with oxo;
    R.sup.14 is hydrogen, C.sub.1-C.sub.6 alkyl, 5- to 10-membered monocyclic or bicyclic heteroaryl or C.sub.6-C.sub.10 monocyclic or bicyclic aryl, wherein each C.sub.1-C.sub.6 alkyl, aryl or heteroaryl is optionally independently substituted with 1 or 2 R.sup.6;
    or a pharmaceutically acceptable salt thereof.

    [0072] In some embodiments, provided herein is a compound of Formula AA

    ##STR00021##

    wherein
    m=0, 1, or 2;
    n=0, 1, or 2;
    o=1 or 2;
    p=0, 1, 2, or 3,
    wherein
    A is a 5- to 10-membered monocyclic or bicyclic heteroaryl or a C.sub.6-C.sub.10 monocyclic or bicyclic aryl;
    B is a 5- to 10-membered monocyclic or bicyclic heteroaryl or a C.sub.6-C.sub.10 monocyclic or bicyclic aryl;
    wherein
    at least one R.sup.6 is ortho to the bond connecting the B ring to the NH(CO) group of Formula AA;
    R.sup.1 and R.sup.2 are each independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO—C.sub.6-C.sub.10 aryl; CO (5- to 10-membered heteroaryl); CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.2-C.sub.6 alkynyl, NHCOOCC.sub.1-C.sub.6 alkyl, NH—(C═NR.sup.13)NR.sup.11R.sup.12, CONR.sup.8R.sup.9, SF.sub.5, SC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, S(O)C.sub.1-C.sub.6 alkyl, S(O.sub.2)NR.sup.11R.sup.12, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl,
    wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; [0073] wherein each C.sub.1-C.sub.6 alkyl substituent and each C.sub.1-C.sub.6 alkoxy substituent of the R.sup.1 or R.sup.2 C.sub.3-C.sub.7 cycloalkyl or of the R.sup.1 or R.sup.2 3- to 7-membered heterocycloalkyl is further optionally independently substituted with one to three hydroxy, halo, NR.sup.8R.sup.9, or oxo; [0074] wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl) and NHCO (3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
    or at least one pair of R.sup.1 and R.sup.2 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.8 carbocyclic ring or at least one 5- to 8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9 wherein the C.sub.1-C.sub.6 alkyl and C.sub.1-C.sub.6 alkoxy are optionally substituted with hydroxy, halo, oxo, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9;

    [0075] R.sup.6 and R.sup.7 are each independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.10 cycloalkyl and 3- to 10-membered heterocycloalkyl, and a C.sub.2-C.sub.6 alkenyl,

    wherein R.sup.6 and R.sup.7 are each optionally substituted with one or more substituents independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.2-C.sub.6 alkynyl, C.sub.6-C.sub.10 aryloxy, and S(O.sub.2)C.sub.1-C.sub.6 alkyl; and wherein the C.sub.1-C.sub.6 alkyl or C.sub.1-C.sub.6 alkoxy that R.sup.6 or R.sup.7 is substituted with is optionally substituted with one or more hydroxyl, C.sub.6-C.sub.10 aryl or NR.sup.8R.sup.9, or wherein R.sup.6 or R.sup.7 is optionally fused to a five- to -seven-membered carbocyclic ring or heterocyclic ring containing one or two heteroatoms independently selected from oxygen, sulfur and nitrogen; [0076] wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl) and NHCO (3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
    or at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.8 carbocyclic ring or at least one 5- to 8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, hydroxymethyl, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, CH.sub.2NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9;
    each of R.sup.4 and R.sup.5 is independently selected from hydrogen and C.sub.1-C.sub.6 alkyl;
    R.sup.10 is C.sub.1-C.sub.6 alkyl;
    each of R.sup.8 and R.sup.9 at each occurrence is independently selected from hydrogen, C.sub.1-C.sub.6 alkyl, (C═NR.sup.13)NR.sup.11R.sup.12, S(O.sub.2)C.sub.1-C.sub.6 alkyl, S(O.sub.2)NR.sup.11R.sup.12, COR.sup.13, CO.sub.2R.sup.13 and CONR.sup.11R.sup.12; wherein the C.sub.1-C.sub.6 alkyl is optionally substituted with one or more hydroxy, halo, C.sub.1-C.sub.6 alkoxy, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.7 cycloalkyl or 3- to 7-membered heterocycloalkyl; or
    R.sup.8 and R.sup.9 taken together with the nitrogen they are attached to form a 3- to 7-membered ring optionally containing one or more heteroatoms in addition to the nitrogen they are attached to;
    R.sup.13 is C.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, or 5- to 10-membered heteroaryl;
    each of R.sup.11 and R.sup.12 at each occurrence is independently selected from hydrogen and C.sub.1-C.sub.6 alkyl;
    R.sup.3 is selected from hydrogen, cyano, hydroxy, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 alkyl, and

    ##STR00022##

    wherein the C.sub.1-C.sub.2 alkylene group is optionally substituted by oxo;
    R.sup.14 is hydrogen, C.sub.1-C.sub.6 alkyl, 5- to 10-membered monocyclic or bicyclic heteroaryl or C.sub.6-C.sub.10 monocyclic or bicyclic aryl, wherein each C.sub.1-C.sub.6 alkyl, aryl or heteroaryl is optionally independently substituted with 1 or 2 R.sup.6;
    with the proviso that the compound of Formula AA is not a compound selected from the group consisting of:

    ##STR00023##

    or a pharmaceutically acceptable salt thereof.

    [0077] In some embodiments, provided herein is a compound of Formula AA

    ##STR00024##

    wherein
    m=0, 1, or 2;
    n=0, 1, or 2;
    o=1 or 2;
    p=0, 1, 2, or 3,
    wherein
    A is a 5- to 10-membered monocyclic or bicyclic heteroaryl or a C.sub.6-C.sub.10 monocyclic or bicyclic aryl;
    B is a 5-membered heteroaryl, a 7-10 membered monocyclic or bicyclic heteroaryl, or a C.sub.6-C.sub.10 monocyclic or bicyclic aryl;
    wherein
    at least one R.sup.6 is ortho to the bond connecting the B ring to the NH(CO) group of Formula AA;
    R.sup.1 and R.sup.2 are each independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO—C.sub.6-C.sub.10 aryl; CO (5- to 10-membered heteroaryl); CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.2-C.sub.6 alkynyl, NHCOOCC.sub.1-C.sub.6 alkyl, NH—(C═NR.sup.13)NR.sup.11R.sup.12, CONR.sup.8R.sup.9, SF.sub.5, SC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, S(O)C.sub.1-C.sub.6 alkyl, S(O.sub.2)NR.sup.11R.sup.12, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl,
    wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10 COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; [0078] wherein each C.sub.1-C.sub.6 alkyl substituent and each C.sub.1-C.sub.6 alkoxy substituent of the R.sup.1 or R.sup.2 C.sub.3-C.sub.7 cycloalkyl or of the R.sup.1 or R.sup.2 3- to 7-membered heterocycloalkyl is further optionally independently substituted with one to three hydroxy, halo, NR.sup.8R.sup.9, or oxo; [0079] wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl) and NHCO (3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
    or at least one pair of R.sup.1 and R.sup.2 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.8 carbocyclic ring or at least one 5- to 8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9 wherein the C.sub.1-C.sub.6 alkyl and C.sub.1-C.sub.6 alkoxy are optionally substituted with hydroxy, halo, oxo, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9;
    R.sup.6 and R.sup.7 are each independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.10 cycloalkyl and 3- to 10-membered heterocycloalkyl, and a C.sub.2-C.sub.6 alkenyl,
    wherein R.sup.6 and R.sup.7 are each optionally substituted with one or more substituents independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.2-C.sub.6 alkynyl, C.sub.6-C.sub.10 aryloxy, and S(O.sub.2)C.sub.1-C.sub.6 alkyl; and wherein the C.sub.1-C.sub.6 alkyl or C.sub.1-C.sub.6 alkoxy that R.sup.6 or R.sup.7 is substituted with is optionally substituted with one or more hydroxyl, C.sub.6-C.sub.10 aryl or NR.sup.8R.sup.9, or wherein R.sup.6 or R.sup.7 is optionally fused to a five- to -seven-membered carbocyclic ring or heterocyclic ring containing one or two heteroatoms independently selected from oxygen, sulfur and nitrogen; [0080] wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl) and NHCO (3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
    or at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.8 carbocyclic ring or at least one 5- to 8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, hydroxymethyl, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, CH.sub.2NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9;
    each of R.sup.4 and R.sup.5 is independently selected from hydrogen and C.sub.1-C.sub.6 alkyl;
    R.sup.10 is C.sub.1-C.sub.6 alkyl;
    each of R.sup.8 and R.sup.9 at each occurrence is independently selected from hydrogen, C.sub.1-C.sub.6 alkyl, (C═NR.sup.13)NR.sup.11R.sup.12, S(O.sub.2)C.sub.1-C.sub.6 alkyl, S(O.sub.2)NR.sup.11R.sup.12, COR.sup.13, CO.sub.2R.sup.13 and CONR.sup.11R.sup.12; wherein the C.sub.1-C.sub.6 alkyl is optionally substituted with one or more hydroxy, halo, C.sub.1-C.sub.6 alkoxy, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.7 cycloalkyl or 3- to 7-membered heterocycloalkyl; or
    R.sup.8 and R.sup.9 taken together with the nitrogen they are attached to form a 3- to 7-membered ring optionally containing one or more heteroatoms in addition to the nitrogen they are attached to;
    R.sup.13 is C.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, or 5- to 10-membered heteroaryl;
    each of R.sup.11 and R.sup.12 at each occurrence is independently selected from hydrogen and C.sub.1-C.sub.6 alkyl;
    R.sup.3 is selected from hydrogen, cyano, hydroxy, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 alkyl, and

    ##STR00025##

    wherein the C.sub.1-C.sub.2 alkylene group is optionally substituted by oxo; and
    R.sup.14 is hydrogen, C.sub.1-C.sub.6 alkyl, 5- to 10-membered monocyclic or bicyclic heteroaryl or C.sub.6-C.sub.10 monocyclic or bicyclic aryl, wherein each C.sub.1-C.sub.6 alkyl, aryl or heteroaryl is optionally independently substituted with 1 or 2 R.sup.6;
    or a pharmaceutically acceptable salt thereof.

    [0081] In some embodiments the variables shown in the formulae herein are as follows:

    The Variables m and n

    [0082] In some embodiments m=0, 1, or 2.

    [0083] In some embodiments m=0 or 1.

    [0084] In some embodiments m=1 or 2.

    [0085] In some embodiments m=0 or 2.

    [0086] In some embodiments m=0.

    [0087] In some embodiments m=1.

    [0088] In some embodiments m=2.

    [0089] In some embodiments n=0, 1, or 2.

    [0090] In some embodiments n=0 or 1.

    [0091] In some embodiments n=1 or 2.

    [0092] In some embodiments n=0 or 2.

    [0093] In some embodiments n=0.

    [0094] In some embodiments n=1.

    [0095] In some embodiments n=2.

    [0096] In some embodiments, m=0 and n=0.

    [0097] In some embodiments, m=1 and n=0.

    [0098] In some embodiments, m=1 and n=1.

    The Ring a and Substitutions on the Ring A

    [0099] In some embodiments, A is a 5- to 10-membered (e.g., 5- to 6-membered) monocyclic or bicyclic heteroaryl or a C.sub.6-C.sub.10 (e.g., C.sub.6) monocyclic or bicyclic aryl, such as phenyl.

    [0100] In some embodiments, A is a 5- to 10-membered (e.g., 5- to 6-membered) monocyclic or bicyclic heteroaryl.

    [0101] In some embodiments, A is a 5-membered heteroaryl containing a sulfur and optionally one or more nitrogens.

    [0102] In some embodiments, A is a C.sub.6-C.sub.10 monocyclic or bicyclic aryl.

    [0103] In some embodiments, A is phenyl optionally substituted with 1 or 2 R.sup.1 and optionally substituted with 1 or 2 R.sup.2.

    [0104] In some embodiments, A is naphthyl optionally substituted with 1 or 2 R.sup.1 and optionally substituted with 1 or 2 R.sup.2.

    [0105] In some embodiments, A is furanyl optionally substituted with 1 or 2 R.sup.1 and optionally substituted with 1 R.sup.2.

    [0106] In some embodiments, A is furanyl optionally substituted with 1 R.sup.1 and optionally substituted with 1 or 2 R.sup.2.

    [0107] In some embodiments, A is thiophenyl optionally substituted with 1 or 2 R.sup.1 and optionally substituted with 1 or 2 R.sup.2.

    [0108] In some embodiments, A is oxazolyl optionally substituted with 1 or 2 R.sup.1 and optionally substituted with 1 or 2 R.sup.2.

    [0109] In some embodiments, A is thiazolyl optionally substituted with 1 or 2 R.sup.1 and optionally substituted with 1 or 2 R.sup.2.

    [0110] In some embodiments, A is oxazolyl optionally substituted with 2 R.sup.1 or optionally substituted with 2 R.sup.2.

    [0111] In some embodiments, A is thiazolyl optionally substituted with 2 R.sup.1 or optionally substituted with 2 R.sup.2.

    [0112] In some embodiments, A is pyrazolyl optionally substituted with 1 or 2 R.sup.1 and optionally substituted with 1 or 2 R.sup.2.

    [0113] In some embodiments, A is pyrazolyl optionally substituted with 1 R.sup.1 and optionally substituted with 1 or 2 R.sup.2.

    [0114] In some embodiments, A is pyrazolyl optionally substituted with 1 or 2 R.sup.1 and optionally substituted with 1 R.sup.2.

    [0115] In some embodiments, A is pyridyl optionally substituted with 1 or 2 R.sup.1 and optionally substituted with 1 or 2 R.sup.2.

    [0116] In some embodiments, A is indazolyl optionally substituted with 1 or 2 R.sup.1 and optionally substituted with 1 or 2 R.sup.2.

    [0117] In some embodiments, A is phenyl substituted with 1 R.sup.1 and optionally substituted with 1 R.sup.2.

    [0118] In some embodiments, A is naphthyl substituted with 1 R.sup.1 and optionally substituted with 1 R.sup.2. In some embodiments, A is furanyl substituted with 1 R.sup.1 and optionally substituted with 1 R.sup.2. In some embodiments, A is thiophenyl substituted with 1 R.sup.1 and optionally substituted with 1 R.sup.2.

    [0119] In some embodiments, A is oxazolyl substituted with 1 R.sup.1 and optionally substituted with 1 R.sup.2.

    [0120] In some embodiments, A is thiazolyl substituted with 1 R.sup.1 and optionally substituted with 1 R.sup.2.

    [0121] In some embodiments, A is pyrazolyl substituted with 1 R.sup.1 and optionally substituted with 1 R.sup.2.

    [0122] In some embodiments, A is pyridyl substituted with 1 R.sup.1 and optionally substituted with 1 R.sup.2.

    [0123] In some embodiments, A is indazolyl optionally substituted with 1 R.sup.1 and optionally substituted with 1 R.sup.2.

    [0124] In some embodiments, A is phenyl substituted with 1 R.sup.1 and substituted with 1 R.sup.2.

    [0125] In some embodiments, A is furanyl substituted with 1 R.sup.1 and substituted with 1 R.sup.2.

    [0126] In some embodiments, A is thiophenyl substituted with 1 R.sup.1 and substituted with 1 R.sup.2.

    [0127] In some embodiments, A is oxazolyl substituted with 1 R.sup.1 and substituted with 1 R.sup.2.

    [0128] In some embodiments, A is thiazolyl substituted with 1 R.sup.1 and substituted with 1 R.sup.2.

    [0129] In some embodiments, A is pyrazolyl substituted with 1 R.sup.1 and substituted with 1 R.sup.2.

    [0130] In some embodiments, A is pyridyl substituted with 1 R.sup.1 and substituted with 1 R.sup.2.

    [0131] In some embodiments, A is phenyl, m is 0 or 1, and n is 0, 1, or 2.

    [0132] In some embodiments, A is furanyl, m is 0 or 1, and n is 0, 1, or 2.

    [0133] In some embodiments, A is thiophenyl, m is 0 or 1, and n is 0, 1, or 2.

    [0134] In some embodiments, A is oxazolyl, m is 0 or 1, and n is 0, 1, or 2.

    [0135] In some embodiments, A is thiazolyl, m is 0 or 1, and n is 0, 1, or 2.

    [0136] In some embodiments, A is pyrazolyl, m is 0 or 1, and n is 0, 1, or 2.

    [0137] In some embodiments, A is pyridyl, m is 0 or 1, and n is 0, 1, or 2.

    [0138] In some embodiments, A is indazolyl, m is 0 or 1, and n is 0, 1, or 2.

    [0139] In some embodiments, A is phenyl, m is 0, and n is 0 or 1.

    [0140] In some embodiments, A is furanyl, m is 0, and n is 0 or 1.

    [0141] In some embodiments, A is thiophenyl, m is 0, and n is 0 or 1.

    [0142] In some embodiments, A is oxazolyl, m is 0, and n is 0 or 1.

    [0143] In some embodiments, A is thiazolyl, m is 0, and n is 0 or 1.

    [0144] In some embodiments, A is pyrazolyl, m is 0, and n is 0 or 1.

    [0145] In some embodiments, A is pyridyl, m is 0, and n is 0 or 1.

    [0146] In some embodiments, A is one of the rings disclosed hereinbelow optionally substituted as disclosed hereinbelow, wherein in each case the bond that is shown as being broken by the wavy line custom-character connects A to the S(O)(NR.sup.3R.sup.3)═N moiety of Formula AA.

    [0147] In some embodiments, the optionally substituted ring A

    ##STR00026##

    [0148] In some embodiments, the optionally substituted ring A is

    ##STR00027##

    [0149] In some embodiments, the optionally substituted ring A is

    ##STR00028##

    [0150] In some embodiments, the optionally substituted ring A is

    ##STR00029##

    [0151] In some embodiments, the optionally substituted ring A is

    ##STR00030##

    [0152] In some embodiments, the optionally substituted ring A is

    ##STR00031##

    [0153] In some embodiments, the optionally substituted ring A is

    ##STR00032##

    [0154] In some embodiments, the optionally substituted ring A is

    ##STR00033##

    [0155] In some embodiments, the optionally substituted ring A is

    ##STR00034##

    [0156] In some embodiments, the optionally substituted ring A is

    ##STR00035##

    [0157] In some embodiments, the optionally substituted ring A is

    ##STR00036##

    [0158] In some embodiments, the optionally substituted ring A is

    ##STR00037##

    [0159] In some embodiments, the optionally substituted ring A is

    ##STR00038##

    [0160] In some embodiments, the optionally substituted ring A is

    ##STR00039##

    [0161] In some embodiments, the optionally substituted ring A is

    ##STR00040##

    [0162] In some embodiments, the optionally substituted ring A is

    ##STR00041##

    [0163] In some embodiments, the optionally substituted ring A is

    ##STR00042##

    [0164] In some embodiments, the optionally substituted ring A is

    ##STR00043##

    [0165] In some embodiments, the optionally substituted ring A is

    ##STR00044##

    [0166] In some embodiments, the optionally substituted ring A is

    ##STR00045##

    [0167] In some embodiments, the optionally substituted ring A is

    ##STR00046##

    [0168] In some embodiments, the optionally substituted ring A is

    ##STR00047##

    [0169] In some embodiments, the optionally substituted ring A is

    ##STR00048##

    [0170] In some embodiments, the optionally substituted ring A is

    ##STR00049##

    [0171] In some embodiments, the optionally substituted ring A is

    ##STR00050##

    [0172] In some embodiments, the optionally substituted ring A is

    ##STR00051##

    [0173] In some embodiments, the optionally substituted ring A is

    ##STR00052##

    [0174] In some embodiments, the optionally substituted ring A is

    ##STR00053##

    [0175] In some embodiments, the optionally substituted ring A is

    ##STR00054##

    [0176] In some embodiments, the optionally substituted ring A is

    ##STR00055##

    [0177] In some embodiments, the optionally substituted ring A is

    ##STR00056##

    [0178] In some embodiments, the optionally substituted ring A is

    ##STR00057##

    [0179] In some embodiments, the optionally substituted ring A is

    ##STR00058##

    [0180] In some embodiments, the optionally substituted ring A is

    ##STR00059##

    [0181] In some embodiments, the optionally substituted ring A is

    ##STR00060##

    [0182] In some embodiments, the optionally substituted ring A is

    ##STR00061##

    [0183] In some embodiments, the optionally substituted ring A is

    ##STR00062##

    [0184] In some embodiments, the optionally substituted ring A is

    ##STR00063##

    [0185] In some embodiments, the optionally substituted ring A is

    ##STR00064##

    [0186] In some embodiments, the optionally substituted ring A is

    ##STR00065##

    [0187] In some embodiments, the optionally substituted ring A is

    ##STR00066##

    [0188] In some embodiments, the optionally substituted ring A is

    ##STR00067##

    [0189] In some embodiments, the optionally substituted ring A is

    ##STR00068##

    [0190] In some embodiments, the optionally substituted ring A is

    ##STR00069##

    [0191] In some embodiments, the optionally substituted ring A is

    ##STR00070##

    [0192] In some embodiments, the optionally substituted ring A is

    ##STR00071##

    [0193] In some embodiments, the optionally substituted ring A is

    ##STR00072##

    [0194] In some embodiments, the optionally substituted ring A is

    ##STR00073##

    [0195] In some embodiments, the optionally substituted ring A is

    ##STR00074##

    [0196] In some embodiments, the optionally substituted ring A is

    ##STR00075##

    [0197] In some embodiments, the optionally substituted ring A is

    ##STR00076##

    [0198] In some embodiments, the optionally substituted ring A is

    ##STR00077##

    [0199] In some embodiments, the optionally substituted ring A is

    ##STR00078##

    [0200] In some embodiments, the optionally substituted ring A is

    ##STR00079##

    [0201] In some embodiments, the optionally substituted ring A is

    ##STR00080##

    [0202] In some embodiments, the optionally substituted ring A is

    ##STR00081##

    [0203] In some embodiments, the optionally substituted ring A is

    ##STR00082##

    [0204] In some embodiments, the optionally substituted ring A is

    ##STR00083##

    [0205] In some embodiments, the optionally substituted ring A is

    ##STR00084##

    [0206] In some embodiments, the optionally substituted ring A is

    ##STR00085##

    [0207] In some embodiments, the optionally substituted ring A is

    ##STR00086##

    [0208] In some embodiments, the optionally substituted ring A is

    ##STR00087##

    [0209] In some embodiments, the optionally substituted ring A is

    ##STR00088##

    [0210] In some embodiments, the optionally substituted ring A is

    ##STR00089##

    [0211] In some embodiments, the optionally substituted ring A is

    ##STR00090##

    [0212] In some embodiments, the optionally substituted ring A is

    ##STR00091##

    [0213] In some embodiments, the optionally substituted ring A is

    ##STR00092##

    [0214] In some embodiments, the optionally substituted ring A is

    ##STR00093##

    [0215] In some embodiments, the optionally substituted ring A is

    ##STR00094##

    [0216] In some embodiments, the optionally substituted ring A is

    ##STR00095##

    [0217] In some embodiments, the optionally substituted ring A is

    ##STR00096##

    [0218] In some embodiments, the optionally substituted ring A is

    ##STR00097##

    [0219] In some embodiments, the optionally substituted ring A is

    ##STR00098##

    [0220] In some embodiments, the optionally substituted ring A is

    ##STR00099##

    [0221] In some embodiments, the optionally substituted ring A is

    ##STR00100##

    [0222] In some embodiments, the optionally substituted ring A is

    ##STR00101##

    [0223] In some embodiments, the optionally substituted ring A is

    ##STR00102##

    [0224] In some embodiments, the optionally substituted ring A is

    ##STR00103##

    [0225] In some embodiments, the optionally substituted ring A is

    ##STR00104##

    [0226] In some embodiments, the optionally substituted ring A is

    ##STR00105##

    [0227] In some embodiments, the optionally substituted ring A is

    ##STR00106##

    The Groups R.sup.1 and R.sup.2

    [0228] In some embodiments,

    R.sup.1 and R.sup.2 are each independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO—C.sub.6-C.sub.10 aryl, CO (5- to 10-membered heteroaryl), CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SF.sub.5, SC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, S(O.sub.2)NR.sup.11R.sup.12, S(O)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl,
    wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10 COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), and OCO (3- to 7-membered heterocycloalkyl); [0229] wherein each C.sub.1-C.sub.6 alkyl substituent and each C.sub.1-C.sub.6 alkoxy substituent of the R.sup.1 or R.sup.2 C.sub.3-C.sub.7 cycloalkyl or of the R.sup.1 or R.sup.2 3- to 7-membered heterocycloalkyl is further optionally independently substituted with one to three hydroxy, halo, NR.sup.8R.sup.9, or oxo; [0230] wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, and 5- to 10-membered heteroaryl are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
    or at least one pair of R.sup.1 and R.sup.2 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.8 carbocyclic ring or at least one 5- to-8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9;

    [0231] In some embodiments,

    R.sup.1 and R.sup.2 are each independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO—C.sub.6-C.sub.10 aryl; CO (5- to 10-membered heteroaryl); CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SF.sub.5, SC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, S(O.sub.2)NR.sup.11R.sup.12, S(O)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl,
    wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; [0232] wherein each C.sub.1-C.sub.6 alkyl substituent and each C.sub.1-C.sub.6 alkoxy substituent of the R.sup.1 or R.sup.2 C.sub.3-C.sub.7 cycloalkyl or of the R.sup.1 or R.sup.2 3- to 7-membered heterocycloalkyl is further optionally independently substituted with one to three hydroxy, halo, NR.sup.8R.sup.9, or oxo; [0233] wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl) and NHCO (3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
    or at least one pair of R.sup.1 and R.sup.2 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.8 carbocyclic ring or at least one 5- to 8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9;

    [0234] In some embodiments,

    R.sup.1 and R.sup.2 are each independently selected from C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO—C.sub.6-C.sub.10 aryl, CO (5- to 10-membered heteroaryl), CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SF.sub.5, SC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, S(O.sub.2)NR.sup.11R.sup.12, S(O)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl,
    wherein the C.sub.3-C.sub.7 cycloalkyl, C.sub.1-C.sub.6 haloalkyl, and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; [0235] wherein each C.sub.1-C.sub.6 alkyl substituent and each C.sub.1-C.sub.6 alkoxy substituent of the R.sup.1 or R.sup.2 C.sub.3-C.sub.7 cycloalkyl or of the R.sup.1 or R.sup.2 3- to 7-membered heterocycloalkyl is further optionally independently substituted with one to three hydroxy, halo, NR.sup.8R.sup.9, or oxo; [0236] wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl) and NHCO (3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
    or at least one pair of R.sup.1 and R.sup.2 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.8 carbocyclic ring or at least one 5- to 8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.

    [0237] In some embodiments,

    R.sup.1 and R.sup.2 are each independently selected from C.sub.1-C.sub.6 alkyl, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO—C.sub.6-C.sub.10 aryl, CO (5- to 10-membered heteroaryl), CO.sub.2C.sub.1-C.sub.6 alkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SF.sub.5, SC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, S(O.sub.2)NR.sup.11R.sup.12, S(O)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl,
    wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; [0238] wherein each C.sub.1-C.sub.6 alkyl substituent and each C.sub.1-C.sub.6 alkoxy substituent of the R.sup.1 or R.sup.2 C.sub.3-C.sub.7 cycloalkyl or of the R.sup.1 or R.sup.2 3- to 7-membered heterocycloalkyl is further optionally independently substituted with one to three hydroxy, halo, NR.sup.8R.sup.9, or oxo; [0239] wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl) and NHCO (3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
    or at least one pair of R.sup.1 and R.sup.2 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.8 carbocyclic ring or at least one 5- to 8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.

    [0240] In some embodiments,

    R.sup.1 and R.sup.2 are each independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO—C.sub.6-C.sub.10 aryl, CO (5- to 10-membered heteroaryl), CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SF.sub.5, SC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, S(O.sub.2)NR.sup.11R.sup.12, S(O)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl,
    wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; [0241] wherein each C.sub.1-C.sub.6 alkyl substituent and each C.sub.1-C.sub.6 alkoxy substituent of the R.sup.1 or R.sup.2 C.sub.3-C.sub.7 cycloalkyl or of the R.sup.1 or R.sup.2 3- to 7-membered heterocycloalkyl is further optionally independently substituted with one to three hydroxy, halo, or oxo; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl) and NHCO (3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
    or at least one pair of R.sup.1 and R.sup.2 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.8 carbocyclic ring or at least one 5- to-8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.

    [0242] In some embodiments,

    R.sup.1 and R.sup.2 are each independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO—C.sub.6-C.sub.10 aryl, CO (5- to 10-membered heteroaryl), CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SF.sub.5, SC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, S(O.sub.2)NR.sup.11R.sup.12, S(O)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl,
    wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; [0243] wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl) and NHCO (3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl.

    [0244] In some embodiments,

    R.sup.1 and R.sup.2 are each independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO—C.sub.6-C.sub.10 aryl, CO (5- to 10-membered heteroaryl), CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SF.sub.5, SC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, S(O.sub.2)NR.sup.11R.sup.12, S(O)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl,
    wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl are each unsubstituted;
    or at least one pair of R.sup.1 and R.sup.2 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.8 carbocyclic ring or at least one 5- to-8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9;

    [0245] In some embodiments,

    R.sup.1 and R.sup.2 are each independently selected from C.sub.1-C.sub.6 alkyl, halo, CN, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, S(O)C.sub.1-C.sub.6 alkyl, 5- to 10-membered heteroaryl, and 3- to 7-membered heterocycloalkyl,
    wherein the C.sub.1-C.sub.6 alkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy and oxo.

    [0246] In some embodiments, m=1; n=0; and

    R.sup.1 is selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO—C.sub.6-C.sub.10 aryl, CO (5- to 10-membered heteroaryl), CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SF.sub.5, SC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, S(O.sub.2)NR.sup.11R.sup.12, S(O)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl,
    wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; [0247] wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl) and NHCO (3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl.

    [0248] In some embodiments, m=1; n=0; and,

    R.sup.1 is selected from C.sub.1-C.sub.6 alkyl, halo, CN, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, S(O)C.sub.1-C.sub.6 alkyl, and 3- to 7-membered heterocycloalkyl, wherein the C.sub.1-C.sub.6 alkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy and oxo.

    [0249] In some embodiments, m=1; n=1; and

    R.sup.1 and R.sup.2 are each independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO—C.sub.6-C.sub.10 aryl, CO (5- to 10-membered heteroaryl), CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SF.sub.5, SC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, S(O.sub.2)NR.sup.11R.sup.12, S(O)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl,
    wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl) and NHCO (3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;

    [0250] In some embodiments, m=1; n=1; and,

    R.sup.1 and R.sup.2 are each independently selected from C.sub.1-C.sub.6 alkyl, halo, CN, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, S(O)C.sub.1-C.sub.6 alkyl, and 3- to 7-membered heterocycloalkyl,
    wherein the C.sub.1-C.sub.6 alkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy and oxo.

    [0251] In some embodiments, m=1; n=1; and

    R.sup.1 and R.sup.2 are on adjacent atoms, and taken together with the atoms connecting them, form a C.sub.4-C.sub.8 carbocyclic ring or a 5- to-8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.

    [0252] In some embodiments, m=1; n=1; and

    R.sup.1 and R.sup.2 are on adjacent atoms, and taken together with the atoms connecting them, form a C.sub.6 carbocyclic ring or a 5-to-6-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, NR.sup.10 COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.

    [0253] In some embodiments, m=1; n=1; and

    R.sup.1 and R.sup.2 are on adjacent atoms, and taken together with the atoms connecting them, form a C.sub.5 carbocyclic ring or a 5- to-6-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.

    [0254] In some embodiments, m=1; n=1; and

    R.sup.1 and R.sup.2 are on adjacent atoms, and taken together with the atoms connecting them, form a C.sub.4-C.sub.8 carbocyclic ring or a 5- to 8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is unsubstituted.

    [0255] Particular embodiments wherein m=1 and n=0:

    [0256] In some embodiments, R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy.

    [0257] In some embodiments, R.sup.1 is 1-hydroxy-2-methylpropan-2-yl.

    [0258] In some embodiments, R.sup.1 is 2-hydroxyethyl.

    [0259] In some embodiments, R.sup.1 is C.sub.1-C.sub.6 alkyl.

    [0260] In some embodiments, R.sup.1 is methyl.

    [0261] In some embodiments, R.sup.1 is isopropyl.

    [0262] In some embodiments, R.sup.1 is isopropyl.

    [0263] In some embodiments, R.sup.1 is C.sub.1-C.sub.6 alkyl substituted with hydroxy at the carbon directly connected to ring A.

    [0264] In some embodiments, R.sup.1 is 2-hydroxy-2-propyl.

    [0265] In some embodiments, R.sup.1 is hydroxymethyl.

    [0266] In some embodiments, R.sup.1 is 1-hydroxyethyl.

    [0267] In some embodiments, R.sup.1 is 1-hydroxy-2-propyl.

    [0268] In some embodiments, R.sup.1 is C.sub.1-C.sub.6 alkyl substituted with two or more hydroxy groups.

    [0269] In some embodiments, R.sup.1 is C.sub.1-C.sub.6 alkyl substituted with two or more hydroxy groups, wherein one of the two or more hydroxy groups is bonded to the carbon directly connected to ring A.

    [0270] In some embodiments, R.sup.1 is 1,2-dihydroxy-prop-2-yl.

    [0271] In some embodiments, R.sup.1 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy.

    [0272] In some embodiments, R.sup.1 is C.sub.3-C.sub.7 cycloalkyl.

    [0273] In some embodiments, R.sup.1 is C.sub.3-C.sub.7 cycloalkyl substituted with hydroxy at the carbon directly connected to ring A.

    [0274] In some embodiments, R.sup.1 is 1-hydroxy-1-cyclopropyl.

    [0275] In some embodiments, R.sup.1 is 1-hydroxy-1-cyclobutyl.

    [0276] In some embodiments, R.sup.1 is 1-hydroxy-1-cyclopentyl.

    [0277] In some embodiments, R.sup.1 is 1-hydroxy-1-cyclohexyl.

    [0278] In some embodiments, R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy.

    [0279] In some embodiments, R.sup.1 is 3- to 7-membered heterocycloalkyl.

    [0280] In some embodiments, R.sup.1 is morpholinyl (e.g., 1-morpholinyl).

    [0281] In some embodiments, R.sup.1 is 1,3-dioxolan-2-yl.

    [0282] In some embodiments, R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more C.sub.1-C.sub.6 alkyl.

    [0283] In some embodiments, R.sup.1 is 1-methylpyrrolidin-2-yl.

    [0284] In some embodiments, R.sup.1 is 3- to 7-membered heterocycloalkyl substituted with hydroxy at the carbon directly connected to ring A.

    [0285] In some embodiments, R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo.

    [0286] In some embodiments, R.sup.1 is COCH.sub.3.

    [0287] In some embodiments, R.sup.1 is COCH.sub.2CH.sub.3.

    [0288] In some embodiments, R.sup.1 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more oxo.

    [0289] In some embodiments, R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more oxo.

    [0290] In some embodiments, R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy.

    [0291] In some embodiments, R.sup.1 is 2-methoxy-2-propyl.

    [0292] In some embodiments, R.sup.1 is methoxymethyl.

    [0293] In some embodiments, R.sup.1 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy.

    [0294] In some embodiments, R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy.

    [0295] In some embodiments, R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9.

    [0296] In some embodiments, R.sup.1 is C.sub.1-C.sub.6 alkyl substituted with NR.sup.8R.sup.9 at the carbon directly connected to ring A.

    [0297] In some embodiments, R.sup.1 is (methylamino)methyl.

    [0298] In some embodiments, R.sup.1 is (dimethylamino)methyl.

    [0299] In some embodiments, R.sup.1 is aminomethyl.

    [0300] In some embodiments, R.sup.1 is N-methylacetamidomethyl.

    [0301] In some embodiments, R.sup.1 is 1-(dimethylamino)eth-1-yl.

    [0302] In some embodiments, R.sup.1 is 2-(dimethylamino)prop-2-yl.

    [0303] In some embodiments, R.sup.1 is (2-methoxy-eth-1-yl)(methyl)aminomethyl.

    [0304] In some embodiments, R.sup.1 is (methyl)(acetyl)aminomethyl.

    [0305] In some embodiments, R.sup.1 is (methyl)(cyclopropylmethyl)aminomethyl.

    [0306] In some embodiments, R.sup.1 is (methyl)(2,2-difluoroeth-1-yl)aminomethyl.

    [0307] In some embodiments, R.sup.1 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more NR.sup.8R.sup.9.

    [0308] In some embodiments, R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more NR.sup.8R.sup.9.

    [0309] In some embodiments, R.sup.1 is C.sub.1-C.sub.6 haloalkyl optionally substituted with one or more hydroxy.

    [0310] In some embodiments, R.sup.1 is C.sub.1-C.sub.6 alkoxy.

    [0311] In some embodiments, R.sup.1 is C.sub.1-C.sub.6 haloalkoxy.

    [0312] In some embodiments, R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with 3- to 7-membered heterocycloalkyl, wherein the 3- to 7-membered heterocycloalkyl is further optionally substituted as defined elsewhere herein.

    [0313] In some embodiments, R.sup.1 is pyrrolidinylmethyl (e.g., pyrrolidin-1-ylmethyl).

    [0314] In some embodiments, R.sup.1 is optionally substituted pyrrolidinylmethyl (e.g., 3,3-difluoropyrrolidin-1-ylmethyl).

    [0315] In some embodiments, R.sup.1 is azetidinylmethyl (e.g., azetidin-1-ylmethyl).

    [0316] In some embodiments, R.sup.1 is optionally substituted azetidinylmethyl (e.g., 3-methoxyazetidin-1-ylmethyl).

    [0317] In some embodiments, R.sup.1 is morpholinylmethyl (e.g., morpholin-4-ylmethyl).

    [0318] In some embodiments, R.sup.1 is halo.

    [0319] In some embodiments, R.sup.1 is fluoro.

    [0320] In some embodiments, R.sup.1 is chloro.

    [0321] In some embodiments, R.sup.1 is CN.

    [0322] In some embodiments, R.sup.1 is NO.sub.2

    [0323] In some embodiments, R.sup.1 is COC.sub.1-C.sub.6 alkyl.

    [0324] In some embodiments, R.sup.1 is CO—C.sub.6-C.sub.10 aryl.

    [0325] In some embodiments, R.sup.1 is CO (5- to 10-membered heteroaryl).

    [0326] In some embodiments, R.sup.1 is CO.sub.2C.sub.1-C.sub.6 alkyl.

    [0327] In some embodiments, R.sup.1 is CO.sub.2C.sub.3-C.sub.8 cycloalkyl.

    [0328] In some embodiments, R.sup.1 is OCOC.sub.1-C.sub.6 alkyl.

    [0329] In some embodiments, R.sup.1 is OCOC.sub.6-C.sub.10 aryl.

    [0330] In some embodiments, R.sup.1 is OCO (5- to 10-membered heteroaryl).

    [0331] In some embodiments, R.sup.1 is OCO (3- to 7-membered heterocycloalkyl).

    [0332] In some embodiments, R.sup.1 is C.sub.6-C.sub.10 aryl.

    [0333] In some embodiments, R.sup.1 is phenyl.

    [0334] In some embodiments, R.sup.1 is 5- to 10-membered heteroaryl.

    [0335] In some embodiments, R.sup.1 is pyridyl (e.g., 4-pyridyl).

    [0336] In some embodiments, R.sup.1 is pyrazolyl (e.g., 1-pyrazolyl).

    [0337] In some embodiments, R.sup.1 is NH.sub.2.

    [0338] In some embodiments, R.sup.1 is NHC.sub.1-C.sub.6 alkyl.

    [0339] In some embodiments, R.sup.1 is N(C.sub.1-C.sub.6 alkyl).sub.2.

    [0340] In some embodiments, R.sup.1 is CONR.sup.8R.sup.9.

    [0341] In some embodiments, R.sup.1 is SF.sub.5.

    [0342] In some embodiments, R.sup.1 is SC.sub.1-C.sub.6 alkyl,

    [0343] In some embodiments, R.sup.1 is S(O.sub.2)C.sub.1-C.sub.6 alkyl.

    [0344] In some embodiments, R.sup.1 is S(O.sub.2)CH.sub.3.

    [0345] In some embodiments, R.sup.1 is S(O.sub.2)NR.sup.11R.sup.12.

    [0346] In some embodiments, R.sup.1 is S(O.sub.2)N(CH.sub.3).sub.2.

    [0347] In some embodiments, R.sup.1 is S(O)C.sub.1-C.sub.6 alkyl.

    [0348] In some embodiments, R.sup.1 is S(O)CH.sub.3.

    [0349] In some embodiments, R.sup.1 is attached to a carbon of an aryl ring A.

    [0350] In some embodiments, R.sup.1 is attached to a carbon of a heteroaryl ring A.

    [0351] In some embodiments, R.sup.1 is attached to a nitrogen of a heteroaryl ring A.

    Particular Embodiments Wherein m=1 and n=1:

    [0352] In some embodiments, R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy.

    [0353] In some embodiments, R.sup.1 is 1-hydroxy-2-methylpropan-2-yl, and R.sup.2 is methyl.

    [0354] In some embodiments, R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is methyl.

    [0355] In some embodiments, R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is isopropyl.

    [0356] In some embodiments, R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is 2-hydroxy-2-propyl.

    [0357] In some embodiments, R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is 1-hydroxyethyl.

    [0358] In some embodiments, R.sup.1 is hydroxymethyl and R.sup.2 is methyl.

    [0359] In some embodiments, R.sup.1 is 1-hydroxyethyl and R.sup.2 is methyl.

    [0360] In some embodiments, R.sup.1 is 2-hydroxyethyl and R.sup.2 is methyl.

    [0361] In some embodiments, R.sup.1 is 1-hydroxy-2-propyl and R.sup.2 is methyl.

    [0362] In some embodiments, R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.6-C.sub.10 aryl.

    [0363] In some embodiments, R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is phenyl.

    [0364] In some embodiments, R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is 5- to 10-membered heteroaryl.

    [0365] In some embodiments, R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is pyridyl.

    [0366] In some embodiments, R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is pyrazolyl.

    [0367] In some embodiments, R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is SF.sub.5.

    [0368] In some embodiments, R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is SC.sub.1-C.sub.6 alkyl,

    [0369] In some embodiments, R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is S(O.sub.2)C.sub.1-C.sub.6 alkyl.

    [0370] In some embodiments, R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is S(O.sub.2)CH.sub.3.

    [0371] In some embodiments, R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is halo.

    [0372] In some embodiments, R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is chloro.

    [0373] In some embodiments, R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is fluoro.

    [0374] In some embodiments, R.sup.1 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl.

    [0375] In some embodiments, R.sup.1 is 1-hydroxy-1-cyclopropyl, and R.sup.2 is methyl.

    [0376] In some embodiments, R.sup.1 is 1-hydroxy-1-cyclobutyl, and R.sup.2 is methyl.

    [0377] In some embodiments, R.sup.1 is 1-hydroxy-1-cyclopentyl, and R.sup.2 is methyl.

    [0378] In some embodiments, R.sup.1 is 1-hydroxy-1-cyclohexyl, and R.sup.2 is methyl.

    [0379] In some embodiments, R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl.

    [0380] In some embodiments, R.sup.1 is morpholinyl, and R.sup.2 is methyl.

    [0381] In some embodiments, R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is methyl.

    [0382] In some embodiments, R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is halo.

    [0383] In some embodiments, R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is fluoro.

    [0384] In some embodiments, R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is chloro.

    [0385] In some embodiments, R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.2 is methyl.

    [0386] In some embodiments, R.sup.1 is COCH.sub.3, and R.sup.2 is methyl.

    [0387] In some embodiments, R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl.

    [0388] In some embodiments, R.sup.1 is 2-methoxy-2-propyl, and R.sup.2 is methyl.

    [0389] In some embodiments, R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.2 is C.sub.1-C.sub.6 alkyl.

    [0390] In some embodiments, R.sup.1 is (dimethylamino)methyl, and R.sup.2 is methyl.

    [0391] In some embodiments, R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.2 is halo.

    [0392] In some embodiments, R.sup.1 is (dimethylamino)methyl, and R.sup.2 is fluoro.

    [0393] In some embodiments, R.sup.1 is (dimethylamino)methyl, and R.sup.2 is fluoro.

    [0394] In some embodiments, R.sup.1 is (methylamino)methyl, and R.sup.2 is fluoro.

    [0395] In some embodiments, R.sup.1 is aminomethyl, and R.sup.2 is fluoro.

    [0396] In some embodiments, R.sup.1 is C.sub.1-C.sub.6 alkyl, and R.sup.2 is C.sub.1-C.sub.6 alkyl.

    [0397] In some embodiments, R.sup.1 is methyl, and R.sup.2 is methyl.

    [0398] In some embodiments, R.sup.2 is 1-hydroxy-2-methylpropan-2-yl, and R.sup.1 is methyl.

    [0399] In some embodiments, R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is methyl.

    [0400] In some embodiments, R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is isopropyl.

    [0401] In some embodiments, R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is 1-hydroxyethyl.

    [0402] In some embodiments, R.sup.2 is hydroxymethyl and R.sup.1 is methyl.

    [0403] In some embodiments, R.sup.2 is 1-hydroxyethyl and R.sup.1 is methyl.

    [0404] In some embodiments, R.sup.2 is 2-hydroxyethyl and R.sup.1 is methyl.

    [0405] In some embodiments, R.sup.2 is 1-hydroxy-2-propyl and R.sup.1 is methyl.

    [0406] In some embodiments, R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.6-C.sub.10 aryl.

    [0407] In some embodiments, R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is phenyl.

    [0408] In some embodiments, R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is 5- to 10-membered heteroaryl.

    [0409] In some embodiments, R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is pyridyl.

    [0410] In some embodiments, R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is pyrazolyl.

    [0411] In some embodiments, R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is SF.sub.5.

    [0412] In some embodiments, R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is SC.sub.1-C.sub.6 alkyl.

    [0413] In some embodiments, R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is S(O.sub.2)C.sub.1-C.sub.6 alkyl.

    [0414] In some embodiments, R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is S(O.sub.2)CH.sub.3.

    [0415] In some embodiments, R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is halo.

    [0416] In some embodiments, R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is chloro.

    [0417] In some embodiments, R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is fluoro.

    [0418] In some embodiments, R.sup.2 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl.

    [0419] In some embodiments, R.sup.2 is 1-hydroxy-1-cyclopropyl, and R.sup.1 is methyl.

    [0420] In some embodiments, R.sup.2 is 1-hydroxy-1-cyclobutyl, and R.sup.1 is methyl.

    [0421] In some embodiments, R.sup.2 is 1-hydroxy-1-cyclopentyl, and R.sup.1 is methyl.

    [0422] In some embodiments, R.sup.2 is 1-hydroxy-1-cyclohexyl, and R.sup.1 is methyl.

    [0423] In some embodiments, R.sup.2 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl.

    [0424] In some embodiments, R.sup.2 is morpholinyl, and R.sup.1 is methyl.

    [0425] In some embodiments, R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is methyl.

    [0426] In some embodiments, R.sup.2 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is halo.

    [0427] In some embodiments, R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is fluoro.

    [0428] In some embodiments, R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is chloro.

    [0429] In some embodiments, R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.1 is methyl.

    [0430] In some embodiments, R.sup.2 is COCH.sub.3, and R.sup.1 is methyl.

    [0431] In some embodiments, R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl.

    [0432] In some embodiments, R.sup.2 is 2-methoxy-2-propyl, and R.sup.1 is methyl.

    [0433] In some embodiments, R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.1 is C.sub.1-C.sub.6 alkyl.

    [0434] In some embodiments, R.sup.2 is (dimethylamino)methyl, and R.sup.1 is methyl.

    [0435] In some embodiments, R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.1 is halo.

    [0436] In some embodiments, R.sup.2 is (dimethylamino)methyl, and R.sup.1 is fluoro.

    [0437] In some embodiments, R.sup.2 is (methylamino)methyl, and R.sup.1 is fluoro.

    [0438] In some embodiments, R.sup.2 is aminomethyl, and R.sup.1 is fluoro.

    [0439] In some embodiments, R.sup.2 is C.sub.1-C.sub.6 alkoxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9.

    [0440] In some embodiments, R.sup.2 is methoxy, and R.sup.1 is (dimethylamino)methyl.

    [0441] In some embodiments, R.sup.1 and R.sup.2 are each attached to a carbon of an aryl ring A.

    [0442] In some embodiments, R.sup.1 and R.sup.2 are each attached to a carbon of a heteroaryl ring A.

    [0443] In some embodiments, R.sup.1 is attached to a carbon and R.sup.2 is attached to a nitrogen of a heteroaryl ring A.

    [0444] In some embodiments, R.sup.2 is attached to a carbon and R.sup.1 is attached to a nitrogen of a heteroaryl ring A.

    [0445] In some embodiments, R.sup.1 and R.sup.2 are on adjacent atoms, and taken together with the atoms connecting them, form a C.sub.5 carbocyclic ring optionally substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.

    [0446] In some embodiments, R.sup.1 and R.sup.2 are on adjacent atoms, and taken together with the atoms connecting them, form a C.sub.5 aliphatic carbocyclic ring.

    [0447] In some embodiments, R.sup.1 and R.sup.2 are on adjacent atoms, and taken together with the atoms connecting them, form a C.sub.6 carbocyclic ring optionally substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.

    [0448] In some embodiments, R.sup.1 and R.sup.2 are on adjacent atoms, and taken together with the atoms connecting them, form a C.sub.6 aliphatic carbocyclic ring.

    [0449] In some embodiments, R.sup.1 and R.sup.2 are on adjacent atoms, and taken together with the atoms connecting them, form a C.sub.6 aromatic carbocyclic ring.

    [0450] In some embodiments, R.sup.1 and R.sup.2 are on adjacent atoms, and taken together with the atoms connecting them, form a 5-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, optionally substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.

    [0451] In some embodiments, R.sup.1 and R.sup.2 are on adjacent atoms, and taken together with the atoms connecting them, form a 5-membered aliphatic heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S.

    [0452] In some embodiments, R.sup.1 and R.sup.2 are on adjacent atoms, and taken together with the atoms connecting them, form a 5-membered heteroaromatic ring containing 1 or 2 heteroatoms independently selected from O, N, and S.

    [0453] In some embodiments, R.sup.1 and R.sup.2 are on adjacent atoms, and taken together with the atoms connecting them, form a 6-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, optionally substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.

    [0454] In some embodiments, R.sup.1 and R.sup.2 are on adjacent atoms, and taken together with the atoms connecting them, form a 6-membered aliphatic heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S.

    [0455] In some embodiments, R.sup.1 and R.sup.2 are on adjacent atoms, and taken together with the atoms connecting them, form a 6-membered heteroaromatic ring containing 1 or 2 heteroatoms independently selected from O, N, and S.

    [0456] In some embodiments, R.sup.1 and R.sup.2 are different.

    [0457] In some embodiments, R.sup.1 and R.sup.2 are different, and R.sup.2 comprises a carbonyl group.

    [0458] In some embodiments, R.sup.1 and R.sup.2 are different, and R.sup.2 comprises 1 or 2 (e.g., 1) nitrogen atoms.

    [0459] In some embodiments, R.sup.1 and R.sup.2 are different, and R.sup.2 comprises 1 or 2 (e.g., 1) oxygen atoms.

    [0460] In some embodiments, R.sup.1 and R.sup.2 are different, and R.sup.2 comprises a sulfur atom.

    [0461] In some embodiments, R.sup.2 and R.sup.1 are different, and R.sup.2 comprises a carbonyl group.

    [0462] In some embodiments, R.sup.2 and R.sup.1 are different, and R.sup.2 comprises 1 or 2 (e.g., 1) nitrogen atoms.

    [0463] In some embodiments, R.sup.2 and R.sup.1 are different, and R.sup.2 comprises 1 or 2 (e.g., 1) oxygen atoms.

    [0464] In some embodiments, R.sup.2 and R.sup.1 are different, and R.sup.2 comprises a sulfur atom.

    [0465] In some embodiments, R.sup.1 and R.sup.2 are the same.

    [0466] In some embodiments, R.sup.1 is para or meta to R.sup.2.

    [0467] In some embodiments, R.sup.1 is para or ortho to R.sup.2.

    [0468] In some embodiments, R.sup.1 is ortho or meta to R.sup.2. In some embodiments, R.sup.1 is para to R.sup.2.

    [0469] In some embodiments, R.sup.1 is meta to R.sup.2.

    [0470] In some embodiments, R.sup.1 is ortho to R.sup.2.

    The Variables o and p

    [0471] In some embodiments, o=1 or 2.

    [0472] In some embodiments, o=1.

    [0473] In some embodiments, o=2.

    [0474] In some embodiments, p=0, 1, 2, or 3.

    [0475] In some embodiments, p=0.

    [0476] In some embodiments, p=1.

    [0477] In some embodiments, p=2.

    [0478] In some embodiments, o=1 and p=0.

    [0479] In some embodiments, o=2 and p=0.

    [0480] In some embodiments, o=1 and p=1.

    [0481] In some embodiments, o=1 and p=2.

    [0482] In some embodiments, o=2 and p=1.

    [0483] In some embodiments, o=2 and p=2.

    [0484] In some embodiments, o=2 and p=3.

    [0485] The Ring B and Substitutions on the Ring B

    [0486] In some embodiments, B is a 5- to 10-membered monocyclic or bicyclic heteroaryl or a C.sub.6-C.sub.10 monocyclic or bicyclic aryl, such as phenyl.

    [0487] In some embodiments, B is a 5- to 6-membered monocyclic heteroaryl or a C.sub.6 monocyclic aryl.

    [0488] In some embodiments, B is a 5- to 10-membered monocyclic or bicyclic heteroaryl.

    [0489] In some embodiments, B is a C.sub.6-C.sub.10 monocyclic or bicyclic aryl.

    [0490] In some embodiments, B is a 5-membered heteroaryl.

    [0491] In some embodiments, B is a 7-10 membered monocyclic or bicyclic heteroaryl.

    [0492] In some embodiments, B is phenyl substituted with 1 or 2 R.sup.6 and optionally substituted with 1, 2, or 3 R.sup.7.

    [0493] In some embodiments, B is pyridyl substituted with 1 or 2 R.sup.6 and optionally substituted with 1, 2, or 3 R.sup.7.

    [0494] In some embodiments, B is indazolyl substituted with 1 or 2 R.sup.6 and optionally substituted with 1, 2, or 3 R.sup.7.

    [0495] In some embodiments, B is pyrazolyl substituted with 1 or 2 R.sup.6 and optionally substituted with 1 or 2 R.sup.7.

    [0496] In some embodiments, B is phenyl, o is 1 or 2, and p is 0, 1, 2, or 3.

    [0497] In some embodiments, B is phenyl, o is 1, and p is 0, 1, 2, or 3.

    [0498] In some embodiments, B is phenyl, o is 2, and p is 0, 1, 2, or 3.

    [0499] In some embodiments, B is one of the rings disclosed hereinbelow, substituted as disclosed hereinbelow, wherein in each case the bond that is shown as being broken by the wavy line custom-character connects B to the NH(CO) group of Formula AA.

    [0500] In some embodiments, the substituted ring B

    ##STR00107##

    is

    ##STR00108##

    [0501] In some embodiments, the substituted ring B

    ##STR00109##

    is

    ##STR00110##

    [0502] In some embodiments, the substituted ring B is

    ##STR00111##

    [0503] In some embodiments, the substituted ring B is

    ##STR00112##

    [0504] In some embodiments, the substituted ring B is

    ##STR00113##

    [0505] In some embodiments, the substituted ring B is

    ##STR00114##

    [0506] In some embodiments, the substituted ring B is

    ##STR00115##

    [0507] In some embodiments, the substituted ring B is

    ##STR00116##

    [0508] In some embodiments, the substituted ring B is

    ##STR00117##

    [0509] In some embodiments, the substituted ring B is

    ##STR00118##

    [0510] In some embodiments, the substituted ring B is

    ##STR00119##

    [0511] In some embodiments, the substituted ring B is

    ##STR00120##

    [0512] In some embodiments, the substituted ring B is

    ##STR00121##

    [0513] In some embodiments, the substituted ring B is

    ##STR00122##

    [0514] In some embodiments, the substituted ring B is

    ##STR00123##

    [0515] In some embodiments, the substituted ring B is

    ##STR00124##

    [0516] In some embodiments, the substituted ring B is

    ##STR00125##

    [0517] In some embodiments, the substituted ring B is

    ##STR00126##

    [0518] In some embodiments, the substituted ring B is

    ##STR00127##

    [0519] In some embodiments, the substituted ring B is

    ##STR00128##

    [0520] In some embodiments, the substituted ring B is

    ##STR00129##

    [0521] In some embodiments, the substituted ring B is

    ##STR00130##

    [0522] In some embodiments, the substituted ring B is

    ##STR00131##

    [0523] In some embodiments, the substituted ring B is

    ##STR00132##

    [0524] In some embodiments, the substituted ring B is

    ##STR00133##

    [0525] In some embodiments, the substituted ring B is

    ##STR00134##

    [0526] In some embodiments, the substituted ring B is

    ##STR00135##

    [0527] In some embodiments, the substituted ring B is

    ##STR00136##

    [0528] In some embodiments, the substituted ring B is

    ##STR00137##

    [0529] In some embodiments, the substituted ring B is

    ##STR00138##

    [0530] In some embodiments, the substituted ring B is

    ##STR00139##

    [0531] In some embodiments, the substituted ring B is

    ##STR00140##

    [0532] In some embodiments, the substituted ring B is

    ##STR00141##

    [0533] In some embodiments, the substituted ring B is

    ##STR00142##

    [0534] In some embodiments, the substituted ring B is

    ##STR00143##

    [0535] In some embodiments, the substituted ring B is

    ##STR00144##

    [0536] In some embodiments, the substituted ring B is

    ##STR00145##

    [0537] In some embodiments, the substituted ring B is

    ##STR00146##

    [0538] In some embodiments, the substituted ring B is

    ##STR00147##

    [0539] In some embodiments, the substituted ring B is

    ##STR00148##

    [0540] In some embodiments, the substituted ring B is

    ##STR00149##

    [0541] In some embodiments, the substituted ring B is

    ##STR00150##

    [0542] In some embodiments, the substituted ring B is

    ##STR00151##

    [0543] In some embodiments, the substituted ring B is

    ##STR00152##

    [0544] In some embodiments, the substituted ring B is

    ##STR00153##

    [0545] In some embodiments, the substituted ring B is

    ##STR00154##

    [0546] In some embodiments, the substituted ring B is

    ##STR00155##

    [0547] In some embodiments, the substituted ring B is

    ##STR00156##

    [0548] In some embodiments, the substituted ring B is

    ##STR00157##

    [0549] In some embodiments, the substituted ring B is

    ##STR00158##

    [0550] The Groups R.sup.6 and R.sup.7

    [0551] In some embodiments,

    R.sup.6 and R.sup.7 are each independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.10 cycloalkyl and 3- to 10-membered heterocycloalkyl, and a C.sub.2-C.sub.6 alkenyl,
    wherein R.sup.6 and R.sup.7 are each optionally substituted with one or more substituents independently selected from
    hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, NR.sup.10 COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.2-C.sub.6 alkynyl,
    C.sub.6-C.sub.10 aryloxy, and S(O.sub.2)C.sub.1-C.sub.6 alkyl; and wherein the C.sub.1-C.sub.6 alkyl or C.sub.1-C.sub.6 alkoxy that R.sup.6 or R.sup.7 is substituted with is optionally substituted with one or more hydroxyl, C.sub.6-C.sub.10 aryl or NR.sup.8R.sup.9, or wherein R.sup.6 or R.sup.7 is optionally fused to a five- to -seven-membered carbocyclic ring or heterocyclic ring containing one or two heteroatoms independently selected from oxygen, sulfur and nitrogen; [0552] wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl) and NHCO (3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
    or at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.8 carbocyclic ring or at least one 5- to 8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, hydroxymethyl, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, CH.sub.2NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.

    [0553] In some embodiments,

    R.sup.6 and R.sup.7 are each independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.10 cycloalkyl and 3- to 10-membered heterocycloalkyl, and a C.sub.2-C.sub.6 alkenyl,
    wherein R.sup.6 and R.sup.7 are each optionally substituted with one or more substituents independently selected from
    hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, NR.sup.10 COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.2-C.sub.6 alkynyl,
    C.sub.6-C.sub.10 aryloxy, and S(O.sub.2)C.sub.1-C.sub.6 alkyl; and wherein the C.sub.1-C.sub.6 alkyl or C.sub.1-C.sub.6 alkoxy that R.sup.6 or R.sup.7 is substituted with is optionally substituted with one or more hydroxyl, C.sub.6-C.sub.10 aryl or NR.sup.8R.sup.9, or wherein R.sup.6 or R.sup.7 is optionally fused to a five- to -seven-membered carbocyclic ring or heterocyclic ring containing one or two heteroatoms independently selected from oxygen, sulfur and nitrogen; [0554] wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl) and NHCO (3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
    or at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.6 aliphatic carbocyclic ring or at least one 5- to 6-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, hydroxymethyl, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, CH.sub.2NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.

    [0555] In some embodiments,

    R.sup.6 and R.sup.7 are each independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SF.sub.5, SC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl,
    wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; [0556] wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl) and NHCO (3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
    or at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.8 carbocyclic ring or at least one 5- to 8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, hydroxymethyl, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, CH.sub.2NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.

    [0557] In some embodiments,

    R.sup.6 and R.sup.7 are each independently selected from C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SF.sub.5, SC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl,
    wherein the C.sub.3-C.sub.7 cycloalkyl, C.sub.1-C.sub.6 haloalkyl, and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; [0558] wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl) and NHCO (3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
    or at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.8 carbocyclic ring or at least one 5- to 8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, hydroxymethyl, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, CH.sub.2NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.

    [0559] In some embodiments,

    R.sup.6 and R.sup.7 are each independently selected from C.sub.1-C.sub.6 alkyl, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SF.sub.5, SC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl,
    wherein the C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10 COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; [0560] wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl) and NHCO (3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
    or at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.8 carbocyclic ring or at least one 5- to 8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, hydroxymethyl, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, CH.sub.2NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.

    [0561] In some embodiments,

    R.sup.6 and R.sup.7 are each independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SF.sub.5, SC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl,
    wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl, and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; [0562] wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl) and NHCO (3- to 7-membered heterocycloalkyl) are unsubstituted;
    or at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.8 carbocyclic ring or at least one 5- to 8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, hydroxymethyl, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, CH.sub.2NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.

    [0563] In some embodiments,

    R.sup.6 and R.sup.7 are each independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SF.sub.5, SC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl,
    wherein the C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl are each unsubstituted;
    or at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.8 carbocyclic ring or at least one 5- to 8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, hydroxymethyl, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, CH.sub.2NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.

    [0564] In some embodiments,

    R.sup.6 is independently selected from C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CO—C.sub.1-C.sub.6 alkyl; CONR.sup.8R.sup.9, and 4- to 6-membered heterocycloalkyl,
    wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 4- to 6-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 4- to 6-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (4- to 6-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (4- to 6-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; [0565] and R.sup.7 is independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.6 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CONR.sup.8R.sup.9, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 4- to 6-membered heterocycloalkyl, wherein the C.sub.1-C.sub.6 alkyl is optionally substituted with one to two C.sub.1-C.sub.6 alkoxy;
    or R.sup.6 and R.sup.7, taken together with the atoms connecting them, independently form C.sub.4-C.sub.7 carbocyclic ring or at least one 5-to-7-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.

    [0566] In some embodiments,

    R.sup.6 and R.sup.7 are each independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CONR.sup.8R.sup.9, and 3- to 7-membered heterocycloalkyl,
    wherein the C.sub.1-C.sub.6 alkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy or oxo,
    or at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.8 carbocyclic ring, wherein the carbocyclic ring is optionally independently substituted with one or more hydroxy or oxo.

    [0567] In some embodiments,

    R.sup.6 and R.sup.7 are each independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CONR.sup.8R.sup.9, and 3- to 7-membered heterocycloalkyl,
    wherein the C.sub.1-C.sub.6 alkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy or oxo,
    or at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.6 aliphatic carbocyclic ring, wherein the carbocyclic ring is optionally independently substituted with one or more hydroxy or oxo.

    [0568] In some embodiments,

    R.sup.6 and R.sup.7 are each independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CONR.sup.8R.sup.9, and 3- to 7-membered heterocycloalkyl,
    wherein the C.sub.1-C.sub.6 alkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy or oxo,
    or at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one 5- to 8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the heterocyclic ring is optionally independently substituted with one or more hydroxy or oxo.

    [0569] In some embodiments,

    R.sup.6 and R.sup.7 are each independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CONR.sup.8R.sup.9, and 3- to 7-membered heterocycloalkyl,
    wherein the C.sub.1-C.sub.6 alkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy or oxo,
    or at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.8 carbocyclic ring, wherein the carbocyclic ring is optionally independently substituted with one or more hydroxy or oxo.

    [0570] In some embodiments,

    at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.6 aliphatic carbocyclic ring, wherein the carbocyclic ring is optionally independently substituted with one or more hydroxy or oxo.

    [0571] In some embodiments,

    at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4 aliphatic carbocyclic ring, wherein the carbocyclic ring is optionally independently substituted with one or more hydroxy or oxo.

    [0572] In some embodiments,

    at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.5 aliphatic carbocyclic ring, wherein the carbocyclic ring is optionally independently substituted with one or more hydroxy or oxo.

    [0573] In some embodiments,

    at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.6 aliphatic carbocyclic ring, wherein the carbocyclic ring is optionally independently substituted with one or more hydroxy or oxo.

    [0574] In some embodiments,

    at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one 5- to 6-membered heterocyclic ring containing 1 heteroatom independently selected from O, N, and S, wherein the heterocyclic ring is optionally independently substituted with one or more hydroxy or oxo.

    [0575] In some embodiments,

    at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one 5-membered heterocyclic ring containing 1 heteroatom independently selected from O, N, and S, wherein the heterocyclic ring is optionally independently substituted with one or more hydroxy or oxo.

    [0576] In some embodiments,

    at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one 6-membered heterocyclic ring containing 1 heteroatom independently selected from O, N, and S, wherein the heterocyclic ring is optionally independently substituted with one or more hydroxy or oxo.

    [0577] In some embodiments,

    at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4 aliphatic carbocyclic ring, wherein the carbocyclic ring is optionally independently substituted with one or more C.sub.1-C.sub.6 alkyl.

    [0578] In some embodiments,

    at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.5 aliphatic carbocyclic ring, wherein the carbocyclic ring is optionally independently substituted with one or more C.sub.1-C.sub.6 alkyl.

    [0579] In some embodiments,

    at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.6 aliphatic carbocyclic ring, wherein the carbocyclic ring is optionally independently substituted with one or more C.sub.1-C.sub.6 alkyl.

    [0580] In some embodiments,

    at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one 5- to 6-membered heterocyclic ring containing 1 heteroatom independently selected from O, N, and S, wherein the heterocyclic ring is optionally independently substituted with one or more C.sub.1-C.sub.6 alkyl.

    [0581] In some embodiments,

    at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one 5-membered heterocyclic ring containing 1 heteroatom independently selected from O, N, and S, wherein the heterocyclic ring is optionally independently substituted with one or more C.sub.1-C.sub.6 alkyl.

    [0582] In some embodiments,

    at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one 6-membered heterocyclic ring containing 1 heteroatom independently selected from O, N, and S, wherein the heterocyclic ring is optionally independently substituted with one or more C.sub.1-C.sub.6 alkyl.

    [0583] In some embodiments, o=1; p=0; and

    R.sup.6 is selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SF.sub.5, SC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl,
    wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; [0584] wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl) and NHCO (3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl.

    [0585] In some embodiments, o=1; p=1; and

    R.sup.6 and R.sup.7 are each independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CONR.sup.8R.sup.9, and 3- to 7-membered heterocycloalkyl,
    wherein the C.sub.1-C.sub.6 alkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy or oxo,
    or at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.8 carbocyclic ring, wherein the carbocyclic ring is optionally independently substituted with one or more hydroxy or oxo.

    [0586] In some embodiments, o=1 or 2; p=1, 2, or 3; and

    R.sup.6 and R.sup.7 are each independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SF.sub.5, SC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl,
    wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl, and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; [0587] wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl) and NHCO (3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl.

    [0588] In some embodiments, o=2; p=1; and

    each R.sup.6 is independently selected from C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CO—C.sub.1-C.sub.6 alkyl; CONR.sup.8R.sup.9, and 4- to 6-membered heterocycloalkyl,
    wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 4- to 6-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 4- to 6-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (4- to 6-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (4- to 6-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; [0589] and R.sup.7 is independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.6 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CONR.sup.8R.sup.9, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 4- to 6-membered heterocycloalkyl, wherein the C.sub.1-C.sub.6 alkyl is optionally substituted with one to two C.sub.1-C.sub.6 alkoxy;
    or R.sup.6 and R.sup.7, taken together with the atoms connecting them, independently form C.sub.4-C.sub.7 carbocyclic ring or at least one 5-to-7-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.

    [0590] In some embodiments, o=2; p=2 or 3; and

    each R.sup.6 is independently selected from C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CO—C.sub.1-C.sub.6 alkyl; CONR.sup.8R.sup.9, and 4- to 6-membered heterocycloalkyl,
    wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 4- to 6-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 4- to 6-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (4- to 6-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (4- to 6-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; [0591] wherein each R.sup.7 is independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.6 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CONR.sup.8R.sup.9, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 4- to 6-membered heterocycloalkyl, wherein the C.sub.1-C.sub.6 alkyl is optionally substituted with one to two C.sub.1-C.sub.6 alkoxy;
    or at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.7 (e.g., C.sub.4-C.sub.6) carbocyclic ring (e.g., aliphatic carbocyclic ring) or at least one 5-to-7-membered (e.g., 5-to-6-membered) heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, hydroxymethyl, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, CH.sub.2NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.

    [0592] In some embodiments, o=1 or 2; p=1, 2, or 3; and

    R.sup.6 and R.sup.7 are each independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CONR.sup.8R.sup.9, and 3- to 7-membered heterocycloalkyl,
    wherein the C.sub.1-C.sub.6 alkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy or oxo,
    or at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.8 carbocyclic ring, wherein the carbocyclic ring is optionally independently substituted with one or more hydroxy or oxo.

    [0593] In some embodiments, o=1 or 2; p=1, 2, or 3; and

    R.sup.6 and R.sup.7 are each independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CONR.sup.8R.sup.9, and 3- to 7-membered heterocycloalkyl,
    wherein the C.sub.1-C.sub.6 alkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy or oxo.

    [0594] In some embodiments, o=1 or 2; p=1, 2, or 3; and

    one R.sup.6 and one R.sup.7 are on adjacent atoms, and taken together with the atoms connecting them, form a C.sub.4-C.sub.8 carbocyclic ring or a 5- to 8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.

    [0595] In some embodiments, o=1 or 2; p=1, 2, or 3; and

    one R.sup.6 and one R.sup.7 are on adjacent atoms, and taken together with the atoms connecting them, form a C.sub.6 carbocyclic ring or a 5-to-6-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, NR.sup.10 COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.

    [0596] In some embodiments, o=1 or 2; p=1, 2, or 3; and

    one R.sup.6 and one R.sup.7 are on adjacent atoms, and taken together with the atoms connecting them, form a C.sub.4-C.sub.8 carbocyclic ring or a 5- to 8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is unsubstituted.

    [0597] In some embodiments, o=2; p=2 or 3; and

    two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them independently form a C.sub.4-C.sub.8 carbocyclic ring or a 5- to 8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein each carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.

    [0598] In some embodiments, o=2; p=2 or 3; and

    two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them independently form a C.sub.6 carbocyclic ring or a 5-to-6-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.

    [0599] In some embodiments, o=2; p=2 or 3; and

    two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them independently form a C.sub.5 carbocyclic ring, wherein the carbocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10 COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.

    [0600] In some embodiments, o=2; p=2 or 3; and

    two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them independently form a C.sub.4 carbocyclic ring, wherein the carbocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10 COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.

    [0601] In some embodiments, o=2; p=2 or 3; and

    two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, one pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them independently form a C.sub.4 carbocyclic ring, and the other pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them independently form a C.sub.5 carbocyclic ring, wherein each of C.sub.4 and C.sub.5 carbocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.

    [0602] In some embodiments, o=2; p=2 or 3; and

    two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, one pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them independently form a C.sub.5 carbocyclic ring, and the other pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them independently form a 5- to 8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S (e.g., a 5-membered heteorocyclic ring, e.g., 5-membered heterocyclic ring containing 1 heteroatom), wherein each of carbocyclic and heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10 COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.

    [0603] In some embodiments, o=2; p=2 or 3; and

    two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them independently form a C.sub.4-C.sub.8 carbocyclic ring or a 5- to 8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is unsubstituted.

    [0604] Particular Embodiments Wherein o=1; p=0:

    [0605] In some embodiments, R.sup.6 is C.sub.1-C.sub.6 alkyl.

    [0606] In some embodiments, R.sup.6 is isopropyl.

    [0607] In some embodiments, R.sup.6 is ethyl.

    [0608] In some embodiments, R.sup.6 is methyl.

    [0609] In some embodiments, R.sup.6 is C.sub.1-C.sub.6 alkyl substituted with one or more halo.

    [0610] In some embodiments, R.sup.6 is trifluoromethyl.

    [0611] In some embodiments, R.sup.6 is trifluoromethoxy.

    [0612] In some embodiments, R.sup.6 is C.sub.3-C.sub.7 cycloalkyl.

    [0613] In some embodiments, R.sup.6 is cyclopropyl.

    [0614] In some embodiments, R.sup.6 is halo.

    [0615] In some embodiments, R.sup.6 is chloro.

    [0616] In some embodiments, R.sup.6 is fluoro.

    [0617] In some embodiments, R.sup.6 is cyano.

    [0618] In some embodiments, R.sup.6 is attached to a carbon of an aryl ring B.

    [0619] In some embodiments, R.sup.6 is attached to a carbon of a heteroaryl ring B.

    [0620] In some embodiments, R.sup.6 is attached to a nitrogen of a heteroaryl ring B.

    [0621] Particular Embodiments Wherein o=1 or 2; p=1, 2, or 3:

    [0622] In some embodiments, at least one R.sup.6 is C.sub.1-C.sub.6 alkyl, and at least one R.sup.7 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo.

    [0623] In some embodiments, at least one R.sup.6 is C.sub.1-C.sub.6 alkyl and at least one R.sup.7 is C.sub.1-C.sub.6 alkyl.

    [0624] In some embodiments, at least one R.sup.6 is isopropyl and at least one R.sup.7 is methyl.

    [0625] In some embodiments, at least one R.sup.6 is isopropyl and at least one R.sup.7 is isopropyl.

    [0626] In some embodiments, o=1; p=1; R.sup.6 is isopropyl; and R.sup.7 is isopropyl.

    [0627] In some embodiments, at least one R.sup.6 is C.sub.1-C.sub.6 alkyl, and at least one R.sup.7 is C.sub.1-C.sub.6 alkyl substituted with one or more halo.

    [0628] In some embodiments, at least one R.sup.6 is isopropyl and at least one R.sup.7 is trifluoromethyl.

    [0629] In some embodiments, at least one R.sup.6 is C.sub.1-C.sub.6 alkyl, and at least one R.sup.7 is C.sub.3-C.sub.7 cycloalkyl.

    [0630] In some embodiments, at least one R.sup.6 is isopropyl and at least one R.sup.7 is cyclopropyl.

    [0631] In some embodiments, o=1; p=1; R.sup.6 is isopropyl; and R.sup.7 is cyclopropyl.

    [0632] In some embodiments, at least one R.sup.6 is C.sub.1-C.sub.6 alkyl, and at least one R.sup.7 is halo.

    [0633] In some embodiments, at least one R.sup.6 is isopropyl and at least one R.sup.7 is halo.

    [0634] In some embodiments, at least one R.sup.6 is isopropyl and at least one R.sup.7 is chloro.

    [0635] In some embodiments, at least one R.sup.6 is isopropyl and at least one R.sup.7 is fluoro.

    [0636] In some embodiments, o=1; p=1; R.sup.6 is isopropyl; and R.sup.7 is chloro.

    [0637] In some embodiments, o=2; p=1; at least one R.sup.6 is isopropyl; and R.sup.7 is chloro.

    [0638] In some embodiments, o=1; p=1; R.sup.6 is isopropyl; and R.sup.7 is fluoro.

    [0639] In some embodiments, o=2; p=1; at least one R.sup.6 is isopropyl; and R.sup.7 is fluoro.

    [0640] In some embodiments, o=2; p=2; at least one R.sup.6 is isopropyl; and at least one R.sup.7 is fluoro.

    [0641] In some embodiments, o=2; p=2; at least one R.sup.6 is isopropyl; one R.sup.7 is fluoro; and the other R.sup.7 is cyano.

    [0642] In some embodiments, o=2; p=3; at least one R.sup.6 is isopropyl; two R.sup.7 are fluoro; and one R.sup.7 is chloro.

    [0643] In some embodiments, o=2; p=1; at least one R.sup.6 is ethyl; and R.sup.7 is fluoro.

    [0644] In some embodiments, o=2; p=1; one R.sup.6 is isopropyl; the other R.sup.6 is trifluoromethyl; and R.sup.7 is chloro.

    [0645] In some embodiments, at least one R.sup.6 is C.sub.1-C.sub.6 alkyl, and at least one R.sup.7 is cyano.

    [0646] In some embodiments, at least one R.sup.6 is isopropyl and at least one R.sup.7 is cyano.

    [0647] In some embodiments, o=1; p=1; R.sup.6 is isopropyl; and R.sup.7 is cyano.

    [0648] In some embodiments, o=2; p=1; at least one R.sup.6 is isopropyl; and R.sup.7 is cyano.

    [0649] In some embodiments, at least one R.sup.6 is C.sub.3-C.sub.7 cycloalkyl, and at least one R.sup.7 is C.sub.3-C.sub.7 cycloalkyl.

    [0650] In some embodiments, at least one R.sup.6 is cyclopropyl, and at least one R.sup.7 is cyclopropyl.

    [0651] In some embodiments, at least one R.sup.6 is C.sub.3-C.sub.7 cycloalkyl, and at least one R.sup.7 is halo.

    [0652] In some embodiments, at least one R.sup.6 is cyclopropyl and at least one R.sup.7 is halo.

    [0653] In some embodiments, at least one R.sup.6 is cyclopropyl and at least one R.sup.7 is chloro.

    [0654] In some embodiments, at least one R.sup.6 is cyclopropyl and at least one R.sup.7 is fluoro.

    [0655] In some embodiments, o=1; p=1; R.sup.6 is cyclopropyl; and R.sup.7 is chloro.

    [0656] In some embodiments, o=1; p=1; R.sup.6 is cyclopropyl; and R.sup.7 is fluoro.

    [0657] In some embodiments, at least one R.sup.6 is C.sub.1-C.sub.6 alkyl, and at least one R.sup.7 is C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo.

    [0658] In some embodiments, at least one R.sup.6 is isopropyl, and at least one R.sup.7 is C.sub.1-C.sub.6 alkoxy.

    [0659] In some embodiments, at least one R.sup.6 is isopropyl, and at least one R.sup.7 is methoxy.

    [0660] In some embodiments, o=1; p=1; R.sup.6 is isopropyl, and R.sup.7 is methoxy.

    [0661] In some embodiments, o=2; p=1; at least one R.sup.6 is isopropyl, and R.sup.7 is methoxy.

    [0662] In some embodiments, at least one R.sup.6 is C.sub.1-C.sub.6 alkyl, and at least one R.sup.7 is C.sub.1-C.sub.6 alkoxy substituted with one or more halo.

    [0663] In some embodiments, at least one R.sup.6 is isopropyl, and at least one R.sup.7 is trifluoromethoxy.

    [0664] In some embodiments, at least one R.sup.6 is isopropyl, and at least one R.sup.7 is difluoromethoxy.

    [0665] In some embodiments, at least one R.sup.6 is halo, and at least one R.sup.7 is C.sub.1-C.sub.6 haloalkyl optionally substituted with hydroxy.

    [0666] In some embodiments, o=1; p=1; R.sup.6 is chloro, and R.sup.7 is trifluoromethyl.

    [0667] In some embodiments, at least one R.sup.6 is halo, and at least one R.sup.7 is C.sub.1-C.sub.6 haloalkoxy.

    [0668] In some embodiments, at least one R.sup.6 is chloro, and at least one R.sup.7 is trifluoromethoxy.

    [0669] In some embodiments, o=1; p=1; R.sup.6 is chloro, and R.sup.7 is trifluoromethoxy.

    [0670] In some embodiments, at least one R.sup.6 is C.sub.1-C.sub.6 alkoxy; and at least one R.sup.7 is halo.

    [0671] In some embodiments, o=1; p=2; R.sup.6 is C.sub.1-C.sub.6 alkoxy; and at least one R.sup.7 is chloro.

    [0672] In some embodiments, at least one R.sup.7 is C.sub.1-C.sub.6 alkyl, and at least one R.sup.6 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo.

    [0673] In some embodiments, at least one R.sup.7 is isopropyl and at least one R.sup.6 is methyl.

    [0674] In some embodiments, at least one R.sup.7 is C.sub.1-C.sub.6 alkyl, and at least one R.sup.6 is C.sub.1-C.sub.6 alkyl substituted with one or more halo.

    [0675] In some embodiments, at least one R.sup.7 is isopropyl and at least one R.sup.6 is trifluoromethyl.

    [0676] In some embodiments, at least one R.sup.7 is C.sub.1-C.sub.6 alkyl, and at least one R.sup.6 is C.sub.3-C.sub.7 cycloalkyl.

    [0677] In some embodiments, at least one R.sup.7 is isopropyl and at least one R.sup.6 is cyclopropyl.

    [0678] In some embodiments, o=1; p=1; R.sup.7 is isopropyl; and R.sup.6 is cyclopropyl.

    [0679] In some embodiments, at least one R.sup.7 is C.sub.1-C.sub.6 alkyl, and at least one R.sup.6 is halo.

    [0680] In some embodiments, at least one R.sup.7 is isopropyl and at least one R.sup.6 is halo.

    [0681] In some embodiments, at least one R.sup.7 is isopropyl and at least one R.sup.6 is chloro.

    [0682] In some embodiments, at least one R.sup.7 is isopropyl and at least one R.sup.6 is fluoro.

    [0683] In some embodiments, o=1; p=1; R.sup.7 is isopropyl; and R.sup.6 is chloro.

    [0684] In some embodiments, o=2; p=1; R.sup.7 is isopropyl; and at least one R.sup.6 is chloro.

    [0685] In some embodiments, o=1; p=1; R.sup.7 is isopropyl; and R.sup.6 is fluoro.

    [0686] In some embodiments, o=2; p=1; R.sup.7 is isopropyl; and at least one R.sup.6 is fluoro.

    [0687] In some embodiments, o=2; p=2; R.sup.7 is isopropyl; and at least one R.sup.6 is fluoro.

    [0688] In some embodiments, o=2; p=2; at least one R.sup.7 is isopropyl; one R.sup.6 is fluoro; and the other R.sup.6 is cyano.

    [0689] In some embodiments, o=2; p=1; R.sup.7 is ethyl; and at least one R.sup.6 is fluoro.

    [0690] In some embodiments, o=1; p=2; one R.sup.7 is isopropyl; the other R.sup.7 is trifluoromethyl; and R.sup.6 is chloro.

    [0691] In some embodiments, at least one R.sup.7 is C.sub.1-C.sub.6 alkyl, and at least one R.sup.6 is cyano.

    [0692] In some embodiments, at least one R.sup.7 is isopropyl and at least one R.sup.6 is cyano.

    [0693] In some embodiments, o=1; p=1; R.sup.7 is isopropyl; and R.sup.6 is cyano.

    [0694] In some embodiments, o=2; p=1; R.sup.7 is isopropyl; and at least one R.sup.6 is cyano.

    [0695] In some embodiments, at least one R.sup.7 is C.sub.3-C.sub.7 cycloalkyl, and at least one R.sup.6 is C.sub.3-C.sub.7 cycloalkyl.

    [0696] In some embodiments, at least one R.sup.7 is cyclopropyl, and at least one R.sup.6 is cyclopropyl.

    [0697] In some embodiments, at least one R.sup.7 is C.sub.3-C.sub.7 cycloalkyl, and at least one R.sup.6 is halo.

    [0698] In some embodiments, at least one R.sup.7 is cyclopropyl and at least one R.sup.6 is halo.

    [0699] In some embodiments, at least one R.sup.7 is cyclopropyl and at least one R.sup.6 is chloro.

    [0700] In some embodiments, at least one R.sup.7 is cyclopropyl and at least one R.sup.6 is fluoro.

    [0701] In some embodiments, o=1; p=1; R.sup.7 is cyclopropyl; and R.sup.6 is chloro.

    [0702] In some embodiments, o=1; p=1; R.sup.7 is cyclopropyl; and R.sup.6 is fluoro.

    [0703] In some embodiments, at least one R.sup.7 is C.sub.1-C.sub.6 alkyl, and at least one R.sup.6 is C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo.

    [0704] In some embodiments, at least one R.sup.7 is isopropyl, and at least one R.sup.6 is C.sub.1-C.sub.6 alkoxy.

    [0705] In some embodiments, at least one R.sup.7 is isopropyl, and at least one R.sup.6 is methoxy.

    [0706] In some embodiments, o=1; p=1; R.sup.7 is isopropyl, and R.sup.6 is methoxy.

    [0707] In some embodiments, o=2; p=1; R.sup.7 is isopropyl, and at least one R.sup.6 is methoxy.

    [0708] In some embodiments, at least one R.sup.7 is C.sub.1-C.sub.6 alkyl, and at least one R.sup.6 is C.sub.1-C.sub.6 alkoxy substituted with one or more halo.

    [0709] In some embodiments, at least one R.sup.7 is isopropyl, and at least one R.sup.6 is trifluoromethoxy.

    [0710] In some embodiments, at least one R.sup.7 is halo, and at least one R.sup.6 is C.sub.1-C.sub.6 haloalkyl optionally substituted with one or more hydroxy.

    [0711] In some embodiments, o=1; p=1; R.sup.7 is chloro, and R.sup.6 is trifluoromethyl.

    [0712] In some embodiments, at least one R.sup.7 is halo, and at least one R.sup.6 is C.sub.1-C.sub.6 haloalkoxy.

    [0713] In some embodiments, at least one R.sup.7 is chloro, and at least one R.sup.6 is trifluoromethoxy.

    [0714] In some embodiments, o=1; p=1; R.sup.7 is chloro, and R.sup.6 is trifluoromethoxy.

    [0715] In some embodiments, at least one R.sup.7 is C.sub.1-C.sub.6 alkoxy; and at least one R.sup.6 is halo.

    [0716] In some embodiments, o=1; p=2; at least one R.sup.7 is C.sub.1-C.sub.6 alkoxy; and R.sup.6 is chloro.

    [0717] In some embodiments, R.sup.6 and R.sup.7 are each attached to a carbon of an aryl ring B.

    [0718] In some embodiments, R.sup.6 and R.sup.7 are each attached to a carbon of a heteroaryl ring B.

    [0719] In some embodiments, R.sup.6 is attached to a carbon and R.sup.7 is attached to a nitrogen of a heteroaryl ring B.

    [0720] In some embodiments, R.sup.7 is attached to a carbon and R.sup.6 is attached to a nitrogen of a heteroaryl ring B.

    [0721] In some embodiments, one R.sup.6 and one R.sup.7 are on adjacent atoms, and taken together with the atoms connecting them, form a C.sub.5 carbocyclic ring optionally substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.

    [0722] In some embodiments, R.sup.6 and R.sup.7 are on adjacent atoms, and taken together with the atoms connecting them, form a C.sub.5 aliphatic carbocyclic ring.

    [0723] In some embodiments, R.sup.6 and R.sup.7 are on adjacent atoms, and taken together with the atoms connecting them, form a C.sub.6 carbocyclic ring optionally substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10 COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.

    [0724] In some embodiments, R.sup.6 and R.sup.7 are on adjacent atoms, and taken together with the atoms connecting them, form a C.sub.6 aliphatic carbocyclic ring.

    [0725] In some embodiments, R.sup.6 and R.sup.7 are on adjacent atoms, and taken together with the atoms connecting them, form a C.sub.6 aromatic carbocyclic ring.

    [0726] In some embodiments, R.sup.6 and R.sup.7 are on adjacent atoms, and taken together with the atoms connecting them, form a 5-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, optionally substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.

    [0727] In some embodiments, R.sup.6 and R.sup.7 are on adjacent atoms, and taken together with the atoms connecting them, form a 5-membered aliphatic heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S.

    [0728] In some embodiments, R.sup.6 and R.sup.7 are on adjacent atoms, and taken together with the atoms connecting them, form a 5-membered heteroaromatic ring containing 1 or 2 heteroatoms independently selected from O, N, and S.

    [0729] In some embodiments, R.sup.6 and R.sup.7 are on adjacent atoms, and taken together with the atoms connecting them, form a 6-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, optionally substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, NR.sup.10. COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.

    [0730] In some embodiments, R.sup.6 and R.sup.7 are on adjacent atoms, and taken together with the atoms connecting them, form a 6-membered aliphatic heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S.

    [0731] In some embodiments, R.sup.6 and R.sup.7 are on adjacent atoms, and taken together with the atoms connecting them, form a 6-membered heteroaromatic ring containing 1 or 2 heteroatoms independently selected from O, N, and S.

    [0732] In some embodiments, one R.sup.6 and one R.sup.7 are on adjacent atoms, and taken together with the atoms connecting them, form a C.sub.4-C.sub.8 carbocyclic ring or a 5- to 8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the ring is fused to the B ring at the 2- and 3-positions relative to the bond connecting the B ring to the NH(CO) group.

    [0733] In some embodiments, o=1; p=2; and one pair of one R.sup.6 and one R.sup.7, are on adjacent atoms; and said pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form form a C.sub.4-C.sub.8 carbocyclic ring or a 5- to 8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S,

    wherein the ring is fused to the B ring at the 2- and 3-positions relative to the bond connecting the B ring to the NR.sup.3(CO) group.

    [0734] In some embodiments, o=1; p=2; and

    one pair of one R.sup.6 and one R.sup.7, are on adjacent atoms; and said pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form form a C.sub.4-C.sub.8 carbocyclic ring optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10 COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.

    [0735] In some embodiments, o=1; p=2; and

    one pair of one R.sup.6 and one R.sup.7, are on adjacent atoms; and said pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form form a C.sub.5 carbocyclic ring optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10 COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.

    [0736] In some embodiments, o=1; p=2; and

    one pair of one R.sup.6 and one R.sup.7, are on adjacent atoms; and said pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form form a C.sub.5 aliphatic carbocyclic ring.

    [0737] In some embodiments, o=2; p=2; and

    one pair of one R.sup.6 and one R.sup.7, are on adjacent atoms; and said pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form form a C.sub.4-C.sub.8 carbocyclic ring optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10 COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.

    [0738] In some embodiments, o=2; p=2; and

    one pair of one R.sup.6 and one R.sup.7, are on adjacent atoms; and said pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form form a C.sub.5 carbocyclic ring optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.

    [0739] In some embodiments, o=1; p=2; and

    one pair of one R.sup.6 and one R.sup.7, are on adjacent atoms; and said pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form form a C.sub.5 aliphatic carbocyclic ring.

    [0740] In some embodiments, o=2; p=2 or 3; and

    two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms; one pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a C.sub.4 carbocyclic ring optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9; and the other pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a C.sub.5 carbocyclic ring optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.

    [0741] In some embodiments, o=2; p=2 or 3; and

    two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms; one pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a C.sub.4 aliphatic carbocyclic ring and the other pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a C.sub.5 aliphatic carbocyclic ring.

    [0742] In some embodiments, o=2; p=2 or 3; and

    two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a C.sub.5 carbocyclic ring optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.

    [0743] In some embodiments, o=2; p=2 or 3; and

    two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a C.sub.5 aliphatic carbocyclic ring.

    [0744] In some embodiments, o=2; p=2 or 3; and

    two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a C.sub.6 carbocyclic ring optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10 COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.

    [0745] In some embodiments, o=2; p=2 or 3; and

    two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a C.sub.6 aliphatic carbocyclic ring.

    [0746] In some embodiments, o=2; p=2 or 3; and

    two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a C.sub.6 aromatic carbocyclic ring.

    [0747] In some embodiments, o=2; p=2 or 3; and

    two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a 5-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, optionally substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.

    [0748] In some embodiments, o=2; p=2 or 3; and

    two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a 5-membered aliphatic heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S.

    [0749] In some embodiments, o=2; p=2 or 3; and

    two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a 5-membered heteroaromatic ring containing 1 or 2 heteroatoms independently selected from O, N, and S.

    [0750] In some embodiments, o=2; p=2 or 3; and

    two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a 6-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, optionally substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.

    [0751] In some embodiments, o=2; p=2 or 3; and

    two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a 6-membered aliphatic heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S.

    [0752] In some embodiments, o=2; p=2 or 3; and

    two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a 6-membered heteroaromatic ring containing 1 or 2 heteroatoms independently selected from O, N, and S.

    [0753] In some embodiments, o=2; p=2 or 3; and

    two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms; one pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a C.sub.4-8 carbocyclic ring optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9; and the other pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a 5- to 8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, optionally substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.

    [0754] In some embodiments, o=2; p=2 or 3; and

    two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms; one pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a C.sub.5 aliphatic carbocyclic ring and the other pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a 5-membered aliphatic heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S.

    [0755] In some embodiments, o=2; p=2 or 3; and

    two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms; one pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a C.sub.5 carbocyclic ring optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9; and the other pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a 6-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, optionally substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.

    [0756] In some embodiments, o=2; p=2 or 3; and

    two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms; one pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a C.sub.5 aliphatic carbocyclic ring and the other pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a 5-membered aliphatic heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S.

    [0757] In some embodiments, o=2; p=2 or 3; and

    two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them independently form a C.sub.4-C.sub.8 carbocyclic ring or a 5- to 8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein one of the two rings is fused to the B ring at the 2- and 3-positions relative to the bond connecting the B ring to the NR.sup.3(CO) group, and the other of the two rings is fused to the B ring at the 5- and 6-positions relative to the bond connecting the B ring to the NH(CO) group.

    [0758] In some embodiments, o=2; p=2 or 3; and

    two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them independently form a C.sub.4-C.sub.8 carbocyclic ring or a 5- to 8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S,
    wherein one of the two rings is fused to the B ring at the 2- and 3-positions relative to the bond connecting the B ring to the NR.sup.3(CO) group, and the other of the two rings is fused to the B ring at the 4- and 5-positions relative to the bond connecting the B ring to the NH(CO) group.

    [0759] In some embodiments, o=2; p=2; and

    two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a C.sub.5 aliphatic carbocyclic ring.

    [0760] In some embodiments, o=2; p=2; and

    two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, one pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a C.sub.4 aliphatic carbocyclic ring, and the other pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a C.sub.5 aliphatic carbocyclic ring.

    [0761] In some embodiments, o=2; p=2; and

    two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a C.sub.4 aliphatic carbocyclic ring.

    [0762] In some embodiments, o=2; p=2; and

    two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, one pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a C.sub.5 aliphatic carbocyclic ring, and the other pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a 5-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S.

    [0763] In some embodiments, o=2; p=3; and

    two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a C.sub.5 aliphatic carbocyclic ring; and one R.sup.7 is halo (e.g., Cl or F).

    [0764] In some embodiments, o=2; p=3; and

    two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a C.sub.5 aliphatic carbocyclic ring; and one R.sup.7 is CN.

    [0765] In some embodiments, one R.sup.7 is pyrazolyl and is para to the bond connecting the B ring to the NH(CO) group of Formula AA.

    [0766] In some embodiments, one R.sup.7 is 3-pyrazolyl and is para to the bond connecting the B ring to the NH(CO) group of Formula AA.

    [0767] In some embodiments, one R.sup.7 is 4-pyrazolyl and is para to the bond connecting the B ring to the NH(CO) group of Formula AA.

    [0768] In some embodiments, one R.sup.7 is 5-pyrazolyl and is para to the bond connecting the B ring to the NH(CO) group of Formula AA.

    [0769] In some embodiments, one R.sup.7 is thiazolyl and is para to the bond connecting the B ring to the NH(CO) group of Formula AA.

    [0770] In some embodiments, one R.sup.7 is 4-thiazolyl and is para to the bond connecting the B ring to the NH(CO) group of Formula AA.

    [0771] In some embodiments, one R.sup.7 is 5-thiazolyl and is para to the bond connecting the B ring to the NH(CO) group of Formula AA.

    [0772] In some embodiments, one R.sup.7 is furyl and is para to the bond connecting the B ring to the NH(CO) group of Formula AA.

    [0773] In some embodiments, one R.sup.7 is 2-furyl and is para to the bond connecting the B ring to the NH(CO) group of Formula AA.

    [0774] In some embodiments, one R.sup.7 is thiophenyl and is para to the bond connecting the B ring to the NH(CO) group of Formula AA.

    [0775] In some embodiments, one R.sup.7 is 2-thiophenyl and is para to the bond connecting the B ring to the NH(CO) group of Formula AA.

    [0776] In some embodiments, one R.sup.7 is phenyl and is para to the bond connecting the B ring to the NH(CO) group of Formula AA.

    [0777] In some embodiments, one R.sup.7 is cycloalkenyl (e.g., cyclopentenyl, e.g., 1-cyclopentenyl) and is para to the bond connecting the B ring to the NR.sup.3(CO) group of Formula AA.

    [0778] In some embodiments, one R.sup.7 is phenyl optionally substituted with one or more C.sub.1-C.sub.6 alkyl (e.g., methyl or propyl, e.g., 2-propyl) optionally substituted with one or more hydroxyl, NR.sup.8R.sup.9 (e.g., dimethylamino), or C.sub.6-C.sub.10 aryl (e.g., phenyl, naphthyl, or methylenedioxyphenyl and is para to the bond connecting the B ring to the NH(CO) group of Formula AA.

    [0779] In some embodiments, one R.sup.7 is phenyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy (e.g., methoxy) optionally substituted with one or more hydroxyl, NR.sup.8R.sup.9 (e.g., dimethylamino), or C.sub.6-C.sub.10 aryl (e.g., phenyl, naphthyl, or methylenedioxyphenyl and is para to the bond connecting the B ring to the NH(CO) group of Formula AA.

    [0780] In some embodiments, one R.sup.7 is phenyl optionally substituted with one or more C.sub.6-C.sub.10 aryloxy (e.g., phenoxy) and is para to the bond connecting the B ring to the NH(CO) group of Formula AA.

    [0781] In some embodiments, one R.sup.7 is phenyl optionally substituted with one or more CN and is para to the bond connecting the B ring to the NH(CO) group of Formula AA.

    [0782] In some embodiments, one R.sup.7 is phenyl optionally substituted with one or more halo (e.g., F, Cl) and is para to the bond connecting the B ring to the NH(CO) group of Formula AA and is para to the bond connecting the B ring to the NH(CO) group of Formula AA.

    [0783] In some embodiments, one R.sup.7 is phenyl optionally substituted with one or more COOC.sub.1-C.sub.6 alkyl (e.g., CO.sub.2t-Bu) and is para to the bond connecting the B ring to the NH(CO) group of Formula AA.

    [0784] In some embodiments, one R.sup.7 is phenyl optionally substituted with one or more S(O.sub.2)C.sub.1-C.sub.6 alkyl (e.g., S(O.sub.2)methyl) and is para to the bond connecting the B ring to the NH(CO) group of Formula AA.

    [0785] In some embodiments, one R.sup.7 is phenyl optionally substituted with one or more 3- to 7-membered heterocycloalkyl (e.g., morpholinyl) and is para to the bond connecting the B ring to the NH(CO) group of Formula AA.

    [0786] In some embodiments, one R.sup.7 is phenyl optionally substituted with one or more CONR.sup.8R.sup.9 (e.g., unsubstituted amido) and is para to the bond connecting the B ring to the NH(CO) group of Formula AA.

    [0787] In some embodiments, one R.sup.7 is phenyl optionally substituted with one or more C.sub.1-C.sub.6 alkyl (e.g., methyl or propyl, e.g., 2-propyl) and with one or more halo (e.g., F, Cl) and is para to the bond connecting the B ring to the NH(CO) group of Formula AA and is para to the bond connecting the B ring to the NH(CO) group of Formula AA.

    [0788] In some embodiments, R.sup.6 and R.sup.7 are each attached to a carbon of an aryl ring B.

    [0789] In some embodiments, R.sup.6 and R.sup.7 are each attached to a carbon of a heteroaryl ring B.

    [0790] In some embodiments, R.sup.6 is attached to a carbon and R.sup.7 is attached to a nitrogen of a heteroaryl ring B.

    [0791] In some embodiments, R.sup.7 is attached to a carbon and R.sup.6 is attached to a nitrogen of a heteroaryl ring B.

    [0792] In some embodiments of any of the formulae herein, each of R.sup.1 and R.sup.2 is independently selected from the group consisting of C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, halo, oxo, or C.sub.1-C.sub.6 alkoxy; C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, halo, oxo, C.sub.1-C.sub.6 alkoxy, or C.sub.1-C.sub.6 alkyl; wherein the C.sub.1-C.sub.6 alkoxy or C.sub.1-C.sub.6 alkyl is further optionally substituted with one to three hydroxy, halo, NR.sup.8R.sup.9, or oxo; 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, halo, oxo, or C.sub.1-C.sub.6 alkyl wherein the C.sub.1-C.sub.6 alkoxy or C.sub.1-C.sub.6 alkyl is further optionally substituted with one to three hydroxy, halo, or oxo; C.sub.1-C.sub.6 haloalkyl; C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 haloalkoxy; halo; CN; CO—C.sub.1-C.sub.6 alkyl; CO—C.sub.6-C.sub.10 aryl; CO (5- to 10-membered heteroaryl); CO.sub.2C.sub.1-C.sub.6 alkyl; CO.sub.2C.sub.3-C.sub.8 cycloalkyl; OCOC.sub.1-C.sub.6 alkyl; OCOC.sub.6-C.sub.10 aryl; OCO (5- to 10-membered heteroaryl); OCO (3- to 7-membered heterocycloalkyl); C.sub.6-C.sub.10 aryl; 5- to 10-membered heteroaryl; NH.sub.2; NHC.sub.1-C.sub.6 alkyl; N(C.sub.1-C.sub.6 alkyl).sub.2; CONR.sup.8R.sup.9; SF.sub.5; S(O.sub.2)NR.sup.11R.sup.12; S(O)C.sub.1-C.sub.6 alkyl; and S(O.sub.2)C.sub.1-C.sub.6 alkyl.

    [0793] In some embodiments of any of the formulae herein, R.sup.1 is selected from the group consisting of 1-hydroxy-2-methylpropan-2-yl; methyl; isopropyl; 2-hydroxy-2-propyl; hydroxymethyl; 1-hydroxyethyl; 2-hydroxyethyl; 1-hydroxy-2-propyl; 1-hydroxy-1-cyclopropyl; 1-hydroxy-1-cyclobutyl; 1-hydroxy-1-cyclopentyl; 1-hydroxy-1-cyclohexyl; morpholinyl; 1,3-dioxolan-2-yl; COCH.sub.3; COCH.sub.2CH.sub.3; 2-methoxy-2-propyl; fluoro; chloro; phenyl; pyridyl; pyrazolyl; S(O.sub.2)CH.sub.3, and S(O.sub.2)NR.sup.11R.sup.12. [0794] In some embodiments, R.sup.2 is selected from the group consisting of fluoro, chloro, cyano, methyl; methoxy; ethoxy; isopropyl; 1-hydroxy-2-methylpropan-2-yl; 2-hydroxy-2-propyl; hydroxymethyl; 1-hydroxyethyl; 2-hydroxyethyl; 1-hydroxy-2-propyl; 1-hydroxy-1-cyclopropyl; COCH.sub.3; COPh; 2-methoxy-2-propyl; S(O.sub.2)CH.sub.3, and S(O.sub.2)NR.sup.11R.sup.12. [0795] In some embodiments, the substituted ring B is

    ##STR00159##  and each R.sup.6 is independently selected from the group consisting of: C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CO—C.sub.1-C.sub.6 alkyl; CONR.sup.8R.sup.9, and 4- to 6-membered heterocycloalkyl, wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 4- to 6-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 4- to 6-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (4- to 6-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (4- to 6-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl. [0796] In some embodiments, the substituted ring B is

    ##STR00160##  and each R.sup.6 is independently selected from the group consisting of: C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, and C.sub.3-C.sub.7 cycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, or oxo. [0797] In some embodiments, the substituted ring B is

    ##STR00161##  wherein each R.sup.6 is independently selected from C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CO—C.sub.1-C.sub.6 alkyl; CONR.sup.8R.sup.9, and 4- to 6-membered heterocycloalkyl,
    wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 4- to 6-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 4- to 6-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (4- to 6-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (4- to 6-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; [0798] wherein R.sup.7 is independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.6 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CONR.sup.8R.sup.9, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 4- to 6-membered heterocycloalkyl, wherein the C.sub.1-C.sub.6 alkyl is optionally substituted with one to two C.sub.1-C.sub.6 alkoxy;
    or R.sup.6 and R.sup.7, taken together with the atoms connecting them, independently form C.sub.4-C.sub.7 carbocyclic ring or at least one 5-to-7-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.

    [0799] In some embodiments, the substituted ring B is

    ##STR00162##

    wherein each R.sup.6 is independently selected from C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CO—C.sub.1-C.sub.6 alkyl; CONR.sup.8R.sup.9, and 4- to 6-membered heterocycloalkyl,
    wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 4- to 6-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 4- to 6-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (4- to 6-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (4- to 6-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; [0800] wherein R.sup.7 is independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.6 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CONR.sup.8R.sup.9, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 4- to 6-membered heterocycloalkyl, wherein the C.sub.1-C.sub.6 alkyl is optionally substituted with one to two C.sub.1-C.sub.6 alkoxy;
    or R.sup.6 and R.sup.7, taken together with the atoms connecting them, independently form C.sub.4-C.sub.7 carbocyclic ring or at least one 5-to-7-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9. [0801] In some embodiments, the substituted ring B is

    ##STR00163##

    wherein each R.sup.6 is independently selected from C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CO—C.sub.1-C.sub.6 alkyl; CONR.sup.8R.sup.9, and 4- to 6-membered heterocycloalkyl,
    wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 4- to 6-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 4- to 6-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (4- to 6-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (4- to 6-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; [0802] wherein R.sup.7 is independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.6 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CONR.sup.8R.sup.9, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 4- to 6-membered heterocycloalkyl, wherein the C.sub.1-C.sub.6 alkyl is optionally substituted with one to two C.sub.1-C.sub.6 alkoxy. [0803] In some embodiments, the substituted ring B is

    ##STR00164##  wherein each R.sup.6 is independently selected from C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CO—C.sub.1-C.sub.6 alkyl; CONR.sup.8R.sup.9, and 4- to 6-membered heterocycloalkyl,
    wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 4- to 6-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 4- to 6-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (4- to 6-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (4- to 6-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; [0804] wherein each R.sup.7 is independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.6 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CONR.sup.8R.sup.9, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 4- to 6-membered heterocycloalkyl, wherein the C.sub.1-C.sub.6 alkyl is optionally substituted with one to two C.sub.1-C.sub.6 alkoxy;
    or at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.7 carbocyclic ring or at least one 5-to-7-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9. [0805] In some embodiments, the substituted ring B is

    ##STR00165##  wherein each R.sup.6 is independently selected from C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CO—C.sub.1-C.sub.6 alkyl; CONR.sup.8R.sup.9, and 4- to 6-membered heterocycloalkyl,
    wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 4- to 6-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 4- to 6-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (4- to 6-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (4- to 6-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; [0806] wherein each R.sup.7 is independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.6 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CONR.sup.8R.sup.9, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 4- to 6-membered heterocycloalkyl, wherein the C.sub.1-C.sub.6 alkyl is optionally substituted with one to two C.sub.1-C.sub.6 alkoxy;
    or at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.7 carbocyclic ring or at least one 5-to-7-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9. [0807] In some embodiments, the substituted ring B is

    ##STR00166##  wherein each R.sup.6 is independently selected from C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CO—C.sub.1-C.sub.6 alkyl; CONR.sup.8R.sup.9, and 4- to 6-membered heterocycloalkyl,
    wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 4- to 6-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 4- to 6-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (4- to 6-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (4- to 6-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; [0808] wherein each R.sup.7 is independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.6 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CONR.sup.8R.sup.9, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 4- to 6-membered heterocycloalkyl, wherein the C.sub.1-C.sub.6 alkyl is optionally substituted with one to two C.sub.1-C.sub.6 alkoxy;
    or at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.7 carbocyclic ring or at least one 5-to-7-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9. [0809] In some embodiments, the substituted ring B is

    ##STR00167##  wherein each R.sup.6 is independently selected from C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CO—C.sub.1-C.sub.6 alkyl; CONR.sup.8R.sup.9, and 4- to 6-membered heterocycloalkyl,
    wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 4- to 6-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 4- to 6-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (4- to 6-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (4- to 6-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; [0810] wherein each R.sup.7 is independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.6 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CONR.sup.8R.sup.9, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 4- to 6-membered heterocycloalkyl, wherein the C.sub.1-C.sub.6 alkyl is optionally substituted with one to two C.sub.1-C.sub.6 alkoxy; [0811] or R.sup.6 and R.sup.7, taken together with the atoms connecting them, independently form a C.sub.4-C.sub.7 carbocyclic ring or at least one 5-to-7-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10 COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9. [0812] In some embodiments, the substituted ring B is

    ##STR00168##  wherein each R.sup.6 is independently selected from C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CO—C.sub.1-C.sub.6 alkyl; CONR.sup.8R.sup.9, and 4- to 6-membered heterocycloalkyl,
    wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 4- to 6-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 4- to 6-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (4- to 6-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (4- to 6-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; [0813] wherein each R.sup.7 is independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.6 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CONR.sup.8R.sup.9, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 4- to 6-membered heterocycloalkyl, wherein the C.sub.1-C.sub.6 alkyl is optionally substituted with one to two C.sub.1-C.sub.6 alkoxy; [0814] or at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.7 carbocyclic ring or at least one 5-to-7-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, hydroxymethyl, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, CH.sub.2NR.sup.8R.sup.9, ═NR.sup.10 COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9;

    [0815] The Group R.sup.3

    [0816] In some embodiments, R.sup.3 is selected from hydrogen, C.sub.1-C.sub.6 alkyl, and

    ##STR00169##

    wherein the C.sub.1-C.sub.2 alkylene group is optionally substituted with oxo.

    [0817] In some embodiments, R.sup.3 is hydrogen.

    [0818] In some embodiments, R.sup.3 is cyano.

    [0819] In some embodiments, R.sup.3 is hydroxy.

    [0820] In some embodiments, R.sup.3 is C.sub.1-C.sub.6 alkoxy. In some embodiments, R.sup.3 is C.sub.1-C.sub.6 alkyl.

    [0821] In some embodiments, R.sup.3 is methyl.

    [0822] In some embodiments, R.sup.3 is

    ##STR00170##

    wherein the C.sub.1-C.sub.2 alkylene group is optionally substituted with oxo.

    [0823] In some embodiments, R.sup.3 is —CH.sub.2R.sup.14.

    [0824] In some embodiments, R.sup.3 is —C(O)R.sup.14.

    [0825] In some embodiments, R.sup.3 is —CH.sub.2CH.sub.2R.sup.14.

    [0826] In some embodiments, R.sup.3 is —CHR.sup.14CH.sub.3.

    [0827] In some embodiments, R.sup.3 is —CH.sub.2C(O)R.sup.14.

    [0828] In some embodiments, R.sup.3 is —C(O)CH.sub.2R.sup.14.

    [0829] In some embodiments, R.sup.3 is CO.sub.2C.sub.1-C.sub.6 alkyl.

    [0830] The Group R.sup.14

    [0831] In some embodiments, R.sup.14 is hydrogen, C.sub.1-C.sub.6 alkyl, 5- to 10-membered monocyclic or bicyclic heteroaryl or C.sub.6-C.sub.10 monocyclic or bicyclic aryl, wherein each C.sub.1-C.sub.6 alkyl, aryl or heteroaryl is optionally independently substituted with 1 or 2 R.sup.6.

    [0832] In some embodiments, R.sup.14 is hydrogen or C.sub.1-C.sub.6 alkyl.

    [0833] In some embodiments, R.sup.14 is hydrogen, 5- to 10-membered monocyclic or bicyclic heteroaryl or C.sub.6-C.sub.10 monocyclic or bicyclic aryl, wherein each C.sub.1-C.sub.6 alkyl, aryl or heteroaryl is optionally independently substituted with 1 or 2 R.sup.6.

    [0834] In some embodiments, R is hydrogen.

    [0835] In some embodiments, R.sup.14 is C.sub.1-C.sub.6 alkyl.

    [0836] In some embodiments, R.sup.14 is methyl.

    [0837] In some embodiments, R.sup.14 is 5- to 10-membered monocyclic or bicyclic heteroaryl optionally independently substituted with 1 or 2 R.sup.6.

    [0838] In some embodiments, R.sup.14 is C.sub.6-C.sub.10 monocyclic or bicyclic aryl optionally independently substituted with 1 or 2 R.sup.6.

    [0839] The Moiety S(═O)(NHR.sup.3)═N—

    [0840] In some embodiments, the sulfur in the moiety S(═O)(NHR.sup.3)═N— has (S) stereochemistry.

    [0841] In some embodiments, the sulfur in the moiety S(═O)(NHR.sup.3)═N— has (R) stereochemistry.

    [0842] The Group R.sup.10

    [0843] In some embodiments, R.sup.10 is C.sub.1-C.sub.6 alkyl.

    [0844] In some embodiments, R.sup.10 is methyl.

    [0845] In some embodiments, R.sup.10 is ethyl.

    [0846] The groups R.sup.8 and R.sup.9

    [0847] In some embodiments, each of R.sup.8 and R.sup.9 at each occurrence is independently selected from hydrogen, C.sub.1-C.sub.6 alkyl, (C═NR.sup.13)NR.sup.11R.sup.12, S(O.sub.2)C.sub.1-C.sub.6 alkyl, S(O.sub.2)NR.sup.11R.sup.12, COR.sup.13, CO.sub.2R.sup.13 and CONR.sup.11R.sup.12, wherein the C.sub.1-C.sub.6 alkyl is optionally substituted with one or more hydroxy, halo, C.sub.1-C.sub.6 alkoxy, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.7 cycloalkyl or 3- to 7-membered heterocycloalkyl; or R.sup.8 and R.sup.9 taken together with the nitrogen they are attached to form a 3- to 7-membered ring optionally containing one or more heteroatoms in addition to the nitrogen they are attached to.

    [0848] In some embodiments, each of R.sup.8 and R.sup.9 at each occurrence is independently selected from hydrogen, C.sub.1-C.sub.6 alkyl, (C═NR.sup.13)NR.sup.11R.sup.12, S(O.sub.2)C.sub.1-C.sub.6 alkyl, S(O.sub.2)NR.sup.11R.sup.12, COR.sup.13, CO.sub.2R.sup.13 and CONR.sup.11R.sup.12, wherein the C.sub.1-C.sub.6 alkyl is optionally substituted with one or more hydroxy, halo, C.sub.1-C.sub.6 alkoxy, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.7 cycloalkyl or 3- to 7-membered heterocycloalkyl; or R.sup.8 and R.sup.9 taken together with the nitrogen they are attached to form a 3- to 7-membered ring optionally containing one or more heteroatoms in addition to the nitrogen they are attached to.

    [0849] In some embodiments, each of R.sup.8 and R.sup.9 at each occurrence is hydrogen,

    [0850] In some embodiments, each R.sup.8 at each occurrence is hydrogen and each R.sup.9 at each occurrence is C.sub.1-C.sub.6 alkyl.

    [0851] In some embodiments, each R.sup.8 at each occurrence is hydrogen and each R.sup.9 at each occurrence is methyl.

    [0852] In some embodiments, each R.sup.8 at each occurrence is hydrogen and each R.sup.9 at each occurrence is ethyl.

    [0853] In some embodiments, each of R.sup.8 and R.sup.9 at each occurrence is methyl.

    [0854] In some embodiments, each of R.sup.8 and R.sup.9 at each occurrence is ethyl.

    [0855] In some embodiments, R.sup.8 and R.sup.9 taken together with the nitrogen they are attached to form a 3-membered ring.

    [0856] In some embodiments, R.sup.8 and R.sup.9 taken together with the nitrogen they are attached to form a 4-membered ring.

    [0857] In some embodiments, R.sup.8 and R.sup.9 taken together with the nitrogen they are attached to form a 5-membered ring.

    [0858] In some embodiments, R.sup.8 and R.sup.9 taken together with the nitrogen they are attached to form a 6-membered ring optionally containing one or more oxygen atoms in addition to the nitrogen they are attached to.

    [0859] In some embodiments, R.sup.8 and R.sup.9 taken together with the nitrogen they are attached to form a 6-membered ring optionally containing one or more nitrogen atoms in addition to the nitrogen they are attached to.

    [0860] In some embodiments, R.sup.8 and R.sup.9 taken together with the nitrogen they are attached to form a 7-membered ring.

    [0861] The Group R.sup.13

    [0862] In some embodiments, R.sup.13 is C.sub.1-C.sub.6 alkyl.

    [0863] In some embodiments, R.sup.13 is methyl.

    [0864] In some embodiments, R.sup.13 is ethyl.

    [0865] In some embodiments, R.sup.13 is C.sub.6-C.sub.10 aryl.

    [0866] In some embodiments, R.sup.13 is phenyl.

    [0867] In some embodiments, R.sup.13 is 5- to 10-membered heteroaryl.

    [0868] The groups R.sup.14 and R.sup.12

    [0869] In some embodiments, each of R.sup.14 and R.sup.12 at each occurrence is independently selected from hydrogen and C.sub.1-C.sub.6 alkyl.

    [0870] In some embodiments, each of R.sup.14 and R.sup.12 at each occurrence is hydrogen,

    [0871] In some embodiments, each R.sup.14 at each occurrence is hydrogen and each R.sup.12 at each occurrence is C.sub.1-C.sub.6 alkyl.

    [0872] In some embodiments, each R.sup.14 at each occurrence is hydrogen and each R.sup.12 at each occurrence is methyl.

    [0873] In some embodiments, each R.sup.14 at each occurrence is hydrogen and each R.sup.12 at each occurrence is ethyl.

    [0874] In some embodiments, each of R.sup.14 and R.sup.12 at each occurrence is methyl.

    [0875] In some embodiments, each of R.sup.14 and R.sup.12 at each occurrence is ethyl.

    [0876] In some embodiments of the compound of formula AA,

    the substituted ring A is

    ##STR00171##

    and R.sup.1 is selected from:
    C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy; 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy; C.sub.1-C.sub.6 alkyl substituted with one or more oxo; C.sub.3-C.sub.7 cycloalkyl substituted with one or more oxo; C.sub.1-C.sub.6 alkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.3-C.sub.7 cycloalkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 haloalkyl; C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 haloalkoxy; halo; CN; NO.sub.2; COC.sub.1-C.sub.6 alkyl; CO—C.sub.6-C.sub.10 aryl; CO (5- to 10-membered heteroaryl); CO.sub.2C.sub.1-C.sub.6 alkyl; CO.sub.2C.sub.3-C.sub.8 cycloalkyl; OCOC.sub.1-C.sub.6 alkyl; OCOC.sub.6-C.sub.10 aryl; OCO (5- to 10-membered heteroaryl); OCO (3- to 7-membered heterocycloalkyl); C.sub.6-C.sub.10 aryl; 5- to 10-membered heteroaryl; NH.sub.2; NHC.sub.1-C.sub.6 alkyl; N(C.sub.1-C.sub.6 alkyl).sub.2; CONR.sup.8R.sup.9; SF.sub.5; and S(O.sub.2)C.sub.1-C.sub.6 alkyl.

    [0877] In some embodiments of the compound of formula AA,

    the substituted ring A is

    ##STR00172##

    and R.sup.1 is selected from: [0878] 1-hydroxy-2-methylpropan-2-yl; methyl; isopropyl; 2-hydroxy-2-propyl; hydroxymethyl; 1-hydroxyethyl; 2-hydroxyethyl; 1-hydroxy-2-propyl; 1-hydroxy-1-cyclopropyl; 1-hydroxy-1-cyclobutyl; 1-hydroxy-1-cyclopentyl; 1-hydroxy-1-cyclohexyl; morpholinyl; 1,3-dioxolan-2-yl; COCH.sub.3; COCH.sub.2CH.sub.3; 2-methoxy-2-propyl; (dimethylamino)methyl; 1-(dimethylamino)ethyl; fluoro; chloro; phenyl; pyridyl; pyrazolyl; and S(O.sub.2)CH.sub.3.

    [0879] In some embodiments of the compound of formula AA,

    the substituted ring A is

    ##STR00173##

    and R.sup.1 is selected from: [0880] C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy; 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy; C.sub.1-C.sub.6 alkyl substituted with one or more oxo; C.sub.3-C.sub.7 cycloalkyl substituted with one or more oxo; C.sub.1-C.sub.6 alkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.3-C.sub.7 cycloalkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 alkyl substituted with one or more NR.sup.8R.sup.9; 3- to 7-membered heterocycloalkyl substituted with one or more NR.sup.8R.sup.9; C.sub.1-C.sub.6 haloalkyl; C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 haloalkoxy; halo; CN; NO.sub.2; COC.sub.1-C.sub.6 alkyl; CO—C.sub.6-C.sub.10 aryl; CO (5- to 10-membered heteroaryl); CO.sub.2C.sub.1-C.sub.6 alkyl; CO.sub.2C.sub.3-C.sub.8 cycloalkyl; OCOC.sub.1-C.sub.6 alkyl; OCOC.sub.6-C.sub.10 aryl; OCO (5- to 10-membered heteroaryl); OCO (3- to 7-membered heterocycloalkyl); C.sub.6-C.sub.10 aryl; 5- to 10-membered heteroaryl; NH.sub.2; NHC.sub.1-C.sub.6 alkyl; N(C.sub.1-C.sub.6 alkyl).sub.2; CONR.sup.8R.sup.9; SF.sub.5; and S(O.sub.2)C.sub.1-C.sub.6 alkyl.

    [0881] In some embodiments of the compound of formula AA,

    the substituted ring A is

    ##STR00174##

    and R.sup.1 is selected from: [0882] 1-hydroxy-2-methylpropan-2-yl; methyl; isopropyl; 2-hydroxy-2-propyl; hydroxymethyl; 1-hydroxyethyl; 2-hydroxyethyl; 1-hydroxy-2-propyl; 1-hydroxy-1-cyclopropyl; 1-hydroxy-1-cyclobutyl; 1-hydroxy-1-cyclopentyl; 1-hydroxy-1-cyclohexyl; morpholinyl; 1,3-dioxolan-2-yl; COCH.sub.3; COCH.sub.2CH.sub.3; 2-methoxy-2-propyl; (dimethylamino)methyl; 1-(dimethylamino)ethyl; fluoro; chloro; phenyl; pyridyl; pyrazolyl; and S(O.sub.2)CH.sub.3.

    [0883] In some embodiments of the compound of formula AA,

    the substituted ring A is

    ##STR00175##

    and R.sup.1 is selected from: [0884] C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy; 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy; C.sub.1-C.sub.6 alkyl substituted with one or more oxo; C.sub.3-C.sub.7 cycloalkyl substituted with one or more oxo; C.sub.1-C.sub.6 alkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.3-C.sub.7 cycloalkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 alkyl substituted with one or more NR.sup.8R.sup.9; 3- to 7-membered heterocycloalkyl substituted with one or more NR.sup.8R.sup.9; C.sub.1-C.sub.6 haloalkyl; C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 haloalkoxy; halo; CN; NO.sub.2; COC.sub.1-C.sub.6 alkyl; CO—C.sub.6-C.sub.10 aryl; CO (5- to 10-membered heteroaryl); CO.sub.2C.sub.1-C.sub.6 alkyl; CO.sub.2C.sub.3-C.sub.8 cycloalkyl; OCOC.sub.1-C.sub.6 alkyl; OCOC.sub.6-C.sub.10 aryl; OCO (5- to 10-membered heteroaryl); OCO (3- to 7-membered heterocycloalkyl); C.sub.6-C.sub.10 aryl; 5- to 10-membered heteroaryl; NH.sub.2; NHC.sub.1-C.sub.6 alkyl; N(C.sub.1-C.sub.6 alkyl).sub.2; CONR.sup.8R.sup.9; SF.sub.5; and S(O.sub.2)C.sub.1-C.sub.6 alkyl.

    [0885] In some embodiments of the compound of formula AA,

    the substituted ring A is

    ##STR00176##

    and R.sup.1 is selected from: [0886] 1-hydroxy-2-methylpropan-2-yl; methyl; isopropyl; 2-hydroxy-2-propyl; hydroxymethyl; 1-hydroxyethyl; 2-hydroxyethyl; 1-hydroxy-2-propyl; 1-hydroxy-1-cyclopropyl; 1-hydroxy-1-cyclobutyl; 1-hydroxy-1-cyclopentyl; 1-hydroxy-1-cyclohexyl; morpholinyl; 1,3-dioxolan-2-yl; COCH.sub.3; COCH.sub.2CH.sub.3; 2-methoxy-2-propyl; (dimethylamino)methyl; 1-(dimethylamino)ethyl; fluoro; chloro; phenyl; pyridyl; pyrazolyl; and S(O.sub.2)CH.sub.3.

    [0887] In some embodiments of the compound of formula AA,

    the substituted ring A is

    ##STR00177##

    and R.sup.1 is selected from: [0888] C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy; 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy; C.sub.1-C.sub.6 alkyl substituted with one or more oxo; C.sub.3-C.sub.7 cycloalkyl substituted with one or more oxo; C.sub.1-C.sub.6 alkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.3-C.sub.7 cycloalkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 alkyl substituted with one or more NR.sup.8R.sup.9; 3- to 7-membered heterocycloalkyl substituted with one or more NR.sup.8R.sup.9; C.sub.1-C.sub.6 haloalkyl; C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 haloalkoxy; halo; CN; NO.sub.2; COC.sub.1-C.sub.6 alkyl; CO—C.sub.6-C.sub.10 aryl; CO (5- to 10-membered heteroaryl); CO.sub.2C.sub.1-C.sub.6 alkyl; CO.sub.2C.sub.3-C.sub.8 cycloalkyl; OCOC.sub.1-C.sub.6 alkyl; OCOC.sub.6-C.sub.10 aryl; OCO (5- to 10-membered heteroaryl); OCO (3- to 7-membered heterocycloalkyl); C.sub.6-C.sub.10 aryl; 5- to 10-membered heteroaryl; NH.sub.2; NHC.sub.1-C.sub.6 alkyl; N(C.sub.1-C.sub.6 alkyl).sub.2; CONR.sup.8R.sup.9; SF.sub.5; and S(O.sub.2)C.sub.1-C.sub.6 alkyl.

    [0889] In some embodiments of the compound of formula AA,

    the substituted ring A is

    ##STR00178##

    and R.sup.1 is selected from: [0890] 1-hydroxy-2-methylpropan-2-yl; methyl; isopropyl; 2-hydroxy-2-propyl; hydroxymethyl; 1-hydroxyethyl; 2-hydroxyethyl; 1-hydroxy-2-propyl; 1-hydroxy-1-cyclopropyl; 1-hydroxy-1-cyclobutyl; 1-hydroxy-1-cyclopentyl; 1-hydroxy-1-cyclohexyl; morpholinyl; 1,3-dioxolan-2-yl; COCH.sub.3; COCH.sub.2CH.sub.3; 2-methoxy-2-propyl; (dimethylamino)methyl; 1-(dimethylamino)ethyl; fluoro; chloro; phenyl; pyridyl; pyrazolyl; and S(O.sub.2)CH.sub.3.

    [0891] In some embodiments of the compound of formula AA,

    the substituted ring A is

    ##STR00179##

    and R.sup.1 is selected from: [0892] C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy; 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy; C.sub.1-C.sub.6 alkyl substituted with one or more oxo; C.sub.3-C.sub.7 cycloalkyl substituted with one or more oxo; C.sub.1-C.sub.6 alkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.3-C.sub.7 cycloalkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 alkyl substituted with one or more NR.sup.8R.sup.9; 3- to 7-membered heterocycloalkyl substituted with one or more NR.sup.8R.sup.9; C.sub.1-C.sub.6 haloalkyl; C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 haloalkoxy; halo; CN; NO.sub.2; COC.sub.1-C.sub.6 alkyl; CO—C.sub.6-C.sub.10 aryl; CO (5- to 10-membered heteroaryl); CO.sub.2C.sub.1-C.sub.6 alkyl; CO.sub.2C.sub.3-C.sub.8 cycloalkyl; OCOC.sub.1-C.sub.6 alkyl; OCOC.sub.6-C.sub.10 aryl; OCO (5- to 10-membered heteroaryl); OCO (3- to 7-membered heterocycloalkyl); C.sub.6-C.sub.10 aryl; 5- to 10-membered heteroaryl; NH.sub.2; NHC.sub.1-C.sub.6 alkyl; N(C.sub.1-C.sub.6 alkyl).sub.2; CONR.sup.8R.sup.9; SF.sub.5; and S(O.sub.2)C.sub.1-C.sub.6 alkyl.

    [0893] In some embodiments of the compound of formula AA,

    the substituted ring A is

    ##STR00180##

    and R.sup.1 is selected from: [0894] 1-hydroxy-2-methylpropan-2-yl; methyl; isopropyl; 2-hydroxy-2-propyl; hydroxymethyl; 1-hydroxyethyl; 2-hydroxyethyl; 1-hydroxy-2-propyl; 1-hydroxy-1-cyclopropyl; 1-hydroxy-1-cyclobutyl; 1-hydroxy-1-cyclopentyl; 1-hydroxy-1-cyclohexyl; morpholinyl; 1,3-dioxolan-2-yl; COCH.sub.3; COCH.sub.2CH.sub.3; 2-methoxy-2-propyl; (dimethylamino)methyl; 1-(dimethylamino)ethyl; fluoro; chloro; phenyl; pyridyl; pyrazolyl; and S(O.sub.2)CH.sub.3.

    [0895] In some embodiments of the compound of formula AA,

    the substituted ring A is

    ##STR00181##

    and R.sup.1 is selected from: [0896] C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy; 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy; C.sub.1-C.sub.6 alkyl substituted with one or more oxo; C.sub.3-C.sub.7 cycloalkyl substituted with one or more oxo; C.sub.1-C.sub.6 alkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.3-C.sub.7 cycloalkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 alkyl substituted with one or more NR.sup.8R.sup.9; 3- to 7-membered heterocycloalkyl substituted with one or more NR.sup.8R.sup.9; C.sub.1-C.sub.6 haloalkyl; C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 haloalkoxy; halo; CN; NO.sub.2; COC.sub.1-C.sub.6 alkyl; CO—C.sub.6-C.sub.10 aryl; CO (5- to 10-membered heteroaryl); CO.sub.2C.sub.1-C.sub.6 alkyl; CO.sub.2C.sub.3-C.sub.8 cycloalkyl; OCOC.sub.1-C.sub.6 alkyl; OCOC.sub.6-C.sub.10 aryl; OCO (5- to 10-membered heteroaryl); OCO (3- to 7-membered heterocycloalkyl); C.sub.6-C.sub.10 aryl; 5- to 10-membered heteroaryl; NH.sub.2; NHC.sub.1-C.sub.6 alkyl; N(C.sub.1-C.sub.6 alkyl).sub.2; CONR.sup.8R.sup.9; SF.sub.5; and S(O.sub.2)C.sub.1-C.sub.6 alkyl.

    [0897] In some embodiments of the compound of formula AA,

    the substituted ring A is

    ##STR00182##

    and R.sup.1 is selected from: [0898] 1-hydroxy-2-methylpropan-2-yl; methyl; isopropyl; 2-hydroxy-2-propyl; hydroxymethyl; 1-hydroxyethyl; 2-hydroxyethyl; 1-hydroxy-2-propyl; 1-hydroxy-1-cyclopropyl; 1-hydroxy-1-cyclobutyl; 1-hydroxy-1-cyclopentyl; 1-hydroxy-1-cyclohexyl; morpholinyl; 1,3-dioxolan-2-yl; COCH.sub.3; COCH.sub.2CH.sub.3; 2-methoxy-2-propyl; (dimethylamino)methyl; 1-(dimethylamino)ethyl; fluoro; chloro; phenyl; pyridyl; pyrazolyl; and S(O.sub.2)CH.sub.3.

    [0899] In some embodiments of the compound of formula AA,

    the substituted ring A is

    ##STR00183##

    and R.sup.1 is selected from: [0900] C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy; 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy; C.sub.1-C.sub.6 alkyl substituted with one or more oxo; C.sub.3-C.sub.7 cycloalkyl substituted with one or more oxo; C.sub.1-C.sub.6 alkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.3-C.sub.7 cycloalkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 alkyl substituted with one or more NR.sup.8R.sup.9; 3- to 7-membered heterocycloalkyl substituted with one or more NR.sup.8R.sup.9; C.sub.1-C.sub.6 haloalkyl; C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 haloalkoxy; halo; CN; NO.sub.2; COC.sub.1-C.sub.6 alkyl; CO—C.sub.6-C.sub.10 aryl; CO (5- to 10-membered heteroaryl); CO.sub.2C.sub.1-C.sub.6 alkyl; CO.sub.2C.sub.3-C.sub.8 cycloalkyl; OCOC.sub.1-C.sub.6 alkyl; OCOC.sub.6-C.sub.10 aryl; OCO (5- to 10-membered heteroaryl); OCO (3- to 7-membered heterocycloalkyl); C.sub.6-C.sub.10 aryl; 5- to 10-membered heteroaryl; NH.sub.2; NHC.sub.1-C.sub.6 alkyl; N(C.sub.1-C.sub.6 alkyl).sub.2; CONR.sup.8R.sup.9; SF.sub.5; and S(O.sub.2)C.sub.1-C.sub.6 alkyl.

    [0901] In some embodiments of the compound of formula AA,

    the substituted ring A is

    ##STR00184##

    and R.sup.1 is selected from: [0902] 1-hydroxy-2-methylpropan-2-yl; methyl; isopropyl; 2-hydroxy-2-propyl; hydroxymethyl; 1-hydroxyethyl; 2-hydroxyethyl; 1-hydroxy-2-propyl; 1-hydroxy-1-cyclopropyl; 1-hydroxy-1-cyclobutyl; 1-hydroxy-1-cyclopentyl; 1-hydroxy-1-cyclohexyl; morpholinyl; 1,3-dioxolan-2-yl; COCH.sub.3; COCH.sub.2CH.sub.3; 2-methoxy-2-propyl; (dimethylamino)methyl; 1-(dimethylamino)ethyl; fluoro; chloro; phenyl; pyridyl; pyrazolyl; and S(O.sub.2)CH.sub.3.

    [0903] In some embodiments of the compound of formula AA,

    the substituted ring A is

    ##STR00185##

    and R.sup.1 is selected from: [0904] C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy; 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy; C.sub.1-C.sub.6 alkyl substituted with one or more oxo; C.sub.3-C.sub.7 cycloalkyl substituted with one or more oxo; C.sub.1-C.sub.6 alkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.3-C.sub.7 cycloalkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 alkyl substituted with one or more NR.sup.8R.sup.9; 3- to 7-membered heterocycloalkyl substituted with one or more NR.sup.8R.sup.9; C.sub.1-C.sub.6 haloalkyl; C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 haloalkoxy; halo; CN; NO.sub.2; COC.sub.1-C.sub.6 alkyl; CO—C.sub.6-C.sub.10 aryl; CO (5- to 10-membered heteroaryl); CO.sub.2C.sub.1-C.sub.6 alkyl; CO.sub.2C.sub.3-C.sub.8 cycloalkyl; OCOC.sub.1-C.sub.6 alkyl; OCOC.sub.6-C.sub.10 aryl; OCO (5- to 10-membered heteroaryl); OCO (3- to 7-membered heterocycloalkyl); C.sub.6-C.sub.10 aryl; 5- to 10-membered heteroaryl; NH.sub.2; NHC.sub.1-C.sub.6 alkyl; N(C.sub.1-C.sub.6 alkyl).sub.2; CONR.sup.8R.sup.9; SF.sub.5; and S(O.sub.2)C.sub.1-C.sub.6 alkyl.

    [0905] In some embodiments of the compound of formula AA,

    the substituted ring A is

    ##STR00186##

    and R.sup.1 is selected from: [0906] 1-hydroxy-2-methylpropan-2-yl; methyl; isopropyl; 2-hydroxy-2-propyl; hydroxymethyl; 1-hydroxyethyl; 2-hydroxyethyl; 1-hydroxy-2-propyl; 1-hydroxy-1-cyclopropyl; 1-hydroxy-1-cyclobutyl; 1-hydroxy-1-cyclopentyl; 1-hydroxy-1-cyclohexyl; morpholinyl; 1,3-dioxolan-2-yl; COCH.sub.3; COCH.sub.2CH.sub.3; 2-methoxy-2-propyl; (dimethylamino)methyl; 1-(dimethylamino)ethyl; fluoro; chloro; phenyl; pyridyl; pyrazolyl; and S(O.sub.2)CH.sub.3.

    [0907] In some embodiments of the compound of formula AA,

    the substituted ring A is

    ##STR00187##

    and R.sup.1 is selected from: [0908] C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy; 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy; C.sub.1-C.sub.6 alkyl substituted with one or more oxo; C.sub.3-C.sub.7 cycloalkyl substituted with one or more oxo; C.sub.1-C.sub.6 alkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.3-C.sub.7 cycloalkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 alkyl substituted with one or more NR.sup.8R.sup.9; 3- to 7-membered heterocycloalkyl substituted with one or more NR.sup.8R.sup.9; C.sub.1-C.sub.6 haloalkyl; C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 haloalkoxy; halo; CN; NO.sub.2; COC.sub.1-C.sub.6 alkyl; CO—C.sub.6-C.sub.10 aryl; CO (5- to 10-membered heteroaryl); CO.sub.2C.sub.1-C.sub.6 alkyl; CO.sub.2C.sub.3-C.sub.8 cycloalkyl; OCOC.sub.1-C.sub.6 alkyl; OCOC.sub.6-C.sub.10 aryl; OCO (5- to 10-membered heteroaryl); OCO (3- to 7-membered heterocycloalkyl); C.sub.6-C.sub.10 aryl; 5- to 10-membered heteroaryl; NH.sub.2; NHC.sub.1-C.sub.6 alkyl; N(C.sub.1-C.sub.6 alkyl).sub.2; CONR.sup.8R.sup.9; SF.sub.5; and S(O.sub.2)C.sub.1-C.sub.6 alkyl. In some embodiments of the compound of formula AA,
    the substituted ring A is

    ##STR00188##

    and R.sup.1 is selected from: [0909] 1-hydroxy-2-methylpropan-2-yl; methyl; isopropyl; 2-hydroxy-2-propyl; hydroxymethyl; 1-hydroxyethyl; 2-hydroxyethyl; 1-hydroxy-2-propyl; 1-hydroxy-1-cyclopropyl; 1-hydroxy-1-cyclobutyl; 1-hydroxy-1-cyclopentyl; 1-hydroxy-1-cyclohexyl; morpholinyl; 1,3-dioxolan-2-yl; COCH.sub.3; COCH.sub.2CH.sub.3; 2-methoxy-2-propyl; (dimethylamino)methyl; 1-(dimethylamino)ethyl; fluoro; chloro; phenyl; pyridyl; pyrazolyl; and S(O.sub.2)CH.sub.3.

    [0910] In some embodiments of the compound of formula AA,

    the substituted ring A is

    ##STR00189##

    and R.sup.1 is selected from: [0911] C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy; 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy; C.sub.1-C.sub.6 alkyl substituted with one or more oxo; C.sub.3-C.sub.7 cycloalkyl substituted with one or more oxo; C.sub.1-C.sub.6 alkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.3-C.sub.7 cycloalkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 alkyl substituted with one or more NR.sup.8R.sup.9; 3- to 7-membered heterocycloalkyl substituted with one or more NR.sup.8R.sup.9; C.sub.1-C.sub.6 haloalkyl; C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 haloalkoxy; halo; CN; NO.sub.2; COC.sub.1-C.sub.6 alkyl; CO—C.sub.6-C.sub.10 aryl; CO (5- to 10-membered heteroaryl); CO.sub.2C.sub.1-C.sub.6 alkyl; CO.sub.2C.sub.3-C.sub.8 cycloalkyl; OCOC.sub.1-C.sub.6 alkyl; OCOC.sub.6-C.sub.10 aryl; OCO (5- to 10-membered heteroaryl); OCO (3- to 7-membered heterocycloalkyl); C.sub.6-C.sub.10 aryl; 5- to 10-membered heteroaryl; NH.sub.2; NHC.sub.1-C.sub.6 alkyl; N(C.sub.1-C.sub.6 alkyl).sub.2; CONR.sup.8R.sup.9; SF.sub.5; and S(O.sub.2)C.sub.1-C.sub.6 alkyl.

    [0912] In some embodiments of the compound of formula AA,

    the substituted ring A is

    ##STR00190##

    and R.sup.1 is selected from: [0913] 1-hydroxy-2-methylpropan-2-yl; methyl; isopropyl; 2-hydroxy-2-propyl; hydroxymethyl; 1-hydroxyethyl; 2-hydroxyethyl; 1-hydroxy-2-propyl; 1-hydroxy-1-cyclopropyl; 1-hydroxy-1-cyclobutyl; 1-hydroxy-1-cyclopentyl; 1-hydroxy-1-cyclohexyl; morpholinyl; 1,3-dioxolan-2-yl; COCH.sub.3; COCH.sub.2CH.sub.3; 2-methoxy-2-propyl; (dimethylamino)methyl; 1-(dimethylamino)ethyl; fluoro; chloro; phenyl; pyridyl; pyrazolyl; and S(O.sub.2)CH.sub.3.

    [0914] In some embodiments of the compound of formula AA,

    the substituted ring A is

    ##STR00191##

    and R.sup.1 is selected from: [0915] C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy; 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy; C.sub.1-C.sub.6 alkyl substituted with one or more oxo; C.sub.3-C.sub.7 cycloalkyl substituted with one or more oxo; C.sub.1-C.sub.6 alkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.3-C.sub.7 cycloalkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 alkyl substituted with one or more NR.sup.8R.sup.9; 3- to 7-membered heterocycloalkyl substituted with one or more NR.sup.8R.sup.9; C.sub.1-C.sub.6 haloalkyl; C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 haloalkoxy; halo; CN; NO.sub.2; COC.sub.1-C.sub.6 alkyl; CO—C.sub.6-C.sub.10 aryl; CO (5- to 10-membered heteroaryl); CO.sub.2C.sub.1-C.sub.6 alkyl; CO.sub.2C.sub.3-C.sub.8 cycloalkyl; OCOC.sub.1-C.sub.6 alkyl; OCOC.sub.6-C.sub.10 aryl; OCO (5- to 10-membered heteroaryl); OCO (3- to 7-membered heterocycloalkyl); C.sub.6-C.sub.10 aryl; 5- to 10-membered heteroaryl; NH.sub.2; NHC.sub.1-C.sub.6 alkyl; N(C.sub.1-C.sub.6 alkyl).sub.2; CONR.sup.8R.sup.9; SF.sub.5; and S(O.sub.2)C.sub.1-C.sub.6 alkyl.

    [0916] In some embodiments of the compound of formula AA,

    the substituted ring A is

    ##STR00192##

    and R.sup.1 is selected from: [0917] 1-hydroxy-2-methylpropan-2-yl; methyl; isopropyl; 2-hydroxy-2-propyl; hydroxymethyl; 1-hydroxyethyl; 2-hydroxyethyl; 1-hydroxy-2-propyl; 1-hydroxy-1-cyclopropyl; 1-hydroxy-1-cyclobutyl; 1-hydroxy-1-cyclopentyl; 1-hydroxy-1-cyclohexyl; morpholinyl; 1,3-dioxolan-2-yl; COCH.sub.3; COCH.sub.2CH.sub.3; 2-methoxy-2-propyl; (dimethylamino)methyl; 1-(dimethylamino)ethyl; fluoro; chloro; phenyl; pyridyl; pyrazolyl; and S(O.sub.2)CH.sub.3.

    [0918] In some embodiments of the compound of formula AA,

    the substituted ring A is

    ##STR00193##

    and R.sup.1 is selected from: [0919] C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy; 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy; C.sub.1-C.sub.6 alkyl substituted with one or more oxo; C.sub.3-C.sub.7 cycloalkyl substituted with one or more oxo; C.sub.1-C.sub.6 alkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.3-C.sub.7 cycloalkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 alkyl substituted with one or more NR.sup.8R.sup.9; 3- to 7-membered heterocycloalkyl substituted with one or more NR.sup.8R.sup.9; C.sub.1-C.sub.6 haloalkyl; C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 haloalkoxy; halo; CN; NO.sub.2; COC.sub.1-C.sub.6 alkyl; CO—C.sub.6-C.sub.10 aryl; CO (5- to 10-membered heteroaryl); CO.sub.2C.sub.1-C.sub.6 alkyl; CO.sub.2C.sub.3-C.sub.8 cycloalkyl; OCOC.sub.1-C.sub.6 alkyl; OCOC.sub.6-C.sub.10 aryl; OCO (5- to 10-membered heteroaryl); OCO (3- to 7-membered heterocycloalkyl); C.sub.6-C.sub.10 aryl; 5- to 10-membered heteroaryl; NH.sub.2; NHC.sub.1-C.sub.6 alkyl; N(C.sub.1-C.sub.6 alkyl).sub.2; CONR.sup.8R.sup.9; SF.sub.5; and S(O.sub.2)C.sub.1-C.sub.6 alkyl.

    [0920] In some embodiments of the compound of formula AA,

    the substituted ring A is

    ##STR00194##

    and R.sup.1 is selected from: [0921] 1-hydroxy-2-methylpropan-2-yl; methyl; isopropyl; 2-hydroxy-2-propyl; hydroxymethyl; 1-hydroxyethyl; 2-hydroxyethyl; 1-hydroxy-2-propyl; 1-hydroxy-1-cyclopropyl; 1-hydroxy-1-cyclobutyl; 1-hydroxy-1-cyclopentyl; 1-hydroxy-1-cyclohexyl; morpholinyl; 1,3-dioxolan-2-yl; COCH.sub.3; COCH.sub.2CH.sub.3; 2-methoxy-2-propyl; (dimethylamino)methyl; 1-(dimethylamino)ethyl; fluoro; chloro; phenyl; pyridyl; pyrazolyl; and S(O.sub.2)CH.sub.3.

    [0922] In some embodiments of the compound of formula AA,

    the substituted ring A is

    ##STR00195##

    and R.sup.1 is selected from: [0923] C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy; 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy; C.sub.1-C.sub.6 alkyl substituted with one or more oxo; C.sub.3-C.sub.7 cycloalkyl substituted with one or more oxo; C.sub.1-C.sub.6 alkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.3-C.sub.7 cycloalkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 alkyl substituted with one or more NR.sup.8R.sup.9; 3- to 7-membered heterocycloalkyl substituted with one or more NR.sup.8R.sup.9; C.sub.1-C.sub.6 haloalkyl; C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 haloalkoxy; halo; CN; NO.sub.2; COC.sub.1-C.sub.6 alkyl; CO—C.sub.6-C.sub.10 aryl; CO (5- to 10-membered heteroaryl); CO.sub.2C.sub.1-C.sub.6 alkyl; CO.sub.2C.sub.3-C.sub.8 cycloalkyl; OCOC.sub.1-C.sub.6 alkyl; OCOC.sub.6-C.sub.10 aryl; OCO (5- to 10-membered heteroaryl); OCO (3- to 7-membered heterocycloalkyl); C.sub.6-C.sub.10 aryl; 5- to 10-membered heteroaryl; NH.sub.2; NHC.sub.1-C.sub.6 alkyl; N(C.sub.1-C.sub.6 alkyl).sub.2; CONR.sup.8R.sup.9; SF.sub.5; and S(O.sub.2)C.sub.1-C.sub.6 alkyl.

    [0924] In some embodiments of the compound of formula AA,

    the substituted ring A is

    ##STR00196##

    and R.sup.1 is selected from: [0925] 1-hydroxy-2-methylpropan-2-yl; methyl; isopropyl; 2-hydroxy-2-propyl; hydroxymethyl; 1-hydroxyethyl; 2-hydroxyethyl; 1-hydroxy-2-propyl; 1-hydroxy-1-cyclopropyl; 1-hydroxy-1-cyclobutyl; 1-hydroxy-1-cyclopentyl; 1-hydroxy-1-cyclohexyl; morpholinyl; 1,3-dioxolan-2-yl; COCH.sub.3; COCH.sub.2CH.sub.3; 2-methoxy-2-propyl; (dimethylamino)methyl; 1-(dimethylamino)ethyl; fluoro; chloro; phenyl; pyridyl; pyrazolyl; and S(O.sub.2)CH.sub.3.

    [0926] In some embodiments of the compound of formula AA,

    the substituted ring A is

    ##STR00197##

    and R.sup.1 is selected from: [0927] C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy; 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy; C.sub.1-C.sub.6 alkyl substituted with one or more oxo; C.sub.3-C.sub.7 cycloalkyl substituted with one or more oxo; C.sub.1-C.sub.6 alkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.3-C.sub.7 cycloalkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 alkyl substituted with one or more NR.sup.8R.sup.9; 3- to 7-membered heterocycloalkyl substituted with one or more NR.sup.8R.sup.9; C.sub.1-C.sub.6 haloalkyl; C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 haloalkoxy; halo; CN; NO.sub.2; COC.sub.1-C.sub.6 alkyl; CO—C.sub.6-C.sub.10 aryl; CO (5- to 10-membered heteroaryl); CO.sub.2C.sub.1-C.sub.6 alkyl; CO.sub.2C.sub.3-C.sub.8 cycloalkyl; OCOC.sub.1-C.sub.6 alkyl; OCOC.sub.6-C.sub.10 aryl; OCO (5- to 10-membered heteroaryl); OCO (3- to 7-membered heterocycloalkyl); C.sub.6-C.sub.10 aryl; 5- to 10-membered heteroaryl; NH.sub.2; NHC.sub.1-C.sub.6 alkyl; N(C.sub.1-C.sub.6 alkyl).sub.2; CONR.sup.8R.sup.9; SF.sub.5; and S(O.sub.2)C.sub.1-C.sub.6 alkyl.

    [0928] In some embodiments of the compound of formula AA,

    the substituted ring A is

    ##STR00198##

    and R.sup.1 is selected from: [0929] 1-hydroxy-2-methylpropan-2-yl; methyl; isopropyl; 2-hydroxy-2-propyl; hydroxymethyl; 1-hydroxyethyl; 2-hydroxyethyl; 1-hydroxy-2-propyl; 1-hydroxy-1-cyclopropyl; 1-hydroxy-1-cyclobutyl; 1-hydroxy-1-cyclopentyl; 1-hydroxy-1-cyclohexyl; morpholinyl; 1,3-dioxolan-2-yl; COCH.sub.3; COCH.sub.2CH.sub.3; 2-methoxy-2-propyl; (dimethylamino)methyl; 1-(dimethylamino)ethyl; fluoro; chloro; phenyl; pyridyl; pyrazolyl; and S(O.sub.2)CH.sub.3.

    [0930] In some embodiments of the compound of formula AA,

    the substituted ring A is

    ##STR00199##

    and R.sup.1 is selected from: [0931] C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy; 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy; C.sub.1-C.sub.6 alkyl substituted with one or more oxo; C.sub.3-C.sub.7 cycloalkyl substituted with one or more oxo; C.sub.1-C.sub.6 alkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.3-C.sub.7 cycloalkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 alkyl substituted with one or more NR.sup.8R.sup.9; 3- to 7-membered heterocycloalkyl substituted with one or more NR.sup.8R.sup.9; C.sub.1-C.sub.6 haloalkyl; C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 haloalkoxy; halo; CN; NO.sub.2; COC.sub.1-C.sub.6 alkyl; CO—C.sub.6-C.sub.10 aryl; CO (5- to 10-membered heteroaryl); CO.sub.2C.sub.1-C.sub.6 alkyl; CO.sub.2C.sub.3-C.sub.8 cycloalkyl; OCOC.sub.1-C.sub.6 alkyl; OCOC.sub.6-C.sub.10 aryl; OCO (5- to 10-membered heteroaryl); OCO (3- to 7-membered heterocycloalkyl); C.sub.6-C.sub.10 aryl; 5- to 10-membered heteroaryl; NH.sub.2; NHC.sub.1-C.sub.6 alkyl; N(C.sub.1-C.sub.6 alkyl).sub.2; CONR.sup.8R.sup.9; SF.sub.5; and S(O.sub.2)C.sub.1-C.sub.6 alkyl.

    [0932] In some embodiments of the compound of formula AA,

    the substituted ring A is

    ##STR00200##

    and R.sup.1 is selected from: [0933] 1-hydroxy-2-methylpropan-2-yl; methyl; isopropyl; 2-hydroxy-2-propyl; hydroxymethyl; 1-hydroxyethyl; 2-hydroxyethyl; 1-hydroxy-2-propyl; 1-hydroxy-1-cyclopropyl; 1-hydroxy-1-cyclobutyl; 1-hydroxy-1-cyclopentyl; 1-hydroxy-1-cyclohexyl; morpholinyl; 1,3-dioxolan-2-yl; COCH.sub.3; COCH.sub.2CH.sub.3; 2-methoxy-2-propyl; (dimethylamino)methyl; 1-(dimethylamino)ethyl; fluoro; chloro; phenyl; pyridyl; pyrazolyl; and S(O.sub.2)CH.sub.3.
    the substituted ring A is

    ##STR00201##

    and R.sup.1 is selected from: [0934] C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy; 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy; C.sub.1-C.sub.6 alkyl substituted with one or more oxo; C.sub.3-C.sub.7 cycloalkyl substituted with one or more oxo; C.sub.1-C.sub.6 alkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.3-C.sub.7 cycloalkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 alkyl substituted with one or more NR.sup.8R.sup.9; 3- to 7-membered heterocycloalkyl substituted with one or more NR.sup.8R.sup.9; C.sub.1-C.sub.6 haloalkyl; C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 haloalkoxy; halo; CN; NO.sub.2; COC.sub.1-C.sub.6 alkyl; CO—C.sub.6-C.sub.10 aryl; CO (5- to 10-membered heteroaryl); CO.sub.2C.sub.1-C.sub.6 alkyl; CO.sub.2C.sub.3-C.sub.8 cycloalkyl; OCOC.sub.1-C.sub.6 alkyl; OCOC.sub.6-C.sub.10 aryl; OCO (5- to 10-membered heteroaryl); OCO (3- to 7-membered heterocycloalkyl); C.sub.6-C.sub.10 aryl; 5- to 10-membered heteroaryl; NH.sub.2; NHC.sub.1-C.sub.6 alkyl; N(C.sub.1-C.sub.6 alkyl).sub.2; CONR.sup.8R.sup.9; SF.sub.5; and S(O.sub.2)C.sub.1-C.sub.6 alkyl.

    [0935] In some embodiments of the compound of formula AA,

    the substituted ring A is

    ##STR00202##

    and R.sup.1 is selected from: [0936] 1-hydroxy-2-methylpropan-2-yl; methyl; isopropyl; 2-hydroxy-2-propyl; hydroxymethyl; 1-hydroxyethyl; 2-hydroxyethyl; 1-hydroxy-2-propyl; 1-hydroxy-1-cyclopropyl; 1-hydroxy-1-cyclobutyl; 1-hydroxy-1-cyclopentyl; 1-hydroxy-1-cyclohexyl; morpholinyl; 1,3-dioxolan-2-yl; COCH.sub.3; COCH.sub.2CH.sub.3; 2-methoxy-2-propyl; (dimethylamino)methyl; 1-(dimethylamino)ethyl; fluoro; chloro; phenyl; pyridyl; pyrazolyl; and S(O.sub.2)CH.sub.3.

    [0937] In some embodiments of the compound of formula AA,

    the substituted ring A is

    ##STR00203##

    and R.sup.1 is selected from: [0938] C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy; 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy; C.sub.1-C.sub.6 alkyl substituted with one or more oxo; C.sub.3-C.sub.7 cycloalkyl substituted with one or more oxo; C.sub.1-C.sub.6 alkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.3-C.sub.7 cycloalkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 alkyl substituted with one or more NR.sup.8R.sup.9; 3- to 7-membered heterocycloalkyl substituted with one or more NR.sup.8R.sup.9; C.sub.1-C.sub.6 haloalkyl; C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 haloalkoxy; halo; CN; NO.sub.2; COC.sub.1-C.sub.6 alkyl; CO—C.sub.6-C.sub.10 aryl; CO-5- to 10-membered heteroaryl; CO.sub.2C.sub.1-C.sub.6 alkyl; CO.sub.2C.sub.3-C.sub.8 cycloalkyl; OCOC.sub.1-C.sub.6 alkyl; OCOC.sub.6-C.sub.10 aryl; OCO (5- to 10-membered heteroaryl); OCO (3- to 7-membered heterocycloalkyl); C.sub.6-C.sub.10 aryl; 5- to 10-membered heteroaryl; NH.sub.2; NHC.sub.1-C.sub.6 alkyl; N(C.sub.1-C.sub.6 alkyl).sub.2; CONR.sup.8R.sup.9; SF.sub.5; and S(O.sub.2)C.sub.1-C.sub.6 alkyl.

    [0939] In some embodiments of the compound of formula AA,

    the substituted ring A is

    ##STR00204##

    and R.sup.1 is selected from: [0940] 1-hydroxy-2-methylpropan-2-yl; methyl; isopropyl; 2-hydroxy-2-propyl; hydroxymethyl; 1-hydroxyethyl; 2-hydroxyethyl; 1-hydroxy-2-propyl; 1-hydroxy-1-cyclopropyl; 1-hydroxy-1-cyclobutyl; 1-hydroxy-1-cyclopentyl; 1-hydroxy-1-cyclohexyl; morpholinyl; 1,3-dioxolan-2-yl; COCH.sub.3; COCH.sub.2CH.sub.3; 2-methoxy-2-propyl; (dimethylamino)methyl; 1-(dimethylamino)ethyl; fluoro; chloro; phenyl; pyridyl; pyrazolyl; and S(O.sub.2)CH.sub.3.

    [0941] In some embodiments of the compound of formula AA,

    the substituted ring A is

    ##STR00205##

    and R.sup.1 is selected from: [0942] C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy; 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy; C.sub.1-C.sub.6 alkyl substituted with one or more oxo; C.sub.3-C.sub.7 cycloalkyl substituted with one or more oxo; C.sub.1-C.sub.6 alkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.3-C.sub.7 cycloalkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 alkyl substituted with one or more NR.sup.8R.sup.9; 3- to 7-membered heterocycloalkyl substituted with one or more NR.sup.8R.sup.9; C.sub.1-C.sub.6 haloalkyl; C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 haloalkoxy; halo; CN; NO.sub.2; COC.sub.1-C.sub.6 alkyl; CO—C.sub.6-C.sub.10 aryl; CO (5- to 10-membered heteroaryl); CO.sub.2C.sub.1-C.sub.6 alkyl; CO.sub.2C.sub.3-C.sub.8 cycloalkyl; OCOC.sub.1-C.sub.6 alkyl; OCOC.sub.6-C.sub.10 aryl; OCO (5- to 10-membered heteroaryl); OCO (3- to 7-membered heterocycloalkyl); C.sub.6-C.sub.10 aryl; 5- to 10-membered heteroaryl; NH.sub.2; NHC.sub.1-C.sub.6 alkyl; N(C.sub.1-C.sub.6 alkyl).sub.2; CONR.sup.8R.sup.9; SF.sub.5; and S(O.sub.2)C.sub.1-C.sub.6 alkyl.

    [0943] In some embodiments of the compound of formula AA,

    the substituted ring A is

    ##STR00206##

    and R.sup.1 is selected from: [0944] 1-hydroxy-2-methylpropan-2-yl; methyl; isopropyl; 2-hydroxy-2-propyl; hydroxymethyl; 1-hydroxyethyl; 2-hydroxyethyl; 1-hydroxy-2-propyl; 1-hydroxy-1-cyclopropyl; 1-hydroxy-1-cyclobutyl; 1-hydroxy-1-cyclopentyl; 1-hydroxy-1-cyclohexyl; morpholinyl; 1,3-dioxolan-2-yl; COCH.sub.3; COCH.sub.2CH.sub.3; 2-methoxy-2-propyl; (dimethylamino)methyl; 1-(dimethylamino)ethyl; fluoro; chloro; phenyl; pyridyl; pyrazolyl; and S(O.sub.2)CH.sub.3.

    [0945] In some embodiments of the compound of formula AA,

    the substituted ring A is

    ##STR00207##

    and R.sup.1 is selected from: [0946] C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy; 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy; C.sub.1-C.sub.6 alkyl substituted with one or more oxo; C.sub.3-C.sub.7 cycloalkyl substituted with one or more oxo; C.sub.1-C.sub.6 alkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.3-C.sub.7 cycloalkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 haloalkyl; C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 haloalkoxy; halo; CN; NO.sub.2; COC.sub.1-C.sub.6 alkyl; CO—C.sub.6-C.sub.10 aryl; CO (5- to 10-membered heteroaryl); CO.sub.2C.sub.1-C.sub.6 alkyl; CO.sub.2C.sub.3-C.sub.8 cycloalkyl; OCOC.sub.1-C.sub.6 alkyl; OCOC.sub.6-C.sub.10 aryl; OCO (5- to 10-membered heteroaryl); OCO (3- to 7-membered heterocycloalkyl); C.sub.6-C.sub.10 aryl; 5- to 10-membered heteroaryl; NH.sub.2; NHC.sub.1-C.sub.6 alkyl; N(C.sub.1-C.sub.6 alkyl).sub.2; CONR.sup.8R.sup.9; SF.sub.5; C.sub.1-C.sub.6 alkyl substituted with one or more NR.sup.8R.sup.9; and S(O.sub.2)C.sub.1-C.sub.6 alkyl.
    the substituted ring A is

    ##STR00208##

    and R.sup.1 is selected from: [0947] 1-hydroxy-2-methylpropan-2-yl; methyl; isopropyl; 2-hydroxy-2-propyl; hydroxymethyl; 1-hydroxyethyl; 2-hydroxyethyl; 1-hydroxy-2-propyl; 1-hydroxy-1-cyclopropyl; 1-hydroxy-1-cyclobutyl; 1-hydroxy-1-cyclopentyl; 1-hydroxy-1-cyclohexyl; morpholinyl; [0948] (dimethylamino)methyl; 1,3-dioxolan-2-yl; COCH.sub.3; COCH.sub.2CH.sub.3; 2-methoxy-2-propyl; fluoro; chloro; phenyl; pyridyl; pyrazolyl; and S(O.sub.2)CH.sub.3.
    the substituted ring A is

    ##STR00209##

    and R.sup.1 is selected from: [0949] C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy; 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy; C.sub.1-C.sub.6 alkyl substituted with one or more oxo; C.sub.3—C.sub.7 cycloalkyl substituted with one or more oxo; C.sub.1-C.sub.6 alkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.3-C.sub.7 cycloalkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 haloalkyl; C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 haloalkoxy; halo; CN; NO.sub.2; COC.sub.1-C.sub.6 alkyl; CO—C.sub.6-C.sub.10 aryl; CO (5- to 10-membered heteroaryl); CO.sub.2C.sub.1-C.sub.6 alkyl; CO.sub.2C.sub.3-C.sub.8 cycloalkyl; OCOC.sub.1-C.sub.6 alkyl; OCOC.sub.6-C.sub.10 aryl; OCO (5- to 10-membered heteroaryl); OCO (3- to 7-membered heterocycloalkyl); C.sub.6-C.sub.10 aryl; 5- to 10-membered heteroaryl; NH.sub.2; NHC.sub.1-C.sub.6 alkyl; N(C.sub.1-C.sub.6 alkyl).sub.2; CONR.sup.8R.sup.9; SF.sub.5; C.sub.1-C.sub.6 alkyl substituted with one or more NR.sup.8R.sup.9; and S(O.sub.2)C.sub.1-C.sub.6 alkyl.
    the substituted ring A is

    ##STR00210##

    and R.sup.1 is selected from: [0950] 1-hydroxy-2-methylpropan-2-yl; methyl; isopropyl; 2-hydroxy-2-propyl; hydroxymethyl; 1-hydroxyethyl; 2-hydroxyethyl; 1-hydroxy-2-propyl; 1-hydroxy-1-cyclopropyl; 1-hydroxy-1-cyclobutyl; 1-hydroxy-1-cyclopentyl; 1-hydroxy-1-cyclohexyl; morpholinyl; 1,3-dioxolan-2-yl; COCH.sub.3; COCH.sub.2CH.sub.3; 2-methoxy-2-propyl; fluoro; chloro; phenyl; pyridyl; pyrazolyl; (dimethylamino)methyl; and S(O.sub.2)CH.sub.3.

    [0951] In some embodiments of the compound of formula AA,

    the substituted ring A is

    ##STR00211##

    and R.sup.1 and R.sup.2 are one of the following combinations: [0952] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; [0953] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.6-C.sub.10 aryl; [0954] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is 5- to 10-membered heteroaryl; [0955] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is SF.sub.5; [0956] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is S(O.sub.2)C.sub.1-C.sub.6 alkyl; [0957] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is halo;

    [0958] R.sup.1 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl;

    [0959] R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl;

    [0960] R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is halo; [0961] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.2 is methyl; [0962] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; [0963] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.2 is C.sub.1-C.sub.6 alkyl; [0964] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.2 is halo; [0965] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.6-C.sub.10 aryl; [0966] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is 5- to 10-membered heteroaryl; [0967] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is SF.sub.5. [0968] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is S(O.sub.2)C.sub.1-C.sub.6 alkyl; [0969] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is halo; [0970] R.sup.2 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; [0971] R.sup.2 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; [0972] R.sup.2 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is halo; [0973] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.1 is methyl; [0974] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; [0975] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.1 is C.sub.1-C.sub.6 alkyl; [0976] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.1 is halo.

    [0977] In some embodiments of the compound of formula AA,

    the substituted ring A is

    ##STR00212##

    and R.sup.1 and R.sup.2 are one of the following combinations: [0978] R.sup.1 is 1-hydroxy-2-methylpropan-2-yl, and R.sup.2 is methyl; [0979] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is methyl; [0980] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is isopropyl; [0981] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is 2-hydroxy-2-propyl; [0982] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is 1-hydroxyethyl; [0983] R.sup.1 is hydroxymethyl and R.sup.2 is methyl; [0984] R.sup.1 is 1-hydroxyethyl and R.sup.2 is methyl; [0985] R.sup.1 is 2-hydroxyethyl and R.sup.2 is methyl; [0986] R.sup.1 is 1-hydroxy-2-propyl and R.sup.2 is methyl; [0987] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is phenyl; [0988] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is pyridyl; [0989] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is pyrazolyl; [0990] R.sup.1 is 2-hydroxy-2-propyl, and R.sup.2 is S(O.sub.2)CH.sub.3; [0991] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is chloro; [0992] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is fluoro; [0993] R.sup.1 is 1-hydroxy-1-cyclopropyl, and R.sup.2 is methyl; [0994] R.sup.1 is 1-hydroxy-1-cyclobutyl, and R.sup.2 is methyl; [0995] R.sup.1 is 1-hydroxy-1-cyclopentyl, and R.sup.2 is methyl; [0996] R.sup.1 is 1-hydroxy-1-cyclohexyl, and R.sup.2 is methyl; [0997] R.sup.1 is morpholinyl, and R.sup.2 is methyl; [0998] R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is methyl; [0999] R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is fluoro; [1000] R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is chloro; [1001] R.sup.1 is COCH.sub.3, and R.sup.2 is methyl; [1002] R.sup.1 is 2-methoxy-2-propyl, and R.sup.2 is methyl; [1003] R.sup.2 is (dimethylamino)methyl, and R.sup.1 is methyl. [1004] R.sup.2 is 1-hydroxy-2-methylpropan-2-yl, and R.sup.1 is methyl; [1005] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is methyl; [1006] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is isopropyl; [1007] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is 1-hydroxyethyl; [1008] R.sup.2 is hydroxymethyl and R.sup.1 is methyl; [1009] R.sup.2 is 1-hydroxyethyl and R.sup.1 is methyl; [1010] R.sup.2 is 2-hydroxyethyl and R.sup.1 is methyl; [1011] R.sup.2 is 1-hydroxy-2-propyl and R.sup.1 is methyl; [1012] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is phenyl; [1013] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is 5- to 10-membered heteroaryl; [1014] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is pyridyl; [1015] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is pyrazolyl; [1016] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is S(O.sub.2)CH.sub.3; [1017] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is chloro; [1018] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is fluoro; [1019] R.sup.2 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; [1020] R.sup.2 is 1-hydroxy-1-cyclopropyl, and R.sup.1 is methyl; [1021] R.sup.2 is 1-hydroxy-1-cyclobutyl, and R.sup.1 is methyl; [1022] R.sup.2 is 1-hydroxy-1-cyclopentyl, and R.sup.1 is methyl; [1023] R.sup.2 is 1-hydroxy-1-cyclohexyl, and R.sup.1 is methyl; [1024] R.sup.2 is morpholinyl, and R.sup.1 is methyl; [1025] R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is methyl; [1026] R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is fluoro; [1027] R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is chloro; [1028] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.1 is methyl; [1029] R.sup.2 is COCH.sub.3, and R.sup.1 is methyl; or [1030] R.sup.2 is 2-methoxy-2-propyl, and R.sup.1 is methyl.

    [1031] In some embodiments, of the compound of formula AA,

    the substituted ring A is

    ##STR00213##

    and R.sup.1 and R.sup.2 are one of the following combinations: [1032] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; [1033] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.6-C.sub.10 aryl; [1034] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is 5- to 10-membered heteroaryl; [1035] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is SF.sub.5; [1036] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is S(O.sub.2)C.sub.1-C.sub.6 alkyl; [1037] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is halo; [1038] R.sup.1 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; [1039] R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; [1040] R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is halo; [1041] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.2 is methyl; [1042] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; [1043] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.2 is C.sub.1-C.sub.6 alkyl; [1044] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.2 is halo; [1045] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.6-C.sub.10 aryl; [1046] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is 5- to 10-membered heteroaryl; [1047] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is SF.sub.5. [1048] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is S(O.sub.2)C.sub.1-C.sub.6 alkyl; [1049] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is halo; [1050] R.sup.2 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; [1051] R.sup.2 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; [1052] R.sup.2 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is halo; [1053] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.1 is methyl; [1054] or [1055] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl. [1056] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.1 is C.sub.1-C.sub.6 alkyl; [1057] or [1058] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.1 is halo.

    [1059] In some embodiments, of the compound of formula AA,

    the substituted ring A is

    ##STR00214##

    and R.sup.1 and R.sup.2 are one of the following combinations: [1060] R.sup.1 is 1-hydroxy-2-methylpropan-2-yl, and R.sup.2 is methyl; [1061] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is methyl; [1062] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is isopropyl; [1063] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is 2-hydroxy-2-propyl; [1064] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is 1-hydroxyethyl; [1065] R.sup.1 is hydroxymethyl and R.sup.2 is methyl; [1066] R.sup.1 is 1-hydroxyethyl and R.sup.2 is methyl; [1067] R.sup.1 is 2-hydroxyethyl and R.sup.2 is methyl; [1068] R.sup.1 is 1-hydroxy-2-propyl and R.sup.2 is methyl; [1069] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is phenyl; [1070] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is pyridyl; [1071] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is pyrazolyl; [1072] R.sup.1 is 2-hydroxy-2-propyl, and R.sup.2 is S(O.sub.2)CH.sub.3; [1073] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is chloro; [1074] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is fluoro; [1075] R.sup.1 is 1-hydroxy-1-cyclopropyl, and R.sup.2 is methyl; [1076] R.sup.1 is 1-hydroxy-1-cyclobutyl, and R.sup.2 is methyl; [1077] R.sup.1 is 1-hydroxy-1-cyclopentyl, and R.sup.2 is methyl; [1078] R.sup.1 is 1-hydroxy-1-cyclohexyl, and R.sup.2 is methyl; [1079] R.sup.1 is morpholinyl, and R.sup.2 is methyl; [1080] R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is methyl; [1081] R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is fluoro; [1082] R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is chloro; [1083] R.sup.1 is COCH.sub.3, and R.sup.2 is methyl; [1084] R.sup.1 is 2-methoxy-2-propyl, and R.sup.2 is methyl; [1085] R.sup.1 is (dimethylamino)methyl, and R.sup.2 is methyl. [1086] R.sup.2 is 1-hydroxy-2-methylpropan-2-yl, and R.sup.1 is methyl; [1087] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is methyl; [1088] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is isopropyl; [1089] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is 1-hydroxyethyl; [1090] R.sup.2 is hydroxymethyl and R.sup.1 is methyl; [1091] R.sup.2 is 1-hydroxyethyl and R.sup.1 is methyl; [1092] R.sup.2 is 2-hydroxyethyl and R.sup.1 is methyl; [1093] R.sup.2 is 1-hydroxy-2-propyl and R.sup.1 is methyl; [1094] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is phenyl; [1095] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is 5- to 10-membered heteroaryl; [1096] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is pyridyl; [1097] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is pyrazolyl; [1098] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is S(O.sub.2)CH.sub.3; [1099] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is chloro; [1100] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is fluoro; [1101] R.sup.2 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; [1102] R.sup.2 is 1-hydroxy-1-cyclopropyl, and R.sup.1 is methyl; [1103] R.sup.2 is 1-hydroxy-1-cyclobutyl, and R.sup.1 is methyl; [1104] R.sup.2 is 1-hydroxy-1-cyclopentyl, and R.sup.1 is methyl; [1105] R.sup.2 is 1-hydroxy-1-cyclohexyl, and R.sup.1 is methyl; [1106] R.sup.2 is morpholinyl, and R.sup.1 is methyl; [1107] R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is methyl; [1108] R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is fluoro; [1109] R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is chloro; [1110] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.1 is methyl; [1111] R.sup.2 is (dimethylamino)methyl, and R.sup.1 is methyl; [1112] R.sup.2 is COCH.sub.3, and R.sup.1 is methyl; or [1113] R.sup.2 is 2-methoxy-2-propyl, and R.sup.1 is methyl.

    [1114] In some embodiments, of the compound of formula AA,

    the substituted ring A is

    ##STR00215##

    and R.sup.1 and R.sup.2 are one of the following combinations: [1115] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; [1116] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.6-C.sub.10 aryl; [1117] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is 5- to 10-membered heteroaryl; [1118] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is SF.sub.5; [1119] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is S(O.sub.2)C.sub.1-C.sub.6 alkyl; [1120] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is halo; [1121] R.sup.1 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; [1122] R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; [1123] R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is halo; [1124] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.2 is methyl; [1125] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; [1126] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.2 is C.sub.1-C.sub.6 alkyl; [1127] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.2 is halo; [1128] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.6-C.sub.10 aryl; [1129] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is 5- to 10-membered heteroaryl; [1130] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is SF.sub.5. [1131] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is S(O.sub.2)C.sub.1-C.sub.6 alkyl; [1132] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is halo; [1133] R.sup.2 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; [1134] R.sup.2 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; [1135] R.sup.2 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is halo; [1136] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.1 is C.sub.1-C.sub.6 alkyl; [1137] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.1 is halo; [1138] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.1 is methyl; or [1139] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl.

    [1140] In some embodiments, of the compound of formula AA,

    the substituted ring A is

    ##STR00216##

    and R.sup.1 and R.sup.2 are one of the following combinations: [1141] R.sup.1 is 1-hydroxy-2-methylpropan-2-yl, and R.sup.2 is methyl; [1142] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is methyl; [1143] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is isopropyl; [1144] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is 2-hydroxy-2-propyl; [1145] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is 1-hydroxyethyl; [1146] R.sup.1 is hydroxymethyl and R.sup.2 is methyl; [1147] R.sup.1 is 1-hydroxyethyl and R.sup.2 is methyl; [1148] R.sup.1 is 2-hydroxyethyl and R.sup.2 is methyl; [1149] R.sup.1 is 1-hydroxy-2-propyl and R.sup.2 is methyl; [1150] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is phenyl; [1151] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is pyridyl; [1152] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is pyrazolyl; [1153] R.sup.1 is 2-hydroxy-2-propyl, and R.sup.2 is S(O.sub.2)CH.sub.3; [1154] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is chloro; [1155] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is fluoro; [1156] R.sup.1 is 1-hydroxy-1-cyclopropyl, and R.sup.2 is methyl; [1157] R.sup.1 is 1-hydroxy-1-cyclobutyl, and R.sup.2 is methyl; [1158] R.sup.1 is 1-hydroxy-1-cyclopentyl, and R.sup.2 is methyl; [1159] R.sup.1 is 1-hydroxy-1-cyclohexyl, and R.sup.2 is methyl; [1160] R.sup.1 is morpholinyl, and R.sup.2 is methyl; [1161] R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is methyl; [1162] R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is fluoro; [1163] R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is chloro; [1164] R.sup.1 is COCH.sub.3, and R.sup.2 is methyl; [1165] R.sup.1 is 2-methoxy-2-propyl, and R.sup.2 is methyl; [1166] R.sup.1 is (dimethylamino)methyl, and R.sup.2 is methyl; [1167] R.sup.2 is 1-hydroxy-2-methylpropan-2-yl, and R.sup.1 is methyl; [1168] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is methyl; [1169] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is isopropyl; [1170] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is 1-hydroxyethyl; [1171] R.sup.2 is hydroxymethyl and R.sup.1 is methyl; [1172] R.sup.2 is 1-hydroxyethyl and R.sup.1 is methyl; [1173] R.sup.2 is 2-hydroxyethyl and R.sup.1 is methyl; [1174] R.sup.2 is 1-hydroxy-2-propyl and R.sup.1 is methyl; [1175] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is phenyl; [1176] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is 5- to 10-membered heteroaryl; [1177] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is pyridyl; [1178] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is pyrazolyl; [1179] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is S(O.sub.2)CH.sub.3; [1180] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is chloro; [1181] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is fluoro; [1182] R.sup.2 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; [1183] R.sup.2 is 1-hydroxy-1-cyclopropyl, and R.sup.1 is methyl; [1184] R.sup.2 is 1-hydroxy-1-cyclobutyl, and R.sup.1 is methyl; [1185] R.sup.2 is 1-hydroxy-1-cyclopentyl, and R.sup.1 is methyl; [1186] R.sup.2 is 1-hydroxy-1-cyclohexyl, and R.sup.1 is methyl; [1187] R.sup.2 is morpholinyl, and R.sup.1 is methyl; [1188] R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is methyl; [1189] R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is fluoro; [1190] R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is chloro; [1191] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.1 is methyl; [1192] R.sup.2 is (dimethylamino)methyl, and R.sup.1 is methyl; [1193] R.sup.2 is COCH.sub.3, and R.sup.1 is methyl; or [1194] R.sup.2 is 2-methoxy-2-propyl, and R.sup.1 is methyl.

    [1195] In some embodiments, of the compound of formula AA,

    the substituted ring A is

    ##STR00217##

    and R.sup.1 and R.sup.2 are one of the following combinations: [1196] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; [1197] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.6-C.sub.10 aryl; [1198] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is 5- to 10-membered heteroaryl; [1199] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is SF.sub.5; [1200] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is S(O.sub.2)C.sub.1-C.sub.6 alkyl; [1201] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is halo; [1202] R.sup.1 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; [1203] R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; [1204] R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is halo; [1205] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.2 is methyl; [1206] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; [1207] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.2 is C.sub.1-C.sub.6 alkyl; [1208] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.2 is halo; [1209] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.6-C.sub.10 aryl; [1210] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is 5- to 10-membered heteroaryl; [1211] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is SF.sub.5. [1212] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is S(O.sub.2)C.sub.1-C.sub.6 alkyl; [1213] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is halo; [1214] R.sup.2 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; [1215] R.sup.2 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; [1216] R.sup.2 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is halo; [1217] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.1 is C.sub.1-C.sub.6 alkyl; [1218] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.1 is halo; [1219] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.1 is methyl; or [1220] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl.

    [1221] In some embodiments, of the compound of formula AA,

    the substituted ring A is

    ##STR00218##

    and R.sup.1 and R.sup.2 are one of the following combinations: [1222] R.sup.1 is 1-hydroxy-2-methylpropan-2-yl, and R.sup.2 is methyl; [1223] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is methyl; [1224] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is isopropyl; [1225] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is 2-hydroxy-2-propyl; [1226] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is 1-hydroxyethyl; [1227] R.sup.1 is hydroxymethyl and R.sup.2 is methyl; [1228] R.sup.1 is 1-hydroxyethyl and R.sup.2 is methyl; [1229] R.sup.1 is 2-hydroxyethyl and R.sup.2 is methyl; [1230] R.sup.1 is 1-hydroxy-2-propyl and R.sup.2 is methyl; [1231] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is phenyl; [1232] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is pyridyl; [1233] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is pyrazolyl; [1234] R.sup.1 is 2-hydroxy-2-propyl, and R.sup.2 is S(O.sub.2)CH.sub.3; [1235] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is chloro; [1236] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is fluoro; [1237] R.sup.1 is 1-hydroxy-1-cyclopropyl, and R.sup.2 is methyl; [1238] R.sup.1 is 1-hydroxy-1-cyclobutyl, and R.sup.2 is methyl; [1239] R.sup.1 is 1-hydroxy-1-cyclopentyl, and R.sup.2 is methyl; [1240] R.sup.1 is 1-hydroxy-1-cyclohexyl, and R.sup.2 is methyl; [1241] R.sup.1 is morpholinyl, and R.sup.2 is methyl; [1242] R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is methyl; [1243] R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is fluoro; [1244] R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is chloro; [1245] R.sup.1 is COCH.sub.3, and R.sup.2 is methyl; [1246] R.sup.1 is 2-methoxy-2-propyl, and R.sup.2 is methyl; [1247] R.sup.1 is (dimethylamino)methyl, and R.sup.2 is methyl. [1248] R.sup.2 is 1-hydroxy-2-methylpropan-2-yl, and R.sup.1 is methyl; [1249] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is methyl; [1250] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is isopropyl; [1251] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is 1-hydroxyethyl; [1252] R.sup.2 is hydroxymethyl and R.sup.1 is methyl; [1253] R.sup.2 is 1-hydroxyethyl and R.sup.1 is methyl; [1254] R.sup.2 is 2-hydroxyethyl and R.sup.1 is methyl; [1255] R.sup.2 is 1-hydroxy-2-propyl and R.sup.1 is methyl; [1256] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is phenyl; [1257] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is 5- to 10-membered heteroaryl; [1258] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is pyridyl; [1259] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is pyrazolyl; [1260] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is S(O.sub.2)CH.sub.3; [1261] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is chloro; [1262] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is fluoro; [1263] R.sup.2 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; [1264] R.sup.2 is 1-hydroxy-1-cyclopropyl, and R.sup.1 is methyl; [1265] R.sup.2 is 1-hydroxy-1-cyclobutyl, and R.sup.1 is methyl; [1266] R.sup.2 is 1-hydroxy-1-cyclopentyl, and R.sup.1 is methyl; [1267] R.sup.2 is 1-hydroxy-1-cyclohexyl, and R.sup.1 is methyl; [1268] R.sup.2 is morpholinyl, and R.sup.1 is methyl; [1269] R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is methyl; [1270] R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is fluoro; [1271] R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is chloro; [1272] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.1 is methyl; [1273] R.sup.2 is (dimethylamino)methyl, and R.sup.1 is methyl; [1274] R.sup.2 is COCH.sub.3, and R.sup.1 is methyl; or [1275] R.sup.2 is 2-methoxy-2-propyl, and R.sup.1 is methyl.

    [1276] In some embodiments, of the compound of formula AA,

    the substituted ring A is

    ##STR00219##

    and R.sup.1 and R.sup.2 are one of the following combinations: [1277] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; [1278] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.6-C.sub.10 aryl; [1279] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is 5- to 10-membered heteroaryl; [1280] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is SF.sub.5; [1281] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is S(O.sub.2)C.sub.1-C.sub.6 alkyl; [1282] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is halo; [1283] R.sup.1 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; [1284] R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; [1285] R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is halo; [1286] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.2 is methyl; [1287] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; [1288] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.2 is C.sub.1-C.sub.6 alkyl; [1289] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.2 is halo; [1290] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.6-C.sub.10 aryl; [1291] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is 5- to 10-membered heteroaryl; [1292] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is SF.sub.5. [1293] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is S(O.sub.2)C.sub.1-C.sub.6 alkyl; [1294] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is halo; [1295] R.sup.2 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; [1296] R.sup.2 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; [1297] R.sup.2 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is halo; [1298] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.1 is C.sub.1-C.sub.6 alkyl; [1299] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.1 is halo; [1300] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.1 is methyl; or [1301] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl.

    [1302] In some embodiments, of the compound of formula AA,

    the substituted ring A is

    ##STR00220##

    and R.sup.1 and R.sup.2 are one of the following combinations: [1303] R.sup.1 is 1-hydroxy-2-methylpropan-2-yl, and R.sup.2 is methyl; [1304] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is methyl; [1305] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is isopropyl; [1306] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is 2-hydroxy-2-propyl; [1307] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is 1-hydroxyethyl; [1308] R.sup.1 is hydroxymethyl and R.sup.2 is methyl; [1309] R.sup.1 is 1-hydroxyethyl and R.sup.2 is methyl; [1310] R.sup.1 is 2-hydroxyethyl and R.sup.2 is methyl; [1311] R.sup.1 is 1-hydroxy-2-propyl and R.sup.2 is methyl; [1312] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is phenyl; [1313] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is pyridyl; [1314] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is pyrazolyl; [1315] R.sup.1 is 2-hydroxy-2-propyl, and R.sup.2 is S(O.sub.2)CH.sub.3; [1316] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is chloro; [1317] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is fluoro; [1318] R.sup.1 is 1-hydroxy-1-cyclopropyl, and R.sup.2 is methyl; [1319] R.sup.1 is 1-hydroxy-1-cyclobutyl, and R.sup.2 is methyl; [1320] R.sup.1 is 1-hydroxy-1-cyclopentyl, and R.sup.2 is methyl; [1321] R.sup.1 is 1-hydroxy-1-cyclohexyl, and R.sup.2 is methyl; [1322] R.sup.1 is morpholinyl, and R.sup.2 is methyl; [1323] R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is methyl; [1324] R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is fluoro; [1325] R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is chloro; [1326] R.sup.1 is COCH.sub.3, and R.sup.2 is methyl; [1327] R.sup.1 is 2-methoxy-2-propyl, and R.sup.2 is methyl; [1328] R.sup.1 is (dimethylamino)methyl, and R.sup.2 is methyl. [1329] R.sup.2 is 1-hydroxy-2-methylpropan-2-yl, and R.sup.1 is methyl; [1330] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is methyl; [1331] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is isopropyl; [1332] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is 1-hydroxyethyl; [1333] R.sup.2 is hydroxymethyl and R.sup.1 is methyl; [1334] R.sup.2 is 1-hydroxyethyl and R.sup.1 is methyl; [1335] R.sup.2 is 2-hydroxyethyl and R.sup.1 is methyl; [1336] R.sup.2 is 1-hydroxy-2-propyl and R.sup.1 is methyl; [1337] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is phenyl; [1338] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is 5- to 10-membered heteroaryl; [1339] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is pyridyl; [1340] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is pyrazolyl; [1341] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is S(O.sub.2)CH.sub.3; [1342] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is chloro; [1343] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is fluoro; [1344] R.sup.2 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; [1345] R.sup.2 is 1-hydroxy-1-cyclopropyl, and R.sup.1 is methyl; [1346] R.sup.2 is 1-hydroxy-1-cyclobutyl, and R.sup.1 is methyl; [1347] R.sup.2 is 1-hydroxy-1-cyclopentyl, and R.sup.1 is methyl; [1348] R.sup.2 is 1-hydroxy-1-cyclohexyl, and R.sup.1 is methyl; [1349] R.sup.2 is morpholinyl, and R.sup.1 is methyl; [1350] R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is methyl; [1351] R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is fluoro; [1352] R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is chloro; [1353] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.1 is methyl; [1354] R.sup.2 is (dimethylamino)methyl, and R.sup.1 is methyl; [1355] R.sup.2 is COCH.sub.3, and R.sup.1 is methyl; or [1356] R.sup.2 is 2-methoxy-2-propyl, and R.sup.1 is methyl.

    [1357] In some embodiments, of the compound of formula AA,

    the substituted ring A is

    ##STR00221##

    and R.sup.1 and R.sup.2 are one of the following combinations: [1358] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; [1359] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.6-C.sub.10 aryl; [1360] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is 5- to 10-membered heteroaryl; [1361] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is SF.sub.5; [1362] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is S(O.sub.2)C.sub.1-C.sub.6 alkyl; [1363] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is halo; [1364] R.sup.1 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; [1365] R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; [1366] R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is halo; [1367] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.2 is methyl; [1368] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; [1369] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.2 is C.sub.1-C.sub.6 alkyl; [1370] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.2 is halo; [1371] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.6-C.sub.10 aryl; [1372] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is 5- to 10-membered heteroaryl; [1373] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is SF.sub.5. [1374] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is S(O.sub.2)C.sub.1-C.sub.6 alkyl; [1375] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is halo; [1376] R.sup.2 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; [1377] R.sup.2 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; [1378] R.sup.2 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is halo; [1379] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.1 is C.sub.1-C.sub.6 alkyl; [1380] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.1 is halo; [1381] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.1 is methyl; or [1382] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl.

    [1383] In some embodiments, of the compound of formula AA,

    the substituted ring A is

    ##STR00222##

    and R.sup.1 and R.sup.2 are one of the following combinations: [1384] R.sup.1 is 1-hydroxy-2-methylpropan-2-yl, and R.sup.2 is methyl; [1385] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is methyl; [1386] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is isopropyl; [1387] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is 2-hydroxy-2-propyl; [1388] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is 1-hydroxyethyl; [1389] R.sup.1 is hydroxymethyl and R.sup.2 is methyl; [1390] R.sup.1 is 1-hydroxyethyl and R.sup.2 is methyl; [1391] R.sup.1 is 2-hydroxyethyl and R.sup.2 is methyl; [1392] R.sup.1 is 1-hydroxy-2-propyl and R.sup.2 is methyl; [1393] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is phenyl; [1394] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is pyridyl; [1395] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is pyrazolyl; [1396] R.sup.1 is 2-hydroxy-2-propyl, and R.sup.2 is S(O.sub.2)CH.sub.3; [1397] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is chloro; [1398] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is fluoro; [1399] R.sup.1 is 1-hydroxy-1-cyclopropyl, and R.sup.2 is methyl; [1400] R.sup.1 is 1-hydroxy-1-cyclobutyl, and R.sup.2 is methyl; [1401] R.sup.1 is 1-hydroxy-1-cyclopentyl, and R.sup.2 is methyl; [1402] R.sup.1 is 1-hydroxy-1-cyclohexyl, and R.sup.2 is methyl; [1403] R.sup.1 is morpholinyl, and R.sup.2 is methyl; [1404] R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is methyl; [1405] R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is fluoro; [1406] R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is chloro; [1407] R.sup.1 is COCH.sub.3, and R.sup.2 is methyl; [1408] R.sup.1 is 2-methoxy-2-propyl, and R.sup.2 is methyl; [1409] R.sup.1 is (dimethylamino)methyl, and R.sup.2 is methyl. [1410] R.sup.2 is 1-hydroxy-2-methylpropan-2-yl, and R.sup.1 is methyl; [1411] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is methyl; [1412] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is isopropyl; [1413] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is 1-hydroxyethyl; [1414] R.sup.2 is hydroxymethyl and R.sup.1 is methyl; [1415] R.sup.2 is 1-hydroxyethyl and R.sup.1 is methyl; [1416] R.sup.2 is 2-hydroxyethyl and R.sup.1 is methyl; [1417] R.sup.2 is 1-hydroxy-2-propyl and R.sup.1 is methyl; [1418] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is phenyl; [1419] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is 5- to 10-membered heteroaryl; [1420] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is pyridyl; [1421] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is pyrazolyl; [1422] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is S(O.sub.2)CH.sub.3; [1423] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is chloro; [1424] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is fluoro; [1425] R.sup.2 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; [1426] R.sup.2 is 1-hydroxy-1-cyclopropyl, and R.sup.1 is methyl; [1427] R.sup.2 is 1-hydroxy-1-cyclobutyl, and R.sup.1 is methyl; [1428] R.sup.2 is 1-hydroxy-1-cyclopentyl, and R.sup.1 is methyl; [1429] R.sup.2 is 1-hydroxy-1-cyclohexyl, and R.sup.1 is methyl; [1430] R.sup.2 is morpholinyl, and R.sup.1 is methyl; [1431] R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is methyl; [1432] R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is fluoro; [1433] R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is chloro; [1434] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.1 is methyl; [1435] R.sup.2 is (dimethylamino)methyl, and R.sup.1 is methyl; [1436] R.sup.2 is COCH.sub.3, and R.sup.1 is methyl; or [1437] R.sup.2 is 2-methoxy-2-propyl, and R.sup.1 is methyl.

    [1438] In some embodiments, of the compound of formula AA,

    the substituted ring A is

    ##STR00223##

    and R.sup.1 and R.sup.2 are one of the following combinations: [1439] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; [1440] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.6-C.sub.10 aryl; [1441] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is 5- to 10-membered heteroaryl; [1442] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is SF.sub.5; [1443] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is S(O.sub.2)C.sub.1-C.sub.6 alkyl; [1444] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is halo; [1445] R.sup.1 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; [1446] R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; [1447] R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is halo; [1448] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.2 is methyl; [1449] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; [1450] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.2 is C.sub.1-C.sub.6 alkyl; [1451] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.2 is halo; [1452] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.6-C.sub.10 aryl; [1453] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is 5- to 10-membered heteroaryl; [1454] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is SF.sub.5. [1455] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is S(O.sub.2)C.sub.1-C.sub.6 alkyl; [1456] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is halo; [1457] R.sup.2 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; [1458] R.sup.2 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; [1459] R.sup.2 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is halo; [1460] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.1 is C.sub.1-C.sub.6 alkyl; [1461] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.1 is halo; [1462] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.1 is methyl; or [1463] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl.

    [1464] In some embodiments, of the compound of formula AA,

    the substituted ring A is

    ##STR00224##

    and R.sup.1 and R.sup.2 are one of the following combinations: [1465] R.sup.1 is 1-hydroxy-2-methylpropan-2-yl, and R.sup.2 is methyl; [1466] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is methyl; [1467] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is isopropyl; [1468] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is 2-hydroxy-2-propyl; [1469] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is 1-hydroxyethyl; [1470] R.sup.1 is hydroxymethyl and R.sup.2 is methyl; [1471] R.sup.1 is 1-hydroxyethyl and R.sup.2 is methyl; [1472] R.sup.1 is 2-hydroxyethyl and R.sup.2 is methyl; [1473] R.sup.1 is 1-hydroxy-2-propyl and R.sup.2 is methyl; [1474] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is phenyl; [1475] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is pyridyl; [1476] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is pyrazolyl; [1477] R.sup.1 is 2-hydroxy-2-propyl, and R.sup.2 is S(O.sub.2)CH.sub.3; [1478] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is chloro; [1479] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is fluoro; [1480] R.sup.1 is 1-hydroxy-1-cyclopropyl, and R.sup.2 is methyl; [1481] R.sup.1 is 1-hydroxy-1-cyclobutyl, and R.sup.2 is methyl; [1482] R.sup.1 is 1-hydroxy-1-cyclopentyl, and R.sup.2 is methyl; [1483] R.sup.1 is 1-hydroxy-1-cyclohexyl, and R.sup.2 is methyl; [1484] R.sup.1 is morpholinyl, and R.sup.2 is methyl; [1485] R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is methyl; [1486] R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is fluoro; [1487] R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is chloro; [1488] R.sup.1 is COCH.sub.3, and R.sup.2 is methyl; [1489] R.sup.1 is 2-methoxy-2-propyl, and R.sup.2 is methyl; [1490] R.sup.1 is (dimethylamino)methyl, and R.sup.2 is methyl. [1491] R.sup.2 is 1-hydroxy-2-methylpropan-2-yl, and R.sup.1 is methyl; [1492] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is methyl; [1493] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is isopropyl; [1494] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is 1-hydroxyethyl; [1495] R.sup.2 is hydroxymethyl and R.sup.1 is methyl; [1496] R.sup.2 is 1-hydroxyethyl and R.sup.1 is methyl; [1497] R.sup.2 is 2-hydroxyethyl and R.sup.1 is methyl; [1498] R.sup.2 is 1-hydroxy-2-propyl and R.sup.1 is methyl; [1499] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is phenyl; [1500] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is 5- to 10-membered heteroaryl; [1501] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is pyridyl; [1502] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is pyrazolyl; [1503] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is S(O.sub.2)CH.sub.3; [1504] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is chloro; [1505] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is fluoro; [1506] R.sup.2 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; [1507] R.sup.2 is 1-hydroxy-1-cyclopropyl, and R.sup.1 is methyl; [1508] R.sup.2 is 1-hydroxy-1-cyclobutyl, and R.sup.1 is methyl; [1509] R.sup.2 is 1-hydroxy-1-cyclopentyl, and R.sup.1 is methyl; [1510] R.sup.2 is 1-hydroxy-1-cyclohexyl, and R.sup.1 is methyl; [1511] R.sup.2 is morpholinyl, and R.sup.1 is methyl; [1512] R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is methyl; [1513] R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is fluoro; [1514] R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is chloro; [1515] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.1 is methyl; [1516] R.sup.2 is (dimethylamino)methyl, and R.sup.1 is methyl; [1517] R.sup.2 is COCH.sub.3, and R.sup.1 is methyl; or [1518] R.sup.2 is 2-methoxy-2-propyl, and R.sup.1 is methyl.

    [1519] In some embodiments, of the compound of formula AA,

    the substituted ring A is

    ##STR00225##

    and R.sup.1 and R.sup.2 are one of the following combinations: [1520] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; [1521] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.6-C.sub.10 aryl; [1522] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is 5- to 10-membered heteroaryl; [1523] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is SF.sub.5; [1524] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is S(O.sub.2)C.sub.1-C.sub.6 alkyl; [1525] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is halo; [1526] R.sup.1 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; [1527] R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; [1528] R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is halo; [1529] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.2 is methyl; [1530] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; [1531] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.2 is C.sub.1-C.sub.6 alkyl; [1532] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.2 is halo; [1533] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.6-C.sub.10 aryl; [1534] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is 5- to 10-membered heteroaryl; [1535] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is SF.sub.5. [1536] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is S(O.sub.2)C.sub.1-C.sub.6 alkyl; [1537] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is halo; [1538] R.sup.2 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; [1539] R.sup.2 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; [1540] R.sup.2 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is halo; [1541] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.1 is C.sub.1-C.sub.6 alkyl; [1542] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.1 is halo; [1543] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.1 is methyl; or [1544] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl.

    [1545] In some embodiments, of the compound of formula AA,

    the substituted ring A is

    ##STR00226##

    and R.sup.1 and R.sup.2 are one of the following combinations: [1546] R.sup.1 is 1-hydroxy-2-methylpropan-2-yl, and R.sup.2 is methyl; [1547] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is methyl; [1548] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is isopropyl; [1549] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is 2-hydroxy-2-propyl; [1550] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is 1-hydroxyethyl; [1551] R.sup.1 is hydroxymethyl and R.sup.2 is methyl; [1552] R.sup.1 is 1-hydroxyethyl and R.sup.2 is methyl; [1553] R.sup.1 is 2-hydroxyethyl and R.sup.2 is methyl; [1554] R.sup.1 is 1-hydroxy-2-propyl and R.sup.2 is methyl; [1555] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is phenyl; [1556] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is pyridyl; [1557] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is pyrazolyl; [1558] R.sup.1 is 2-hydroxy-2-propyl, and R.sup.2 is S(O.sub.2)CH.sub.3; [1559] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is chloro; [1560] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is fluoro; [1561] R.sup.1 is 1-hydroxy-1-cyclopropyl, and R.sup.2 is methyl; [1562] R.sup.1 is 1-hydroxy-1-cyclobutyl, and R.sup.2 is methyl; [1563] R.sup.1 is 1-hydroxy-1-cyclopentyl, and R.sup.2 is methyl; [1564] R.sup.1 is 1-hydroxy-1-cyclohexyl, and R.sup.2 is methyl; [1565] R.sup.1 is morpholinyl, and R.sup.2 is methyl; [1566] R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is methyl; [1567] R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is fluoro; [1568] R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is chloro; [1569] R.sup.1 is COCH.sub.3, and R.sup.2 is methyl; [1570] R.sup.1 is 2-methoxy-2-propyl, and R.sup.2 is methyl; [1571] R.sup.1 is (dimethylamino)methyl, and R.sup.2 is methyl. [1572] R.sup.2 is 1-hydroxy-2-methylpropan-2-yl, and R.sup.1 is methyl; [1573] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is methyl; [1574] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is isopropyl; [1575] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is 1-hydroxyethyl; [1576] R.sup.2 is hydroxymethyl and R.sup.1 is methyl; [1577] R.sup.2 is 1-hydroxyethyl and R.sup.1 is methyl; [1578] R.sup.2 is 2-hydroxyethyl and R.sup.1 is methyl; [1579] R.sup.2 is 1-hydroxy-2-propyl and R.sup.1 is methyl; [1580] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is phenyl; [1581] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is 5- to 10-membered heteroaryl; [1582] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is pyridyl; [1583] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is pyrazolyl; [1584] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is S(O.sub.2)CH.sub.3; [1585] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is chloro; [1586] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is fluoro; [1587] R.sup.2 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; [1588] R.sup.2 is 1-hydroxy-1-cyclopropyl, and R.sup.1 is methyl; [1589] R.sup.2 is 1-hydroxy-1-cyclobutyl, and R.sup.1 is methyl; [1590] R.sup.2 is 1-hydroxy-1-cyclopentyl, and R.sup.1 is methyl; [1591] R.sup.2 is 1-hydroxy-1-cyclohexyl, and R.sup.1 is methyl; [1592] R.sup.2 is morpholinyl, and R.sup.1 is methyl; [1593] R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is methyl; [1594] R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is fluoro; [1595] R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is chloro; [1596] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.1 is methyl; [1597] R.sup.2 is (dimethylamino)methyl, and R.sup.1 is methyl; [1598] R.sup.2 is COCH.sub.3, and R.sup.1 is methyl; or [1599] R.sup.2 is 2-methoxy-2-propyl, and R.sup.1 is methyl.

    [1600] In some embodiments, of the compound of formula AA,

    the substituted ring A is

    ##STR00227##

    and R.sup.1 and R.sup.2 are one of the following combinations: [1601] R.sup.1 is 1-hydroxy-2-methylpropan-2-yl, and R.sup.2 is methyl; [1602] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is methyl; [1603] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is isopropyl; [1604] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is 2-hydroxy-2-propyl; [1605] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is 1-hydroxyethyl; [1606] R.sup.1 is hydroxymethyl and R.sup.2 is methyl; [1607] R.sup.1 is 1-hydroxyethyl and R.sup.2 is methyl; [1608] R.sup.1 is 2-hydroxyethyl and R.sup.2 is methyl; [1609] R.sup.1 is 1-hydroxy-2-propyl and R.sup.2 is methyl; [1610] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is phenyl; [1611] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is pyridyl; [1612] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is pyrazolyl; [1613] R.sup.1 is 2-hydroxy-2-propyl, and R.sup.2 is S(O.sub.2)CH.sub.3; [1614] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is chloro; [1615] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is fluoro; [1616] R.sup.1 is 1-hydroxy-1-cyclopropyl, and R.sup.2 is methyl; [1617] R.sup.1 is 1-hydroxy-1-cyclobutyl, and R.sup.2 is methyl; [1618] R.sup.1 is 1-hydroxy-1-cyclopentyl, and R.sup.2 is methyl; [1619] R.sup.1 is 1-hydroxy-1-cyclohexyl, and R.sup.2 is methyl; [1620] R.sup.1 is morpholinyl, and R.sup.2 is methyl; [1621] R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is methyl; [1622] R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is fluoro; [1623] R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is chloro; [1624] R.sup.1 is COCH.sub.3, and R.sup.2 is methyl; [1625] R.sup.1 is 2-methoxy-2-propyl, and R.sup.2 is methyl; [1626] R.sup.1 is (dimethylamino)methyl, and R.sup.2 is methyl. [1627] R.sup.2 is 1-hydroxy-2-methylpropan-2-yl, and R.sup.1 is methyl; [1628] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is methyl; [1629] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is isopropyl; [1630] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is 1-hydroxyethyl; [1631] R.sup.2 is hydroxymethyl and R.sup.1 is methyl; [1632] R.sup.2 is 1-hydroxyethyl and R.sup.1 is methyl; [1633] R.sup.2 is 2-hydroxyethyl and R.sup.1 is methyl; [1634] R.sup.2 is 1-hydroxy-2-propyl and R.sup.1 is methyl; [1635] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is phenyl; [1636] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is 5- to 10-membered heteroaryl; [1637] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is pyridyl; [1638] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is pyrazolyl; [1639] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is S(O.sub.2)CH.sub.3; [1640] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is chloro; [1641] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is fluoro; [1642] R.sup.2 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; [1643] R.sup.2 is 1-hydroxy-1-cyclopropyl, and R.sup.1 is methyl; [1644] R.sup.2 is 1-hydroxy-1-cyclobutyl, and R.sup.1 is methyl; [1645] R.sup.2 is 1-hydroxy-1-cyclopentyl, and R.sup.1 is methyl; [1646] R.sup.2 is 1-hydroxy-1-cyclohexyl, and R.sup.1 is methyl; [1647] R.sup.2 is morpholinyl, and R.sup.1 is methyl; [1648] R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is methyl; [1649] R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is fluoro; [1650] R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is chloro; [1651] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.1 is methyl; [1652] R.sup.2 is (dimethylamino)methyl, and R.sup.1 is methyl; [1653] R.sup.2 is COCH.sub.3, and R.sup.1 is methyl; or [1654] R.sup.2 is 2-methoxy-2-propyl, and R.sup.1 is methyl.

    [1655] In some embodiments, of the compound of formula AA,

    the substituted ring A is

    ##STR00228##

    and R.sup.1 and R.sup.2 are one of the following combinations: [1656] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; [1657] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.6-C.sub.10 aryl; [1658] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is 5- to 10-membered heteroaryl; [1659] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is SF.sub.5; [1660] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is S(O.sub.2)C.sub.1-C.sub.6 alkyl; [1661] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is halo; [1662] R.sup.1 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; [1663] R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; [1664] R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is halo; [1665] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.2 is methyl; [1666] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; [1667] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.2 is C.sub.1-C.sub.6 alkyl; [1668] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.2 is halo; [1669] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.6-C.sub.10 aryl; [1670] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is 5- to 10-membered heteroaryl; [1671] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is SF.sub.5. [1672] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is S(O.sub.2)C.sub.1-C.sub.6 alkyl; [1673] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is halo; [1674] R.sup.2 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; [1675] R.sup.2 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; [1676] R.sup.2 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is halo; [1677] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.1 is C.sub.1-C.sub.6 alkyl; [1678] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.1 is halo; [1679] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.1 is methyl; or [1680] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl.

    [1681] In some embodiments, of the compound of formula AA,

    the substituted ring A is

    ##STR00229##

    and R.sup.1 and R.sup.2 are one of the following combinations: [1682] R.sup.1 is 1-hydroxy-2-methylpropan-2-yl, and R.sup.2 is methyl; [1683] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is methyl; [1684] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is isopropyl; [1685] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is 2-hydroxy-2-propyl; [1686] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is 1-hydroxyethyl; [1687] R.sup.1 is hydroxymethyl and R.sup.2 is methyl; [1688] R.sup.1 is 1-hydroxyethyl and R.sup.2 is methyl; [1689] R.sup.1 is 2-hydroxyethyl and R.sup.2 is methyl; [1690] R.sup.1 is 1-hydroxy-2-propyl and R.sup.2 is methyl; [1691] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is phenyl; [1692] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is pyridyl; [1693] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is pyrazolyl; [1694] R.sup.1 is 2-hydroxy-2-propyl, and R.sup.2 is S(O.sub.2)CH.sub.3; [1695] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is chloro; [1696] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is fluoro; [1697] R.sup.1 is 1-hydroxy-1-cyclopropyl, and R.sup.2 is methyl; [1698] R.sup.1 is 1-hydroxy-1-cyclobutyl, and R.sup.2 is methyl; [1699] R.sup.1 is 1-hydroxy-1-cyclopentyl, and R.sup.2 is methyl; [1700] R.sup.1 is 1-hydroxy-1-cyclohexyl, and R.sup.2 is methyl; [1701] R.sup.1 is morpholinyl, and R.sup.2 is methyl; [1702] R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is methyl; [1703] R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is fluoro; [1704] R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is chloro; [1705] R.sup.1 is COCH.sub.3, and R.sup.2 is methyl; [1706] R.sup.1 is 2-methoxy-2-propyl, and R.sup.2 is methyl; [1707] R.sup.1 is (dimethylamino)methyl, and R.sup.2 is methyl. [1708] R.sup.2 is 1-hydroxy-2-methylpropan-2-yl, and R.sup.1 is methyl; [1709] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is methyl; [1710] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is isopropyl; [1711] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is 1-hydroxyethyl; [1712] R.sup.2 is hydroxymethyl and R.sup.1 is methyl; [1713] R.sup.2 is 1-hydroxyethyl and R.sup.1 is methyl; [1714] R.sup.2 is 2-hydroxyethyl and R.sup.1 is methyl; [1715] R.sup.2 is 1-hydroxy-2-propyl and R.sup.1 is methyl; [1716] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is phenyl; [1717] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is 5- to 10-membered heteroaryl; [1718] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is pyridyl; [1719] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is pyrazolyl; [1720] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is S(O.sub.2)CH.sub.3; [1721] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is chloro; [1722] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is fluoro; [1723] R.sup.2 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; [1724] R.sup.2 is 1-hydroxy-1-cyclopropyl, and R.sup.1 is methyl; [1725] R.sup.2 is 1-hydroxy-1-cyclobutyl, and R.sup.1 is methyl; [1726] R.sup.2 is 1-hydroxy-1-cyclopentyl, and R.sup.1 is methyl; [1727] R.sup.2 is 1-hydroxy-1-cyclohexyl, and R.sup.1 is methyl; [1728] R.sup.2 is morpholinyl, and R.sup.1 is methyl; [1729] R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is methyl; [1730] R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is fluoro; [1731] R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is chloro; [1732] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.1 is methyl; [1733] R.sup.2 is (dimethylamino)methyl, and R.sup.1 is methyl; [1734] R.sup.2 is COCH.sub.3, and R.sup.1 is methyl; or [1735] R.sup.2 is 2-methoxy-2-propyl, and R.sup.1 is methyl.

    [1736] In some embodiments, of the compound of formula AA,

    the substituted ring A is

    ##STR00230##

    and R.sup.1 and R.sup.2 are one of the following combinations: [1737] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; [1738] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.6-C.sub.10 aryl; [1739] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is 5- to 10-membered heteroaryl; [1740] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is SF.sub.5; [1741] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is S(O.sub.2)C.sub.1-C.sub.6 alkyl; [1742] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is halo; [1743] R.sup.1 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; [1744] R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; [1745] R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is halo; [1746] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.2 is methyl; [1747] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; [1748] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.2 is C.sub.1-C.sub.6 alkyl; [1749] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.2 is halo; [1750] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.6-C.sub.10 aryl; [1751] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is 5- to 10-membered heteroaryl; [1752] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is SF.sub.5. R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is S(O.sub.2)C.sub.1-C.sub.6 alkyl; [1753] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is halo; [1754] R.sup.2 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; [1755] R.sup.2 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; [1756] R.sup.2 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is halo; [1757] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.1 is C.sub.1-C.sub.6 alkyl; [1758] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.1 is halo; [1759] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.1 is methyl; or [1760] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl.

    [1761] In some embodiments, of the compound of formula AA,

    the substituted ring A is

    ##STR00231##

    and R.sup.1 and R.sup.2 are one of the following combinations: [1762] R.sup.1 is 1-hydroxy-2-methylpropan-2-yl, and R.sup.2 is methyl; [1763] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is methyl; [1764] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is isopropyl; [1765] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is 2-hydroxy-2-propyl; [1766] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is 1-hydroxyethyl; [1767] R.sup.1 is hydroxymethyl and R.sup.2 is methyl; [1768] R.sup.1 is 1-hydroxyethyl and R.sup.2 is methyl; [1769] R.sup.1 is 2-hydroxyethyl and R.sup.2 is methyl; [1770] R.sup.1 is 1-hydroxy-2-propyl and R.sup.2 is methyl; [1771] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is phenyl; [1772] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is pyridyl; [1773] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is pyrazolyl; [1774] R.sup.1 is 2-hydroxy-2-propyl, and R.sup.2 is S(O.sub.2)CH.sub.3; [1775] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is chloro; [1776] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is fluoro; [1777] R.sup.1 is 1-hydroxy-1-cyclopropyl, and R.sup.2 is methyl; [1778] R.sup.1 is 1-hydroxy-1-cyclobutyl, and R.sup.2 is methyl; [1779] R.sup.1 is 1-hydroxy-1-cyclopentyl, and R.sup.2 is methyl; [1780] R.sup.1 is 1-hydroxy-1-cyclohexyl, and R.sup.2 is methyl; [1781] R.sup.1 is morpholinyl, and R.sup.2 is methyl; [1782] R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is methyl; [1783] R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is fluoro; [1784] R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is chloro; [1785] R.sup.1 is COCH.sub.3, and R.sup.2 is methyl; [1786] R.sup.1 is 2-methoxy-2-propyl, and R.sup.2 is methyl; [1787] R.sup.1 is (dimethylamino)methyl, and R.sup.2 is methyl. [1788] R.sup.2 is 1-hydroxy-2-methylpropan-2-yl, and R.sup.1 is methyl; [1789] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is methyl; [1790] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is isopropyl; [1791] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is 1-hydroxyethyl; [1792] R.sup.2 is hydroxymethyl and R.sup.1 is methyl; [1793] R.sup.2 is 1-hydroxyethyl and R.sup.1 is methyl; [1794] R.sup.2 is 2-hydroxyethyl and R.sup.1 is methyl; [1795] R.sup.2 is 1-hydroxy-2-propyl and R.sup.1 is methyl; [1796] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is phenyl; [1797] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is 5- to 10-membered heteroaryl; [1798] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is pyridyl; [1799] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is pyrazolyl; [1800] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is S(O.sub.2)CH.sub.3; [1801] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is chloro; [1802] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is fluoro; [1803] R.sup.2 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; [1804] R.sup.2 is 1-hydroxy-1-cyclopropyl, and R.sup.1 is methyl; [1805] R.sup.2 is 1-hydroxy-1-cyclobutyl, and R.sup.1 is methyl; [1806] R.sup.2 is 1-hydroxy-1-cyclopentyl, and R.sup.1 is methyl; [1807] R.sup.2 is 1-hydroxy-1-cyclohexyl, and R.sup.1 is methyl; [1808] R.sup.2 is morpholinyl, and R.sup.1 is methyl; [1809] R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is methyl; [1810] R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is fluoro; [1811] R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is chloro; [1812] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.1 is methyl; [1813] R.sup.2 is (dimethylamino)methyl, and R.sup.1 is methyl; [1814] R.sup.2 is COCH.sub.3, and R.sup.1 is methyl; or [1815] R.sup.2 is 2-methoxy-2-propyl, and R.sup.1 is methyl.

    [1816] In some embodiments, of the compound of formula AA,

    the substituted ring A is

    ##STR00232##

    and R.sup.1 and R.sup.2 are one of the following combinations: [1817] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; [1818] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.6-C.sub.10 aryl; [1819] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is 5- to 10-membered heteroaryl; [1820] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is SF.sub.5; [1821] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is S(O.sub.2)C.sub.1-C.sub.6 alkyl; [1822] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is halo; [1823] R.sup.1 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; [1824] R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; [1825] R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is halo; [1826] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.2 is methyl; [1827] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; [1828] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.2 is C.sub.1-C.sub.6 alkyl; [1829] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.2 is halo; [1830] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.6-C.sub.10 aryl; [1831] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is 5- to 10-membered heteroaryl; [1832] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is SF.sub.5. [1833] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is S(O.sub.2)C.sub.1-C.sub.6 alkyl; [1834] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is halo; [1835] R.sup.2 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; [1836] R.sup.2 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; [1837] R.sup.2 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is halo; [1838] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.1 is C.sub.1-C.sub.6 alkyl; [1839] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.1 is halo; [1840] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.1 is methyl; or [1841] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl.

    [1842] In some embodiments, of the compound of formula AA,

    the substituted ring A is

    ##STR00233##

    and R.sup.1 and R.sup.2 are one of the following combinations: [1843] R.sup.1 is 1-hydroxy-2-methylpropan-2-yl, and R.sup.2 is methyl; [1844] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is methyl; [1845] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is isopropyl; [1846] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is 2-hydroxy-2-propyl; [1847] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is 1-hydroxyethyl; [1848] R.sup.1 is hydroxymethyl and R.sup.2 is methyl; [1849] R.sup.1 is 1-hydroxyethyl and R.sup.2 is methyl; [1850] R.sup.1 is 2-hydroxyethyl and R.sup.2 is methyl; [1851] R.sup.1 is 1-hydroxy-2-propyl and R.sup.2 is methyl; [1852] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is phenyl; [1853] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is pyridyl; [1854] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is pyrazolyl; [1855] R.sup.1 is 2-hydroxy-2-propyl, and R.sup.2 is S(O.sub.2)CH.sub.3; [1856] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is chloro; [1857] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is fluoro; [1858] R.sup.1 is 1-hydroxy-1-cyclopropyl, and R.sup.2 is methyl; [1859] R.sup.1 is 1-hydroxy-1-cyclobutyl, and R.sup.2 is methyl; [1860] R.sup.1 is 1-hydroxy-1-cyclopentyl, and R.sup.2 is methyl; [1861] R.sup.1 is 1-hydroxy-1-cyclohexyl, and R.sup.2 is methyl; [1862] R.sup.1 is morpholinyl, and R.sup.2 is methyl; [1863] R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is methyl; [1864] R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is fluoro; [1865] R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is chloro; [1866] R.sup.1 is COCH.sub.3, and R.sup.2 is methyl; [1867] R.sup.1 is 2-methoxy-2-propyl, and R.sup.2 is methyl; [1868] R.sup.1 is (dimethylamino)methyl, and R.sup.2 is methyl. [1869] R.sup.2 is 1-hydroxy-2-methylpropan-2-yl, and R.sup.1 is methyl; [1870] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is methyl; [1871] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is isopropyl; [1872] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is 1-hydroxyethyl; [1873] R.sup.2 is hydroxymethyl and R.sup.1 is methyl; [1874] R.sup.2 is 1-hydroxyethyl and R.sup.1 is methyl; [1875] R.sup.2 is 2-hydroxyethyl and R.sup.1 is methyl; [1876] R.sup.2 is 1-hydroxy-2-propyl and R.sup.1 is methyl; [1877] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is phenyl; [1878] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is 5- to 10-membered heteroaryl; [1879] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is pyridyl; [1880] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is pyrazolyl; [1881] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is S(O.sub.2)CH.sub.3; [1882] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is chloro; [1883] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is fluoro; [1884] R.sup.2 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; [1885] R.sup.2 is 1-hydroxy-1-cyclopropyl, and R.sup.1 is methyl; [1886] R.sup.2 is 1-hydroxy-1-cyclobutyl, and R.sup.1 is methyl; [1887] R.sup.2 is 1-hydroxy-1-cyclopentyl, and R.sup.1 is methyl; [1888] R.sup.2 is 1-hydroxy-1-cyclohexyl, and R.sup.1 is methyl; [1889] R.sup.2 is morpholinyl, and R.sup.1 is methyl; [1890] R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is methyl; [1891] R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is fluoro; [1892] R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is chloro; [1893] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.1 is methyl; [1894] R.sup.2 is (dimethylamino)methyl, and R.sup.1 is methyl; [1895] R.sup.2 is COCH.sub.3, and R.sup.1 is methyl; or [1896] R.sup.2 is 2-methoxy-2-propyl, and R.sup.1 is methyl.

    [1897] In some embodiments, of the compound of formula AA,

    the substituted ring A is

    ##STR00234##

    and R.sup.1 and R.sup.2 are one of the following combinations: [1898] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; [1899] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.6-C.sub.10 aryl; [1900] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is 5- to 10-membered heteroaryl; [1901] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is SF.sub.5; [1902] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is S(O.sub.2)C.sub.1-C.sub.6 alkyl; [1903] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is halo; [1904] R.sup.1 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; [1905] R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; [1906] R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is halo; [1907] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.2 is methyl; [1908] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; [1909] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.2 is C.sub.1-C.sub.6 alkyl; [1910] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.2 is halo; [1911] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.6-C.sub.10 aryl; [1912] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is 5- to 10-membered heteroaryl; [1913] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is SF.sub.5. [1914] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is S(O.sub.2)C.sub.1-C.sub.6 alkyl; [1915] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is halo; [1916] R.sup.2 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; [1917] R.sup.2 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; [1918] R.sup.2 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is halo; [1919] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.1 is C.sub.1-C.sub.6 alkyl; [1920] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.1 is halo; [1921] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.1 is methyl; or [1922] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl.

    [1923] In some embodiments, of the compound of formula AA,

    the substituted ring A is

    ##STR00235##

    and R.sup.1 and R.sup.2 are one of the following combinations: [1924] R.sup.1 is 1-hydroxy-2-methylpropan-2-yl, and R.sup.2 is methyl; [1925] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is methyl; [1926] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is isopropyl; [1927] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is 2-hydroxy-2-propyl; [1928] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is 1-hydroxyethyl; [1929] R.sup.1 is hydroxymethyl and R.sup.2 is methyl; [1930] R.sup.1 is 1-hydroxyethyl and R.sup.2 is methyl; [1931] R.sup.1 is 2-hydroxyethyl and R.sup.2 is methyl; [1932] R.sup.1 is 1-hydroxy-2-propyl and R.sup.2 is methyl; [1933] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is phenyl; [1934] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is pyridyl; [1935] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is pyrazolyl; [1936] R.sup.1 is 2-hydroxy-2-propyl, and R.sup.2 is S(O.sub.2)CH.sub.3; [1937] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is chloro; [1938] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is fluoro; [1939] R.sup.1 is 1-hydroxy-1-cyclopropyl, and R.sup.2 is methyl; [1940] R.sup.1 is 1-hydroxy-1-cyclobutyl, and R.sup.2 is methyl; [1941] R.sup.1 is 1-hydroxy-1-cyclopentyl, and R.sup.2 is methyl; [1942] R.sup.1 is 1-hydroxy-1-cyclohexyl, and R.sup.2 is methyl; [1943] R.sup.1 is morpholinyl, and R.sup.2 is methyl; [1944] R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is methyl; [1945] R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is fluoro; [1946] R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is chloro; [1947] R.sup.1 is COCH.sub.3, and R.sup.2 is methyl; [1948] R.sup.1 is 2-methoxy-2-propyl, and R.sup.2 is methyl; [1949] R.sup.1 is (dimethylamino)methyl, and R.sup.2 is methyl. [1950] R.sup.2 is 1-hydroxy-2-methylpropan-2-yl, and R.sup.1 is methyl; [1951] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is methyl; [1952] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is isopropyl; [1953] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is 1-hydroxyethyl; [1954] R.sup.2 is hydroxymethyl and R.sup.1 is methyl; [1955] R.sup.2 is 1-hydroxyethyl and R.sup.1 is methyl; [1956] R.sup.2 is 2-hydroxyethyl and R.sup.1 is methyl; [1957] R.sup.2 is 1-hydroxy-2-propyl and R.sup.1 is methyl; [1958] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is phenyl; [1959] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is 5- to 10-membered heteroaryl; [1960] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is pyridyl; [1961] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is pyrazolyl; [1962] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is S(O.sub.2)CH.sub.3; [1963] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is chloro; [1964] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is fluoro; [1965] R.sup.2 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; [1966] R.sup.2 is 1-hydroxy-1-cyclopropyl, and R.sup.1 is methyl; [1967] R.sup.2 is 1-hydroxy-1-cyclobutyl, and R.sup.1 is methyl; [1968] R.sup.2 is 1-hydroxy-1-cyclopentyl, and R.sup.1 is methyl; [1969] R.sup.2 is 1-hydroxy-1-cyclohexyl, and R.sup.1 is methyl; [1970] R.sup.2 is morpholinyl, and R.sup.1 is methyl; [1971] R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is methyl; [1972] R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is fluoro; [1973] R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is chloro; [1974] R.sup.2 is (dimethylamino)methyl, and R.sup.1 is methyl; [1975] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.1 is methyl; or [1976] R.sup.2 is COCH.sub.3, and R.sup.1 is methyl.

    [1977] In some embodiments, of the compound of formula AA,

    the substituted ring A is

    ##STR00236##

    and R.sup.1 and R.sup.2 are one of the following combinations: [1978] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; [1979] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.6-C.sub.10 aryl; [1980] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is 5- to 10-membered heteroaryl; [1981] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is SF.sub.5; [1982] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is S(O.sub.2)C.sub.1-C.sub.6 alkyl; [1983] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is halo; [1984] R.sup.1 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; [1985] R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; [1986] R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is halo; [1987] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.2 is methyl; [1988] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; [1989] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.2 is C.sub.1-C.sub.6 alkyl; [1990] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.2 is halo; [1991] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.6-C.sub.10 aryl; [1992] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is 5- to 10-membered heteroaryl; [1993] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is SF.sub.5. [1994] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is S(O.sub.2)C.sub.1-C.sub.6 alkyl; [1995] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is halo; [1996] R.sup.2 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; [1997] R.sup.2 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; [1998] R.sup.2 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is halo; [1999] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.1 is C.sub.1-C.sub.6 alkyl; [2000] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.1 is halo; [2001] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.1 is methyl; or [2002] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl.

    [2003] In some embodiments, of the compound of formula AA,

    the substituted ring A is

    ##STR00237##

    and R.sup.1 and R.sup.2 are one of the following combinations: [2004] R.sup.1 is 1-hydroxy-2-methylpropan-2-yl, and R.sup.2 is methyl; [2005] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is methyl; [2006] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is isopropyl; [2007] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is 2-hydroxy-2-propyl; [2008] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is 1-hydroxyethyl; [2009] R.sup.1 is hydroxymethyl and R.sup.2 is methyl; [2010] R.sup.1 is 1-hydroxyethyl and R.sup.2 is methyl; [2011] R.sup.1 is 2-hydroxyethyl and R.sup.2 is methyl; [2012] R.sup.1 is 1-hydroxy-2-propyl and R.sup.2 is methyl; [2013] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is phenyl; [2014] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is pyridyl; [2015] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is pyrazolyl; [2016] R.sup.1 is 2-hydroxy-2-propyl, and R.sup.2 is S(O.sub.2)CH.sub.3; [2017] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is chloro; [2018] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is fluoro; [2019] R.sup.1 is 1-hydroxy-1-cyclopropyl, and R.sup.2 is methyl; [2020] R.sup.1 is 1-hydroxy-1-cyclobutyl, and R.sup.2 is methyl; [2021] R.sup.1 is 1-hydroxy-1-cyclopentyl, and R.sup.2 is methyl; [2022] R.sup.1 is 1-hydroxy-1-cyclohexyl, and R.sup.2 is methyl; [2023] R.sup.1 is morpholinyl, and R.sup.2 is methyl; [2024] R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is methyl; [2025] R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is fluoro; [2026] R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is chloro; [2027] R.sup.1 is COCH.sub.3, and R.sup.2 is methyl; [2028] R.sup.1 is 2-methoxy-2-propyl, and R.sup.2 is methyl; [2029] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.2 is C.sub.1-C.sub.6 alkyl; [2030] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.2 is halo; [2031] R.sup.2 is 1-hydroxy-2-methylpropan-2-yl, and R.sup.1 is methyl; [2032] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is methyl; [2033] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is isopropyl; [2034] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is 1-hydroxyethyl; [2035] R.sup.2 is hydroxymethyl and R.sup.1 is methyl; [2036] R.sup.2 is 1-hydroxyethyl and R.sup.1 is methyl; [2037] R.sup.2 is 2-hydroxyethyl and R.sup.1 is methyl; [2038] R.sup.2 is 1-hydroxy-2-propyl and R.sup.1 is methyl; [2039] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is phenyl; [2040] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is 5- to 10-membered heteroaryl; [2041] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is pyridyl; [2042] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is pyrazolyl; [2043] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is S(O.sub.2)CH.sub.3; [2044] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is chloro; [2045] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is fluoro; [2046] R.sup.2 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; [2047] R.sup.2 is 1-hydroxy-1-cyclopropyl, and R.sup.1 is methyl; [2048] R.sup.2 is 1-hydroxy-1-cyclobutyl, and R.sup.1 is methyl; [2049] R.sup.2 is 1-hydroxy-1-cyclopentyl, and R.sup.1 is methyl; [2050] R.sup.2 is 1-hydroxy-1-cyclohexyl, and R.sup.1 is methyl; [2051] R.sup.2 is morpholinyl, and R.sup.1 is methyl; [2052] R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is methyl; [2053] R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is fluoro; [2054] R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is chloro; [2055] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.1 is methyl; [2056] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.1 is C.sub.1-C.sub.6 alkyl; [2057] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.1 is halo; [2058] R.sup.2 is COCH.sub.3, and R.sup.1 is methyl; or [2059] R.sup.2 is 2-methoxy-2-propyl, and R.sup.1 is methyl.

    [2060] In some embodiments, of the compound of formula AA,

    the substituted ring A is

    ##STR00238##

    and R.sup.1 and R.sup.2 are one of the following combinations: [2061] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; [2062] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.6-C.sub.10 aryl; [2063] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is 5- to 10-membered heteroaryl; [2064] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is SF.sub.5; [2065] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is S(O.sub.2)C.sub.1-C.sub.6 alkyl; [2066] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is halo; [2067] R.sup.1 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; [2068] R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; [2069] R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is halo; [2070] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.2 is methyl; [2071] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; [2072] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.2 is C.sub.1-C.sub.6 alkyl; [2073] R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.2 is halo; [2074] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.6-C.sub.10 aryl; [2075] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is 5- to 10-membered heteroaryl; [2076] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is SF.sub.5. [2077] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is S(O.sub.2)C.sub.1-C.sub.6 alkyl; [2078] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is halo; [2079] R.sup.2 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; [2080] R.sup.2 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; [2081] R.sup.2 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is halo; [2082] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.1 is C.sub.1-C.sub.6 alkyl; [2083] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.1 is halo; [2084] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.1 is methyl; or [2085] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl.

    [2086] In some embodiments, of the compound of formula AA,

    the substituted ring A is

    ##STR00239##

    and R.sup.1 and R.sup.2 are one of the following combinations: [2087] R.sup.1 is 1-hydroxy-2-methylpropan-2-yl, and R.sup.2 is methyl; [2088] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is methyl; [2089] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is isopropyl; [2090] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is 2-hydroxy-2-propyl; [2091] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is 1-hydroxyethyl; [2092] R.sup.1 is hydroxymethyl and R.sup.2 is methyl; [2093] R.sup.1 is 1-hydroxyethyl and R.sup.2 is methyl; [2094] R.sup.1 is 2-hydroxyethyl and R.sup.2 is methyl; [2095] R.sup.1 is 1-hydroxy-2-propyl and R.sup.2 is methyl; [2096] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is phenyl; [2097] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is pyridyl; [2098] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is pyrazolyl; [2099] R.sup.1 is 2-hydroxy-2-propyl, and R.sup.2 is S(O.sub.2)CH.sub.3; [2100] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is chloro; [2101] R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is fluoro; [2102] R.sup.1 is 1-hydroxy-1-cyclopropyl, and R.sup.2 is methyl; [2103] R.sup.1 is 1-hydroxy-1-cyclobutyl, and R.sup.2 is methyl; [2104] R.sup.1 is 1-hydroxy-1-cyclopentyl, and R.sup.2 is methyl; [2105] R.sup.1 is 1-hydroxy-1-cyclohexyl, and R.sup.2 is methyl; [2106] R.sup.1 is morpholinyl, and R.sup.2 is methyl; [2107] R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is methyl; [2108] R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is fluoro; [2109] R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is chloro; [2110] R.sup.1 is COCH.sub.3, and R.sup.2 is methyl; [2111] R.sup.1 is 2-methoxy-2-propyl, and R.sup.2 is methyl; [2112] R.sup.1 is (dimethylamino)methyl, and R.sup.2 is methyl. [2113] R.sup.2 is 1-hydroxy-2-methylpropan-2-yl, and R.sup.1 is methyl; [2114] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is methyl; [2115] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is isopropyl; [2116] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is 1-hydroxyethyl; [2117] R.sup.2 is hydroxymethyl and R.sup.1 is methyl; [2118] R.sup.2 is 1-hydroxyethyl and R.sup.1 is methyl; [2119] R.sup.2 is 2-hydroxyethyl and R.sup.1 is methyl; [2120] R.sup.2 is 1-hydroxy-2-propyl and R.sup.1 is methyl; [2121] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is phenyl; [2122] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is 5- to 10-membered heteroaryl; [2123] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is pyridyl; [2124] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is pyrazolyl; [2125] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is S(O.sub.2)CH.sub.3; [2126] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is chloro; [2127] R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is fluoro; [2128] R.sup.2 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; [2129] R.sup.2 is 1-hydroxy-1-cyclopropyl, and R.sup.1 is methyl; [2130] R.sup.2 is 1-hydroxy-1-cyclobutyl, and R.sup.1 is methyl; [2131] R.sup.2 is 1-hydroxy-1-cyclopentyl, and R.sup.1 is methyl; [2132] R.sup.2 is 1-hydroxy-1-cyclohexyl, and R.sup.1 is methyl; [2133] R.sup.2 is morpholinyl, and R.sup.1 is methyl; [2134] R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is methyl; [2135] R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is fluoro; [2136] R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is chloro; [2137] R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.1 is methyl; [2138] R.sup.2 is (dimethylamino)methyl, and R.sup.1 is methyl; [2139] R.sup.2 is COCH.sub.3, and R.sup.1 is methyl; or [2140] R.sup.2 is 2-methoxy-2-propyl, and R.sup.1 is methyl.

    [2141] In some embodiments of the compound of formula AA,

    the substituted ring B is

    ##STR00240##

    and R.sup.6 is selected from: [2142] C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkyl substituted with one or more halo, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 alkoxy substituted with one or more halo, C.sub.3-C.sub.7 cycloalkyl, halo, and cyano.

    [2143] In some embodiments of the compound of formula AA,

    the substituted ring B is

    ##STR00241##

    and R.sup.6 is selected from: [2144] isopropyl, ethyl, methyl, trifluoromethyl, trifluoromethoxy, cyclopropyl, halo, chloro, and fluoro.

    [2145] In some embodiments of the compound of formula AA,

    the substituted ring B is

    ##STR00242##

    and R.sup.6 is selected from: [2146] C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkyl substituted with one or more halo, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 alkoxy substituted with one or more halo, C.sub.3-C.sub.7 cycloalkyl, halo, and cyano.

    [2147] In some embodiments of the compound of formula AA,

    the substituted ring B is

    ##STR00243##

    and R.sup.6 is selected from: [2148] isopropyl, ethyl, methyl, trifluoromethyl, trifluoromethoxy, cyclopropyl, halo, chloro, and fluoro.

    [2149] In some embodiments of the compound of formula AA,

    the substituted ring B is

    ##STR00244##

    and R.sup.6 is selected from: [2150] C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkyl substituted with one or more halo, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 alkoxy substituted with one or more halo, C.sub.3-C.sub.7 cycloalkyl, halo, and cyano.

    [2151] In some embodiments of the compound of formula AA,

    the substituted ring B is

    ##STR00245##

    and R.sup.6 is selected from: [2152] isopropyl, ethyl, methyl, trifluoromethyl, trifluoromethoxy, cyclopropyl, halo, chloro, and fluoro.

    [2153] In some embodiments of the compound of formula AA,

    the substituted ring B is

    ##STR00246##

    and R.sup.6 is selected from: [2154] C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkyl substituted with one or more halo, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 alkoxy substituted with one or more halo, C.sub.3-C.sub.7 cycloalkyl, halo, and cyano.

    [2155] In some embodiments of the compound of formula AA,

    the substituted ring B is

    ##STR00247##

    and R.sup.6 is selected from: [2156] isopropyl, ethyl, methyl, trifluoromethyl, trifluoromethoxy, cyclopropyl, halo, chloro, and fluoro.

    [2157] In some embodiments of the compound of formula AA,

    the substituted ring B is

    ##STR00248##

    and R.sup.6 is selected from: [2158] C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkyl substituted with one or more halo, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 alkoxy substituted with one or more halo, C.sub.3-C.sub.7 cycloalkyl, halo, and cyano.

    [2159] In some embodiments of the compound of formula AA,

    the substituted ring B is

    ##STR00249##

    and R.sup.6 is selected from: [2160] isopropyl, ethyl, methyl, trifluoromethyl, trifluoromethoxy, cyclopropyl, halo, chloro, and fluoro.

    [2161] In some embodiments, of the compound of formula AA,

    the substituted ring B is

    ##STR00250##

    and the two R.sup.6 are one of the following combinations: [2162] (i) One R.sup.6 is C.sub.1-C.sub.6 alkyl, and the other R.sup.6 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo; [2163] (ii) One R.sup.6 is C.sub.1-C.sub.6 alkyl and the other R.sup.6 is C.sub.1-C.sub.6 alkyl; [2164] (iii) One R.sup.6 is C.sub.1-C.sub.6 alkyl, and the other R.sup.6 is C.sub.1-C.sub.6 alkyl substituted with one or more halo; [2165] (iv) One R.sup.6 is C.sub.1-C.sub.6 alkyl, and the other R.sup.6 is C.sub.3-C.sub.7 cycloalkyl; [2166] (v) One R.sup.6 is C.sub.1-C.sub.6 alkyl, and the other R.sup.6 is halo; [2167] (vi) One R.sup.6 is C.sub.1-C.sub.6 alkyl, and the other R.sup.6 is cyano; [2168] (vii) One R.sup.6 is C.sub.3-C.sub.7 cycloalkyl, and the other R.sup.6 is C.sub.3-C.sub.7 cycloalkyl; [2169] (viii) One R.sup.6 is C.sub.3-C.sub.7 cycloalkyl, and the other R.sup.6 is halo; [2170] (ix) One R.sup.6 is cyclopropyl and the other R.sup.6 is halo; [2171] (x) One R.sup.6 is C.sub.1-C.sub.6 alkyl, and the other R.sup.6 is C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo; [2172] (xi) One R.sup.6 is C.sub.1-C.sub.6 alkyl, and the other R.sup.6 is C.sub.1-C.sub.6 alkoxy; [2173] (xii) One R.sup.6 is C.sub.1-C.sub.6 alkyl, and the other R.sup.6 is C.sub.1-C.sub.6 alkoxy substituted with one or more halo; [2174] (xiii) One R.sup.6 is halo, and the other R.sup.6 is C.sub.1-C.sub.6 haloalkyl; [2175] (xiv) One R.sup.6 is halo, and the other R.sup.6 is C.sub.1-C.sub.6 haloalkoxy; [2176] (xv) One R.sup.6 is C.sub.1-C.sub.6 alkoxy; and the other R.sup.6 is halo; [2177] (xvi) One R.sup.6 is C.sub.1-C.sub.6 alkoxy; and the other R.sup.6 is chloro.

    [2178] In some embodiments, of the compound of formula AA,

    the substituted ring B is

    ##STR00251##

    and the two R.sup.6 are one of the following combinations: [2179] (i) One R.sup.6 is isopropyl; and the other R.sup.6 is methyl; [2180] (ii) One R.sup.6 is isopropyl; and the other R.sup.6 is n-propyl; [2181] (iii) One R.sup.6 is isopropyl; and the other R.sup.6 is isopropyl; [2182] (iv) One R.sup.6 is isopropyl; and the other R.sup.6 is trifluoromethyl; [2183] (v) One R.sup.6 is isopropyl; and the other R.sup.6 is cyclopropyl; [2184] (vi) One R.sup.6 is isopropyl; and the other R.sup.6 is chloro; [2185] (vii) One R.sup.6 is isopropyl; and the other R.sup.6 is fluoro; [2186] (viii) One R.sup.6 is ethyl; and the other R.sup.6 is fluoro; [2187] (ix) One R.sup.6 is isopropyl; and the other R.sup.6 is cyano; [2188] (x) One R.sup.6 is cyclopropyl; and the other R.sup.6 is cyclopropyl; [2189] (xi) One R.sup.6 is cyclopropyl; and the other R.sup.6 is chloro; [2190] (xii) One R.sup.6 is cyclopropyl; and the other R.sup.6 is fluoro; [2191] (xiii) One R.sup.6 is isopropyl; and the other R.sup.6 is methoxy; [2192] (xiv) One R.sup.6 is isopropyl; and the other R.sup.6 is methoxy; or [2193] (xv) One R.sup.6 is isopropyl; and the other R.sup.6 is trifluoromethoxy.

    [2194] In some embodiments, of the compound of formula AA,

    the substituted ring B is

    ##STR00252##

    and R.sup.6 and R.sup.7 are one of the following combinations: [2195] (i) R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo; [2196] (ii) R.sup.6 is C.sub.1-C.sub.6 alkyl and R.sup.7 is C.sub.1-C.sub.6 alkyl; [2197] (iii) R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkyl substituted with one or more halo; [2198] (iv) R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.3-C.sub.7 cycloalkyl; [2199] (v) R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is halo; [2200] (vi) R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is cyano; [2201] (vii) R.sup.6 is C.sub.3-C.sub.7 cycloalkyl, and R.sup.7 is C.sub.3-C.sub.7 cycloalkyl; [2202] (viii) R.sup.6 is C.sub.3-C.sub.7 cycloalkyl, and R.sup.7 is halo; [2203] (ix) R.sup.6 is cyclopropyl and R.sup.7 is halo; [2204] (x) R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo; [2205] (xi) R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkoxy; [2206] (xii) R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkoxy substituted with one or more halo; [2207] (xiii) R.sup.6 is halo, and R.sup.7 is C.sub.1-C.sub.6 haloalkyl; [2208] (xiv) R.sup.6 is halo, and R.sup.7 is C.sub.1-C.sub.6 haloalkoxy; [2209] (xv) R.sup.6 is C.sub.1-C.sub.6 alkoxy; and R.sup.7 is halo; [2210] (xvi) R.sup.6 is C.sub.1-C.sub.6 alkoxy; and R.sup.7 is chloro; [2211] (xvii) R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo; [2212] (xviii) R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkyl substituted with one or more halo; [2213] (xix) R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.3-C.sub.7 cycloalkyl; [2214] (xx) R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is halo; [2215] (xxi) R.sup.7 is C.sub.1-C.sub.6 alkyl and R.sup.6 is halo; [2216] (xxii) R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is cyano; [2217] (xxiii) R.sup.7 is C.sub.3-C.sub.7 cycloalkyl, and R.sup.6 is C.sub.3-C.sub.7 cycloalkyl; [2218] (xxiv) R.sup.7 is C.sub.3-C.sub.7 cycloalkyl, and R.sup.6 is halo; [2219] (xxv) R.sup.7 is C.sub.3-C.sub.7 cycloalkyl and R.sup.6 is halo; [2220] (xxvi) R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo; [2221] (xxvii) R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkoxy; [2222] (xxviii) R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkoxy substituted with one or more halo; [2223] (xxix) R.sup.7 is halo, and R.sup.6 is C.sub.1-C.sub.6 haloalkyl; [2224] (xxx) R.sup.7 is halo, and R.sup.6 is C.sub.1-C.sub.6 haloalkoxy; [2225] (xxxi) R.sup.7 is C.sub.1-C.sub.6 alkoxy; and R.sup.6 is halo; or [2226] (xxxii) R.sup.7 is C.sub.1-C.sub.6 alkoxy; and R.sup.6 is chloro.

    [2227] In some embodiments, of the compound of formula AA,

    the substituted ring B is

    ##STR00253##

    and R.sup.6 and R.sup.7 are one of the following combinations: [2228] (i) R.sup.6 is isopropyl; and R.sup.7 is methyl; [2229] (ii) R.sup.6 is isopropyl; and R.sup.7 is isopropyl; [2230] (iii) R.sup.6 is isopropyl; and R.sup.7 is trifluoromethyl; [2231] (iv) R.sup.6 is isopropyl; and R.sup.7 is cyclopropyl; [2232] (v) R.sup.6 is isopropyl; and R.sup.7 is chloro; [2233] (vi) R.sup.6 is isopropyl; and R.sup.7 is fluoro; [2234] (vii) R.sup.6 is ethyl; and R.sup.7 is fluoro; [2235] (viii) R.sup.6 is isopropyl; and R.sup.7 is cyano; [2236] (ix) R.sup.6 is cyclopropyl; and R.sup.7 is cyclopropyl; [2237] (x) R.sup.6 is cyclopropyl; and R.sup.7 is chloro; [2238] (xi) R.sup.6 is cyclopropyl; and R.sup.7 is fluoro; R.sup.6 is isopropyl; and R.sup.7 is methoxy; [2239] (xii) R.sup.6 is isopropyl; and R.sup.7 is trifluoromethoxy; [2240] (xiii) R.sup.6 is chloro; and R.sup.7 is trifluoromethyl; [2241] (xiv) R.sup.6 is chloro; and R.sup.7 is trifluoromethoxy; [2242] (xv) R.sup.7 is isopropyl; and R.sup.6 is methyl; [2243] (xvi) R.sup.7 is isopropyl; and R.sup.6 is trifluoromethyl; [2244] (xvii) R.sup.7 is isopropyl; and R.sup.6 is cyclopropyl; [2245] (xviii) R.sup.7 is isopropyl; and R.sup.6 is chloro; [2246] (xix) R.sup.7 is ethyl; and R.sup.6 is fluoro; [2247] (xx) R.sup.7 is isopropyl; and R.sup.6 is cyano; [2248] (xxi) R.sup.7 is cyclopropyl; and R.sup.6 is cyclopropyl; [2249] (xxii) R.sup.7 is cyclopropyl; and R.sup.6 is chloro; [2250] (xxiii) R.sup.7 is cyclopropyl; and R.sup.6 is fluoro; [2251] (xxiv) R.sup.7 is isopropyl; and R.sup.6 is methoxy; [2252] (xxv) R.sup.7 is isopropyl; and R.sup.6 is trifluoromethoxy; [2253] (xxvi) R.sup.7 is chloro; and R.sup.6 is trifluoromethyl; or [2254] (xxvii) R.sup.7 is chloro; and R.sup.6 is trifluoromethoxy.

    [2255] In some embodiments, of the compound of formula AA,

    the substituted ring B is

    ##STR00254##

    and R.sup.6 and R.sup.7 are one of the following combinations: [2256] (i) R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo; [2257] (ii) R.sup.6 is C.sub.1-C.sub.6 alkyl and R.sup.7 is C.sub.1-C.sub.6 alkyl; [2258] (iii) R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkyl substituted with one or more halo; [2259] (iv) R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.3-C.sub.7 cycloalkyl; [2260] (v) R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is halo; [2261] (vi) R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is cyano; [2262] (vii) R.sup.6 is C.sub.3-C.sub.7 cycloalkyl, and R.sup.7 is C.sub.3-C.sub.7 cycloalkyl; [2263] (viii) R.sup.6 is C.sub.3-C.sub.7 cycloalkyl, and R.sup.7 is halo; [2264] (ix) R.sup.6 is cyclopropyl and R.sup.7 is halo; [2265] (x) R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo; [2266] (xi) R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkoxy; [2267] (xii) R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkoxy substituted with one or more halo; [2268] (xiii) R.sup.6 is halo, and R.sup.7 is C.sub.1-C.sub.6 haloalkyl; [2269] (xiv) R.sup.6 is halo, and R.sup.7 is C.sub.1-C.sub.6 haloalkoxy; [2270] (xv) R.sup.6 is C.sub.1-C.sub.6 alkoxy; and R.sup.7 is halo; [2271] (xvi) R.sup.6 is C.sub.1-C.sub.6 alkoxy; and R.sup.7 is chloro; [2272] (xvii) R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo; [2273] (xviii) R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkyl substituted with one or more halo; [2274] (xix) R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.3-C.sub.7 cycloalkyl; [2275] (xx) R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is halo; [2276] (xxi) R.sup.7 is C.sub.1-C.sub.6 alkyl and R.sup.6 is halo; [2277] (xxii) R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is cyano; [2278] (xxiii) R.sup.7 is C.sub.3-C.sub.7 cycloalkyl, and R.sup.6 is C.sub.3-C.sub.7 cycloalkyl; [2279] (xxiv) R.sup.7 is C.sub.3-C.sub.7 cycloalkyl, and R.sup.6 is halo; [2280] (xxv) R.sup.7 is C.sub.3-C.sub.7 cycloalkyl and R.sup.6 is halo; [2281] (xxvi) R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo; [2282] (xxvii) R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkoxy; [2283] (xxviii) R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkoxy substituted with one or more halo; [2284] (xxix) R.sup.7 is halo, and R.sup.6 is C.sub.1-C.sub.6 haloalkyl; [2285] (xxx) R.sup.7 is halo, and R.sup.6 is C.sub.1-C.sub.6 haloalkoxy; [2286] (xxxi) R.sup.7 is C.sub.1-C.sub.6 alkoxy; and R.sup.6 is halo; or [2287] (xxxii) R.sup.7 is C.sub.1-C.sub.6 alkoxy; and R.sup.6 is chloro.

    [2288] In some embodiments, of the compound of formula AA,

    the substituted ring B is

    ##STR00255##

    and R.sup.6 and R.sup.7 are one of the following combinations: [2289] (i) R.sup.6 is isopropyl; and R.sup.7 is methyl; [2290] (ii) R.sup.6 is isopropyl; and R.sup.7 is isopropyl; [2291] (iii) R.sup.6 is isopropyl; and R.sup.7 is trifluoromethyl; [2292] (iv) R.sup.6 is isopropyl; and R.sup.7 is cyclopropyl; [2293] (v) R.sup.6 is isopropyl; and R.sup.7 is chloro; [2294] (vi) R.sup.6 is isopropyl; and R.sup.7 is fluoro; [2295] (vii) R.sup.6 is ethyl; and R.sup.7 is fluoro; [2296] (viii) R.sup.6 is isopropyl; and R.sup.7 is cyano; [2297] (ix) R.sup.6 is cyclopropyl; and R.sup.7 is cyclopropyl; [2298] (x) R.sup.6 is cyclopropyl; and R.sup.7 is chloro; [2299] (xi) R.sup.6 is cyclopropyl; and R.sup.7 is fluoro; [2300] (xii) R.sup.6 is isopropyl; and R.sup.7 is methoxy; [2301] (xiii) R.sup.6 is isopropyl; and R.sup.7 is trifluoromethoxy; [2302] (xiv) R.sup.6 is chloro; and R.sup.7 is trifluoromethyl; [2303] (xv) R.sup.6 is chloro; and R.sup.7 is trifluoromethoxy; [2304] (xvi) R.sup.7 is isopropyl; and R.sup.6 is methyl; [2305] (xvii) R.sup.7 is isopropyl; and R.sup.6 is trifluoromethyl; [2306] (xviii) R.sup.7 is isopropyl; and R.sup.6 is cyclopropyl; [2307] (xix) R.sup.7 is isopropyl; and R.sup.6 is chloro; [2308] (xx) R.sup.7 is ethyl; and R.sup.6 is fluoro; [2309] (xxi) R.sup.7 is isopropyl; and R.sup.6 is cyano; [2310] (xxii) R.sup.7 is cyclopropyl; and R.sup.6 is cyclopropyl; [2311] (xxiii) R.sup.7 is cyclopropyl; and R.sup.6 is chloro; [2312] (xxiv) R.sup.7 is cyclopropyl; and R.sup.6 is fluoro; [2313] (xxv) R.sup.7 is isopropyl; and R.sup.6 is methoxy; [2314] (xxvi) R.sup.7 is isopropyl; and R.sup.6 is trifluoromethoxy; [2315] (xxvii) R.sup.7 is chloro; and R.sup.6 is trifluoromethyl; or [2316] (xxviii) R.sup.7 is chloro; and R.sup.6 is trifluoromethoxy.

    [2317] In some embodiments, of the compound of formula AA,

    the substituted ring B is

    ##STR00256##

    and R.sup.6 and R.sup.7 are one of the following combinations: [2318] (i) R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo; [2319] (ii) R.sup.6 is C.sub.1-C.sub.6 alkyl and R.sup.7 is C.sub.1-C.sub.6 alkyl; [2320] (iii) R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkyl substituted with one or more halo; [2321] (iv) R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.3-C.sub.7 cycloalkyl; [2322] (v) R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is halo; [2323] (vi) R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is cyano; [2324] (vii) R.sup.6 is C.sub.3-C.sub.7 cycloalkyl, and R.sup.7 is C.sub.3-C.sub.7 cycloalkyl; [2325] (viii) R.sup.6 is C.sub.3-C.sub.7 cycloalkyl, and R.sup.7 is halo; [2326] (ix) R.sup.6 is cyclopropyl and R.sup.7 is halo; [2327] (x) R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo; [2328] (xi) R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkoxy; [2329] (xii) R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkoxy substituted with one or more halo; [2330] (xiii) R.sup.6 is halo, and R.sup.7 is C.sub.1-C.sub.6 haloalkyl; [2331] (xiv) R.sup.6 is halo, and R.sup.7 is C.sub.1-C.sub.6 haloalkoxy; [2332] (xv) R.sup.6 is C.sub.1-C.sub.6 alkoxy; and R.sup.7 is halo; [2333] (xvi) R.sup.6 is C.sub.1-C.sub.6 alkoxy; and R.sup.7 is chloro; [2334] (xvii) R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo; [2335] (xviii) R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkyl substituted with one or more halo; [2336] (xix) R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.3-C.sub.7 cycloalkyl; [2337] (xx) R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is halo; [2338] (xxi) R.sup.7 is C.sub.1-C.sub.6 alkyl and R.sup.6 is halo; [2339] (xxii) R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is cyano; [2340] (xxiii) R.sup.7 is C.sub.3-C.sub.7 cycloalkyl, and R.sup.6 is C.sub.3-C.sub.7 cycloalkyl; [2341] (xxiv) R.sup.7 is C.sub.3-C.sub.7 cycloalkyl, and R.sup.6 is halo; [2342] (xxv) R.sup.7 is C.sub.3-C.sub.7 cycloalkyl and R.sup.6 is halo; [2343] (xxvi) R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo; [2344] (xxvii) R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkoxy; [2345] (xxviii) R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkoxy substituted with one or more halo; [2346] (xxix) R.sup.7 is halo, and R.sup.6 is C.sub.1-C.sub.6 haloalkyl; [2347] (xxx) R.sup.7 is halo, and R.sup.6 is C.sub.1-C.sub.6 haloalkoxy; [2348] (xxxi) R.sup.7 is C.sub.1-C.sub.6 alkoxy; and R.sup.6 is halo; or [2349] (xxxii) R.sup.7 is C.sub.1-C.sub.6 alkoxy; and R.sup.6 is chloro; [2350] (xxxiii) R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a C.sub.4-C.sub.6 aliphatic carbocyclic ring optionally substituted with one or more hydroxy, oxo, or C.sub.1-C.sub.6 alkyl; or [2351] (xxxiv) R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a 5-to-6-membered heterocyclic ring containing 1 heteroatom independently selected from O, N, and S, wherein the heterocyclic ring optionally substituted with one or more hydroxy, oxo, or C.sub.1-C.sub.6 alkyl.

    [2352] In some embodiments, of the compound of formula AA,

    the substituted ring B is

    ##STR00257##

    and R.sup.6 and R.sup.7 are one of the following combinations: [2353] (i) R.sup.6 is isopropyl; and R.sup.7 is methyl; [2354] (ii) R.sup.6 is isopropyl; and R.sup.7 is isopropyl; [2355] (iii) R.sup.6 is isopropyl; and R.sup.7 is trifluoromethyl; [2356] (iv) R.sup.6 is isopropyl; and R.sup.7 is cyclopropyl; [2357] (v) R.sup.6 is isopropyl; and R.sup.7 is chloro; [2358] (vi) R.sup.6 is isopropyl; and R.sup.7 is fluoro; [2359] (vii) R.sup.6 is ethyl; and R.sup.7 is fluoro; [2360] (viii) R.sup.6 is isopropyl; and R.sup.7 is cyano; [2361] (ix) R.sup.6 is cyclopropyl; and R.sup.7 is cyclopropyl; [2362] (x) R.sup.6 is cyclopropyl; and R.sup.7 is chloro; [2363] (xi) R.sup.6 is cyclopropyl; and R.sup.7 is fluoro; [2364] (xii) R.sup.6 is isopropyl; and R.sup.7 is methoxy; [2365] (xiii) R.sup.6 is isopropyl; and R.sup.7 is trifluoromethoxy; [2366] (xiv) R.sup.6 is chloro; and R.sup.7 is trifluoromethyl; [2367] (xv) R.sup.6 is chloro; and R.sup.7 is trifluoromethoxy; [2368] (xvi) R.sup.7 is isopropyl; and R.sup.6 is methyl; [2369] (xvii) R.sup.7 is isopropyl; and R.sup.6 is trifluoromethyl; [2370] (xviii) R.sup.7 is isopropyl; and R.sup.6 is cyclopropyl; [2371] (xix) R.sup.7 is isopropyl; and R.sup.6 is chloro; [2372] (xx) R.sup.7 is ethyl; and R.sup.6 is fluoro; [2373] (xxi) R.sup.7 is isopropyl; and R.sup.6 is cyano; [2374] (xxii) R.sup.7 is cyclopropyl; and R.sup.6 is cyclopropyl; [2375] (xxiii) R.sup.7 is cyclopropyl; and R.sup.6 is chloro; [2376] (xxiv) R.sup.7 is cyclopropyl; and R.sup.6 is fluoro; [2377] (xxv) R.sup.7 is isopropyl; and R.sup.6 is methoxy; [2378] (xxvi) R.sup.7 is isopropyl; and R.sup.6 is trifluoromethoxy; [2379] (xxvii) R.sup.7 is chloro; and R.sup.6 is trifluoromethyl; [2380] (xxviii) R.sup.7 is chloro; and R.sup.6 is trifluoromethoxy; [2381] (xxix) R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a C.sub.4 aliphatic carbocyclic ring; [2382] (xxx) R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a C.sub.5 aliphatic carbocyclic ring; [2383] (xxxi) R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a C.sub.6 aliphatic carbocyclic ring; [2384] (xxxii) R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a 5-membered heterocyclic ring containing 1 heteroatoms independently selected from 0, N, and S; [2385] (xxxiii) R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a 6-membered heterocyclic ring containing 1 heteroatoms independently selected from 0, N, and S; or [2386] (xxxiv) R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a C.sub.5 aliphatic carbocyclic ring.

    [2387] In some embodiments, of the compound of formula AA,

    the substituted ring B is

    ##STR00258##

    and R.sup.6 and R.sup.7 are one of the following combinations: [2388] (i) R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo; [2389] (ii) R.sup.6 is C.sub.1-C.sub.6 alkyl and R.sup.7 is C.sub.1-C.sub.6 alkyl; [2390] (iii) R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkyl substituted with one or more halo; [2391] (iv) R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.3-C.sub.7 cycloalkyl; [2392] (v) R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is halo; [2393] (vi) R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is cyano; [2394] (vii) R.sup.6 is C.sub.3-C.sub.7 cycloalkyl, and R.sup.7 is C.sub.3-C.sub.7 cycloalkyl; [2395] (viii) R.sup.6 is C.sub.3-C.sub.7 cycloalkyl, and R.sup.7 is halo; [2396] (ix) R.sup.6 is cyclopropyl and R.sup.7 is halo; [2397] (x) R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo; [2398] (xi) R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkoxy; [2399] (xii) R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkoxy substituted with one or more halo; [2400] (xiii) R.sup.6 is halo, and R.sup.7 is C.sub.1-C.sub.6 haloalkyl; [2401] (xiv) R.sup.6 is halo, and R.sup.7 is C.sub.1-C.sub.6 haloalkoxy; [2402] (xv) R.sup.6 is C.sub.1-C.sub.6 alkoxy; and R.sup.7 is halo; [2403] (xvi) R.sup.6 is C.sub.1-C.sub.6 alkoxy; and R.sup.7 is chloro; [2404] (xvii) R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo; [2405] (xviii) R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkyl substituted with one or more halo; [2406] (xix) R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.3-C.sub.7 cycloalkyl; [2407] (xx) R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is halo; [2408] (xxi) R.sup.7 is C.sub.1-C.sub.6 alkyl and R.sup.6 is halo; [2409] (xxii) R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is cyano; [2410] (xxiii) R.sup.7 is C.sub.3-C.sub.7 cycloalkyl, and R.sup.6 is C.sub.3-C.sub.7 cycloalkyl; [2411] (xxiv) R.sup.7 is C.sub.3-C.sub.7 cycloalkyl, and R.sup.6 is halo; [2412] (xxv) R.sup.7 is C.sub.3-C.sub.7 cycloalkyl and R.sup.6 is halo; [2413] (xxvi) R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo; [2414] (xxvii) R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkoxy; [2415] (xxviii) R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkoxy substituted with one or more halo; [2416] (xxix) R.sup.7 is halo, and R.sup.6 is C.sub.1-C.sub.6 haloalkyl; [2417] (xxx) R.sup.7 is halo, and R.sup.6 is C.sub.1-C.sub.6 haloalkoxy; [2418] (xxxi) R.sup.7 is C.sub.1-C.sub.6 alkoxy; and R.sup.6 is halo; or [2419] (xxxii) R.sup.7 is C.sub.1-C.sub.6 alkoxy; and R.sup.6 is chloro.

    [2420] In some embodiments, of the compound of formula AA,

    the substituted ring B is

    ##STR00259##

    and R.sup.6 and R.sup.7 are one of the following combinations: [2421] (i) R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo; [2422] (ii) R.sup.6 is C.sub.1-C.sub.6 alkyl and R.sup.7 is C.sub.1-C.sub.6 alkyl; [2423] (iii) R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkyl substituted with one or more halo; [2424] (iv) R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.3-C.sub.7 cycloalkyl; [2425] (v) R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is halo; [2426] (vi) R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is cyano; [2427] (vii) R.sup.6 is C.sub.3-C.sub.7 cycloalkyl, and R.sup.7 is C.sub.3-C.sub.7 cycloalkyl; [2428] (viii) R.sup.6 is C.sub.3-C.sub.7 cycloalkyl, and R.sup.7 is halo; [2429] (ix) R.sup.6 is cyclopropyl and R.sup.7 is halo; [2430] (x) R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo; [2431] (xi) R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkoxy; [2432] (xii) R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkoxy substituted with one or more halo; [2433] (xiii) R.sup.6 is halo, and R.sup.7 is C.sub.1-C.sub.6 haloalkyl; [2434] (xiv) R.sup.6 is halo, and R.sup.7 is C.sub.1-C.sub.6 haloalkoxy; [2435] (xv) R.sup.6 is C.sub.1-C.sub.6 alkoxy; and R.sup.7 is halo; [2436] (xvi) R.sup.6 is C.sub.1-C.sub.6 alkoxy; and R.sup.7 is chloro; [2437] (xvii) R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo; [2438] (xviii) R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkyl substituted with one or more halo; [2439] (xix) R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.3-C.sub.7 cycloalkyl; [2440] (xx) R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is halo; [2441] (xxi) R.sup.7 is C.sub.1-C.sub.6 alkyl and R.sup.6 is halo; [2442] (xxii) R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is cyano; [2443] (xxiii) R.sup.7 is C.sub.3-C.sub.7 cycloalkyl, and R.sup.6 is C.sub.3-C.sub.7 cycloalkyl; [2444] (xxiv) R.sup.7 is C.sub.3-C.sub.7 cycloalkyl, and R.sup.6 is halo; [2445] (xxv) R.sup.7 is C.sub.3-C.sub.7 cycloalkyl and R.sup.6 is halo; [2446] (xxvi) R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo; [2447] (xxvii) R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkoxy; [2448] (xxviii) R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkoxy substituted with one or more halo; [2449] (xxix) R.sup.7 is halo, and R.sup.6 is C.sub.1-C.sub.6 haloalkyl; [2450] (xxx) R.sup.7 is halo, and R.sup.6 is C.sub.1-C.sub.6 haloalkoxy; [2451] (xxxi) R.sup.7 is C.sub.1-C.sub.6 alkoxy; and R.sup.6 is halo; [2452] (xxxii) R.sup.7 is C.sub.1-C.sub.6 alkoxy; and R.sup.6 is chloro; [2453] (xxxiii) R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a C.sub.4-C.sub.6 aliphatic carbocyclic ring optionally substituted with one or more hydroxy, oxo, or C.sub.1-C.sub.6 alkyl; or [2454] (xxxiv) R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a 5-to-6-membered heterocyclic ring containing 1 heteroatom independently selected from O, N, and S, wherein the heterocyclic ring optionally substituted with one or more hydroxy, oxo, or C.sub.1-C.sub.6 alkyl.

    [2455] In some embodiments, of the compound of formula AA,

    the substituted ring B is

    ##STR00260##

    and R.sup.6 and R.sup.7 are one of the following combinations: [2456] (i) R.sup.6 is isopropyl; and R.sup.7 is methyl; [2457] (ii) R.sup.6 is isopropyl; and R.sup.7 is isopropyl; [2458] (iii) R.sup.6 is isopropyl; and R.sup.7 is trifluoromethyl; [2459] (iv) R.sup.6 is isopropyl; and R.sup.7 is cyclopropyl; [2460] (v) R.sup.6 is isopropyl; and R.sup.7 is chloro; [2461] (vi) R.sup.6 is isopropyl; and R.sup.7 is fluoro; [2462] (vii) R.sup.6 is ethyl; and R.sup.7 is fluoro; [2463] (viii) R.sup.6 is isopropyl; and R.sup.7 is cyano; [2464] (ix) R.sup.6 is cyclopropyl; and R.sup.7 is cyclopropyl; [2465] (x) R.sup.6 is cyclopropyl; and R.sup.7 is chloro; [2466] (xi) R.sup.6 is cyclopropyl; and R.sup.7 is fluoro; [2467] (xii) R.sup.6 is isopropyl; and R.sup.7 is methoxy; [2468] (xiii) R.sup.6 is isopropyl; and R.sup.7 is trifluoromethoxy; [2469] (xiv) R.sup.6 is chloro; and R.sup.7 is trifluoromethyl; [2470] (xv) R.sup.6 is chloro; and R.sup.7 is trifluoromethoxy; [2471] (xvi) R.sup.7 is isopropyl; and R.sup.6 is methyl; [2472] (xvii) R.sup.7 is isopropyl; and R.sup.6 is trifluoromethyl; [2473] (xviii) R.sup.7 is isopropyl; and R.sup.6 is cyclopropyl; [2474] (xix) R.sup.7 is isopropyl; and R.sup.6 is chloro; [2475] (xx) R.sup.7 is ethyl; and R.sup.6 is fluoro; [2476] (xxi) R.sup.7 is isopropyl; and R.sup.6 is cyano; [2477] (xxii) R.sup.7 is cyclopropyl; and R.sup.6 is cyclopropyl; [2478] (xxiii) R.sup.7 is cyclopropyl; and R.sup.6 is chloro; [2479] (xxiv) R.sup.7 is cyclopropyl; and R.sup.6 is fluoro; [2480] (xxv) R.sup.7 is isopropyl; and R.sup.6 is methoxy; [2481] (xxvi) R.sup.7 is isopropyl; and R.sup.6 is trifluoromethoxy; [2482] (xxvii) R.sup.7 is chloro; and R.sup.6 is trifluoromethyl; [2483] (xxviii) R.sup.7 is chloro; and R.sup.6 is trifluoromethoxy; [2484] (xxix) R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a C.sub.4 aliphatic carbocyclic ring; [2485] (xxx) R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a C.sub.5 aliphatic carbocyclic ring; [2486] (xxxi) R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a C.sub.6 aliphatic carbocyclic ring; [2487] (xxxii) R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a 5-membered heterocyclic ring containing 1 heteroatoms independently selected from O, N, and S; [2488] (xxxiii) R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a 6-membered heterocyclic ring containing 1 heteroatoms independently selected from O, N, and S; or [2489] (xxxiv) R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a C.sub.5 aliphatic carbocyclic ring.

    [2490] In some embodiments, of the compound of formula AA,

    the substituted ring B is

    ##STR00261##

    and R.sup.6 and R.sup.7 are one of the following combinations: [2491] (i) R.sup.6 is isopropyl; and R.sup.7 is methyl; [2492] (ii) R.sup.6 is isopropyl; and R.sup.7 is isopropyl; [2493] (iii) R.sup.6 is isopropyl; and R.sup.7 is trifluoromethyl; [2494] (iv) R.sup.6 is isopropyl; and R.sup.7 is cyclopropyl; [2495] (v) R.sup.6 is isopropyl; and R.sup.7 is chloro; [2496] (vi) R.sup.6 is isopropyl; and R.sup.7 is fluoro; [2497] (vii) R.sup.6 is ethyl; and R.sup.7 is fluoro; [2498] (viii) R.sup.6 is isopropyl; and R.sup.7 is cyano; [2499] (ix) R.sup.6 is cyclopropyl; and R.sup.7 is cyclopropyl; [2500] (x) R.sup.6 is cyclopropyl; and R.sup.7 is chloro; [2501] (xi) R.sup.6 is cyclopropyl; and R.sup.7 is fluoro; [2502] (xii) R.sup.6 is isopropyl; and R.sup.7 is methoxy; [2503] (xiii) R.sup.6 is isopropyl; and R.sup.7 is trifluoromethoxy; [2504] (xiv) R.sup.6 is chloro; and R.sup.7 is trifluoromethyl; [2505] (xv) R.sup.6 is chloro; and R.sup.7 is trifluoromethoxy; [2506] (xvi) R.sup.7 is isopropyl; and R.sup.6 is methyl; [2507] (xvii) R.sup.7 is isopropyl; and R.sup.6 is trifluoromethyl; [2508] (xviii) R.sup.7 is isopropyl; and R.sup.6 is cyclopropyl; [2509] (xix) R.sup.7 is isopropyl; and R.sup.6 is chloro; [2510] (xx) R.sup.7 is ethyl; and R.sup.6 is fluoro; [2511] (xxi) R.sup.7 is isopropyl; and R.sup.6 is cyano; [2512] (xxii) R.sup.7 is cyclopropyl; and R.sup.6 is cyclopropyl; [2513] (xxiii) R.sup.7 is cyclopropyl; and R.sup.6 is chloro; [2514] (xxiv) R.sup.7 is cyclopropyl; and R.sup.6 is fluoro; [2515] (xxv) R.sup.7 is isopropyl; and R.sup.6 is methoxy; [2516] (xxvi) R.sup.7 is isopropyl; and R.sup.6 is trifluoromethoxy; [2517] (xxvii) R.sup.7 is chloro; and R.sup.6 is trifluoromethyl; or [2518] (xxviii) R.sup.7 is chloro; and R.sup.6 is trifluoromethoxy.

    [2519] In some embodiments, of the compound of formula AA,

    the substituted ring B is

    ##STR00262##

    and R.sup.6 and R.sup.7 are one of the following combinations: [2520] (i) each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo; [2521] (ii) each R.sup.6 is independently C.sub.1-C.sub.6 alkyl and R.sup.7 is C.sub.1-C.sub.6 alkyl; [2522] (iii) each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkyl substituted with one or more halo; [2523] (iv) each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.3-C.sub.7 cycloalkyl; [2524] (v) each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and R.sup.7 is halo; [2525] (vi) each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and R.sup.7 is cyano; [2526] (vii) each R.sup.6 is independently C.sub.3-C.sub.7 cycloalkyl, and R.sup.7 is C.sub.3-C.sub.7 cycloalkyl; [2527] (viii) each R.sup.6 is independently C.sub.3-C.sub.7 cycloalkyl, and R.sup.7 is halo; [2528] (ix) each R.sup.6 is independently cyclopropyl and R.sup.7 is halo; [2529] (x) each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo; [2530] (xi) each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkoxy; [2531] (xii) each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkoxy substituted with one or more halo; [2532] (xiii) each R.sup.6 is independently halo, and R.sup.7 is C.sub.1-C.sub.6 haloalkyl; [2533] (xiv) each R.sup.6 is independently halo, and R.sup.7 is C.sub.1-C.sub.6 haloalkoxy; [2534] (xv) each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy; and R.sup.7 is halo; [2535] (xvi) each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy; and R.sup.7 is chloro; [2536] (xvii) R.sup.7 is C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo; [2537] (xviii) R.sup.7 is C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkyl substituted with one or more halo; [2538] (xix) R.sup.7 is C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.3-C.sub.7 cycloalkyl; [2539] (xx) R.sup.7 is C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently halo; [2540] (xxi) R.sup.7 is C.sub.1-C.sub.6 alkyl and each R.sup.6 is independently halo; [2541] (xxii) R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is cyano; [2542] (xxiii) R.sup.7 is C.sub.3-C.sub.7 cycloalkyl, and each R.sup.6 is independently C.sub.3-C.sub.7 cycloalkyl; [2543] (xxiv) R.sup.7 is C.sub.3-C.sub.7 cycloalkyl, and each R.sup.6 is independently halo; [2544] (xxv) R.sup.7 is C.sub.3-C.sub.7 cycloalkyl and each R.sup.6 is independently halo; [2545] (xxvi) R.sup.7 is C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo; [2546] (xxvii) R.sup.7 is C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy; [2547] (xxviii) R.sup.7 is C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy substituted with one or more halo; [2548] (xxix) R.sup.7 is halo, and each R.sup.6 is independently C.sub.1-C.sub.6 haloalkyl; [2549] (xxx) R.sup.7 is halo, and each R.sup.6 is independently C.sub.1-C.sub.6 haloalkoxy; [2550] (xxxi) R.sup.7 is C.sub.1-C.sub.6 alkoxy; and each R.sup.6 is independently halo; [2551] (xxxii) R.sup.7 is C.sub.1-C.sub.6 alkoxy; and R.sup.6 is chloro; [2552] (xxxiii) R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a C.sub.5 aliphatic carbocyclic ring; [2553] (xxxiv) R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a C.sub.4-C.sub.6 aliphatic carbocyclic ring optionally substituted with one or more hydroxy, oxo, or C.sub.1-C.sub.6 alkyl; and one R.sup.6 is halo or cyano; or [2554] (xxxv) R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a 5-to-6-membered heterocyclic ring containing 1 heteroatom independently selected from O, N, and S, wherein the heterocyclic ring optionally substituted with one or more hydroxy, oxo, or C.sub.1-C.sub.6 alkyl; and one R.sup.6 is halo or cyano.

    [2555] In some embodiments, of the compound of formula AA,

    the substituted ring B is

    ##STR00263##

    and R.sup.6 and R.sup.7 are one of the following combinations: [2556] (i) each R.sup.6 is isopropyl; and R.sup.7 is methyl; [2557] (ii) each R.sup.6 is isopropyl; and R.sup.7 is isopropyl; [2558] (iii) each R.sup.6 is isopropyl; and R.sup.7 is trifluoromethyl; [2559] (iv) each R.sup.6 is isopropyl; and R.sup.7 is cyclopropyl; [2560] (v) each R.sup.6 is isopropyl; and R.sup.7 is chloro; [2561] (vi) each R.sup.6 is isopropyl; and R.sup.7 is fluoro; [2562] (vii) each R.sup.6 is ethyl; and R.sup.7 is fluoro; [2563] (viii) each R.sup.6 is isopropyl; and R.sup.7 is cyano; [2564] (ix) each R.sup.6 is cyclopropyl; and R.sup.7 is cyclopropyl; [2565] (x) each R.sup.6 is cyclopropyl; and R.sup.7 is chloro; [2566] (xi) each R.sup.6 is cyclopropyl; and R.sup.7 is fluoro; [2567] (xii) each R.sup.6 is isopropyl; and R.sup.7 is methoxy; [2568] (xiii) each R.sup.6 is isopropyl; and R.sup.7 is trifluoromethoxy; [2569] (xiv) each R.sup.6 is chloro; and R.sup.7 is trifluoromethyl; [2570] (xv) each R.sup.6 is chloro; and R.sup.7 is trifluoromethoxy; [2571] (xvi) R.sup.7 is isopropyl; and each R.sup.6 is methyl; [2572] (xvii) R.sup.7 is isopropyl; and each R.sup.6 is trifluoromethyl; [2573] (xviii) R.sup.7 is isopropyl; and each R.sup.6 is cyclopropyl; [2574] (xix) R.sup.7 is isopropyl; and each R.sup.6 is chloro; [2575] (xx) R.sup.7 is ethyl; and each R.sup.6 is fluoro; [2576] (xxi) R.sup.7 is isopropyl; and each R.sup.6 is cyano; [2577] (xxii) R.sup.7 is cyclopropyl; and each R.sup.6 is cyclopropyl; [2578] (xxiii) R.sup.7 is cyclopropyl; and each R.sup.6 is chloro; [2579] (xxiv) R.sup.7 is cyclopropyl; and each R.sup.6 is fluoro; [2580] (xxv) R.sup.7 is isopropyl; and each R.sup.6 is methoxy; [2581] (xxvi) R.sup.7 is isopropyl; and each R.sup.6 is trifluoromethoxy; [2582] (xxvii) R.sup.7 is chloro; and each R.sup.6 is trifluoromethyl; [2583] (xxviii) R.sup.7 is chloro; and each R.sup.6 is trifluoromethoxy; [2584] (xxix) one R.sup.6 is isopropyl; the other R.sup.6 is trifluoromethyl; and R.sup.7 is chloro; [2585] (xxx) R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a C.sub.4 aliphatic carbocyclic ring; and one R.sup.6 is fluoro, chloro, or cyano; [2586] (xxxi) R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a C.sub.5 aliphatic carbocyclic ring; and one R.sup.6 is fluoro, chloro, or cyano; [2587] (xxxii) R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a C.sub.6 aliphatic carbocyclic ring; and one R.sup.6 is fluoro, chloro, or cyano; [2588] (xxxiii) R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a 5-membered heterocyclic ring containing 1 heteroatoms independently selected from 0, N, and S; and one R.sup.6 is fluoro, chloro, or cyano; or [2589] (xxxiv) R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a 6-membered heterocyclic ring containing 1 heteroatoms independently selected from 0, N, and S; and one R.sup.6 is fluoro, chloro, or cyano.

    [2590] In some embodiments, of the compound of formula AA,

    the substituted ring B is

    ##STR00264##

    and R.sup.6 and R.sup.7 are one of the following combinations: [2591] (i) each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo; [2592] (ii) each R.sup.6 is independently C.sub.1-C.sub.6 alkyl and R.sup.7 is C.sub.1-C.sub.6 alkyl; [2593] (iii) each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkyl substituted with one or more halo; [2594] (iv) each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.3-C.sub.7 cycloalkyl; [2595] (v) each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and R.sup.7 is halo; [2596] (vi) each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and R.sup.7 is cyano; [2597] (vii) each R.sup.6 is independently C.sub.3-C.sub.7 cycloalkyl, and R.sup.7 is C.sub.3-C.sub.7 cycloalkyl; [2598] (viii) each R.sup.6 is independently C.sub.3-C.sub.7 cycloalkyl, and R.sup.7 is halo; [2599] (ix) each R.sup.6 is independently cyclopropyl and R.sup.7 is halo; [2600] (x) each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo; [2601] (xi) each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkoxy; [2602] (xii) each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkoxy substituted with one or more halo; [2603] (xiii) each R.sup.6 is independently halo, and R.sup.7 is C.sub.1-C.sub.6 haloalkyl; [2604] (xiv) each R.sup.6 is independently halo, and R.sup.7 is C.sub.1-C.sub.6 haloalkoxy; [2605] (xv) each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy; and R.sup.7 is halo; [2606] (xvi) each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy; and R.sup.7 is chloro; [2607] (xvii) R.sup.7 is C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo; [2608] (xviii) R.sup.7 is C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkyl substituted with one or more halo; [2609] (xix) R.sup.7 is C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.3-C.sub.7 cycloalkyl; [2610] (xx) R.sup.7 is C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently halo; [2611] (xxi) R.sup.7 is C.sub.1-C.sub.6 alkyl and each R.sup.6 is independently halo; [2612] (xxii) R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is cyano; [2613] (xxiii) R.sup.7 is C.sub.3-C.sub.7 cycloalkyl, and each R.sup.6 is independently C.sub.3-C.sub.7 cycloalkyl; [2614] (xxiv) R.sup.7 is C.sub.3-C.sub.7 cycloalkyl, and each R.sup.6 is independently halo; [2615] (xxv) R.sup.7 is C.sub.3-C.sub.7 cycloalkyl and each R.sup.6 is independently halo; [2616] (xxvi) R.sup.7 is C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo; [2617] (xxvii) R.sup.7 is C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy; [2618] (xxviii) R.sup.7 is C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy substituted with one or more halo; [2619] (xxix) R.sup.7 is halo, and each R.sup.6 is independently C.sub.1-C.sub.6 haloalkyl; [2620] (xxx) R.sup.7 is halo, and each R.sup.6 is independently C.sub.1-C.sub.6 haloalkoxy; [2621] (xxxi) R.sup.7 is C.sub.1-C.sub.6 alkoxy; and each R.sup.6 is independently halo; or [2622] (xxxii) R.sup.7 is C.sub.1-C.sub.6 alkoxy; and R.sup.6 is chloro.

    [2623] In some embodiments, of the compound of formula AA,

    the substituted ring B is

    ##STR00265##

    and R.sup.6 and R.sup.7 are one of the following combinations: [2624] (i) each R.sup.6 is isopropyl; and R.sup.7 is methyl; [2625] (ii) each R.sup.6 is isopropyl; and R.sup.7 is isopropyl; [2626] (iii) each R.sup.6 is isopropyl; and R.sup.7 is trifluoromethyl; [2627] (iv) each R.sup.6 is isopropyl; and R.sup.7 is cyclopropyl; [2628] (v) each R.sup.6 is isopropyl; and R.sup.7 is chloro; [2629] (vi) each R.sup.6 is isopropyl; and R.sup.7 is fluoro; [2630] (vii) each R.sup.6 is ethyl; and R.sup.7 is fluoro; [2631] (viii) each R.sup.6 is isopropyl; and R.sup.7 is cyano; [2632] (ix) each R.sup.6 is cyclopropyl; and R.sup.7 is cyclopropyl; [2633] (x) each R.sup.6 is cyclopropyl; and R.sup.7 is chloro; [2634] (xi) each R.sup.6 is cyclopropyl; and R.sup.7 is fluoro; [2635] (xii) each R.sup.6 is isopropyl; and R.sup.7 is methoxy; [2636] (xiii) each R.sup.6 is isopropyl; and R.sup.7 is trifluoromethoxy; [2637] (xiv) each R.sup.6 is chloro; and R.sup.7 is trifluoromethyl; [2638] (xv) each R.sup.6 is chloro; and R.sup.7 is trifluoromethoxy; [2639] (xvi) R.sup.7 is isopropyl; and each R.sup.6 is methyl; [2640] (xvii) R.sup.7 is isopropyl; and each R.sup.6 is trifluoromethyl; [2641] (xviii) R.sup.7 is isopropyl; and each R.sup.6 is cyclopropyl; [2642] (xix) R.sup.7 is isopropyl; and each R.sup.6 is chloro; [2643] (xx) R.sup.7 is ethyl; and each R.sup.6 is fluoro; [2644] (xxi) R.sup.7 is isopropyl; and each R.sup.6 is cyano; [2645] (xxii) R.sup.7 is cyclopropyl; and each R.sup.6 is cyclopropyl; [2646] (xxiii) R.sup.7 is cyclopropyl; and each R.sup.6 is chloro; [2647] (xxiv) R.sup.7 is cyclopropyl; and each R.sup.6 is fluoro; [2648] (xxv) R.sup.7 is isopropyl; and each R.sup.6 is methoxy; [2649] (xxvi) R.sup.7 is isopropyl; and each R.sup.6 is trifluoromethoxy; [2650] (xxvii) R.sup.7 is chloro; and each R.sup.6 is trifluoromethyl; [2651] (xxviii) R.sup.7 is chloro; and each R.sup.6 is trifluoromethoxy; or [2652] (xxix) one R.sup.6 is isopropyl; the other R.sup.6 is trifluoromethyl; and R.sup.7 is chloro.

    [2653] In some embodiments, of the compound of formula AA,

    the substituted ring B is

    ##STR00266##

    and R.sup.6 and R.sup.7 are one of the following combinations: [2654] (i) R.sup.6 is C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo; [2655] (ii) R.sup.6 is C.sub.1-C.sub.6 alkyl and each R.sup.7 is independently C.sub.1-C.sub.6 alkyl; [2656] (iii) R.sup.6 is C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkyl substituted with one or more halo; [2657] (iv) R.sup.6 is C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl; [2658] (v) R.sup.6 is C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently halo; [2659] (vi) R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is cyano; [2660] (vii) R.sup.6 is C.sub.3-C.sub.7 cycloalkyl, and each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl; [2661] (viii) R.sup.6 is C.sub.3-C.sub.7 cycloalkyl, and each R.sup.7 is independently halo; [2662] (ix) R.sup.6 is cyclopropyl and each R.sup.7 is independently halo; [2663] (x) R.sup.6 is C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo; [2664] (xi) R.sup.6 is C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy; [2665] (xii) R.sup.6 is C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy substituted with one or more halo; [2666] (xiii) R.sup.6 is halo, and each R.sup.7 is independently C.sub.1-C.sub.6 haloalkyl; [2667] (xiv) R.sup.6 is halo, and each R.sup.7 is independently C.sub.1-C.sub.6 haloalkoxy; [2668] (xv) R.sup.6 is C.sub.1-C.sub.6 alkoxy; and each R.sup.7 is independently halo; [2669] (xvi) R.sup.6 is C.sub.1-C.sub.6 alkoxy; and R.sup.7 is chloro; [2670] (xvii) each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo; [2671] (xviii) each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkyl substituted with one or more halo; [2672] (xix) each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.3-C.sub.7 cycloalkyl; [2673] (xx) each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and R.sup.6 is halo; [2674] (xxi) each R.sup.7 is independently C.sub.1-C.sub.6 alkyl and R.sup.6 is halo; [2675] (xxii) each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and R.sup.6 is cyano; [2676] (xxiii) each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl, and R.sup.6 is C.sub.3-C.sub.7 cycloalkyl. [2677] (xxiv) each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl, and R.sup.6 is halo; [2678] (xxv) each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl and R.sup.6 is halo; [2679] (xxvi) each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo; [2680] (xxvii) each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkoxy; [2681] (xxviii) each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkoxy substituted with one or more halo; [2682] (xxix) each R.sup.7 is independently halo, and R.sup.6 is C.sub.1-C.sub.6 haloalkyl; [2683] (xxx) each R.sup.7 is independently halo, and R.sup.6 is C.sub.1-C.sub.6 haloalkoxy; [2684] (xxxi) each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy; and R.sup.6 is halo; [2685] (xxxii) each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy; and R.sup.6 is chloro; [2686] (xxxiii) R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a C.sub.5 aliphatic carbocyclic ring; [2687] (xxxiv) R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a C.sub.4-C.sub.6 aliphatic carbocyclic ring optionally substituted with one or more hydroxy, oxo, or C.sub.1-C.sub.6 alkyl; or [2688] (xxxv) R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a 5-to-6-membered heterocyclic ring containing 1 heteroatom independently selected from O, N, and S, wherein the heterocyclic ring optionally substituted with one or more hydroxy, oxo, or C.sub.1-C.sub.6 alkyl.

    [2689] In some embodiments, of the compound of formula AA,

    the substituted ring B is

    ##STR00267##

    and R.sup.6 and R.sup.7 are one of the following combinations: [2690] (i) R.sup.6 is isopropyl; and each R.sup.7 is methyl; [2691] (ii) R.sup.6 is isopropyl; and each R.sup.7 is isopropyl; [2692] (iii) R.sup.6 is isopropyl; and each R.sup.7 is trifluoromethyl; [2693] (iv) R.sup.6 is isopropyl; and each R.sup.7 is cyclopropyl; [2694] (v) R.sup.6 is isopropyl; and each R.sup.7 is chloro; [2695] (vi) R.sup.6 is isopropyl; and each R.sup.7 is fluoro; [2696] (vii) R.sup.6 is ethyl; and each R.sup.7 is fluoro; [2697] (viii) R.sup.6 is isopropyl; and each R.sup.7 is cyano; [2698] (ix) R.sup.6 is cyclopropyl; and each R.sup.7 is cyclopropyl; [2699] (x) R.sup.6 is cyclopropyl; and each R.sup.7 is chloro; [2700] (xi) R.sup.6 is cyclopropyl; and each R.sup.7 is fluoro; [2701] (xii) R.sup.6 is isopropyl; and R.sup.7 is methoxy; [2702] (xiii) R.sup.6 is isopropyl; and each R.sup.7 is trifluoromethoxy; [2703] (xiv) R.sup.6 is chloro; and each R.sup.7 is trifluoromethyl; [2704] (xv) R.sup.6 is chloro; and each R.sup.7 is trifluoromethoxy; [2705] (xvi) each R.sup.7 is isopropyl; and R.sup.6 is methyl; [2706] (xvii) each R.sup.7 is isopropyl; and R.sup.6 is trifluoromethyl; [2707] (xviii) each R.sup.7 is isopropyl; and R.sup.6 is cyclopropyl; [2708] (xix) each R.sup.7 is isopropyl; and R.sup.6 is chloro; [2709] (xx) each R.sup.7 is ethyl; and R.sup.6 is fluoro; [2710] (xxi) each R.sup.7 is isopropyl; and R.sup.6 is cyano; [2711] (xxii) each R.sup.7 is cyclopropyl; and R.sup.6 is cyclopropyl; [2712] (xxiii) each R.sup.7 is cyclopropyl; and R.sup.6 is chloro; [2713] (xxiv) each R.sup.7 is cyclopropyl; and R.sup.6 is fluoro; [2714] (xxv) each R.sup.7 is isopropyl; and R.sup.6 is methoxy; [2715] (xxvi) each R.sup.7 is isopropyl; and R.sup.6 is trifluoromethoxy; [2716] (xxvii) each R.sup.7 is chloro; and R.sup.6 is trifluoromethyl; [2717] (xxviii) each R.sup.7 is chloro; and R.sup.6 is trifluoromethoxy; [2718] (xxix) R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a C.sub.5 aliphatic carbocyclic ring; and one R.sup.7 is fluoro, chloro, or cyano; [2719] (xxx) R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a C.sub.4 aliphatic carbocyclic ring; and one R.sup.7 is fluoro, chloro, or cyano; [2720] (xxxi) R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a C.sub.6 aliphatic carbocyclic ring; and one R.sup.7 is fluoro, chloro, or cyano; [2721] (xxxii) R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a 5-membered heterocyclic ring containing 1 heteroatoms independently selected from 0, N, and S; and one R.sup.7 is fluoro, chloro, or cyano; or [2722] (xxxiii) R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a 6-membered heterocyclic ring containing 1 heteroatoms independently selected from 0, N, and S; and one R.sup.7 is fluoro, chloro, or cyano.

    [2723] In some embodiments, of the compound of formula AA,

    the substituted ring B is

    ##STR00268##

    and R.sup.6 and R.sup.7 are one of the following combinations: [2724] (i) R.sup.6 is C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo; [2725] (ii) R.sup.6 is C.sub.1-C.sub.6 alkyl and each R.sup.7 is independently C.sub.1-C.sub.6 alkyl; [2726] (iii) R.sup.6 is C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkyl substituted with one or more halo; [2727] (iv) R.sup.6 is C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl; [2728] (v) R.sup.6 is C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently halo; [2729] (vi) R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is cyano; [2730] (vii) R.sup.6 is C.sub.3-C.sub.7 cycloalkyl, and each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl; [2731] (viii) R.sup.6 is C.sub.3-C.sub.7 cycloalkyl, and each R.sup.7 is independently halo; [2732] (ix) R.sup.6 is cyclopropyl and each R.sup.7 is independently halo; [2733] (x) R.sup.6 is C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo; [2734] (xi) R.sup.6 is C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy; [2735] (xii) R.sup.6 is C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy substituted with one or more halo; [2736] (xiii) R.sup.6 is halo, and each R.sup.7 is independently C.sub.1-C.sub.6 haloalkyl; [2737] (xiv) R.sup.6 is halo, and each R.sup.7 is independently C.sub.1-C.sub.6 haloalkoxy; [2738] (xv) R.sup.6 is C.sub.1-C.sub.6 alkoxy; and each R.sup.7 is independently halo; [2739] (xvi) R.sup.6 is C.sub.1-C.sub.6 alkoxy; and R.sup.7 is chloro; [2740] (xvii) each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo; [2741] (xviii) each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkyl substituted with one or more halo; [2742] (xix) each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.3-C.sub.7 cycloalkyl; [2743] (xx) each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and R.sup.6 is halo; [2744] (xxi) each R.sup.7 is independently C.sub.1-C.sub.6 alkyl and R.sup.6 is halo; [2745] (xxii) each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and R.sup.6 is cyano; [2746] (xxiii) each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl, and R.sup.6 is C.sub.3-C.sub.7 cycloalkyl; [2747] (xxiv) each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl, and R.sup.6 is halo; [2748] (xxv) each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl and R.sup.6 is halo; [2749] (xxvi) each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo; [2750] (xxvii) each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkoxy; [2751] (xxviii) each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkoxy substituted with one or more halo; [2752] (xxix) each R.sup.7 is independently halo, and R.sup.6 is C.sub.1-C.sub.6 haloalkyl; [2753] (xxx) each R.sup.7 is independently halo, and R.sup.6 is C.sub.1-C.sub.6 haloalkoxy; [2754] (xxxi) each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy; and R.sup.6 is halo; [2755] (xxxii) each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy; and R.sup.6 is chloro; [2756] (xxxiii) R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a C.sub.5 aliphatic carbocyclic ring; [2757] (xxxiv) R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a C.sub.4-C.sub.6 aliphatic carbocyclic ring optionally substituted with one or more hydroxy, oxo, or C.sub.1-C.sub.6 alkyl; or [2758] (xxxiv) R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a 5-to-6-membered heterocyclic ring containing 1 heteroatom independently selected from O, N, and S, wherein the heterocyclic ring optionally substituted with one or more hydroxy, oxo, or C.sub.1-C.sub.6 alkyl.

    [2759] In some embodiments, of the compound of formula AA,

    the substituted ring B is

    ##STR00269##

    and R.sup.6 and R.sup.7 are one of the following combinations: [2760] (i) R.sup.6 is isopropyl; and each R.sup.7 is methyl; [2761] (ii) R.sup.6 is isopropyl; and each R.sup.7 is isopropyl; [2762] (iii) R.sup.6 is isopropyl; and each R.sup.7 is trifluoromethyl; [2763] (iv) R.sup.6 is isopropyl; and each R.sup.7 is cyclopropyl; [2764] (v) R.sup.6 is isopropyl; and each R.sup.7 is chloro; [2765] (vi) R.sup.6 is isopropyl; and each R.sup.7 is fluoro; [2766] (vii) R.sup.6 is ethyl; and each R.sup.7 is fluoro; [2767] (viii) R.sup.6 is isopropyl; and each R.sup.7 is cyano; [2768] (ix) R.sup.6 is cyclopropyl; and each R.sup.7 is cyclopropyl; [2769] (x) R.sup.6 is cyclopropyl; and each R.sup.7 is chloro; [2770] (xi) R.sup.6 is cyclopropyl; and each R.sup.7 is fluoro; [2771] (xii) R.sup.6 is isopropyl; and each R.sup.7 is methoxy; [2772] (xiii) R.sup.6 is isopropyl; and each R.sup.7 is trifluoromethoxy; [2773] (xiv) R.sup.6 is chloro; and each R.sup.7 is trifluoromethyl; [2774] (xv) R.sup.6 is chloro; and each R.sup.7 is trifluoromethoxy; [2775] (xvi) each R.sup.7 is isopropyl; and R.sup.6 is methyl; [2776] (xvii) each R.sup.7 is isopropyl; and R.sup.6 is trifluoromethyl; [2777] (xviii) each R.sup.7 is isopropyl; and R.sup.6 is cyclopropyl; [2778] (xix) each R.sup.7 is isopropyl; and R.sup.6 is chloro; [2779] (xx) each R.sup.7 is ethyl; and R.sup.6 is fluoro; [2780] (xxi) each R.sup.7 is isopropyl; and R.sup.6 is cyano; [2781] (xxii) each R.sup.7 is cyclopropyl; and R.sup.6 is cyclopropyl; [2782] (xxiii) each R.sup.7 is cyclopropyl; and R.sup.6 is chloro; [2783] (xxiv) each R.sup.7 is cyclopropyl; and R.sup.6 is fluoro; [2784] (xxv) each R.sup.7 is isopropyl; and R.sup.6 is methoxy; [2785] (xxvi) each R.sup.7 is isopropyl; and R.sup.6 is trifluoromethoxy; [2786] (xxvii) each R.sup.7 is chloro; and R.sup.6 is trifluoromethyl; [2787] (xxviii) each R.sup.7 is chloro; and R.sup.6 is trifluoromethoxy; [2788] (xxix) R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a C.sub.5 aliphatic carbocyclic ring; and one R.sup.7 is fluoro, chloro, or cyano; [2789] (xxx) R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a C.sub.4 aliphatic carbocyclic ring; and one R.sup.7 is fluoro, chloro, or cyano; [2790] (xxxi) R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a C.sub.6 aliphatic carbocyclic ring; and one R.sup.7 is fluoro, chloro, or cyano; [2791] (xxxii) R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a 5-membered heterocyclic ring containing 1 heteroatoms independently selected from 0, N, and S; and one R.sup.7 is fluoro, chloro, or cyano; or [2792] (xxxiii) R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a 6-membered heterocyclic ring containing 1 heteroatoms independently selected from 0, N, and S; and one R.sup.7 is fluoro, chloro, or cyano.

    [2793] In some embodiments, of the compound of formula AA,

    the substituted ring B is

    ##STR00270##

    and R.sup.6 and R.sup.7 are one of the following combinations: [2794] (i) each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo; [2795] (ii) each R.sup.6 is independently C.sub.1-C.sub.6 alkyl and R.sup.7 is C.sub.1-C.sub.6 alkyl; [2796] (iii) each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkyl substituted with one or more halo; [2797] (iv) each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.3-C.sub.7 cycloalkyl; [2798] (v) each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and R.sup.7 is halo; [2799] (vi) each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and R.sup.7 is cyano; [2800] (vii) each R.sup.6 is independently C.sub.3-C.sub.7 cycloalkyl, and R.sup.7 is C.sub.3-C.sub.7 cycloalkyl; [2801] (viii) each R.sup.6 is independently C.sub.3-C.sub.7 cycloalkyl, and R.sup.7 is halo; [2802] (ix) each R.sup.6 is independently cyclopropyl and R.sup.7 is halo; [2803] (x) each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo; [2804] (xi) each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkoxy; [2805] (xii) each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkoxy substituted with one or more halo; [2806] (xiii) each R.sup.6 is independently halo, and R.sup.7 is C.sub.1-C.sub.6 haloalkyl; [2807] (xiv) each R.sup.6 is independently halo, and R.sup.7 is C.sub.1-C.sub.6 haloalkoxy; [2808] (xv) each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy; and R.sup.7 is halo; [2809] (xvi) each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy; and R.sup.7 is chloro; [2810] (xvii) R.sup.7 is C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo; [2811] (xviii) R.sup.7 is C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkyl substituted with one or more halo; [2812] (xix) R.sup.7 is C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.3-C.sub.7 cycloalkyl; [2813] (xx) R.sup.7 is C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently halo; [2814] (xxi) R.sup.7 is C.sub.1-C.sub.6 alkyl and each R.sup.6 is independently halo; [2815] (xxii) R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is cyano; [2816] (xxiii) R.sup.7 is C.sub.3-C.sub.7 cycloalkyl, and each R.sup.6 is independently C.sub.3-C.sub.7 cycloalkyl; [2817] (xxiv) R.sup.7 is C.sub.3-C.sub.7 cycloalkyl, and each R.sup.6 is independently halo; [2818] (xxv) R.sup.7 is C.sub.3-C.sub.7 cycloalkyl and each R.sup.6 is independently halo; [2819] (xxvi) R.sup.7 is C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo; [2820] (xxvii) R.sup.7 is C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy; [2821] (xxviii) R.sup.7 is C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy substituted with one or more halo; [2822] (xxix) R.sup.7 is halo, and each R.sup.6 is independently C.sub.1-C.sub.6 haloalkyl; [2823] (xxx) R.sup.7 is halo, and each R.sup.6 is independently C.sub.1-C.sub.6 haloalkoxy; [2824] (xxxi) R.sup.7 is C.sub.1-C.sub.6 alkoxy; and each R.sup.6 is independently halo; or [2825] (xxxii) R.sup.7 is C.sub.1-C.sub.6 alkoxy; and R.sup.6 is chloro.

    [2826] In some embodiments, of the compound of formula AA,

    the substituted ring B is

    ##STR00271##

    and R.sup.6 and R.sup.7 are one of the following combinations: [2827] (i) each R.sup.6 is isopropyl; and R.sup.7 is methyl; [2828] (ii) each R.sup.6 is isopropyl; and R.sup.7 is isopropyl; [2829] (iii) each R.sup.6 is isopropyl; and R.sup.7 is trifluoromethyl; [2830] (iv) each R.sup.6 is isopropyl; and R.sup.7 is cyclopropyl; [2831] (v) each R.sup.6 is isopropyl; and R.sup.7 is chloro; [2832] (vi) each R.sup.6 is isopropyl; and R.sup.7 is fluoro; [2833] (vii) each R.sup.6 is ethyl; and R.sup.7 is fluoro; [2834] (viii) each R.sup.6 is isopropyl; and R.sup.7 is cyano; [2835] (ix) each R.sup.6 is cyclopropyl; and R.sup.7 is cyclopropyl; [2836] (x) each R.sup.6 is cyclopropyl; and R.sup.7 is chloro; [2837] (xi) each R.sup.6 is cyclopropyl; and R.sup.7 is fluoro; [2838] (xii) each R.sup.6 is isopropyl; and R.sup.7 is methoxy; [2839] (xiii) each R.sup.6 is isopropyl; and R.sup.7 is trifluoromethoxy; [2840] (xiv) each R.sup.6 is chloro; and R.sup.7 is trifluoromethyl; [2841] (xv) each R.sup.6 is chloro; and R.sup.7 is trifluoromethoxy; [2842] (xvi) R.sup.7 is isopropyl; and each R.sup.6 is methyl; [2843] (xvii) R.sup.7 is isopropyl; and each R.sup.6 is trifluoromethyl; [2844] (xviii) R.sup.7 is isopropyl; and each R.sup.6 is cyclopropyl; [2845] (xix) R.sup.7 is isopropyl; and each R.sup.6 is chloro; [2846] (xx) R.sup.7 is ethyl; and each R.sup.6 is fluoro; [2847] (xxi) R.sup.7 is isopropyl; and each R.sup.6 is cyano; [2848] (xxii) R.sup.7 is cyclopropyl; and each R.sup.6 is cyclopropyl; [2849] (xxiii) R.sup.7 is cyclopropyl; and each R.sup.6 is chloro; [2850] (xxiv) R.sup.7 is cyclopropyl; and each R.sup.6 is fluoro; [2851] (xxv) R.sup.7 is isopropyl; and each R.sup.6 is methoxy; [2852] (xxvi) R.sup.7 is isopropyl; and each R.sup.6 is trifluoromethoxy; [2853] (xxvii) R.sup.7 is chloro; and each R.sup.6 is trifluoromethyl; [2854] (xxviii) R.sup.7 is chloro; and each R.sup.6 is trifluoromethoxy; or [2855] (xxix) one R.sup.6 is isopropyl; the other R.sup.6 is trifluoromethyl; and R.sup.7 is chloro.

    [2856] In some embodiments, of the compound of formula AA,

    the substituted ring B is

    ##STR00272##

    and R.sup.6 and R.sup.7 are one of the following combinations: [2857] (i) R.sup.6 is C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo; [2858] (ii) R.sup.6 is C.sub.1-C.sub.6 alkyl and each R.sup.7 is independently C.sub.1-C.sub.6 alkyl; [2859] (iii) R.sup.6 is C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkyl substituted with one or more halo; [2860] (iv) R.sup.6 is C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl; [2861] (v) R.sup.6 is C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently halo; [2862] (vi) R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is cyano; [2863] (vii) R.sup.6 is C.sub.3-C.sub.7 cycloalkyl, and each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl; [2864] (viii) R.sup.6 is C.sub.3-C.sub.7 cycloalkyl, and each R.sup.7 is independently halo; [2865] (ix) R.sup.6 is cyclopropyl and each R.sup.7 is independently halo; [2866] (x) R.sup.6 is C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo; [2867] (xi) R.sup.6 is C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy; [2868] (xii) R.sup.6 is C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy substituted with one or more halo; [2869] (xiii) R.sup.6 is halo, and each R.sup.7 is independently C.sub.1-C.sub.6 haloalkyl; [2870] (xiv) R.sup.6 is halo, and each R.sup.7 is independently C.sub.1-C.sub.6 haloalkoxy; [2871] (xv) R.sup.6 is C.sub.1-C.sub.6 alkoxy; and each R.sup.7 is independently halo; [2872] (xvi) R.sup.6 is C.sub.1-C.sub.6 alkoxy; and R.sup.7 is chloro; [2873] (xvii) each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo; [2874] (xviii) each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkyl substituted with one or more halo; [2875] (xix) each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.3-C.sub.7 cycloalkyl; [2876] (xx) each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and R.sup.6 is halo; [2877] (xxi) each R.sup.7 is independently C.sub.1-C.sub.6 alkyl and R.sup.6 is halo; [2878] (xxii) each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and R.sup.6 is cyano; [2879] (xxiii) each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl, and R.sup.6 is C.sub.3-C.sub.7 cycloalkyl; [2880] (xxiv) each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl, and R.sup.6 is halo; [2881] (xxv) each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl and R.sup.6 is halo; [2882] (xxvi) each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo; [2883] (xxvii) each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkoxy; [2884] (xxviii) each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkoxy substituted with one or more halo; [2885] (xxix) each R.sup.7 is independently halo, and R.sup.6 is C.sub.1-C.sub.6 haloalkyl; [2886] (xxx) each R.sup.7 is independently halo, and R.sup.6 is C.sub.1-C.sub.6 haloalkoxy; [2887] (xxxi) each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy; and R.sup.6 is halo; or [2888] (xxxii) each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy; and R.sup.6 is chloro.

    [2889] In some embodiments, of the compound of formula AA,

    the substituted ring B is

    ##STR00273##

    and R.sup.6 and R.sup.7 are one of the following combinations: [2890] (i) R.sup.6 is isopropyl; and each R.sup.7 is methyl; [2891] (ii) R.sup.6 is isopropyl; and each R.sup.7 is isopropyl; [2892] (iii) R.sup.6 is isopropyl; and each R.sup.7 is trifluoromethyl; [2893] (iv) R.sup.6 is isopropyl; and each R.sup.7 is cyclopropyl; [2894] (v) R.sup.6 is isopropyl; and each R.sup.7 is chloro; [2895] (vi) R.sup.6 is isopropyl; and each R.sup.7 is fluoro; [2896] (vii) R.sup.6 is ethyl; and each R.sup.7 is fluoro; [2897] (viii) R.sup.6 is isopropyl; and each R.sup.7 is cyano; [2898] (ix) R.sup.6 is cyclopropyl; and each R.sup.7 is cyclopropyl; [2899] (x) R.sup.6 is cyclopropyl; and each R.sup.7 is chloro; [2900] (xi) R.sup.6 is cyclopropyl; and each R.sup.7 is fluoro; [2901] (xii) R.sup.6 is isopropyl; and each R.sup.7 is methoxy; [2902] (xiii) R.sup.6 is isopropyl; and each R.sup.7 is trifluoromethoxy; [2903] (xiv) R.sup.6 is chloro; and each R.sup.7 is trifluoromethyl; [2904] (xv) R.sup.6 is chloro; and each R.sup.7 is trifluoromethoxy; [2905] (xvi) each R.sup.7 is isopropyl; and R.sup.6 is methyl; [2906] (xvii) each R.sup.7 is isopropyl; and R.sup.6 is trifluoromethyl; [2907] (xviii) each R.sup.7 is isopropyl; and R.sup.6 is cyclopropyl; [2908] (xix) each R.sup.7 is isopropyl; and R.sup.6 is chloro; [2909] (xx) each R.sup.7 is ethyl; and R.sup.6 is fluoro; [2910] (xxi) each R.sup.7 is isopropyl; and R.sup.6 is cyano; [2911] (xxii) each R.sup.7 is cyclopropyl; and R.sup.6 is cyclopropyl; [2912] (xxiii) each R.sup.7 is cyclopropyl; and R.sup.6 is chloro; [2913] (xxiv) each R.sup.7 is cyclopropyl; and R.sup.6 is fluoro; [2914] (xxv) each R.sup.7 is isopropyl; and R.sup.6 is methoxy; [2915] (xxvi) each R.sup.7 is isopropyl; and R.sup.6 is trifluoromethoxy; [2916] (xxvii) each R.sup.7 is chloro; and R.sup.6 is trifluoromethyl; or [2917] (xxviii) each R.sup.7 is chloro; and R.sup.6 is trifluoromethoxy.

    [2918] In some embodiments, of the compound of formula AA,

    the substituted ring B is

    ##STR00274##

    and R.sup.6 and R.sup.7 are one of the following combinations: [2919] (i) each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo; [2920] (ii) each R.sup.6 is independently C.sub.1-C.sub.6 alkyl and each R.sup.7 is independently C.sub.1-C.sub.6 alkyl; [2921] (iii) each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkyl substituted with one or more halo; [2922] (iv) each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl; [2923] (v) each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently halo; [2924] (vi) each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and R.sup.7 is cyano; [2925] (vii) each R.sup.6 is independently C.sub.3-C.sub.7 cycloalkyl, and each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl; [2926] (viii) each R.sup.6 is independently C.sub.3-C.sub.7 cycloalkyl, and each R.sup.7 is independently halo; [2927] (ix) each R.sup.6 is independently cyclopropyl and each R.sup.7 is independently halo; [2928] (x) each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo; [2929] (xi) each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy; [2930] (xii) each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy substituted with one or more halo; [2931] (xiii) each R.sup.6 is independently halo, and each R.sup.7 is independently C.sub.1-C.sub.6 haloalkyl; [2932] (xiv) each R.sup.6 is independently halo, and each R.sup.7 is independently C.sub.1-C.sub.6 haloalkoxy; [2933] (xv) each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy; and each R.sup.7 is independently halo; [2934] (xvi) each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy; and R.sup.7 is chloro; [2935] (xvii) each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo; [2936] (xviii) each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkyl substituted with one or more halo; [2937] (xix) each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.3-C.sub.7 cycloalkyl; [2938] (xx) each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently halo; [2939] (xxi) each R.sup.7 is independently C.sub.1-C.sub.6 alkyl and each R.sup.6 is independently halo; [2940] (xxii) each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and R.sup.6 is cyano; [2941] (xxiii) each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl, and each R.sup.6 is independently C.sub.3-C.sub.7 cycloalkyl [2942] (xxiv) each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl, and each R.sup.6 is independently halo; [2943] (xxv) each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl and each R.sup.6 is independently halo; [2944] (xxvi) each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo; [2945] (xxvii) each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy; [2946] (xxviii) each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy substituted with one or more halo; [2947] (xxix) each R.sup.7 is independently halo, and each R.sup.6 is independently C.sub.1-C.sub.6 haloalkyl; [2948] (xxx) each R.sup.7 is independently halo, and each R.sup.6 is independently C.sub.1-C.sub.6 haloalkoxy; [2949] (xxxi) each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy; and each R.sup.6 is independently halo; [2950] (xxxii) each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy; and R.sup.6 is chloro; [2951] (xxxiii) two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a C.sub.4-C.sub.8 aliphatic carbocyclic ring; [2952] (xxxiv) two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a C.sub.4-C.sub.6 aliphatic carbocyclic ring optionally substituted with one or more hydroxy, oxo, or C.sub.1-C.sub.6 alkyl; [2953] (xxxv) two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and one pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a C.sub.4-C.sub.6 aliphatic carbocyclic ring optionally substituted with one or more hydroxy, oxo, or C.sub.1-C.sub.6 alkyl, and the other pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a 5-to-6-membered heterocyclic ring containing 1 heteroatom independently selected from O, N, and S, wherein the heterocyclic ring is optionally substituted with one or more hydroxy, oxo, or C.sub.1-C.sub.6 alkyl; or [2954] (xxxvi) two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a 5-to-6-membered heterocyclic ring containing 1 heteroatom independently selected from O, N, and S, wherein the heterocyclic ring optionally substituted with one or more hydroxy, oxo, or C.sub.1-C.sub.6 alkyl.

    [2955] In some embodiments, of the compound of formula AA,

    the substituted ring B is

    ##STR00275##

    and R.sup.6 and R.sup.7 are one of the following combinations: [2956] (i) each R.sup.6 is isopropyl; and each R.sup.7 is methyl; [2957] (ii) each R.sup.6 is isopropyl; and each R.sup.7 is isopropyl; [2958] (iii) each R.sup.6 is isopropyl; and each R.sup.7 is trifluoromethyl; [2959] (iv) each R.sup.6 is isopropyl; and each R.sup.7 is cyclopropyl; [2960] (v) each R.sup.6 is isopropyl; and each R.sup.7 is chloro; [2961] (vi) each R.sup.6 is isopropyl; and each R.sup.7 is fluoro; [2962] (vii) each R.sup.6 is ethyl; and each R.sup.7 is fluoro; [2963] (viii) each R.sup.6 is isopropyl; and each R.sup.7 is cyano; [2964] (ix) each R.sup.6 is cyclopropyl; and each R.sup.7 is cyclopropyl; [2965] (x) each R.sup.6 is cyclopropyl; and each R.sup.7 is chloro; [2966] (xi) each R.sup.6 is cyclopropyl; and each R.sup.7 is fluoro; [2967] (xii) each R.sup.6 is isopropyl; and each R.sup.7 is methoxy; [2968] (xiii) each R.sup.6 is isopropyl; and each R.sup.7 is trifluoromethoxy; [2969] (xiv) each R.sup.6 is chloro; and each R.sup.7 is trifluoromethyl; [2970] (xv) each R.sup.6 is chloro; and each R.sup.7 is trifluoromethoxy; [2971] (xvi) each R.sup.7 is isopropyl; and each R.sup.6 is methyl; [2972] (xvii) each R.sup.7 is isopropyl; and each R.sup.6 is trifluoromethyl; [2973] (xviii) each R.sup.7 is isopropyl; and each R.sup.6 is cyclopropyl; [2974] (xix) each R.sup.7 is isopropyl; and each R.sup.6 is chloro; [2975] (xx) each R.sup.7 is ethyl; and each R.sup.6 is fluoro; [2976] (xxi) each R.sup.7 is isopropyl; and each R.sup.6 is cyano; [2977] (xxii) each R.sup.7 is cyclopropyl; and each R.sup.6 is cyclopropyl; [2978] (xxiii) each R.sup.7 is cyclopropyl; and each R.sup.6 is chloro; [2979] (xxiv) each R.sup.7 is cyclopropyl; and each R.sup.6 is fluoro; [2980] (xxv) each R.sup.7 is isopropyl; and each R.sup.6 is methoxy; [2981] (xxvi) each R.sup.7 is isopropyl; and each R.sup.6 is trifluoromethoxy; [2982] (xxvii) each R.sup.7 is chloro; and each R.sup.6 is trifluoromethyl; [2983] (xxviii) each R.sup.7 is chloro; and each R.sup.6 is trifluoromethoxy; [2984] (xxix) one R.sup.6 is isopropyl; the other R.sup.6 is trifluoromethyl; and each R.sup.7 is chloro; [2985] (xxx) each R.sup.6 is isopropyl; one R.sup.7 is fluoro; and the other R.sup.7 is cyano; [2986] (xxxi) two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a C.sub.5 aliphatic carbocyclic ring; [2987] (xxxii) two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a C.sub.4 aliphatic carbocyclic ring optionally substituted with one or more hydroxy, oxo, or methyl; [2988] (xxxiii) two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a C.sub.5 aliphatic carbocyclic ring optionally substituted with one or more hydroxy, oxo, or methyl; [2989] (xxxiv) two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a C.sub.6 aliphatic carbocyclic ring optionally substituted with one or more hydroxy, oxo, or methyl; [2990] (xxxv) two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a 5-membered heterocyclic ring containing 1 heteroatom independently selected from O, N, and S, wherein the heterocyclic ring is optionally substituted with one or more hydroxy, oxo, or methyl; [2991] (xxxvi) two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a 6-membered heterocyclic ring containing 1 heteroatom independently selected from O, N, and S, wherein the heterocyclic ring is optionally substituted with one or more hydroxy, oxo, or methyl; or [2992] (xxxvii) two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, one pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a 5-membered heterocyclic ring containing 1 heteroatom independently selected from O, N, and S, wherein the heterocyclic ring is optionally substituted with one or more hydroxy, oxo, or methyl, and the other pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a C.sub.5 aliphatic carbocyclic ring optionally substituted with one or more hydroxy, oxo, or methyl.

    [2993] In some embodiments, of the compound of formula AA,

    the substituted ring B is

    ##STR00276##

    and R.sup.6 and R.sup.7 are one of the following combinations: [2994] (i) each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo; [2995] (ii) each R.sup.6 is independently C.sub.1-C.sub.6 alkyl and each R.sup.7 is independently C.sub.1-C.sub.6 alkyl; [2996] (iii) each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkyl substituted with one or more halo; [2997] (iv) each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl; [2998] (v) each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently halo; [2999] (vi) each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and R.sup.7 is cyano; [3000] (vii) each R.sup.6 is independently C.sub.3-C.sub.7 cycloalkyl, and each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl; [3001] (viii) each R.sup.6 is independently C.sub.3-C.sub.7 cycloalkyl, and each R.sup.7 is independently halo; [3002] (ix) each R.sup.6 is independently cyclopropyl and each R.sup.7 is independently halo; [3003] (x) each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo; [3004] (xi) each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy; [3005] (xii) each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy substituted with one or more halo; [3006] (xiii) each R.sup.6 is independently halo, and each R.sup.7 is independently C.sub.1-C.sub.6 haloalkyl; [3007] (xiv) each R.sup.6 is independently halo, and each R.sup.7 is independently C.sub.1-C.sub.6 haloalkoxy; [3008] (xv) each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy; and each R.sup.7 is independently halo; [3009] (xvi) each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy; and R.sup.7 is chloro; [3010] (xvii) each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo; [3011] (xviii) each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkyl substituted with one or more halo; [3012] (xix) each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.3-C.sub.7 cycloalkyl; [3013] (xx) each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently halo; [3014] (xxi) each R.sup.7 is independently C.sub.1-C.sub.6 alkyl and each R.sup.6 is independently halo; [3015] (xxii) each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and R.sup.6 is cyano; [3016] (xxiii) each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl, and each R.sup.6 is independently C.sub.3-C.sub.7 cycloalkyl; [3017] (xxiv) each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl, and each R.sup.6 is independently halo; [3018] (xxv) each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl and each R.sup.6 is independently halo; [3019] (xxvi) each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo; [3020] (xxvii) each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy; [3021] (xxviii) each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy substituted with one or more halo; [3022] (xxix) each R.sup.7 is independently halo, and each R.sup.6 is independently C.sub.1-C.sub.6 haloalkyl; [3023] (xxx) each R.sup.7 is independently halo, and each R.sup.6 is independently C.sub.1-C.sub.6 haloalkoxy; [3024] (xxxi) each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy; and each R.sup.6 is independently halo; [3025] (xxxii) each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy; and R.sup.6 is chloro; [3026] (xxxiii) two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a C.sub.4-C.sub.8 aliphatic carbocyclic ring; [3027] (xxxiv) two pairs, each of one R.sup.6 and one R.sup.7 on adjacent atoms taken together with the atoms connecting them form a C.sub.4-C.sub.6 aliphatic carbocyclic ring optionally substituted with one or more hydroxy, oxo, or C.sub.1-C.sub.6 alkyl; or [3028] (xxxv) two pairs, each of one R.sup.6 and one R.sup.7 on adjacent atoms taken together with the atoms connecting them form a 5-to-6-membered heterocyclic ring containing 1 heteroatom independently selected from O, N, and S, wherein the heterocyclic ring optionally substituted with one or more hydroxy, oxo, or C.sub.1-C.sub.6 alkyl.

    [3029] In some embodiments, of the compound of formula AA,

    the substituted ring B is

    ##STR00277##

    and R.sup.6 and R.sup.7 are one of the following combinations: [3030] (i) each R.sup.6 is isopropyl; and each R.sup.7 is methyl; [3031] (ii) each R.sup.6 is isopropyl; and each R.sup.7 is isopropyl; [3032] (iii) each R.sup.6 is isopropyl; and each R.sup.7 is trifluoromethyl; [3033] (iv) each R.sup.6 is isopropyl; and each R.sup.7 is cyclopropyl; [3034] (v) each R.sup.6 is isopropyl; and each R.sup.7 is chloro; [3035] (vi) each R.sup.6 is isopropyl; and each R.sup.7 is fluoro; [3036] (vii) each R.sup.6 is ethyl; and each R.sup.7 is fluoro; [3037] (viii) each R.sup.6 is isopropyl; and each R.sup.7 is cyano; [3038] (ix) each R.sup.6 is cyclopropyl; and each R.sup.7 is cyclopropyl; [3039] (x) each R.sup.6 is cyclopropyl; and each R.sup.7 is chloro; [3040] (xi) each R.sup.6 is cyclopropyl; and each R.sup.7 is fluoro; [3041] (xii) each R.sup.6 is isopropyl; and each R.sup.7 is methoxy; [3042] (xiii) each R.sup.6 is isopropyl; and each R.sup.7 is trifluoromethoxy; [3043] (xiv) each R.sup.6 is chloro; and each R.sup.7 is trifluoromethyl; [3044] (xv) each R.sup.6 is chloro; and each R.sup.7 is trifluoromethoxy; [3045] (xvi) each R.sup.7 is isopropyl; and each R.sup.6 is methyl; [3046] (xvii) each R.sup.7 is isopropyl; and each R.sup.6 is trifluoromethyl; [3047] (xviii) each R.sup.7 is isopropyl; and each R.sup.6 is cyclopropyl; [3048] (xix) each R.sup.7 is isopropyl; and each R.sup.6 is chloro; [3049] (xx) each R.sup.7 is ethyl; and each R.sup.6 is fluoro; [3050] (xxi) each R.sup.7 is isopropyl; and each R.sup.6 is cyano; [3051] (xxii) each R.sup.7 is cyclopropyl; and each R.sup.6 is cyclopropyl; [3052] (xxiii) each R.sup.7 is cyclopropyl; and each R.sup.6 is chloro; [3053] (xxiv) each R.sup.7 is cyclopropyl; and each R.sup.6 is fluoro; [3054] (xxv) each R.sup.7 is isopropyl; and each R.sup.6 is methoxy; [3055] (xxvi) each R.sup.7 is isopropyl; and each R.sup.6 is trifluoromethoxy; [3056] (xxvii) each R.sup.7 is chloro; and each R.sup.6 is trifluoromethyl; [3057] (xxviii) each R.sup.7 is chloro; and each R.sup.6 is trifluoromethoxy; [3058] (xxix) one R.sup.6 is isopropyl; the other R.sup.6 is trifluoromethyl; and each R.sup.7 is chloro; [3059] (xxx) each R.sup.6 is isopropyl; one R.sup.7 is fluoro; and the other R.sup.7 is cyano; or [3060] (xxxi) two pairs, each of one R.sup.6 and one R.sup.7 on adjacent atoms taken together with the atoms connecting them form a C.sub.4 aliphatic carbocyclic ring optionally substituted with one or more hydroxy, oxo, or methyl; [3061] (xxxii) two pairs, each of one R.sup.6 and one R.sup.7 on adjacent atoms taken together with the atoms connecting them form a C.sub.5 aliphatic carbocyclic ring optionally substituted with one or more hydroxy, oxo, or methyl; [3062] (xxxiii) two pairs, each of one R.sup.6 and one R.sup.7 on adjacent atoms taken together with the atoms connecting them form a C.sub.6 aliphatic carbocyclic ring optionally substituted with one or more hydroxy, oxo, or methyl; [3063] (xxxiv) two pairs, each of one R.sup.6 and one R.sup.7 on adjacent atoms taken together with the atoms connecting them form a 5-membered heterocyclic ring containing 1 heteroatom independently selected from O, N, and S, wherein the heterocyclic ring is optionally substituted with one or more hydroxy, oxo, or methyl; [3064] (xxxv) two pairs, each of one R.sup.6 and one R.sup.7 on adjacent atoms taken together with the atoms connecting them form a 6-membered heterocyclic ring containing 1 heteroatom independently selected from O, N, and S, wherein the heterocyclic ring is optionally substituted with one or more hydroxy, oxo, or methyl; or [3065] (xxxvi) two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a C.sub.5 aliphatic carbocyclic ring.

    [3066] In some embodiments, of the compound of formula AA,

    the substituted ring B is

    ##STR00278##

    and R.sup.6 and R.sup.7 are one of the following combinations: [3067] (i) each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo; [3068] (ii) each R.sup.6 is independently C.sub.1-C.sub.6 alkyl and each R.sup.7 is independently C.sub.1-C.sub.6 alkyl; [3069] (iii) each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkyl substituted with one or more halo; [3070] (iv) each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl; [3071] (v) each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently halo; [3072] (vi) each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and R.sup.7 is cyano; [3073] (vii) each R.sup.6 is independently C.sub.3-C.sub.7 cycloalkyl, and each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl; [3074] (viii) each R.sup.6 is independently C.sub.3-C.sub.7 cycloalkyl, and each R.sup.7 is independently halo; [3075] (ix) each R.sup.6 is independently cyclopropyl and each R.sup.7 is independently halo; [3076] (x) each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo; [3077] (xi) each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy; [3078] (xii) each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy substituted with one or more halo; [3079] (xiii) each R.sup.6 is independently halo, and each R.sup.7 is independently C.sub.1-C.sub.6 haloalkyl; [3080] (xiv) each R.sup.6 is independently halo, and each R.sup.7 is independently C.sub.1-C.sub.6 haloalkoxy; [3081] (xv) each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy; and each R.sup.7 is independently halo; [3082] (xvi) each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy; and R.sup.7 is chloro; [3083] (xvii) each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo; [3084] (xviii) each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkyl substituted with one or more halo; [3085] (xix) each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.3-C.sub.7 cycloalkyl; [3086] (xx) each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently halo; [3087] (xxi) each R.sup.7 is independently C.sub.1-C.sub.6 alkyl and each R.sup.6 is independently halo; [3088] (xxii) each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and R.sup.6 is cyano; [3089] (xxiii) each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl, and each R.sup.6 is independently C.sub.3-C.sub.7 cycloalkyl; [3090] (xxiv) each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl, and each R.sup.6 is independently halo; [3091] (xxv) each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl and each R.sup.6 is independently halo; [3092] (xxvi) each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo; [3093] (xxvii) each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy; [3094] (xxviii) each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy substituted with one or more halo; [3095] (xxix) each R.sup.7 is independently halo, and each R.sup.6 is independently C.sub.1-C.sub.6 haloalkyl; [3096] (xxx) each R.sup.7 is independently halo, and each R.sup.6 is independently C.sub.1-C.sub.6 haloalkoxy; [3097] (xxxi) each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy; and each R.sup.6 is independently halo; or [3098] (xxxii) each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy; and R.sup.6 is chloro.

    [3099] In some embodiments of the compound of formula AA,

    the substituted ring B is

    ##STR00279##

    and R.sup.6 and R.sup.7 are one of the following combinations: [3100] (i) each R.sup.6 is isopropyl; and each R.sup.7 is methyl; [3101] (ii) each R.sup.6 is isopropyl; and each R.sup.7 is isopropyl; [3102] (iii) each R.sup.6 is isopropyl; and each R.sup.7 is trifluoromethyl; [3103] (iv) each R.sup.6 is isopropyl; and each R.sup.7 is cyclopropyl; [3104] (v) each R.sup.6 is isopropyl; and each R.sup.7 is chloro; [3105] (vi) each R.sup.6 is isopropyl; and each R.sup.7 is fluoro; [3106] (vii) each R.sup.6 is ethyl; and each R.sup.7 is fluoro; [3107] (viii) each R.sup.6 is isopropyl; and each R.sup.7 is cyano; [3108] (ix) each R.sup.6 is cyclopropyl; and each R.sup.7 is cyclopropyl; [3109] (x) each R.sup.6 is cyclopropyl; and each R.sup.7 is chloro; [3110] (xi) each R.sup.6 is cyclopropyl; and each R.sup.7 is fluoro; [3111] (xii) each R.sup.6 is isopropyl; and each R.sup.7 is methoxy; [3112] (xiii) each R.sup.6 is isopropyl; and each R.sup.7 is trifluoromethoxy; [3113] (xiv) each R.sup.6 is chloro; and each R.sup.7 is trifluoromethyl; [3114] (xv) each R.sup.6 is chloro; and each R.sup.7 is trifluoromethoxy; [3115] (xvi) each R.sup.7 is isopropyl; and each R.sup.6 is methyl; [3116] (xvii) each R.sup.7 is isopropyl; and each R.sup.6 is trifluoromethyl; [3117] (xviii) each R.sup.7 is isopropyl; and each R.sup.6 is cyclopropyl; [3118] (xix) each R.sup.7 is isopropyl; and each R.sup.6 is chloro; [3119] (xx) each R.sup.7 is ethyl; and each R.sup.6 is fluoro; [3120] (xxi) each R.sup.7 is isopropyl; and each R.sup.6 is cyano; [3121] (xxii) each R.sup.7 is cyclopropyl; and each R.sup.6 is cyclopropyl; [3122] (xxiii) each R.sup.7 is cyclopropyl; and each R.sup.6 is chloro; [3123] (xxiv) each R.sup.7 is cyclopropyl; and each R.sup.6 is fluoro; [3124] (xxv) each R.sup.7 is isopropyl; and each R.sup.6 is methoxy; [3125] (xxvi) each R.sup.7 is isopropyl; and each R.sup.6 is trifluoromethoxy; [3126] (xxvii) each R.sup.7 is chloro; and each R.sup.6 is trifluoromethyl; [3127] (xxviii) each R.sup.7 is chloro; and each R.sup.6 is trifluoromethoxy; [3128] (xxix) one R.sup.6 is isopropyl; the other R.sup.6 is trifluoromethyl; and R.sup.7 is chloro; or [3129] (xxx) R.sup.6 is isopropyl; one R.sup.7 is fluoro; and the other R.sup.7 is cyano.

    [3130] In some embodiments, of the compound of formula AA,

    the substituted ring B is

    ##STR00280##

    and R.sup.6 and R.sup.7 are one of the following combinations: [3131] each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo; [3132] each R.sup.6 is independently C.sub.1-C.sub.6 alkyl and each R.sup.7 is independently C.sub.1-C.sub.6 alkyl; [3133] each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkyl substituted with one or more halo; [3134] each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl; [3135] each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently halo; [3136] each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is cyano; [3137] each R.sup.6 is independently C.sub.3-C.sub.7 cycloalkyl, and each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl; [3138] each R.sup.6 is independently C.sub.3-C.sub.7 cycloalkyl, and each R.sup.7 is independently halo; [3139] each R.sup.6 is independently cyclopropyl and each R.sup.7 is independently halo; [3140] each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo; [3141] each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy; [3142] each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy substituted with one or more halo; [3143] each R.sup.6 is independently halo, and each R.sup.7 is independently C.sub.1-C.sub.6 haloalkyl; [3144] each R.sup.6 is independently halo, and each R.sup.7 is independently C.sub.1-C.sub.6 haloalkoxy; [3145] each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy; and each R.sup.7 is independently halo; [3146] each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy; and each R.sup.7 is chloro; [3147] each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo; [3148] each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkyl substituted with one or more halo; [3149] each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.3-C.sub.7 cycloalkyl; [3150] each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently halo; [3151] each R.sup.7 is independently C.sub.1-C.sub.6 alkyl and each R.sup.6 is independently halo; [3152] each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is cyano; [3153] each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl, and each R.sup.6 is independently C.sub.3-C.sub.7 cycloalkyl; [3154] each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl, and each R.sup.6 is independently halo; [3155] each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl and each R.sup.6 is independently halo; [3156] each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo; [3157] each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy; [3158] each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy substituted with one or more halo; [3159] each R.sup.7 is independently halo, and each R.sup.6 is independently C.sub.1-C.sub.6 haloalkyl; [3160] each R.sup.7 is independently halo, and each R.sup.6 is independently C.sub.1-C.sub.6 haloalkoxy; [3161] each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy; and each R.sup.6 is independently halo; [3162] each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy; and each R.sup.6 is chloro; [3163] R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a C.sub.4-C.sub.6 aliphatic carbocyclic ring optionally substituted with one or more hydroxy, oxo, or C.sub.1-C.sub.6 alkyl; and one R.sup.6 is halo or cyano; or [3164] R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a 5-to-6-membered heterocyclic ring containing 1 heteroatom independently selected from O, N, and S, wherein the heterocyclic ring optionally substituted with one or more hydroxy, oxo, or C.sub.1-C.sub.6 alkyl; and one R.sup.6 is halo or cyano.

    [3165] In some embodiments, of the compound of formula AA,

    the substituted ring B is

    ##STR00281##

    and R.sup.6 and R.sup.7 are one of the following combinations: [3166] each R.sup.6 is isopropyl; and each R.sup.7 is methyl; [3167] each R.sup.6 is isopropyl; and each R.sup.7 is isopropyl; [3168] each R.sup.6 is isopropyl; and each R.sup.7 is trifluoromethyl; [3169] each R.sup.6 is isopropyl; and each R.sup.7 is cyclopropyl; [3170] each R.sup.6 is isopropyl; and each R.sup.7 is chloro; [3171] each R.sup.6 is isopropyl; and each R.sup.7 is fluoro; [3172] each R.sup.6 is ethyl; and each R.sup.7 is fluoro; [3173] each R.sup.6 is isopropyl; and each R.sup.7 is cyano; [3174] each R.sup.6 is cyclopropyl; and each R.sup.7 is cyclopropyl; [3175] each R.sup.6 is cyclopropyl; and each R.sup.7 is chloro; [3176] each R.sup.6 is cyclopropyl; and each R.sup.7 is fluoro; [3177] each R.sup.6 is isopropyl; and each R.sup.7 is methoxy; [3178] each R.sup.6 is isopropyl; and each R.sup.7 is trifluoromethoxy; [3179] each R.sup.6 is chloro; and each R.sup.7 is trifluoromethyl; [3180] each R.sup.6 is chloro; and each R.sup.7 is trifluoromethoxy; [3181] each R.sup.7 is isopropyl; and each R.sup.6 is methyl; [3182] each R.sup.7 is isopropyl; and each R.sup.6 is trifluoromethyl; [3183] each R.sup.7 is isopropyl; and each R.sup.6 is cyclopropyl; [3184] each R.sup.7 is isopropyl; and each R.sup.6 is chloro; [3185] each R.sup.7 is ethyl; and each R.sup.6 is fluoro; [3186] each R.sup.7 is isopropyl; and each R.sup.6 is cyano; [3187] each R.sup.7 is cyclopropyl; and each R.sup.6 is cyclopropyl; [3188] each R.sup.7 is cyclopropyl; and each R.sup.6 is chloro; [3189] each R.sup.7 is cyclopropyl; and each R.sup.6 is fluoro; [3190] each R.sup.7 is isopropyl; and each R.sup.6 is methoxy; [3191] each R.sup.7 is isopropyl; and each R.sup.6 is trifluoromethoxy; [3192] each R.sup.7 is chloro; and each R.sup.6 is trifluoromethyl; [3193] each R.sup.7 is chloro; and each R.sup.6 is trifluoromethoxy;

    [3194] one R.sup.6 is isopropyl; the other R.sup.6 is trifluoromethyl; and each R.sup.7 is chloro; [3195] each R.sup.6 is isopropyl; one R.sup.7 is fluoro; and the other R.sup.7 is cyano; [3196] R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a C.sub.4 aliphatic carbocyclic ring; and one R.sup.6 is chloro, fluoro, or cyano; [3197] R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a C.sub.5 aliphatic carbocyclic ring; and one R.sup.6 is chloro, fluoro, or cyano; [3198] R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a C.sub.6 aliphatic carbocyclic ring; and one R.sup.6 is chloro, fluoro, or cyano; [3199] R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a 5-membered heterocyclic ring containing 1 heteroatoms independently selected from O, N, and S; and one R.sup.6 is chloro, fluoro, or cyano; [3200] R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a 6-membered heterocyclic ring containing 1 heteroatoms independently selected from O, N, and S; and one R.sup.6 is chloro, fluoro, or cyano; or [3201] R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a C.sub.5 aliphatic carbocyclic ring; and one R.sup.6 is chloro, fluoro, or cyano.

    [3202] In some embodiments, of the compound of formula AA,

    the substituted ring B is

    ##STR00282##

    and R.sup.6 and R.sup.7 are one of the following combinations: [3203] (i) each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo; [3204] (ii) each R.sup.6 is independently C.sub.1-C.sub.6 alkyl and each R.sup.7 is independently C.sub.1-C.sub.6 alkyl; [3205] (iii) each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkyl substituted with one or more halo; [3206] (iv) each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl; [3207] (v) each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently halo; [3208] (vi) each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and R.sup.7 is cyano; [3209] (vii) each R.sup.6 is independently C.sub.3-C.sub.7 cycloalkyl, and each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl; [3210] (viii) each R.sup.6 is independently C.sub.3-C.sub.7 cycloalkyl, and each R.sup.7 is independently halo; [3211] (ix) each R.sup.6 is independently cyclopropyl and each R.sup.7 is independently halo; [3212] (x) each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo; [3213] (xi) each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy; [3214] (xii) each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy substituted with one or more halo; [3215] (xiii) each R.sup.6 is independently halo, and each R.sup.7 is independently C.sub.1-C.sub.6 haloalkyl; [3216] (xiv) each R.sup.6 is independently halo, and each R.sup.7 is independently C.sub.1-C.sub.6 haloalkoxy; [3217] (xv) each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy; and each R.sup.7 is independently halo; [3218] (xvi) each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy; and R.sup.7 is chloro; [3219] (xvii) each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo; [3220] (xviii) each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkyl substituted with one or more halo; [3221] (xix) each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.3-C.sub.7 cycloalkyl; [3222] (xx) each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently halo; [3223] (xxi) each R.sup.7 is independently C.sub.1-C.sub.6 alkyl and each R.sup.6 is independently halo; [3224] (xxii) each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and R.sup.6 is cyano; [3225] (xxiii) each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl, and each R.sup.6 is independently C.sub.3-C.sub.7 cycloalkyl; [3226] (xxiv) each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl, and each R.sup.6 is independently halo; [3227] (xxv) each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl and each R.sup.6 is independently halo; [3228] (xxvi) each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo; [3229] (xxvii) each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy; [3230] (xxviii) each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy substituted with one or more halo; [3231] (xxix) each R.sup.7 is independently halo, and each R.sup.6 is independently C.sub.1-C.sub.6 haloalkyl; [3232] (xxx) each R.sup.7 is independently halo, and each R.sup.6 is independently C.sub.1-C.sub.6 haloalkoxy; [3233] (xxxi) each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy; and each R.sup.6 is independently halo; or [3234] (xxxii) each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy; and R.sup.6 is chloro.

    [3235] In some embodiments, of the compound of formula AA,

    the substituted ring B is

    ##STR00283##

    and R.sup.6 and R.sup.7 are one of the following combinations: [3236] (i) each R.sup.6 is isopropyl; and each R.sup.7 is methyl; [3237] (ii) each R.sup.6 is isopropyl; and each R.sup.7 is isopropyl; [3238] (iii) each R.sup.6 is isopropyl; and each R.sup.7 is trifluoromethyl; [3239] (iv) each R.sup.6 is isopropyl; and each R.sup.7 is cyclopropyl; [3240] (v) each R.sup.6 is isopropyl; and each R.sup.7 is chloro; [3241] (vi) each R.sup.6 is isopropyl; and each R.sup.7 is fluoro; [3242] (vii) each R.sup.6 is ethyl; and each R.sup.7 is fluoro; [3243] (viii) each R.sup.6 is isopropyl; and each R.sup.7 is cyano; [3244] (ix) each R.sup.6 is cyclopropyl; and each R.sup.7 is cyclopropyl; [3245] (x) each R.sup.6 is cyclopropyl; and each R.sup.7 is chloro; [3246] (xi) each R.sup.6 is cyclopropyl; and each R.sup.7 is fluoro; [3247] (xii) each R.sup.6 is isopropyl; and each R.sup.7 is methoxy; [3248] (xiii) each R.sup.6 is isopropyl; and each R.sup.7 is trifluoromethoxy; [3249] (xiv) each R.sup.6 is chloro; and each R.sup.7 is trifluoromethyl; [3250] (xv) each R.sup.6 is chloro; and each R.sup.7 is trifluoromethoxy; [3251] (xvi) each R.sup.7 is isopropyl; and each R.sup.6 is methyl; [3252] (xvii) each R.sup.7 is isopropyl; and each R.sup.6 is trifluoromethyl; [3253] (xviii) each R.sup.7 is isopropyl; and each R.sup.6 is cyclopropyl; [3254] (xix) each R.sup.7 is isopropyl; and each R.sup.6 is chloro; [3255] (xx) each R.sup.7 is ethyl; and each R.sup.6 is fluoro; [3256] (xxi) each R.sup.7 is isopropyl; and each R.sup.6 is cyano; [3257] (xxii) each R.sup.7 is cyclopropyl; and each R.sup.6 is cyclopropyl; [3258] (xxiii) each R.sup.7 is cyclopropyl; and each R.sup.6 is chloro; [3259] (xxiv) each R.sup.7 is cyclopropyl; and each R.sup.6 is fluoro; [3260] (xxv) each R.sup.7 is isopropyl; and each R.sup.6 is methoxy; [3261] (xxvi) each R.sup.7 is isopropyl; and each R.sup.6 is trifluoromethoxy; [3262] (xxvii) each R.sup.7 is chloro; and each R.sup.6 is trifluoromethyl; [3263] (xxviii) each R.sup.7 is chloro; and each R.sup.6 is trifluoromethoxy; [3264] (xxix) one R.sup.6 is isopropyl; the other R.sup.6 is trifluoromethyl; and each R.sup.7 is chloro; or [3265] (xxx) each R.sup.6 is isopropyl; one R.sup.7 is fluoro; and the other R.sup.7 is cyano.

    [3266] In some embodiments, of the compound of formula AA,

    the substituted ring B is

    ##STR00284##

    and R.sup.6 and R.sup.7 are one of the following combinations: [3267] (i) each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo; [3268] (ii) each R.sup.6 is independently C.sub.1-C.sub.6 alkyl and each R.sup.7 is independently C.sub.1-C.sub.6 alkyl; [3269] (iii) each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkyl substituted with one or more halo; [3270] (iv) each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl; [3271] (v) each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently halo; [3272] (vi) each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and R.sup.7 is cyano; [3273] (vii) each R.sup.6 is independently C.sub.3-C.sub.7 cycloalkyl, and each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl; [3274] (viii) each R.sup.6 is independently C.sub.3-C.sub.7 cycloalkyl, and each R.sup.7 is independently halo; [3275] (ix) each R.sup.6 is independently cyclopropyl and each R.sup.7 is independently halo; [3276] (x) each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo; [3277] (xi) each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy; [3278] (xii) each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy substituted with one or more halo; [3279] (xiii) each R.sup.6 is independently halo, and each R.sup.7 is independently C.sub.1-C.sub.6 haloalkyl; [3280] (xiv) each R.sup.6 is independently halo, and each R.sup.7 is independently C.sub.1-C.sub.6 haloalkoxy; [3281] (xv) each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy; and each R.sup.7 is independently halo; [3282] (xvi) each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy; and R.sup.7 is chloro; [3283] (xvii) each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo; [3284] (xviii) each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkyl substituted with one or more halo; [3285] (xix) each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.3-C.sub.7 cycloalkyl; [3286] (xx) each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently halo; [3287] (xxi) each R.sup.7 is independently C.sub.1-C.sub.6 alkyl and each R.sup.6 is independently halo; [3288] (xxii) each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and R.sup.6 is cyano; [3289] (xxiii) each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl, and each R.sup.6 is independently C.sub.3-C.sub.7 cycloalkyl; [3290] (xxiv) each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl, and each R.sup.6 is independently halo; [3291] (xxv) each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl and each R.sup.6 is independently halo; [3292] (xxvi) each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo; [3293] (xxvii) each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy; [3294] (xxviii) each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy substituted with one or more halo; [3295] (xxix) each R.sup.7 is independently halo, and each R.sup.6 is independently C.sub.1-C.sub.6 haloalkyl; [3296] (xxx) each R.sup.7 is independently halo, and each R.sup.6 is independently C.sub.1-C.sub.6 haloalkoxy; [3297] (xxxi) each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy; and each R.sup.6 is independently halo; [3298] (xxxvi) each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy; and R.sup.6 is chloro; [3299] (xxxvii) two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a C.sub.4-C.sub.6 aliphatic carbocyclic ring optionally substituted with one or more hydroxy, oxo, or C.sub.1-C.sub.6 alkyl; [3300] (xxxii) two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a 5-to-6-membered heterocyclic ring containing 1 heteroatom independently selected from O, N, and S, wherein the heterocyclic ring optionally substituted with one or more hydroxy, oxo, or C.sub.1-C.sub.6 alkyl; or [3301] (xxxiii) two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, one pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a C.sub.4-C.sub.6 aliphatic carbocyclic ring optionally substituted with one or more hydroxy, oxo, or C.sub.1-C.sub.6 alkyl, and the other pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a 5-to-6-membered heterocyclic ring containing 1 heteroatom independently selected from O, N, and S, wherein the heterocyclic ring optionally substituted with one or more hydroxy, oxo, or C.sub.1-C.sub.6 alkyl.

    [3302] In some embodiments, of the compound of formula AA,

    the substituted ring B is

    ##STR00285##

    and R.sup.6 and R.sup.7 are one of the following combinations: [3303] (i) each R.sup.6 is isopropyl; and each R.sup.7 is methyl; [3304] (ii) each R.sup.6 is isopropyl; and each R.sup.7 is isopropyl; [3305] (iii) each R.sup.6 is isopropyl; and each R.sup.7 is trifluoromethyl; [3306] (iv) each R.sup.6 is isopropyl; and each R.sup.7 is cyclopropyl; [3307] (v) each R.sup.6 is isopropyl; and each R.sup.7 is chloro; [3308] (vi) each R.sup.6 is isopropyl; and each R.sup.7 is fluoro; [3309] (vii) each R.sup.6 is ethyl; and each R.sup.7 is fluoro; [3310] (viii) each R.sup.6 is isopropyl; and each R.sup.7 is cyano; [3311] (ix) each R.sup.6 is cyclopropyl; and each R.sup.7 is cyclopropyl; [3312] (x) each R.sup.6 is cyclopropyl; and each R.sup.7 is chloro; [3313] (xi) each R.sup.6 is cyclopropyl; and each R.sup.7 is fluoro; [3314] (xii) each R.sup.6 is isopropyl; and each R.sup.7 is methoxy; [3315] (xiii) each R.sup.6 is isopropyl; and each R.sup.7 is trifluoromethoxy; [3316] (xiv) each R.sup.6 is chloro; and each R.sup.7 is trifluoromethyl; [3317] (xv) each R.sup.6 is chloro; and each R.sup.7 is trifluoromethoxy; [3318] (xvi) each R.sup.7 is isopropyl; and each R.sup.6 is methyl; [3319] (xvii) each R.sup.7 is isopropyl; and each R.sup.6 is trifluoromethyl; [3320] (xviii) each R.sup.7 is isopropyl; and each R.sup.6 is cyclopropyl; [3321] (xix) each R.sup.7 is isopropyl; and each R.sup.6 is chloro; [3322] (xx) each R.sup.7 is ethyl; and each R.sup.6 is fluoro; [3323] (xxi) each R.sup.7 is isopropyl; and each R.sup.6 is cyano; [3324] (xxii) each R.sup.7 is cyclopropyl; and each R.sup.6 is cyclopropyl; [3325] (xxiii) each R.sup.7 is cyclopropyl; and each R.sup.6 is chloro; [3326] (xxiv) each R.sup.7 is cyclopropyl; and each R.sup.6 is fluoro; [3327] (xxv) each R.sup.7 is isopropyl; and each R.sup.6 is methoxy; [3328] (xxvi) each R.sup.7 is isopropyl; and each R.sup.6 is trifluoromethoxy; [3329] (xxvii) R.sup.7 is chloro; and each R.sup.6 is trifluoromethyl; [3330] (xxviii) R.sup.7 is chloro; and each R.sup.6 is trifluoromethoxy; [3331] (xxix) one R.sup.6 is isopropyl; the other R.sup.6 is trifluoromethyl; and R.sup.7 is chloro; [3332] (xxx) R.sup.6 is isopropyl; one R.sup.7 is fluoro; and the other R.sup.7 is cyano; two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a C.sub.5 aliphatic carbocyclic ring; [3333] (xxxi) two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a C.sub.4 aliphatic carbocyclic ring optionally substituted with one or more hydroxy, oxo, or methyl; [3334] (xxxii) two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a C.sub.5 aliphatic carbocyclic ring optionally substituted with one or more hydroxy, oxo, or methyl; [3335] (xxxiii) two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a C.sub.6 aliphatic carbocyclic ring optionally substituted with one or more hydroxy, oxo, or methyl; [3336] (xxxiv) two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a 5-membered heterocyclic ring containing 1 heteroatom independently selected from O, N, and S, wherein the heterocyclic ring is optionally substituted with one or more hydroxy, oxo, or methyl [3337] (xxxv) two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a 6-membered heterocyclic ring containing 1 heteroatom independently selected from O, N, and S, wherein the heterocyclic ring is optionally substituted with one or more hydroxy, oxo, or methyl; or [3338] (xxxvi) two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, one pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a 5-membered heterocyclic ring containing 1 heteroatom independently selected from O, N, and S, wherein the heterocyclic ring is optionally substituted with one or more hydroxy, oxo, or methyl, and the other pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a C.sub.5 aliphatic carbocyclic ring optionally substituted with one or more hydroxy, oxo, or methyl.

    [3339] In some embodiments, of the compound of formula AA,

    the substituted ring B is

    ##STR00286##

    and R.sup.6 and R.sup.7 are one of the following combinations: [3340] (i) each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo; [3341] (ii) each R.sup.6 is independently C.sub.1-C.sub.6 alkyl and R.sup.7 is C.sub.1-C.sub.6 alkyl; [3342] (iii) each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkyl substituted with one or more halo; [3343] (iv) each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.3-C.sub.7 cycloalkyl; [3344] (v) each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and R.sup.7 is halo; [3345] (vi) each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and R.sup.7 is cyano; [3346] (vii) each R.sup.6 is independently C.sub.3-C.sub.7 cycloalkyl, and R.sup.7 is C.sub.3-C.sub.7 cycloalkyl; [3347] (viii) each R.sup.6 is independently C.sub.3-C.sub.7 cycloalkyl, and R.sup.7 is halo; [3348] (ix) each R.sup.6 is independently cyclopropyl and R.sup.7 is halo; [3349] (x) each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo; [3350] (xi) each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkoxy; [3351] (xii) each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkoxy substituted with one or more halo; [3352] (xiii) each R.sup.6 is independently halo, and R.sup.7 is C.sub.1-C.sub.6 haloalkyl; [3353] (xiv) each R.sup.6 is independently halo, and R.sup.7 is C.sub.1-C.sub.6 haloalkoxy; [3354] (xv) each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy; and R.sup.7 is halo; [3355] (xvi) each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy; and R.sup.7 is chloro; [3356] (xvii) R.sup.7 is C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo; [3357] (xviii) R.sup.7 is C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkyl substituted with one or more halo; [3358] (xix) R.sup.7 is C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.3-C.sub.7 cycloalkyl; [3359] (xx) R.sup.7 is C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently halo; [3360] (xxi) R.sup.7 is C.sub.1-C.sub.6 alkyl and each R.sup.6 is independently halo; [3361] (xxii) R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is cyano; [3362] (xxiii) R.sup.7 is C.sub.3-C.sub.7 cycloalkyl, and each R.sup.6 is independently C.sub.3-C.sub.7 cycloalkyl; [3363] (xxiv) R.sup.7 is C.sub.3-C.sub.7 cycloalkyl, and each R.sup.6 is independently halo; [3364] (xxv) R.sup.7 is C.sub.3-C.sub.7 cycloalkyl and each R.sup.6 is independently halo; [3365] (xxvi) R.sup.7 is C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo; [3366] (xxvii) R.sup.7 is C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy; [3367] (xxviii) R.sup.7 is C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy substituted with one or more halo; [3368] (xxix) R.sup.7 is halo, and each R.sup.6 is independently C.sub.1-C.sub.6 haloalkyl; [3369] (xxx) R.sup.7 is halo, and each R.sup.6 is independently C.sub.1-C.sub.6 haloalkoxy; [3370] (xxxi) R.sup.7 is C.sub.1-C.sub.6 alkoxy; and each R.sup.6 is independently halo; [3371] (xxxii) R.sup.7 is C.sub.1-C.sub.6 alkoxy; and R.sup.6 is chloro; [3372] (xxxiii) two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a C.sub.4-C.sub.8 aliphatic carbocyclic ring; and one R.sup.7 is halo; [3373] (xxxiv) two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a C.sub.4-C.sub.8 aliphatic carbocyclic ring; and one R.sup.7 is cyano; [3374] (xxxv) two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a C.sub.4-C.sub.6 aliphatic carbocyclic ring optionally substituted with one or more hydroxy, oxo, or C.sub.1-C.sub.6 alkyl; and one R.sup.7 is halo or cyano; [3375] (xxxvi) two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a 5-to-6-membered heterocyclic ring containing 1 heteroatom independently selected from O, N, and S, wherein the heterocyclic ring optionally substituted with one or more hydroxy, oxo, or C.sub.1-C.sub.6 alkyl; and one R.sup.7 is halo or cyano; or [3376] (xxxvii) two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, one pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a C.sub.4-C.sub.6 aliphatic carbocyclic ring optionally substituted with one or more hydroxy, oxo, or C.sub.1-C.sub.6 alkyl, and the other pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a 5-to-6-membered heterocyclic ring containing 1 heteroatom independently selected from O, N, and S, wherein the heterocyclic ring optionally substituted with one or more hydroxy, oxo, or C.sub.1-C.sub.6 alkyl; and one R.sup.7 is halo or cyano.

    [3377] In some embodiments, of the compound of formula AA,

    the substituted ring B is

    ##STR00287##

    and R.sup.6 and R.sup.7 are one of the following combinations: [3378] (i) each R.sup.6 is isopropyl; and each R.sup.7 is methyl; [3379] (ii) each R.sup.6 is isopropyl; and each R.sup.7 is isopropyl; [3380] (iii) each R.sup.6 is isopropyl; and each R.sup.7 is trifluoromethyl; [3381] (iv) each R.sup.6 is isopropyl; and each R.sup.7 is cyclopropyl; [3382] (v) each R.sup.6 is isopropyl; and each R.sup.7 is chloro; [3383] (vi) each R.sup.6 is isopropyl; and each R.sup.7 is fluoro; [3384] (vii) each R.sup.6 is ethyl; and each R.sup.7 is fluoro; [3385] (viii) each R.sup.6 is isopropyl; and each R.sup.7 is cyano; [3386] (ix) each R.sup.6 is cyclopropyl; and each R.sup.7 is cyclopropyl; [3387] (x) each R.sup.6 is cyclopropyl; and each R.sup.7 is chloro; [3388] (xi) each R.sup.6 is cyclopropyl; and each R.sup.7 is fluoro; [3389] (xii) each R.sup.6 is isopropyl; and each R.sup.7 is methoxy; [3390] (xiii) each R.sup.6 is isopropyl; and each R.sup.7 is trifluoromethoxy; [3391] (xiv) each R.sup.6 is chloro; and each R.sup.7 is trifluoromethyl; [3392] (xv) each R.sup.6 is chloro; and each R.sup.7 is trifluoromethoxy; [3393] (xvi) each R.sup.7 is isopropyl; and each R.sup.6 is methyl; [3394] (xvii) each R.sup.7 is isopropyl; and each R.sup.6 is trifluoromethyl; [3395] (xviii) each R.sup.7 is isopropyl; and each R.sup.6 is cyclopropyl; [3396] (xix) each R.sup.7 is isopropyl; and each R.sup.6 is chloro; [3397] (xx) each R.sup.7 is ethyl; and each R.sup.6 is fluoro; [3398] (xxi) each R.sup.7 is isopropyl; and each R.sup.6 is cyano; [3399] (xxii) each R.sup.7 is cyclopropyl; and each R.sup.6 is cyclopropyl; [3400] (xxiii) each R.sup.7 is cyclopropyl; and each R.sup.6 is chloro; [3401] (xxiv) each R.sup.7 is cyclopropyl; and each R.sup.6 is fluoro; [3402] (xxv) each R.sup.7 is isopropyl; and each R.sup.6 is methoxy; [3403] (xxvi) each R.sup.7 is isopropyl; and each R.sup.6 is trifluoromethoxy; [3404] (xxvii) each R.sup.7 is chloro; and each R.sup.6 is trifluoromethyl; [3405] (xxviii) each R.sup.7 is chloro; and each R.sup.6 is trifluoromethoxy; [3406] (xxix) each R.sup.6 is isopropyl; two R.sup.7 are fluoro; and one R.sup.7 is chloro; [3407] (xxx) two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a C.sub.5 aliphatic carbocyclic ring; and one R.sup.7 is chloro; [3408] (xxxi) two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a C.sub.5 aliphatic carbocyclic ring; and one R.sup.7 is fluoro; [3409] (xxxii) two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a C.sub.4 aliphatic carbocyclic ring optionally substituted with one or more hydroxy, oxo, or methyl; and one R.sup.7 is fluoro or chloro; [3410] (xxxiii) two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a C.sub.5 aliphatic carbocyclic ring optionally substituted with one or more hydroxy, oxo, or methyl; and one R.sup.7 is fluoro or chloro; [3411] (xxxiv) two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a C.sub.6 aliphatic carbocyclic ring optionally substituted with one or more hydroxy, oxo, or methyl; and one R.sup.7 is fluoro or chloro; [3412] (xxxv) two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a 5-membered heterocyclic ring containing 1 heteroatom independently selected from O, N, and S, wherein the heterocyclic ring is optionally substituted with one or more hydroxy, oxo, or methyl; and one R.sup.7 is fluoro or chloro; [3413] (xxxvi) two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a 6-membered heterocyclic ring containing 1 heteroatom independently selected from O, N, and S, wherein the heterocyclic ring is optionally substituted with one or more hydroxy, oxo, or methyl; and one R.sup.7 is fluoro or chloro; or [3414] (xxxvii) two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, one pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a 5-membered heterocyclic ring containing 1 heteroatom independently selected from O, N, and S, wherein the heterocyclic ring is optionally substituted with one or more hydroxy, oxo, or methyl, and the other pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a C.sub.5 aliphatic carbocyclic ring optionally substituted with one or more hydroxy, oxo, or methyl; and one R.sup.7 is fluoro or chloro.

    Additional Features of the Embodiments Herein

    [3415] In some embodiments of the compound of Formula AA (e.g., Formula AA-1, Formula AA-2, Formula AA-3, Formula AA-4, or Formula AA-5), R.sup.6 is not CN.

    [3416] In some embodiments, the compound of Formula AA is not a compound selected from the group consisting of:

    ##STR00288##

    [3417] In some embodiments, the compound of Formula AA is not a compound selected from the group consisting of:

    ##STR00289##

    [3418] In some embodiments the compound of any of the formulae herein is not a compound disclosed in EP 0173498, which is incorporated herein by reference in its entirety.

    [3419] In some embodiments the compound of any of the formulae herein is not a compound disclosed in U.S. Pat. No. 4,666,506, which is incorporated herein by reference in its entirety.

    [3420] It is understood that the combination of variables in the formulae herein is such that the compounds are stable.

    [3421] In some embodiments, provided herein is a compound that is selected from the group consisting of the compounds in Table 1:

    TABLE-US-00001 TABLE 1 Compound Structure 101′ [00290]embedded image 101 [00291]embedded image 102 [00292]embedded image 103′ [00293]embedded image 103 [00294]embedded image 104 [00295]embedded image 105 [00296]embedded image 105a [00297]embedded image 105b [00298]embedded image 106 [00299]embedded image 106a [00300]embedded image 106b [00301]embedded image 107 [00302]embedded image 107a [00303]embedded image 107b [00304]embedded image 108 [00305]embedded image 108a [00306]embedded image 108b [00307]embedded image 109 [00308]embedded image 109a [00309]embedded image 109b [00310]embedded image 110 [00311]embedded image 110a [00312]embedded image 110b [00313]embedded image 111 [00314]embedded image 112 [00315]embedded image 112a [00316]embedded image 112b [00317]embedded image 113 [00318]embedded image 113a [00319]embedded image 113b [00320]embedded image 114 [00321]embedded image 115 [00322]embedded image 116 [00323]embedded image 116a [00324]embedded image 116b [00325]embedded image 117 [00326]embedded image 118 [00327]embedded image 119 [00328]embedded image 120 [00329]embedded image 120a [00330]embedded image 120b [00331]embedded image 121 [00332]embedded image 121a [00333]embedded image 121b [00334]embedded image 122 [00335]embedded image 122a [00336]embedded image 122b [00337]embedded image 123 [00338]embedded image 124 [00339]embedded image 125 [00340]embedded image 125a [00341]embedded image 125b [00342]embedded image 126 [00343]embedded image 127 [00344]embedded image 128 [00345]embedded image 129 [00346]embedded image 129a [00347]embedded image 129b [00348]embedded image 130 [00349]embedded image 130a [00350]embedded image 130b [00351]embedded image 131 [00352]embedded image 131a [00353]embedded image 131b [00354]embedded image 132 [00355]embedded image 133 [00356]embedded image 134 [00357]embedded image 134a [00358]embedded image 134b [00359]embedded image 135 [00360]embedded image 135a [00361]embedded image 135b [00362]embedded image 136 [00363]embedded image 136a [00364]embedded image 136b [00365]embedded image 137 [00366]embedded image 137a [00367]embedded image 137b [00368]embedded image 138 [00369]embedded image 138a [00370]embedded image 138b [00371]embedded image 139 [00372]embedded image 139a [00373]embedded image 139b [00374]embedded image 140 [00375]embedded image 141 [00376]embedded image 142 [00377]embedded image 143 [00378]embedded image 143a [00379]embedded image 143b [00380]embedded image 144 [00381]embedded image 144a [00382]embedded image 144b [00383]embedded image 145 [00384]embedded image 145a [00385]embedded image 145b [00386]embedded image 146 [00387]embedded image 147 [00388]embedded image 148 [00389]embedded image 148a [00390]embedded image 148b [00391]embedded image 149 [00392]embedded image 149a [00393]embedded image 149b [00394]embedded image 150 [00395]embedded image 151a′ [00396]embedded image 151b′ [00397]embedded image 151 [00398]embedded image 151a [00399]embedded image 151b [00400]embedded image 152 [00401]embedded image 152a [00402]embedded image 152b [00403]embedded image 153 [00404]embedded image 153a [00405]embedded image 153b [00406]embedded image 154 [00407]embedded image 154a [00408]embedded image 154b [00409]embedded image 155 [00410]embedded image 156 [00411]embedded image 157 [00412]embedded image 157a [00413]embedded image 157b [00414]embedded image 158 [00415]embedded image 158a [00416]embedded image 158b [00417]embedded image 159 [00418]embedded image 159a [00419]embedded image 159ba [00420]embedded image 159ab [00421]embedded image 160 [00422]embedded image 161 [00423]embedded image 161a [00424]embedded image 161b [00425]embedded image 162 [00426]embedded image 163 [00427]embedded image 164 [00428]embedded image 165 [00429]embedded image 165a [00430]embedded image 165b [00431]embedded image 166 [00432]embedded image 167 [00433]embedded image 167a [00434]embedded image 167b [00435]embedded image 168 [00436]embedded image 168a [00437]embedded image 168b [00438]embedded image 170 [00439]embedded image 170a [00440]embedded image 170b [00441]embedded image 171 [00442]embedded image 171a [00443]embedded image 171b [00444]embedded image 172 [00445]embedded image 172a [00446]embedded image 172b [00447]embedded image 173 [00448]embedded image 173a [00449]embedded image 173b [00450]embedded image 174 [00451]embedded image 174a [00452]embedded image 174b [00453]embedded image 176 [00454]embedded image 176a [00455]embedded image 176b [00456]embedded image 177 [00457]embedded image 177a [00458]embedded image 177b [00459]embedded image 178 [00460]embedded image 178a [00461]embedded image 178b [00462]embedded image 179 [00463]embedded image 179a [00464]embedded image 179b [00465]embedded image 180 [00466]embedded image 180a [00467]embedded image 180b [00468]embedded image 181 [00469]embedded image 181a [00470]embedded image 181b [00471]embedded image 182 [00472]embedded image 182a [00473]embedded image 182b [00474]embedded image 183 [00475]embedded image 183a [00476]embedded image 183b [00477]embedded image 184 [00478]embedded image 185 [00479]embedded image 185a [00480]embedded image 185b [00481]embedded image 186 [00482]embedded image 186a [00483]embedded image 186b [00484]embedded image 187 [00485]embedded image 187a [00486]embedded image 187b [00487]embedded image 188 [00488]embedded image 188a [00489]embedded image 188b [00490]embedded image 189 [00491]embedded image 189a [00492]embedded image 189b [00493]embedded image 190 [00494]embedded image 190a [00495]embedded image 190b [00496]embedded image 191 [00497]embedded image 191a [00498]embedded image 191b [00499]embedded image 192 [00500]embedded image 192a [00501]embedded image 192b [00502]embedded image 193 [00503]embedded image 193a [00504]embedded image 193b [00505]embedded image 194 [00506]embedded image 195 [00507]embedded image 195a [00508]embedded image 195ba [00509]embedded image 195bb [00510]embedded image 195e [00511]embedded image 196 [00512]embedded image 197 [00513]embedded image 198 [00514]embedded image 199 [00515]embedded image 200 [00516]embedded image 201 [00517]embedded image 202 [00518]embedded image 202a [00519]embedded image 202b [00520]embedded image 203 [00521]embedded image 204 [00522]embedded image 205 [00523]embedded image 205a [00524]embedded image 205b [00525]embedded image 206 [00526]embedded image 206a [00527]embedded image 206b [00528]embedded image 207 [00529]embedded image 207a [00530]embedded image 207b [00531]embedded image 207bb [00532]embedded image 207aa [00533]embedded image 207c [00534]embedded image 208 [00535]embedded image 209 [00536]embedded image 210 [00537]embedded image 211 [00538]embedded image 212 [00539]embedded image 212a [00540]embedded image 212b [00541]embedded image 213 [00542]embedded image 214 [00543]embedded image 215 [00544]embedded image 216 [00545]embedded image 217 [00546]embedded image 218 [00547]embedded image 219 [00548]embedded image 220 [00549]embedded image 220a [00550]embedded image 220b [00551]embedded image 221 [00552]embedded image 223 [00553]embedded image 223a [00554]embedded image 223b [00555]embedded image 225 [00556]embedded image 225a [00557]embedded image 225b [00558]embedded image 226 [00559]embedded image 227 [00560]embedded image 228 [00561]embedded image 229 [00562]embedded image 230 [00563]embedded image 231 [00564]embedded image 232 [00565]embedded image 233 [00566]embedded image 234 [00567]embedded image 235 [00568]embedded image 236 [00569]embedded image 237 [00570]embedded image 238 [00571]embedded image 239 [00572]embedded image 240 [00573]embedded image 241 [00574]embedded image 242 [00575]embedded image 243 [00576]embedded image 244 [00577]embedded image 245 [00578]embedded image 246 [00579]embedded image 247 [00580]embedded image 248 [00581]embedded image 249 [00582]embedded image 250 [00583]embedded image 251 [00584]embedded image 252 [00585]embedded image 253 [00586]embedded image 254 [00587]embedded image 255 [00588]embedded image 256 [00589]embedded image 257 [00590]embedded image 258 [00591]embedded image 259 [00592]embedded image 260 [00593]embedded image 261 [00594]embedded image 262 [00595]embedded image 263 [00596]embedded image 264 [00597]embedded image 265 [00598]embedded image 266 [00599]embedded image 267 [00600]embedded image 268 [00601]embedded image 269 [00602]embedded image 270 [00603]embedded image and pharmaceutically acceptable salts thereof.

    [3422] In some embodiments, provided herein is a compound that is selected from the group consisting of the compounds in the following table:

    TABLE-US-00002 303 [00604]embedded image 303a [00605]embedded image 303b [00606]embedded image 306 [00607]embedded image 307 [00608]embedded image 308 [00609]embedded image 308a [00610]embedded image 308b [00611]embedded image 309 [00612]embedded image 310 [00613]embedded image 311 [00614]embedded image 312 [00615]embedded image 313 [00616]embedded image 314 [00617]embedded image 315 [00618]embedded image 315b [00619]embedded image 315a [00620]embedded image 316 [00621]embedded image 316a [00622]embedded image 316b [00623]embedded image 317 [00624]embedded image 317ab [00625]embedded image 317aa [00626]embedded image 317bb [00627]embedded image 317ba [00628]embedded image 318 [00629]embedded image 318a [00630]embedded image 318b [00631]embedded image 319 [00632]embedded image 319ab [00633]embedded image 319ba [00634]embedded image 319aa [00635]embedded image 319bb [00636]embedded image 320 [00637]embedded image 320a [00638]embedded image 320b [00639]embedded image 321 [00640]embedded image 321b [00641]embedded image 321a [00642]embedded image 322 [00643]embedded image 323 [00644]embedded image 323ab [00645]embedded image 323aa [00646]embedded image 323bb [00647]embedded image 323ba [00648]embedded image 324 [00649]embedded image 325 [00650]embedded image 325a [00651]embedded image 325b [00652]embedded image 326 [00653]embedded image 326b [00654]embedded image 326a [00655]embedded image 327 [00656]embedded image 328b [00657]embedded image 328a [00658]embedded image 329 [00659]embedded image 329a [00660]embedded image 329b [00661]embedded image 330 [00662]embedded image 330a [00663]embedded image 330b [00664]embedded image 331 [00665]embedded image 332 [00666]embedded image 332a [00667]embedded image 332b [00668]embedded image 333 [00669]embedded image 333a [00670]embedded image 333b [00671]embedded image 334 [00672]embedded image 334ba [00673]embedded image 334bb [00674]embedded image 334aa [00675]embedded image 334ab [00676]embedded image 334b [00677]embedded image 334a [00678]embedded image 335 [00679]embedded image 335b [00680]embedded image 335a [00681]embedded image 336 [00682]embedded image 336a [00683]embedded image 336b [00684]embedded image 337 [00685]embedded image 337a [00686]embedded image 337b [00687]embedded image 338 [00688]embedded image 338a [00689]embedded image 338b [00690]embedded image 339 [00691]embedded image 339a [00692]embedded image 339b [00693]embedded image 340 [00694]embedded image 340a [00695]embedded image 340b [00696]embedded image 341 [00697]embedded image 341b [00698]embedded image 341a [00699]embedded image 342 [00700]embedded image 343 [00701]embedded image 343a [00702]embedded image 343b [00703]embedded image 344 [00704]embedded image 345 [00705]embedded image 346 [00706]embedded image 347 [00707]embedded image 348 [00708]embedded image 349 [00709]embedded image 350 [00710]embedded image 351 [00711]embedded image 352 [00712]embedded image 352b [00713]embedded image 352a [00714]embedded image 353 [00715]embedded image 354 [00716]embedded image 354a [00717]embedded image 354b [00718]embedded image 355 [00719]embedded image 356 [00720]embedded image 357 [00721]embedded image 357a [00722]embedded image 357b [00723]embedded image 358 [00724]embedded image 359 [00725]embedded image 359a [00726]embedded image 359b [00727]embedded image 360ba [00728]embedded image 360bb [00729]embedded image 361b [00730]embedded image 361a [00731]embedded image 363b [00732]embedded image 363a [00733]embedded image 364a [00734]embedded image 364b [00735]embedded image 365a [00736]embedded image 365b [00737]embedded image 366a [00738]embedded image 366b [00739]embedded image 367a [00740]embedded image 367b [00741]embedded image 369a [00742]embedded image 369b [00743]embedded image 371a [00744]embedded image 371b [00745]embedded image 372a [00746]embedded image 372b [00747]embedded image 373a [00748]embedded image 373b [00749]embedded image 374a [00750]embedded image 374b [00751]embedded image 375 [00752]embedded image 375a [00753]embedded image 375b [00754]embedded image 376 [00755]embedded image 376a [00756]embedded image 376b [00757]embedded image 377 [00758]embedded image 378 [00759]embedded image 379 [00760]embedded image 379a [00761]embedded image 379b [00762]embedded image 380 [00763]embedded image 380a [00764]embedded image 380b [00765]embedded image 380c [00766]embedded image 380d [00767]embedded image 382 [00768]embedded image 382a [00769]embedded image 382b [00770]embedded image 383 [00771]embedded image 383a [00772]embedded image 383b [00773]embedded image 384a [00774]embedded image 384b [00775]embedded image 387a [00776]embedded image 387b [00777]embedded image and pharmaceutically acceptable salts thereof.

    [3423] In some embodiments, provided herein is a compound that is selected from the group consisting of the compounds in the following table:

    TABLE-US-00003 401 [00778]embedded image 402 [00779]embedded image 403 [00780]embedded image 404 [00781]embedded image 404a [00782]embedded image 404b [00783]embedded image 405 [00784]embedded image 406 [00785]embedded image 407 [00786]embedded image 408 [00787]embedded image 409 [00788]embedded image 409a [00789]embedded image 409b [00790]embedded image 410 [00791]embedded image

    [3424] Pharmaceutical Compositions and Administration

    [3425] General

    [3426] In some embodiments, a chemical entity (e.g., a compound that modulates (e.g., antagonizes) NLRP3, or a pharmaceutically acceptable salt, and/or hydrate, and/or cocrystal, and/or drug combination thereof) is administered as a pharmaceutical composition that includes the chemical entity and one or more pharmaceutically acceptable excipients, and optionally one or more additional therapeutic agents as described herein.

    [3427] In some embodiments, the chemical entities can be administered in combination with one or more conventional pharmaceutical excipients. Pharmaceutically acceptable excipients include, but are not limited to, ion exchangers, alumina, aluminum stearate, lecithin, self-emulsifying drug delivery systems (SEDDS) such as d-α-tocopherol polyethylene glycol 1000 succinate, surfactants used in pharmaceutical dosage forms such as Tweens, poloxamers or other similar polymeric delivery matrices, serum proteins, such as human serum albumin, buffer substances such as phosphates, tris, glycine, sorbic acid, potassium sorbate, partial glyceride mixtures of saturated vegetable fatty acids, water, salts or electrolytes, such as protamine sulfate, disodium hydrogen phosphate, potassium hydrogen phosphate, sodium-chloride, zinc salts, colloidal silica, magnesium trisilicate, polyvinyl pyrrolidone, cellulose-based substances, polyethylene glycol, sodium carboxymethyl cellulose, polyacrylates, waxes, polyethylene-polyoxypropylene-block polymers, and wool fat. Cyclodextrins such as α-, β, and γ-cyclodextrin, or chemically modified derivatives such as hydroxyalkylcyclodextrins, including 2- and 3-hydroxypropyl-β-cyclodextrins, or other solubilized derivatives can also be used to enhance delivery of compounds described herein. Dosage forms or compositions containing a chemical entity as described herein in the range of 0.005% to 100% with the balance made up from non-toxic excipient may be prepared. The contemplated compositions may contain 0.001%400% of a chemical entity provided herein, in one embodiment 0.1-95%, in another embodiment 75-85%, in a further embodiment 20-80%. Actual methods of preparing such dosage forms are known, or will be apparent, to those skilled in this art; for example, see Remington: The Science and Practice of Pharmacy, 22.sup.nd Edition (Pharmaceutical Press, London, U K. 2012).

    [3428] Routes of Administration and Composition Components

    [3429] In some embodiments, the chemical entities described herein or a pharmaceutical composition thereof can be administered to subject in need thereof by any accepted route of administration. Acceptable routes of administration include, but are not limited to, buccal, cutaneous, endocervical, endosinusial, endotracheal, enteral, epidural, interstitial, intra-abdominal, intra-arterial, intrabronchial, intrabursal, intracerebral, intraci sternal, intracoronary, intradermal, intraductal, intraduodenal, intradural, intraepidermal, intraesophageal, intragastric, intragingival, intraileal, intralymphatic, intramedullary, intrameningeal, intramuscular, intraovarian, intraperitoneal, intraprostatic, intrapulmonary, intrasinal, intraspinal, intrasynovial, intratesticular, intrathecal, intratubular, intratumoral, intrauterine, intravascular, intravenous, nasal, nasogastric, oral, parenteral, percutaneous, peridural, rectal, respiratory (inhalation), subcutaneous, sublingual, submucosal, topical, transdermal, transmucosal, transtracheal, ureteral, urethral and vaginal. In certain embodiments, a preferred route of administration is parenteral (e.g., intratumoral).

    [3430] Compositions can be formulated for parenteral administration, e.g., formulated for injection via the intravenous, intramuscular, sub-cutaneous, or even intraperitoneal routes. Typically, such compositions can be prepared as injectables, either as liquid solutions or suspensions; solid forms suitable for use to prepare solutions or suspensions upon the addition of a liquid prior to injection can also be prepared; and the preparations can also be emulsified. The preparation of such formulations will be known to those of skill in the art in light of the present disclosure.

    [3431] The pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions; formulations including sesame oil, peanut oil, or aqueous propylene glycol; and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In all cases the form must be sterile and must be fluid to the extent that it may be easily injected. It also should be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms, such as bacteria and fungi.

    [3432] The carrier also can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils. The proper fluidity can be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size in the case of dispersion, and by the use of surfactants. The prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin.

    [3433] Sterile injectable solutions are prepared by incorporating the active compounds in the required amount in the appropriate solvent with various of the other ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the various sterilized active ingredients into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum-drying and freeze-drying techniques, which yield a powder of the active ingredient, plus any additional desired ingredient from a previously sterile-filtered solution thereof.

    [3434] Intratumoral injections are discussed, e.g., in Lammers, et al., “Effect of Intratumoral Injection on the Biodistribution and the Therapeutic Potential of HPMA Copolymer-Based Drug Delivery Systems” Neoplasia. 2006, 10, 788-795.

    [3435] In certain embodiments, the chemical entities described herein or a pharmaceutical composition thereof are suitable for local, topical administration to the digestive or GI tract, e.g., rectal administration. Rectal compositions include, without limitation, enemas, rectal gels, rectal foams, rectal aerosols, suppositories, jelly suppositories, and enemas (e.g., retention enemas).

    [3436] Pharmacologically acceptable excipients usable in the rectal composition as a gel, cream, enema, or rectal suppository, include, without limitation, any one or more of cocoa butter glycerides, synthetic polymers such as polyvinylpyrrolidone, PEG (like PEG ointments), glycerine, glycerinated gelatin, hydrogenated vegetable oils, poloxamers, mixtures of polyethylene glycols of various molecular weights and fatty acid esters of polyethylene glycol Vaseline, anhydrous lanolin, shark liver oil, sodium saccharinate, menthol, sweet almond oil, sorbitol, sodium benzoate, anoxid SBN, vanilla essential oil, aerosol, parabens in phenoxyethanol, sodium methyl p-oxybenzoate, sodium propyl p-oxybenzoate, diethylamine, carbomers, carbopol, methyloxybenzoate, macrogol cetostearyl ether, cocoyl caprylocaprate, isopropyl alcohol, propylene glycol, liquid paraffin, xanthan gum, carboxy-metabisulfite, sodium edetate, sodium benzoate, potassium metabisulfite, grapefruit seed extract, methyl sulfonyl methane (MSM), lactic acid, glycine, vitamins, such as vitamin A and E and potassium acetate.

    [3437] In certain embodiments, suppositories can be prepared by mixing the chemical entities described herein with suitable non-irritating excipients or carriers such as cocoa butter, polyethylene glycol or a suppository wax which are solid at ambient temperature but liquid at body temperature and therefore melt in the rectum and release the active compound. In other embodiments, compositions for rectal administration are in the form of an enema.

    [3438] In other embodiments, the compounds described herein or a pharmaceutical composition thereof are suitable for local delivery to the digestive or GI tract by way of oral administration (e.g., solid or liquid dosage forms.).

    [3439] Solid dosage forms for oral administration include capsules, tablets, pills, powders, and granules. In such solid dosage forms, the chemical entity is mixed with one or more pharmaceutically acceptable excipients, such as sodium citrate or dicalcium phosphate and/or: a) fillers or extenders such as starches, lactose, sucrose, glucose, mannitol, and silicic acid, b) binders such as, for example, carboxymethylcellulose, alginates, gelatin, polyvinylpyrrolidinone, sucrose, and acacia, c) humectants such as glycerol, d) disintegrating agents such as agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates, and sodium carbonate, e) solution retarding agents such as paraffin, f) absorption accelerators such as quaternary ammonium compounds, g) wetting agents such as, for example, cetyl alcohol and glycerol monostearate, h) absorbents such as kaolin and bentonite clay, and i) lubricants such as talc, calcium stearate, magnesium stearate, solid polyethylene glycols, sodium lauryl sulfate, and mixtures thereof. In the case of capsules, tablets and pills, the dosage form may also comprise buffering agents. Solid compositions of a similar type may also be employed as fillers in soft and hard-filled gelatin capsules using such excipients as lactose or milk sugar as well as high molecular weight polyethylene glycols and the like.

    [3440] In one embodiment, the compositions will take the form of a unit dosage form such as a pill or tablet and thus the composition may contain, along with a chemical entity provided herein, a diluent such as lactose, sucrose, dicalcium phosphate, or the like; a lubricant such as magnesium stearate or the like; and a binder such as starch, gum acacia, polyvinylpyrrolidine, gelatin, cellulose, cellulose derivatives or the like. In another solid dosage form, a powder, marume, solution or suspension (e.g., in propylene carbonate, vegetable oils, PEG's, poloxamer 124 or triglycerides) is encapsulated in a capsule (gelatin or cellulose base capsule). Unit dosage forms in which one or more chemical entities provided herein or additional active agents are physically separated are also contemplated; e.g., capsules with granules (or tablets in a capsule) of each drug; two-layer tablets; two-compartment gel caps, etc. Enteric coated or delayed release oral dosage forms are also contemplated.

    [3441] Other physiologically acceptable compounds include wetting agents, emulsifying agents, dispersing agents or preservatives that are particularly useful for preventing the growth or action of microorganisms. Various preservatives are well known and include, for example, phenol and ascorbic acid.

    [3442] In certain embodiments the excipients are sterile and generally free of undesirable matter. These compositions can be sterilized by conventional, well-known sterilization techniques. For various oral dosage form excipients such as tablets and capsules sterility is not required. The USP/NF standard is usually sufficient.

    [3443] In certain embodiments, solid oral dosage forms can further include one or more components that chemically and/or structurally predispose the composition for delivery of the chemical entity to the stomach or the lower GI; e.g., the ascending colon and/or transverse colon and/or distal colon and/or small bowel. Exemplary formulation techniques are described in, e.g., Filipski, K. J., et al., Current Topics in Medicinal Chemistry, 2013, 13, 776-802, which is incorporated herein by reference in its entirety.

    [3444] Examples include upper-GI targeting techniques, e.g., Accordion Pill (Intec Pharma), floating capsules, and materials capable of adhering to mucosal walls.

    [3445] Other examples include lower-GI targeting techniques. For targeting various regions in the intestinal tract, several enteric/pH-responsive coatings and excipients are available. These materials are typically polymers that are designed to dissolve or erode at specific pH ranges, selected based upon the GI region of desired drug release. These materials also function to protect acid labile drugs from gastric fluid or limit exposure in cases where the active ingredient may be irritating to the upper GI (e.g., hydroxypropyl methylcellulose phthalate series, Coateric (polyvinyl acetate phthalate), cellulose acetate phthalate, hydroxypropyl methylcellulose acetate succinate, Eudragit series (methacrylic acid-methyl methacrylate copolymers), and Marcoat). Other techniques include dosage forms that respond to local flora in the GI tract, Pressure-controlled colon delivery capsule, and Pulsincap.

    [3446] Ocular compositions can include, without limitation, one or more of any of the following: viscogens (e.g., Carboxymethylcellulose, Glycerin, Polyvinylpyrrolidone, Polyethylene glycol); Stabilizers (e.g., Pluronic (triblock copolymers), Cyclodextrins); Preservatives (e.g., Benzalkonium chloride, ETDA, SofZia (boric acid, propylene glycol, sorbitol, and zinc chloride; Alcon Laboratories, Inc.), Purite (stabilized oxychloro complex; Allergan, Inc.)).

    [3447] Topical compositions can include ointments and creams. Ointments are semisolid preparations that are typically based on petrolatum or other petroleum derivatives. Creams containing the selected active agent are typically viscous liquid or semisolid emulsions, often either oil-in-water or water-in-oil. Cream bases are typically water-washable, and contain an oil phase, an emulsifier and an aqueous phase. The oil phase, also sometimes called the “internal” phase, is generally comprised of petrolatum and a fatty alcohol such as cetyl or stearyl alcohol; the aqueous phase usually, although not necessarily, exceeds the oil phase in volume, and generally contains a humectant. The emulsifier in a cream formulation is generally a nonionic, anionic, cationic or amphoteric surfactant. As with other carriers or vehicles, an ointment base should be inert, stable, nonirritating and non-sensitizing.

    [3448] In any of the foregoing embodiments, pharmaceutical compositions described herein can include one or more one or more of the following: lipids, interbilayer crosslinked multilamellar vesicles, biodegradeable poly(D,L-lactic-co-glycolic acid) [PLGA]-based or poly anhydride-based nanoparticles or microparticles, and nanoporous particle-supported lipid bilayers.

    [3449] Enema Formulations

    [3450] In some embodiments, enema formulations containing the chemical entities described herein are provided in “ready-to-use” form.

    [3451] In some embodiments, enema formulations containing the chemical entities described herein are provided in one or more kits or packs. In certain embodiments, the kit or pack includes two or more separately contained/packaged components, e.g. two components, which when mixed together, provide the desired formulation (e.g., as a suspension). In certain of these embodiments, the two component system includes a first component and a second component, in which: (i) the first component (e.g., contained in a sachet) includes the chemical entity (as described anywhere herein) and optionally one or more pharmaceutically acceptable excipients (e.g., together formulated as a solid preparation, e.g., together formulated as a wet granulated solid preparation); and (ii) the second component (e.g., contained in a vial or bottle) includes one or more liquids and optionally one or more other pharmaceutically acceptable excipients together forming a liquid carrier. Prior to use (e.g., immediately prior to use), the contents of (i) and (ii) are combined to form the desired enema formulation, e.g., as a suspension. In other embodiments, each of component (i) and (ii) is provided in its own separate kit or pack.

    [3452] In some embodiments, each of the one or more liquids is water, or a physiologically acceptable solvent, or a mixture of water and one or more physiologically acceptable solvents. Typical such solvents include, without limitation, glycerol, ethylene glycol, propylene glycol, polyethylene glycol and polypropylene glycol. In certain embodiments, each of the one or more liquids is water. In other embodiments, each of the one or more liquids is an oil, e.g. natural and/or synthetic oils that are commonly used in pharmaceutical preparations.

    [3453] Further pharmaceutical excipients and carriers that may be used in the pharmaceutical products herein described are listed in various handbooks (e.g. D. E. Bugay and W. P. Findlay (Eds) Pharmaceutical excipients (Marcel Dekker, New York, 1999), E-M Hoepfner, A. Reng and P. C. Schmidt (Eds) Fiedler Encyclopedia of Excipients for Pharmaceuticals, Cosmetics and Related Areas (Edition Cantor, Munich, 2002) and H. P. Fielder (Ed) Lexikon der Hilfsstoffe fur Pharmazie, Kosmetik and angrenzende Gebiete (Edition Cantor Aulendorf, 1989)).

    [3454] In some embodiments, each of the one or more pharmaceutically acceptable excipients can be independently selelcted from thickeners, viscosity enhancing agents, bulking agents, mucoadhesive agents, penetration enhanceers, buffers, preservatives, diluents, binders, lubricants, glidants, disintegrants, fillers, solubilizing agents, pH modifying agents, preservatives, stabilizing agents, anti-oxidants, wetting or emulsifying agents, suspending agents, pigments, colorants, isotonic agents, chelating agents, emulsifiers, and diagnostic agents.

    [3455] In certain embodiments, each of the one or more pharmaceutically acceptable excipients can be independently selelcted from thickeners, viscosity enhancing agents, mucoadhesive agents, buffers, preservatives, diluents, binders, lubricants, glidants, disintegrants, and fillers.

    [3456] In certain embodiments, each of the one or more pharmaceutically acceptable excipients can be independently selelcted from thickeners, viscosity enhancing agents, bulking agents, mucoadhesive agents, buffers, preservatives, and fillers.

    [3457] In certain embodiments, each of the one or more pharmaceutically acceptable excipients can be independently selelcted from diluents, binders, lubricants, glidants, and disintegrants.

    [3458] Examples of thickeners, viscosity enhancing agents, and mucoadhesive agents include without limitation: gums, e.g. xanthan gum, guar gum, locust bean gum, tragacanth gums, karaya gum, ghatti gum, cholla gum, psyllium seed gum and gum arabic; poly(carboxylic acid-containing) based polymers, such as poly (acrylic, maleic, itaconic, citraconic, hydroxyethyl methacrylic or methacrylic) acid which have strong hydrogen-bonding groups, or derivatives thereof such as salts and esters; cellulose derivatives, such as methyl cellulose, ethyl cellulose, methylethyl cellulose, hydroxymethyl cellulose, hydroxyethyl cellulose, hydroxypropyl cellulose, hydroxyethyl ethyl cellulose, carboxymethyl cellulose, hydroxypropylmethyl cellulose or cellulose esters or ethers or derivatives or salts thereof; clays such as manomorillonite clays, e.g. Veegun, attapulgite clay; polysaccharides such as dextran, pectin, amylopectin, agar, mannan or polygalactonic acid or starches such as hydroxypropyl starch or carboxymethyl starch; polypeptides such as casein, gluten, gelatin, fibrin glue; chitosan, e.g. lactate or glutamate or carboxymethyl chitin; glycosaminoglycans such as hyaluronic acid; metals or water soluble salts of alginic acid such as sodium alginate or magnesium alginate; schleroglucan; adhesives containing bismuth oxide or aluminium oxide; atherocollagen; polyvinyl polymers such as carboxyvinyl polymers; polyvinylpyrrolidone (povidone); polyvinyl alcohol; polyvinyl acetates, polyvinylmethyl ethers, polyvinyl chlorides, polyvinylidenes, and/or the like; polycarboxylated vinyl polymers such as polyacrylic acid as mentioned above; polysiloxanes; polyethers; polyethylene oxides and glycols; polyalkoxys and polyacrylamides and derivatives and salts thereof. Preferred examples can include cellulose derivatives, such as methyl cellulose, ethyl cellulose, methylethyl cellulose, hydroxymethyl cellulose, hydroxyethyl cellulose, hydroxypropyl cellulose, hydroxyethyl ethyl cellulose, carboxymethyl cellulose, hydroxypropylmethyl cellulose or cellulose esters or ethers or derivatives or salts thereof (e.g., methyl cellulose); and polyvinyl polymers such as polyvinylpyrrolidone (povidone).

    [3459] Examples of preservatives include without limitation: benzalkonium chloride, benzoxonium chloride, benzethonium chloride, cetrimide, sepazonium chloride, cetylpyridinium chloride, domiphen bromide (Bradosol®), thiomersal, phenylmercuric nitrate, phenylmercuric acetate, phenylmercuric borate, methylparaben, propylparaben, chlorobutanol, benzyl alcohol, phenyl ethyl alcohol, chlorohexidine, polyhexamethylene biguanide, sodium perborate, imidazolidinyl urea, sorbic acid, Purite®), Polyquart®), and sodium perborate tetrahydrate and the like.

    [3460] In certain embodiments, the preservative is a paraben, or a pharmaceutically acceptable salt thereof. In some embodiments, the paraben is an alkyl substituted 4-hydroxybenzoate, or a pharmaceutically acceptable salt or ester thereof. In certain embodiments, the alkyl is a C1-C4 alkyl. In certain embodiments, the preservative is methyl 4-hydroxybenzoate (methylparaben), or a pharmaceutically acceptable salt or ester thereof, propyl 4-hydroxybenzoate (propylparaben), or a pharmaceutically acceptable salt or ester thereof, or a combination thereof.

    [3461] Examples of buffers include without limitation: phosphate buffer system (sodium dihydrogen phospahate dehydrate, disodium phosphate dodecahydrate, bibasic sodium phosphate, anhydrous monobasic sodium phosphate), bicarbonate buffer system, and bisulfate buffer system.

    [3462] Examples of disintegrants include, without limitation: carmellose calcium, low substituted hydroxypropyl cellulose (L-HPC), carmellose, croscarmellose sodium, partially pregelatinized starch, dry starch, carboxymethyl starch sodium, crospovidone, polysorbate 80 (polyoxyethylenesorbitan oleate), starch, sodium starch glycolate, hydroxypropyl cellulose pregelatinized starch, clays, cellulose, alginine, gums or cross linked polymers, such as crosslinked PVP (Polyplasdone XL from GAF Chemical Corp). In certain embodiments, the disintegrant is crospovidone.

    [3463] Examples of glidants and lubricants (aggregation inhibitors) include without limitation: talc, magnesium stearate, calcium stearate, colloidal silica, stearic acid, aqueous silicon dioxide, synthetic magnesium silicate, fine granulated silicon oxide, starch, sodium laurylsulfate, boric acid, magnesium oxide, waxes, hydrogenated oil, polyethylene glycol, sodium benzoate, stearic acid glycerol behenate, polyethylene glycol, and mineral oil. In certain embodiments, the glidant/lubricant is magnesium stearate, talc, and/or colloidal silica; e.g., magnesium stearate and/or talc.

    [3464] Examples of diluents, also referred to as “fillers” or “bulking agents” include without limitation: dicalcium phosphate dihydrate, calcium sulfate, lactose (e.g., lactose monohydrate), sucrose, mannitol, sorbitol, cellulose, microcrystalline cellulose, kaolin, sodium chloride, dry starch, hydrolyzed starches, pregelatinized starch, silicone dioxide, titanium oxide, magnesium aluminum silicate and powdered sugar. In certain embodiments, the diluent is lactose (e.g., lactose monohydrate).

    [3465] Examples of binders include without limitation: starch, pregelatinized starch, gelatin, sugars (including sucrose, glucose, dxtrose, lactose and sorbitol), polyethylene glycol, waxes, natural and synthetic gums such as acacia tragacanth, sodium alginate cellulose, including hydroxypropylmethylcellulose, hydroxypropylcellulose, ethylcellulose, and veegum, and synthetic polymers such as acrylic acid and methacrylic acid copolymers, methacrylic acid copolymers, methyl methacrylate copolymers, aminoalkyl methacrylate copolymers, polyacrylic acid/polymethacrylic acid and polyvinylpyrrolidone (povidone). In certain embodiments, the binder is polyvinylpyrrolidone (povidone).

    [3466] In some embodiments, enema formulations containing the chemical entities described herein include water and one or more (e.g., all) of the following excipients: [3467] One or more (e.g., one, two, or three) thickeners, viscosity enhancing agents, binders, and/or mucoadhesive agents (e.g., cellulose or cellulose esters or ethers or derivatives or salts thereof (e.g., methyl cellulose); and polyvinyl polymers such as polyvinylpyrrolidone (povidone); [3468] One or more (e.g., one or two; e.g., two) preservatives, such as a paraben, e.g., methyl 4-hydroxybenzoate (methylparaben), or a pharmaceutically acceptable salt or ester thereof, propyl 4-hydroxybenzoate (propylparaben), or a pharmaceutically acceptable salt or ester thereof, or a combination thereof; [3469] One or more (e.g., one or two; e.g., two) buffers, such as phosphate buffer system (e.g., sodium dihydrogen phospahate dehydrate, disodium phosphate dodecahydrate); [3470] One or more (e.g., one or two, e.g., two) glidants and/or lubricants, such as magnesium stearate and/or talc; [3471] One or more (e.g., one or two; e.g., one) disintegrants, such as crospovidone; and [3472] One or more (e.g., one or two; e.g., one) diluents, such as lactose (e.g., lactose monohydrate).

    [3473] In certain of these embodiments, the chemical entity is a compound of Formula AA, or a pharmaceutically acceptable salt and/or hydrate and/or cocrystal thereof.

    [3474] In certain embodiments, enema formulations containing the chemical entities described herein include water, methyl cellulose, povidone, methylparaben, propylparaben, sodium dihydrogen phospahate dehydrate, disodium phosphate dodecahydrate, crospovidone, lactose monohydrate, magnesium stearate, and talc. In certain of these embodiments, the chemical entity is a compound of Formula AA, or a pharmaceutically acceptable salt and/or hydrate and/or cocrystal thereof.

    [3475] In certain embodiments, enema formulations containing the chemical entities described herein are provided in one or more kits or packs. In certain embodiments, the kit or pack includes two separately contained/packaged components, which when mixed together, provide the desired formulation (e.g., as a suspension). In certain of these embodiments, the two component system includes a first component and a second component, in which: (i) the first component (e.g., contained in a sachet) includes the chemical entity (as described anywhere herein) and one or more pharmaceutically acceptable excipients (e.g., together formulated as a solid preparation, e.g., together formulated as a wet granulated solid preparation); and (ii) the second component (e.g., contained in a vial or bottle) includes one or more liquids and one or more one or more other pharmaceutically acceptable excipients together forming a liquid carrier. In other embodiments, each of component (i) and (ii) is provided in its own separate kit or pack.

    [3476] In certain of these embodiments, component (i) includes the chemical entitiy (e.g., a compound of Formula AA, or a pharmaceutically acceptable salt and/or hydrate and/or cocrystal thereof; e.g., a compound of Formula AA) and one or more (e.g., all) of the following excipients: [3477] (a) One or more (e.g., one) binders (e.g., a polyvinyl polymer, such as polyvinylpyrrolidone (povidone); [3478] (b) One or more (e.g., one or two, e.g., two) glidants and/or lubricants, such as magnesium stearate and/or talc; [3479] (c) One or more (e.g., one or two; e.g., one) disintegrants, such as crospovidone; and [3480] (d) One or more (e.g., one or two; e.g., one) diluents, such as lactose (e.g., lactose monohydrate).

    [3481] In certain embodiments, component (i) includes from about 40 weight percent to about 80 weight percent (e.g., from about 50 weight percent to about 70 weight percent, from about 55 weight percent to about 70 weight percent; from about 60 weight percent to about 65 weight percent; e.g., about 62.1 weight percent) of the chemical entity (e.g., a compound of Formula AA, or a pharmaceutically acceptable salt and/or hydrate and/or cocrystal thereof).

    [3482] In certain embodiments, component (i) includes from about 0.5 weight percent to about 5 weight percent (e.g., from about 1.5 weight percent to about 4.5 weight percent, from about 2 weight percent to about 3.5 weight percent; e.g., about 2.76 weight percent) of the binder (e.g., povidone).

    [3483] In certain embodiments, component (i) includes from about 0.5 weight percent to about 5 weight percent (e.g., from about 0.5 weight percent to about 3 weight percent, from about 1 weight percent to about 3 weight percent; about 2 weight percent e.g., about 1.9 weight percent) of the disintegrant (e.g., crospovidone).

    [3484] In certain embodiments, component (i) includes from about 10 weight percent to about 50 weight percent (e.g., from about 20 weight percent to about 40 weight percent, from about 25 weight percent to about 35 weight percent; e.g., about 31.03 weight percent) of the diluent (e.g., lactose, e.g., lactose monohydrate).

    [3485] In certain embodiments, component (i) includes from about 0.05 weight percent to about 5 weight percent (e.g., from about 0.05 weight percent to about 3 weight percent) of the glidants and/or lubricants.

    [3486] In certain embodiments (e.g., when component (i) includes one or more lubricants, such as magnesium stearate), component (i) includes from about 0.05 weight percent to about 1 weight percent (e.g., from about 0.05 weight percent to about 1 weight percent; from about 0.1 weight percent to about 1 weight percent; from about 0.1 weight percent to about 0.5 weight percent; e.g., about 0.27 weight percent) of the lubricant (e.g., magnesium stearate).

    [3487] In certain embodiments (when component (i) includes one or more lubricants, such as talc), component (i) includes from about 0.5 weight percent to about 5 weight percent (e.g., from about 0.5 weight percent to about 3 weight percent, from about 1 weight percent to about 3 weight percent; from about 1.5 weight percent to about 2.5 weight percent; from about 1.8 weight percent to about 2.2 weight percent; about 1.93 weight percent) of the lubricant (e.g., talc).

    [3488] In certain of these embodiments, each of (a), (b), (c), and (d) above is present.

    [3489] In certain embodiments, component (i) includes the ingredients and amounts as shown in Table A.

    TABLE-US-00004 TABLE A Ingredient Weight Percent A compound of 40 weight percent to about 80 weight Formula AA percent (e.g., from about 50 weight percent to about 70 weight percent, from about 55 weight percent to about 70 weight percent; from about 60 weight percent to about 65 weight percent; e.g., about 62.1 weight percent) Crospovidone 0.5 weight percent to about 5 weight (Kollidon CL) percent (e.g., from about 0.5 weight percent to about 3 weight percent, from about 1 weight percent to about 3 weight percent; about 1.93 weight percent lactose monohydrate about 10 weight percent to about 50 weight (Pharmatose 200M) percent (e.g., from about 20 weight percent to about 40 weight percent, from about 25 weight percent to about 35 weight percent; e.g., about 31.03 weight percent Povidone (Kollidon about 0.5 weight percent to about 5 weight K30) percent (e.g., from about 1.5 weight percent to about 4.5 weight percent, from about 2 weight percent to about 3.5 weight percent; e.g., about 2.76 weight percent talc 0.5 weight percent to about 5 weight percent (e.g., from about 0.5 weight percent to about 3 weight percent, from about 1 weight percent to about 3 weight percent; from about 1.5 weight percent to about 2.5 weight percent; from about 1.8 weight percent to about 2.2 weight percent; e.g., about 1.93 weight percent Magnesium stearate about 0.05 weight percent to about 1 weight percent (e.g., from about 0.05 weight percent to about 1 weight percent; from about 0.1 weight percent to about 1 weight percent; from about 0.1 weight percent to about 0.5 weight percent; e.g., about 0.27 weight percent

    [3490] In certain embodiments, component (i) includes the ingredients and amounts as shown in Table B.

    TABLE-US-00005 TABLE B Ingredient Weight Percent A compound of Formula AA About 62.1 weight percent) Crospovidone (Kollidon CL) About 1.93 weight percent lactose monohydrate (Pharmatose 200M) About 31.03 weight percent Povidone (Kollidon K30) About 2.76 weight percent talc About 1.93 weight percent Magnesium stearate About 0.27 weight percent

    [3491] In certain embodiments, component (i) is formulated as a wet granulated solid preparation. In certain of these embodiments an internal phase of ingredients (the chemical entity, disintegrant, and diluent) are combined and mixed in a high-shear granulator. A binder (e.g., povidone) is dissolved in water to form a granulating solution. This solution is added to the Inner Phase mixture resulting in the development of granules. While not wishing to be bound by theory, granule development is believed to be facilitated by the interaction of the polymeric binder with the materials of the internal phase. Once the granulation is formed and dried, an external phase (e.g., one or more lubricants—not an intrinsic component of the dried granulation), is added to the dry granulation. It is believed that lubrication of the granulation is important to the flowability of the granulation, in particular for packaging.

    [3492] In certain of the foregoing embodiments, component (ii) includes water and one or more (e.g., all) of the following excipients: [3493] (a′) One or more (e.g., one, two; e.g., two) thickeners, viscosity enhancing agents, binders, and/or mucoadhesive agents (e.g., cellulose or cellulose esters or ethers or derivatives or salts thereof (e.g., methyl cellulose); and polyvinyl polymers such as polyvinylpyrrolidone (povidone); [3494] (b′) One or more (e.g., one or two; e.g., two) preservatives, such as a paraben, e.g., methyl 4-hydroxybenzoate (methylparaben), or a pharmaceutically acceptable salt or ester thereof, propyl 4-hydroxybenzoate (propylparaben), or a pharmaceutically acceptable salt or ester thereof, or a combination thereof; and [3495] (c′) One or more (e.g., one or two; e.g., two) buffers, such as phosphate buffer system (e.g., sodium dihydrogen phospahate dihydrate, disodium phosphate dodecahydrate);

    [3496] In certain of the foregoing embodiments, component (ii) includes water and one or more (e.g., all) of the following excipients: [3497] (a″) a first thickener, viscosity enhancing agent, binder, and/or mucoadhesive agent (e.g., a cellulose or cellulose ester or ether or derivative or salt thereof (e.g., methyl cellulose)); [3498] (a′) a second thickener, viscosity enhancing agent, binder, and/or mucoadhesive agent (e.g., a polyvinyl polymer, such as polyvinylpyrrolidone (povidone)); [3499] (b″) a first preservative, such as a paraben, e.g., propyl 4-hydroxybenzoate [3500] (propylparaben), or a pharmaceutically acceptable salt or ester thereof; [3501] (b″) a second preservative, such as a paraben, e.g., methyl 4-hydroxybenzoate [3502] (methylparaben), or a pharmaceutically acceptable salt or ester thereof, [3503] (c″) a first buffer, such as phosphate buffer system (e.g., disodium phosphate dodecahydrate); [3504] (c′″) a second buffer, such as phosphate buffer system (e.g., sodium dihydrogen phospahate dehydrate),

    [3505] In certain embodiments, component (ii) includes from about 0.05 weight percent to about 5 weight percent (e.g., from about 0.05 weight percent to about 3 weight percent, from about 0.1 weight percent to about 3 weight percent; e.g., about 1.4 weight percent) of (a″).

    [3506] In certain embodiments, component (ii) includes from about 0.05 weight percent to about 5 weight percent (e.g., from about 0.05 weight percent to about 3 weight percent, from about 0.1 weight percent to about 2 weight percent; e.g., about 1.0 weight percent) of (a′″).

    [3507] In certain embodiments, component (ii) includes from about 0.005 weight percent to about 0.1 weight percent (e.g., from about 0.005 weight percent to about 0.05 weight percent; e.g., about 0.02 weight percent) of (b″).

    [3508] In certain embodiments, component (ii) includes from about 0.05 weight percent to about 1 weight percent (e.g., from about 0.05 weight percent to about 0.5 weight percent; e.g., about 0.20 weight percent) of (b′″).

    [3509] In certain embodiments, component (ii) includes from about 0.05 weight percent to about 1 weight percent (e.g., from about 0.05 weight percent to about 0.5 weight percent; e.g., about 0.15 weight percent) of (c″).

    [3510] In certain embodiments, component (ii) includes from about 0.005 weight percent to about 0.5 weight percent (e.g., from about 0.005 weight percent to about 0.3 weight percent; e.g., about 0.15 weight percent) of (c′″).

    [3511] In certain of these embodiments, each of (a″)-(c′) is present.

    [3512] In certain embodiments, component (ii) includes water (up to 100%) and the ingredients and amounts as shown in Table C.

    TABLE-US-00006 TABLE C Ingredient Weight Percent methyl cellulose 0.05 weight percent to about 5 weight (Methocel A15C percent (e.g., from about 0.05 weight premium) percent to about 3 weight percent, from about 0.1 weight percent to about 3 weight percent; e.g., about 1.4 weight percent Povidone (Kollidon 0.05 weight percent to about 5 weight K30) percent (e.g., from about 0.05 weight percent to about 3 weight percent, from about 0.1 weight percent to about 2 weight percent; e.g., about 1.0 weight percent propyl 4- about 0.005 weight percent to about 0.1 hydroxybenzoate weight percent (e.g., from about 0.005 weight percent to about 0.05 weight percent; e.g., about 0.02 weight percent) methyl 4- about 0.05 weight percent to about 1 hydroxybenzoate weight percent (e.g., from about 0.05 weight percent to about 0.5 weight percent; e.g., about 0.20 weight percent) disodium phosphate about 0.05 weight percent to about 1 dodecahydrate weight percent (e.g., from about 0.05 weight percent to about 0.5 weight percent; e.g., about 0.15 weight percent) sodium dihydrogen about 0.005 weight percent to about 0.5 phospahate dihydrate weight percent (e.g., from about 0.005 weight percent to about 0.3 weight percent; e.g., about 0.15 weight percent)

    [3513] In certain embodiments, component (ii) includes water (up to 100%) and the ingredients and amounts as shown in Table D.

    TABLE-US-00007 TABLE D Ingredient Weight Percent methyl cellulose (Methocel A15C premium) about 1.4 weight percent Povidone (Kollidon K30) about 1.0 weight percent propyl 4-hydroxybenzoate about 0.02 weight percent methyl 4-hydroxybenzoate about 0.20 weight percent disodium phosphate dodecahydrate about 0.15 weight percent sodium dihydrogen phospahate dihydrate about 0.15 weight percent

    [3514] Ready-to-use” enemas are generally be provided in a “single-use” sealed disposable container of plastic or glass. Those formed of a polymeric material preferably have sufficient flexibility for ease of use by an unassisted patient. Typical plastic containers can be made of polyethylene. These containers may comprise a tip for direct introduction into the rectum. Such containers may also comprise a tube between the container and the tip. The tip is preferably provided with a protective shield which is removed before use. Optionally the tip has a lubricant to improve patient compliance.

    [3515] In some embodiments, the enema formulation (e.g., suspension) is poured into a bottle for delivery after it has been prepared in a separate container. In certain embodiments, the bottle is a plastic bottle (e.g., flexible to allow for delivery by squeezing the bottle), which can be a polyethylene bottle (e.g., white in color). In some embodiments, the bottle is a single chamber bottle, which contains the suspension or solution. In other embodiments, the bottle is a multichamber bottle, where each chamber contains a separate mixture or solution. In still other embodiments, the bottle can further include a tip or rectal cannula for direct introduction into the rectum. In some embodiments, the enema formulation can be delivered in the device shown in FIGS. 3A-3C, which includes a plastic bottle, a breakable capsule, and a rectal cannula and single flow pack.

    [3516] Dosages

    [3517] The dosages may be varied depending on the requirement of the patient, the severity of the condition being treating and the particular compound being employed. Determination of the proper dosage for a particular situation can be determined by one skilled in the medical arts. The total daily dosage may be divided and administered in portions throughout the day or by means providing continuous delivery.

    [3518] In some embodiments, the compounds described herein are administered at a dosage of from about 0.001 mg/Kg to about 500 mg/Kg (e.g., from about 0.001 mg/Kg to about 200 mg/Kg; from about 0.01 mg/Kg to about 200 mg/Kg; from about 0.01 mg/Kg to about 150 mg/Kg; from about 0.01 mg/Kg to about 100 mg/Kg; from about 0.01 mg/Kg to about 50 mg/Kg; from about 0.01 mg/Kg to about 10 mg/Kg; from about 0.01 mg/Kg to about 5 mg/Kg; from about 0.01 mg/Kg to about 1 mg/Kg; from about 0.01 mg/Kg to about 0.5 mg/Kg; from about 0.01 mg/Kg to about 0.1 mg/Kg; from about 0.1 mg/Kg to about 200 mg/Kg; from about 0.1 mg/Kg to about 150 mg/Kg; from about 0.1 mg/Kg to about 100 mg/Kg; from about 0.1 mg/Kg to about 50 mg/Kg; from about 0.1 mg/Kg to about 10 mg/Kg; from about 0.1 mg/Kg to about 5 mg/Kg; from about 0.1 mg/Kg to about 1 mg/Kg; from about 0.1 mg/Kg to about 0.5 mg/Kg).

    [3519] In some embodiments, enema formulations include from about 0.5 mg to about 2500 mg (e.g., from about 0.5 mg to about 2000 mg, from about 0.5 mg to about 1000 mg, from about 0.5 mg to about 750 mg, from about 0.5 mg to about 600 mg, from about 0.5 mg to about 500 mg, from about 0.5 mg to about 400 mg, from about 0.5 mg to about 300 mg, from about 0.5 mg to about 200 mg; e.g., from about 5 mg to about 2500 mg, from about 5 mg to about 2000 mg, from about 5 mg to about 1000 mg; from about 5 mg to about 750 mg; from about 5 mg to about 600 mg; from about 5 mg to about 500 mg; from about 5 mg to about 400 mg; from about 5 mg to about 300 mg; from about 5 mg to about 200 mg; e.g., from about 50 mg to about 2000 mg, from about 50 mg to about 1000 mg, from about 50 mg to about 750 mg, from about 50 mg to about 600 mg, from about 50 mg to about 500 mg, from about 50 mg to about 400 mg, from about 50 mg to about 300 mg, from about 50 mg to about 200 mg; e.g., from about 100 mg to about 2500 mg, from about 100 mg to about 2000 mg, from about 100 mg to about 1000 mg, from about 100 mg to about 750 mg, from about 100 mg to about 700 mg, from about 100 mg to about 600 mg, from about 100 mg to about 500 mg, from about 100 mg to about 400 mg, from about 100 mg to about 300 mg, from about 100 mg to about 200 mg; e.g., from about 150 mg to about 2500 mg, from about 150 mg to about 2000 mg, from about 150 mg to about 1000 mg, from about 150 mg to about 750 mg, from about 150 mg to about 700 mg, from about 150 mg to about 600 mg, from about 150 mg to about 500 mg, from about 150 mg to about 400 mg, from about 150 mg to about 300 mg, from about 150 mg to about 200 mg; e.g., from about 150 mg to about 500 mg; e.g., from about 300 mg to about 2500 mg, from about 300 mg to about 2000 mg, from about 300 mg to about 1000 mg, from about 300 mg to about 750 mg, from about 300 mg to about 700 mg, from about 300 mg to about 600 mg; e.g., from about 400 mg to about 2500 mg, from about 400 mg to about 2000 mg, from about 400 mg to about 1000 mg, from about 400 mg to about 750 mg, from about 400 mg to about 700 mg, from about 400 mg to about 600 from about 400 mg to about 500 mg; e.g., 150 mg or 450 mg) of the chemical entity in from about 1 mL to about 3000 mL (e.g., from about 1 mL to about 2000 mL, from about 1 mL to about 1000 mL, from about 1 mL to about 500 mL, from about 1 mL to about 250 mL, from about 1 mL to about 100 mL, from about 10 mL to about 1000 mL, from about 10 mL to about 500 mL, from about 10 mL to about 250 mL, from about 10 mL to about 100 mL, from about 30 mL to about 90 mL, from about 40 mL to about 80 mL; from about 50 mL to about 70 mL; e.g., about 1 mL, about 5 mL, about 10 mL, about 15 mL, about 20 mL, about 25 mL, about 30 mL, about 35 mL, about 40 mL, about 45 mL, about 50 mL, about 55 mL, about 60 mL, about 65 mL, about 70 mL, about 75 mL, about 100 mL, about 250 mL, or about 500 mL, or about 1000 mL, or about 2000 mL, or about 3000 mL; e.g., 60 mL) of liquid carrier.

    [3520] In certain embodiments, enema formulations include from about 50 mg to about 250 mg (e.g., from about 100 mg to about 200; e.g., about 150 mg) of the chemical entity in from about 10 mL to about 100 mL (e.g., from about 20 mL to about 100 mL, from about 30 mL to about 90 mL, from about 40 mL to about 80 mL; from about 50 mL to about 70 mL) of liquid carrier. In certain embodiments, enema formulations include about 150 mg of the chemical entity in about 60 mL of the liquid carrier. In certain of these embodiments, the chemical entity is a compound of Formula AA, or a pharmaceutically acceptable salt and/or hydrate and/or cocrystal thereof. For example, enema formulations can include about 150 mg of a compound of Formula AA in about 60 mL of the liquid carrier.

    [3521] In certain embodiments, enema formulations include from about 350 mg to about 550 mg (e.g., from about 400 mg to about 500; e.g., about 450 mg) of the chemical entity in from about 10 mL to about 100 mL (e.g., from about 20 mL to about 100 mL, from about 30 mL to about 90 mL, from about 40 mL to about 80 mL; from about 50 mL to about 70 mL) of liquid carrier. In certain embodiments, enema formulations include about 450 mg of the chemical entity in about 60 mL of the liquid carrier. In certain of these embodiments, the chemical entity is a compound of Formula AA, or a pharmaceutically acceptable salt and/or hydrate and/or cocrystal thereof. For example, enema formulations can include about 450 mg of a compound of Formula AA in about 60 mL of the liquid carrier.

    [3522] In some embodiments, enema formulations include from about from about 0.01 mg/mL to about 50 mg/mL (e.g., from about 0.01 mg/mL to about 25 mg/mL; from about 0.01 mg/mL to about 10 mg/mL; from about 0.01 mg/mL to about 5 mg/mL; from about 0.1 mg/mL to about 50 mg/mL; from about 0.01 mg/mL to about 25 mg/mL; from about 0.1 mg/mL to about 10 mg/mL; from about 0.1 mg/mL to about 5 mg/mL; from about 1 mg/mL to about 10 mg/mL; from about 1 mg/mL to about 5 mg/mL; from about 5 mg/mL to about 10 mg/mL; e.g., about 2.5 mg/mL or about 7.5 mg/mL) of the chemical entity in liquid carrier. In certain of these embodiments, the chemical entity is a compound of Formula AA, or a pharmaceutically acceptable salt and/or hydrate and/or cocrystal thereof. For example, enema formulations can include about 2.5 mg/mL or about 7.5 mg/mL of a compound of Formula AA in liquid carrier.

    [3523] Regimens

    [3524] The foregoing dosages can be administered on a daily basis (e.g., as a single dose or as two or more divided doses) or non-daily basis (e.g., every other day, every two days, every three days, once weekly, twice weeks, once every two weeks, once a month).

    [3525] In some embodiments, the period of administration of a compound described herein is for 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 9 weeks, 10 weeks, 11 weeks, 12 weeks, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months, or more. In a further embodiment, a period of during which administration is stopped is for 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 9 weeks, 10 weeks, 11 weeks, 12 weeks, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months, or more. In an embodiment, a therapeutic compound is administered to an individual for a period of time followed by a separate period of time. In another embodiment, a therapeutic compound is administered for a first period and a second period following the first period, with administration stopped during the second period, followed by a third period where administration of the therapeutic compound is started and then a fourth period following the third period where administration is stopped. In an aspect of this embodiment, the period of administration of a therapeutic compound followed by a period where administration is stopped is repeated for a determined or undetermined period of time. In a further embodiment, a period of administration is for 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 9 weeks, 10 weeks, 11 weeks, 12 weeks, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months, or more. In a further embodiment, a period of during which administration is stopped is for 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 9 weeks, 10 weeks, 11 weeks, 12 weeks, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months, or more.

    [3526] Methods of Treatment

    [3527] In some embodiments, methods for treating a subject having condition, disease or disorder in which a decrease or increase in NLRP3 activity (e.g., an increase, e.g., NLRP3 signaling) contributes to the pathology and/or symptoms and/or progression of the condition, disease or disorder are provided, comprising administering to a subject an effective amount of a chemical entity described herein (e.g., a compound described generically or specifically herein or a pharmaceutically acceptable salt thereof or compositions containing the same).

    [3528] Indications

    [3529] In some embodiments, the condition, disease or disorder is selected from: inappropriate host responses to infectious diseases where active infection exists at any body site, such as septic shock, disseminated intravascular coagulation, and/or adult respiratory distress syndrome; acute or chronic inflammation due to antigen, antibody and/or complement deposition; inflammatory conditions including arthritis, cholangitis, colitis, encephalitis, endocarditis, glomerulonephritis, hepatitis, myocarditis, pancreatitis, pericarditis, reperfusion injury and vasculitis, immune-based diseases such as acute and delayed hypersensitivity, graft rejection, and graft-versus-host disease; auto-immune diseases including Type 1 diabetes mellitus and multiple sclerosis. For example, the condition, disease or disorder may be an inflammatory disorder such as rheumatoid arthritis, osteoarthritis, septic shock, COPD and periodontal disease.

    [3530] In some embodiments, the condition, disease or disorder is an autoimmune diseases. Non-limiting examples include rheumatoid arthritis, systemic lupus erythematosus, multiple sclerosis, inflammatory bowel diseases (IBDs) comprising Crohn disease (CD) and ulcerative colitis (UC), which are chronic inflammatory conditions with polygenic susceptibility. In certain embodiments, the condition is an inflammatory bowel disease. In certain embodiments, the condition is Crohn's disease, autoimmune colitis, iatrogenic autoimmune colitis, ulcerative colitis, colitis induced by one or more chemotherapeutic agents, colitis induced by treatment with adoptive cell therapy, colitis associated by one or more alloimmune diseases (such as graft-vs-host disease, e.g., acute graft vs. host disease and chronic graft vs. host disease), radiation enteritis, collagenous colitis, lymphocytic colitis, microscopic colitis, and radiation enteritis. In certain of these embodiments, the condition is alloimmune disease (such as graft-vs-host disease, e.g., acute graft vs. host disease and chronic graft vs. host disease), celiac disease, irritable bowel syndrome, rheumatoid arthritis, lupus, scleroderma, psoriasis, cutaneous T-cell lymphoma, uveitis, and mucositis (e.g., oral mucositis, esophageal mucositis or intestinal mucositis).

    [3531] In some embodiments, the condition, disease or disorder is selected from major adverse cardiovascular events such as carbiovascular death, non-fatal myocardial infarction and non-fatal stroke in patients with a prior hear attack and inflammatory atherosclerosis (see for example, NCT01327846).

    [3532] In some embodiments, the condition, disease or disorder is selected from metabolic disorders such as type 2 diabetes, atherosclerosis, obesity and gout, as well as diseases of the central nervous system, such as Alzheimer's disease and multiple sclerosis and Amyotrophic Lateral Sclerosis and Parkinson disease, lung disease, such as asthma and COPD and pulmonary idiopathic fibrosis, liver disease, such as NASH syndrome, viral hepatitis and cirrhosis, pancreatic disease, such as acute and chronic pancreatitis, kidney disease, such as acute and chronic kidney injury, intestinal disease such as Crohn's disease and Ulcerative Colitis, skin disease such as psoriasis, musculoskeletal disease such as scleroderma, vessel disorders, such as giant cell arteritis, disorders of the bones, such as Osteoarthritis, osteoporosis and osteopetrosis disorders eye disease, such as glaucoma and macular degeneration, diseased caused by viral infection such as HIV and AIDS, autoimmune disease such as Rheumatoid Arthritis, Systemic Lupus Erythematosus, Autoimmune Thyroiditis, Addison's disease, pernicious anemia, cancer and aging.

    [3533] In some embodiments, the condition, disease or disorder is a cardiovascular indication. In some embodiments, the condition, disease or disorder is myocardial infraction. In some embodiments, the condition, disease or disorder is stroke.

    [3534] In some embodiments, the condition, disease or disorder is obesity.

    [3535] In some embodiments, the condition, disease or disorder is Type 2 Diabetes.

    [3536] In some embodiments, the condition, disease or disorder is NASH.

    [3537] In some embodiments, the condition, disease or disorder is Alzheimer's disease.

    [3538] In some embodiments, the condition, disease or disorder is gout.

    [3539] In some embodiments, the condition, disease or disorder is SLE.

    [3540] In some embodiments, the condition, disease or disorder is rheumatoid arthritis.

    [3541] In some embodiments, the condition, disease or disorder is IBD.

    [3542] In some embodiments, the condition, disease or disorder is multiple sclerosis.

    [3543] In some embodiments, the condition, disease or disorder is COPD.

    [3544] In some embodiments, the condition, disease or disorder is asthma.

    [3545] In some embodiments, the condition, disease or disorder is scleroderma.

    [3546] In some embodiments, the condition, disease or disorder is pulmonary fibrosis.

    [3547] In some embodiments, the condition, disease or disorder is age related macular degeneration (AMD).

    [3548] In some embodiments, the condition, disease or disorder is cystic fibrosis.

    [3549] In some embodiments, the condition, disease or disorder is Muckle Wells syndrome.

    [3550] In some embodiments, the condition, disease or disorder is familial cold autoinflammatory syndrome (FCAS).

    [3551] In some embodiments, the condition, disease or disorder is chronic neurologic cutaneous and articular syndrome.

    [3552] In some embodiments, the condition, disease or disorder is selected from: myelodysplastic syndromes (MDS); non-small cell lung cancer, such as non-small cell lung cancer in patients carrying mutation or overexpression of NLRP3; acute lymphoblastic leukemia (ALL), such as ALL in patients resistant to glucocorticoids treatment; Langerhan's cell histiocytosis (LCH); multiple myeloma; promyelocytic leukemia; acute myeloid leukemia (AML) chronic myeloid leukemia (CIVIL); gastric cancer; and lung cancer metastasis.

    [3553] In some embodiments, the condition, disease or disorder is selected from: myelodysplastic syndromes (MDS); non-small cell lung cancer, such as non-small cell lung cancer in patients carrying mutation or overexpression of NLRP3; acute lymphoblastic leukemia (ALL), such as ALL in patients resistant to glucocorticoids treatment; Langerhan's cell histiocytosis (LCH); multiple myeloma; promyelocytic leukemia; gastric cancer; and lung cancer metastasis.

    [3554] In some embodiments, the indication is MDS.

    [3555] In some embodiments, the indication is non-small lung cancer in patients carrying mutation or overexpression of NLRP3.

    [3556] In some embodiments, the indication is ALL in patients resistant to glucocorticoids treatment.

    [3557] In some embodiments, the indication is LCH.

    [3558] In some embodiments, the indication is multiple myeloma.

    [3559] In some embodiments, the indication is promyelocytic leukemia.

    [3560] In some embodiments, the indication is gastric cancer.

    [3561] In some embodiments, the indication is lung cancer metastasis.

    [3562] Combination Therapy

    [3563] This disclosure contemplates both monotherapy regimens as well as combination therapy regimens.

    [3564] In some embodiments, the methods described herein can further include administering one or more additional therapies (e.g., one or more additional therapeutic agents and/or one or more therapeutic regimens) in combination with administration of the compounds described herein.

    [3565] In certain embodiments, the second therapeutic agent or regimen is administered to the subject prior to contacting with or administering the chemical entity (e.g., about one hour prior, or about 6 hours prior, or about 12 hours prior, or about 24 hours prior, or about 48 hours prior, or about 1 week prior, or about 1 month prior).

    [3566] In other embodiments, the second therapeutic agent or regimen is administered to the subject at about the same time as contacting with or administering the chemical entity. By way of example, the second therapeutic agent or regimen and the chemical entity are provided to the subject simultaneously in the same dosage form. As another example, the second therapeutic agent or regimen and the chemical entity are provided to the subject concurrently in separate dosage forms.

    [3567] In still other embodiments, the second therapeutic agent or regimen is administered to the subject after contacting with or administering the chemical entity (e.g., about one hour after, or about 6 hours after, or about 12 hours after, or about 24 hours after, or about 48 hours after, or about 1 week after, or about 1 month after).

    [3568] Patient Selection

    [3569] In some embodiments, the methods described herein further include the step of identifying a subject (e.g., a patient) in need of treatment for an indication related to NLRP3 activity, such as an indication related to NLRP3 polymorphism.

    [3570] In some embodiments, the methods described herein further include the step of identifying a subject (e.g., a patient) in need of treatment for an indication related to NLRP3 activity, such as an indication related to NLRP3 where polymorphism is a gain of function

    [3571] In some embodiments, the methods described herein further include the step of identifying a subject (e.g., a patient) in need of treatment for an indication related to NLRP3 activity, such as an indication related to NLRP3 polymorphism found in CAPS syndromes.

    [3572] In some embodiments, the methods described herein further include the step of identifying a subject (e.g., a patient) in need of treatment for an indication related to NLRP3 activity, such as an indication related NLRP3 polymorphism where the polymorphism is VAR_014104 (R262W)

    [3573] In some embodiments, the methods described herein further include the step of identifying a subject (e.g., a patient) in need of treatment for an indication related to NLRP3 activity, such as an indication related NLRP3 polymorphism where the polymorphism is a natural variant reported in http://www.uniprot.org/uniprot/Q96P20.

    [3574] In some embodiments, the methods described herein further include the step of identifying a subject (e.g., a patient) in need of treatment for an indication related to NLRP3 activity, such as an indication related to point mutation of NLRP3 signaling.

    Anti-TNFα Agents

    [3575] The term “anti-TNFα agent” refers to an agent which directly or indirectly blocks, down-regulates, impairs, inhibits, impairs, or reduces TNFα activity and/or expression. In some embodiments, an anti-TNFα agent is an antibody or an antigen-binding fragment thereof, a fusion protein, a soluble TNFα receptor (a soluble tumor necrosis factor receptor superfamily member 1A (TNFR1) or a soluble tumor necrosis factor receptor superfamily 1B (TNFR2)), an inhibitory nucleic acid, or a small molecule TNFα antagonist. In some embodiments, the inhibitory nucleic acid is a ribozyme, small hairpin RNA, a small interfering RNA, an antisense nucleic acid, or an aptamer.

    [3576] Exemplary anti-TNFα agents that directly block, down-regulate, impair, inhibit, or reduce TNFα activity and/or expression can, e.g., inhibit or decrease the expression level of TNFα or a receptor of TNFα (TNFR1 or TNFR2) in a cell (e.g., a cell obtained from a subject, a mammalian cell), or inhibit or reduce binding of TNFα to its receptor (TNFR1 and/or TNFR2) and/or. Non-limiting examples of anti-TNFα agents that directly block, down-regulate, impair, inhibit, or reduce TNFα activity and/or expression include an antibody or fragment thereof, a fusion protein, a soluble TNFα receptor (e.g., a soluble TNFR1 or soluble TNFR2), inhibitory nucleic acids (e.g., any of the examples of inhibitory nucleic acids described herein), and a small molecule TNFα antagonist.

    [3577] Exemplary anti-TNFα agents that can indirectly block, down-regulate, impair, inhibitreduce TNFα activity and/or expression can, e.g., inhibit or decrease the level of downstream signaling of a TNFα receptor (e.g., TNFR1 or TNFR2) in a mammalian cell (e.g., decrease the level and/or activity of one or more of the following signaling proteins: AP-1, mitogen-activated protein kinase kinase kinase 5 (ASK1), inhibitor of nuclear factor kappa B (IKK), mitogen-activated protein kinase 8 (JNK), mitogen-activated protein kinase (MAPK), MEKK 1/4, MEKK 4/7, MEKK 3/6, nuclear factor kappa B (NF-κB), mitogen-activated protein kinase kinase kinase 14 (NIK), receptor interacting serine/threonine kinase 1 (RIP), TNFRSF1A associated via death domain (TRADD), and TNF receptor associated factor 2 (TRAF2), in a cell), and/or decrease the level of TNFa-induced gene expression in a mammalian cell (e.g., decrease the transcription of genes regulated by, e.g., one or more transcription factors selected from the group of activating transcription factor 2 (ATF2), c-Jun, and NF-κB). A description of downstream signaling of a TNFα receptor is provided in Wajant et al., Cell Death Differentiation 10:45-65, 2003 (incorporated herein by reference). For example, such indirect anti-TNFα agents can be an inhibitory nucleic acid that targets (decreases the expression) a signaling component downstream of a TNFa-induced gene (e.g., any TNFa-induced gene known in the art), a TNFα receptor (e.g., any one or more of the signaling components downstream of a TNFα receptor described herein or known in the art), or a transcription factor selected from the group of NF-κB, c-Jun, and ATF2.

    [3578] In other examples, such indirect anti-TNFα agents can be a small molecule inhibitor of a protein encoded by a TNFα-induced gene (e.g., any protein encoded by a TNFα-induced gene known in the art), a small molecule inhibitor of a signaling component downstream of a TNFα receptor (e.g., any of the signaling components downstream of a TNFα receptor described herein or known in the art), and a small molecule inhibitor of a transcription factor selected from the group of ATF2, c-Jun, and NF-κB.

    [3579] In other embodiments, anti-TNFα agents that can indirectly block, down-regulate, impair, or reduce one or more components in a cell (e.g., a cell obtained from a subject, a mammalian cell) that are involved in the signaling pathway that results in TNFα mRNA transcription, TNFα mRNA stabilization, and TNFα mRNA translation (e.g., one or more components selected from the group of CD14, c-Jun, ERK1/2, IKK, IxB, interleukin 1 receptor associated kinase 1 (IRAK), JNK, lipopolysaccharide binding protein (LBP), MEK1/2, MEK3/6, MEK4/7, MK2, MyD88, NF-κB, NIK, PKR, p38, AKT serine/threonine kinase 1 (rac), raf kinase (raf), ras, TRAF6, TTP). For example, such indirect anti-TNFα agents can be an inhibitory nucleic acid that targets (decreases the expression) of a component in a mammalian cell that is involved in the signaling pathway that results in TNFα mRNA transcription, TNFα mRNA stabilization, and TNFα mRNA translation (e.g., a component selected from the group of CD14, c-Jun, ERK1/2, IKK, IκB, IRAK, JNK, LBP, MEK1/2, MEK3/6, MEK4/7, MK2, MyD88, NF-κB, NIK, IRAK, lipopolysaccharide binding protein (LBP), PKR, p38, rac, raf, ras, TRAF6, TTP). In other examples, an indirect anti-TNFα agents is a small molecule inhibitor of a component in a mammalian cell that is involved in the signaling pathway that results in TNFα mRNA transcription, TNFα mRNA stabilization, and TNFα mRNA translation (e.g., a component selected from the group of CD14, c-Jun, ERK1/2, IKK, IκB, IRAK, JNK, lipopolysaccharide binding protein (LBP), MEK1/2, MEK3/6, MEK4/7, MK2, MyD88, NF-κB, NIK, IRAK, lipopolysaccharide binding protein (LBP), PKR, p38, rac, raf, ras, TRAF6, TTP).

    Antibodies

    [3580] In some embodiments, the anti-TNFα agent is an antibody or an antigen-binding fragment thereof (e.g., a Fab or a scFv). In some embodiments, an antibody or antigen-binding fragment of an antibody described herein can bind specifically to TNFα. In some embodiments, an antibody or antigen-binding fragment described herein binds specifically to any one of TNFα, TNFR1, or TNFR2. In some embodiments, an antibody or antigen-binding fragment of an antibody described herein can bind specifically to a TNFα receptor (TNFR1 or TNFR2).

    [3581] In some embodiments, the antibody can be a humanized antibody, a chimeric antibody, a multivalent antibody, or a fragment thereof. In some embodiments, an antibody can be a scFv-Fc, a VHH domain, a VNAR domain, a (scFv).sub.2, a minibody, or a BiTE.

    [3582] In some embodiments, an antibody can be a crossmab, a diabody, a scDiabody, a scDiabody-CH3, a Diabody-CH3, a DutaMab, a DT-IgG, a diabody-Fc, a scDiabody-HAS, a charge pair antibody, a Fab-arm exchange antibody, a SEEDbody, a Triomab, a LUZ-Y, a Fcab, a kλ-body, an orthogonal Fab, a DVD-IgG, an IgG(H)-scFv, a scFv-(H)IgG, an IgG(L)-scFv, a scFv-(L)-IgG, an IgG (L,H)-Fc, an IgG(H)-V, a V(H)-IgG, an IgG(L)-V, a V(L)-IgG, an KIH IgG-scFab, a 2 scFv-IgG, an IgG-2 scFv, a scFv4-Ig, a Zybody, a DVI-IgG, a nanobody, a nanobody-HSA, a DVD-Ig, a dual-affinity re-targeting antibody (DART), a triomab, a kih IgG with a common LC, an ortho-Fab IgG, a 2-in-1-IgG, IgG-ScFv, scFv2-Fc, a bi-nanobody, tanden antibody, a DART-Fc, a scFv-HAS-scFv, a DAF (two-in-one or four-in-one), a DNL-Fab3, knobs-in-holes common LC, knobs-in-holes assembly, a TandAb, a Triple Body, a miniantibody, a minibody, a TriBi minibody, a scFv-CH.sub.3 KIH, a Fab-scFv, a scFv-CH-CL-scFv, a F(ab′).sub.2-scFV2, a scFv-KIH, a Fab-scFv-Fc, a tetravalent HCAb, a scDiabody-Fc, a tandem scFv-Fc, an intrabody, a dock and lock bispecific antibody, an ImmTAC, a HSAbody, a tandem scFv, an IgG-IgG, a Cov-X-Body, and a scFv1-PEG-scFv2.

    [3583] Non-limiting examples of an antigen-binding fragment of an antibody include an Fv fragment, a Fab fragment, a F(ab′).sub.2 fragment, and a Fab′ fragment. Additional examples of an antigen-binding fragment of an antibody is an antigen-binding fragment of an antigen-binding fragment of an IgA (e.g., an antigen-binding fragment of IgA1 or IgA2) (e.g., an antigen-binding fragment of a human or humanized IgA, e.g., a human or humanized IgA1 or IgA2); an antigen-binding fragment of an IgD (e.g., an antigen-binding fragment of a human or humanized IgD); an antigen-binding fragment of an IgE (e.g., an antigen-binding fragment of a human or humanized IgE); an IgG (e.g., an antigen-binding fragment of IgG1, IgG2, IgG3, or IgG4) (e.g., an antigen-binding fragment of a human or humanized IgG, e.g., human or humanized IgG1, IgG2, IgG3, or IgG4); or an antigen-binding fragment of an IgM (e.g., an antigen-binding fragment of a human or humanized IgM).

    [3584] Non-limiting examples of anti-TNFα agents that are antibodies that specifically bind to TNFα are described in Ben-Horin et al., Autoimmunity Rev. 13(1):24-30, 2014; Bongartz et al., JAMA 295(19):2275-2285, 2006; Butler et al., Eur. Cytokine Network 6(4):225-230, 1994; Cohen et al., Canadian J Gastroenterol. Hepatol. 15(6):376-384, 2001; Elliott et al., Lancet 1994; 344: 1125-1127, 1994; Feldmann et al., Ann. Rev. Immunol. 19(1):163-196, 2001; Rankin et al., Br. J Rheumatol. 2:334-342, 1995; Knight et al., Molecular Immunol. 30(16):1443-1453, 1993; Lorenz et al., J. Immunol. 156(4):1646-1653, 1996; Hinshaw et al., Circulatory Shock 30(3):279-292, 1990; Ordas et al., Clin. Pharmacol. Therapeutics 91(4):635-646, 2012; Feldman, Nature Reviews Immunol. 2(5):364-371, 2002; Taylor et al., Nature Reviews Rheumatol. 5(10):578-582, 2009; Garces et al., Annals Rheumatic Dis. 72(12):1947-1955, 2013; Palladino et al., Nature Rev. Drug Discovery 2(9):736-746, 2003; Sandborn et al., Inflammatory Bowel Diseases 5(2):119-133, 1999; Atzeni et al., Autoimmunity Reviews 12(7):703-708, 2013; Maini et al., Immunol. Rev. 144(1):195-223, 1995; Wanner et al., Shock 11(6):391-395, 1999; and U.S. Pat. Nos. 6,090,382; 6,258,562; and 6,509,015).

    [3585] In certain embodiments, the anti-TNFα agent can include or is golimumab (Golimumab™), adalimumab (Humira™), infliximab (Remicade™), CDP571, CDP 870, or certolizumab pegol (Cimzia™). In certain embodiments, the anti-TNFα agent can be a TNFα inhibitor biosimilar. Examples of approved and late-phase TNFα inhibitor biosimilars include, but are not limited to, infliximab biosimilars such as Flixabi™ (SB2) from Samsung Bioepis, Inflectra® (CT-P13) from Celltrion/Pfizer, GS071 from Aprogen, Remsima™, PF-06438179 from Pfizer/Sandoz, NI-071 from Nichi-Iko Pharmaceutical Co., and ABP 710 from Amgen; adalimumab biosimilars such as Amgevita® (ABP 501) from Amgen and Exemptia™ from Zydus Cadila, BMO-2 or MYL-1401-A from Biocon/Mylan, CHS-1420 from Coherus, FKB327 from Kyowa Kirin, and BI 695501 from Boehringer Ingelheim; Solymbic®, SB5 from Samsung Bioepis, GP-2017 from Sandoz, ONS-3010 from Oncobiologics, M923 from Momenta, PF-06410293 from Pfizer, and etanercept biosimilars such as Erelzi™ from Sandoz/Novartis, Brenzys™ (SB4) from Samsung Bioepis, GP2015 from Sandoz, TuNEX® from Mycenax, LBEC0101 from LG Life, and CHS-0214 from Coherus.

    [3586] In some embodiments of any of the methods described herein, the anti-TNFα agent is selected from the group consisting of: adalimumab, certolizumab, etanercept, golimumab, infliximabm, CDP571, and CDP 870.

    [3587] In some embodiments, any of the antibodies or antigen-binding fragments described herein has a dissociation constant (K.sub.D) of less than 1×10.sup.−5M (e.g., less than 0.5×10.sup.−5M, less than 1×10.sup.−6 M, less than 0.5×10.sup.−6 M, less than 1×10.sup.−7M, less than 0.5×10.sup.−7M, less than 1×10.sup.−8M, less than 0.5×10.sup.−8M, less than 1×10.sup.−9M, less than 0.5×10.sup.−9M, less than 1×10.sup.−10 M, less than 0.5×10.sup.−10 M, less than 1×10.sup.−11 M less than 0.5×10.sup.−11 M, or less than 1×10.sup.−12M), e.g., as measured in phosphate buffered saline using surface plasmon resonance (SPR).

    [3588] In some embodiments, any of the antibodies or antigen-binding fragments described herein has a K.sub.D of about 1×10.sup.−12M to about 1×10.sup.−5M, about 0.5×10.sup.−5M, about 1×10.sup.−6 M, about 0.5×10.sup.−6 M, about 1×10.sup.−7M, about 0.5×10.sup.−7M, about 1×10.sup.−8M, about 0.5×10.sup.−8M, about 1×10.sup.−9M, about 0.5×10.sup.−9M, about 1×10.sup.−10 M about 0.5×10.sup.−10 M, about 1×10.sup.−11M, or about 0.5×10.sup.−11M (inclusive); about 0.5×10.sup.−11M to about 1×10.sup.−5M, about 0.5×10.sup.−5M, about 1×10.sup.−6 M, about 0.5×10.sup.−6 M, about 1×10.sup.−7M, about 0.5×10.sup.−7M, about 1×10.sup.−8M, about 0.5×10.sup.−8M, about 1×10.sup.−9M, about 0.5×10.sup.−9M, about 1×10.sup.−10 M, about 0.5×10.sup.−10 M, or about 1×10.sup.−11M (inclusive); about 1×10.sup.−11M to about 1×10.sup.−5M, about 0.5×10.sup.−5M, about 1×10.sup.−6 M, about 0.5×10.sup.−6 M, about 1×10.sup.−7M, about 0.5×10.sup.−7M, about 1×10.sup.−8M, about 0.5×10.sup.−8M, about 1×10.sup.−9M, about 0.5×10.sup.−9M, about 1×10.sup.−10 M, or about 0.5×10.sup.−10 M (inclusive); about 0.5×10.sup.−10 M to about 1×10.sup.−5M, about 0.5×10.sup.−5M, about 1×10.sup.−6 M, about 0.5×10.sup.−6 M, about 1×10.sup.−7M, about 0.5×10.sup.−7M, about 1×10.sup.−8M, about 0.5×10.sup.−8M, about 1×10.sup.−9M, about 0.5×10.sup.−9M, or about 1×10.sup.−10 M (inclusive); about 1×10.sup.−10 M to about 1×10.sup.−5M, about 0.5×10.sup.−5 M, about 1×10.sup.−6 M, about 0.5×10.sup.−6 M, about 1×10.sup.−7M, about 0.5×10.sup.−7M, about 1×10.sup.−8M, about 0.5×10.sup.−8M, about 1×10.sup.−9M, or about 0.5×10.sup.−9M (inclusive); about 0.5×10.sup.−9M to about 1×10.sup.−5M, about 0.5×10.sup.−5M, about 1×10.sup.−6 M, about 0.5×10.sup.−6 M, about 1×10.sup.−7M, about 0.5×10.sup.−7M, about 1×10.sup.−8M, about 0.5×10.sup.−8M, or about 1×10.sup.−9M (inclusive); about 1×10.sup.−9M to about 1×10.sup.−5M, about 0.5×10.sup.−5M, about 1×10.sup.−6 M, about 0.5×10.sup.−6 M, about 1×10.sup.−7M, about 0.5×10.sup.−7M, about 1×10.sup.−8M, or about 0.5×10.sup.−8M (inclusive); about 0.5×10.sup.−8 M to about 1×10.sup.−5M, about 0.5×10.sup.−5M, about 1×10.sup.−6 M, about 0.5×10.sup.−6 M, about 1×10.sup.−7 M, about 0.5×10.sup.−7M, or about 1×10.sup.−8M (inclusive); about 1×10.sup.−8M to about 1×10.sup.−5M, about 0.5×10.sup.−5M, about 1×10.sup.−6 M, about 0.5×10.sup.−6 M, about 1×10.sup.−7M, or about 0.5×10.sup.−7M (inclusive); about 0.5×10.sup.−7 M to about 1×10.sup.−5M, about 0.5×10.sup.−5 M, about 1×10.sup.−6 M, about 0.5×10.sup.−6 M, or about 1×10.sup.−7M (inclusive); about 1×10.sup.−7 M to about 1×10.sup.−5M, about 0.5×10.sup.−5 M, about 1×10.sup.−6 M, or about 0.5×10.sup.−6 M (inclusive); about 0.5×10.sup.−6 M to about 1×10.sup.−5 M, about 0.5×10.sup.−5 M, or about 1×10.sup.−6 M (inclusive); about 1×10.sup.−6 M to about 1×10.sup.−5M or about 0.5×10.sup.−5 M (inclusive); or about 0.5×10.sup.−5M to about 1×10.sup.−5M (inclusive), e.g., as measured in phosphate buffered saline using surface plasmon resonance (SPR).

    [3589] In some embodiments, any of the antibodies or antigen-binding fragments described herein has a K.sub.off of about 1×10.sup.−6 s.sup.−1 to about 1×10.sup.−3 s.sup.−1, about 0.5×10.sup.−3 s.sup.−1, about 1×10's.sup.−1, about 0.5×10.sup.−4 s.sup.−1, about 1×10.sup.−5 s.sup.−1, or about 0.5×10.sup.−5 s.sup.−1 (inclusive); about 0.5×10.sup.−5 s.sup.−1 to about 1×10.sup.−3 s.sup.−1, about 0.5×10.sup.−3 s.sup.−1, about 1×10's.sup.−1, about 0.5×10's.sup.−1, or about 1×10.sup.−5 s.sup.−1 (inclusive); about 1×10.sup.−5 s.sup.−1 to about 1×10.sup.−3 s.sup.−1, about 0.5×10.sup.−3 s.sup.−1, about 1×10's.sup.−1, or about 0.5×10.sup.−4 s.sup.−1 (inclusive); about 0.5×10's.sup.−1 to about 1×10.sup.−3 s.sup.−1, about 0.5×10.sup.−3 s.sup.−1, or about 1×10.sup.−4 s.sup.−1 (inclusive); about 1×10's.sup.−1 to about 1×10.sup.−3 s.sup.−1, or about 0.5×10.sup.−3 s.sup.−1 (inclusive); or about 0.5×10.sup.−5 s.sup.−1 to about 1×10.sup.−3 s.sup.−1 (inclusive), e.g., as measured in phosphate buffered saline using surface plasmon resonance (SPR).

    [3590] In some embodiments, any of the antibodies or antigen-binding fragments described herein has a K.sub.on of about 1×10.sup.2 M.sup.−1 s.sup.−1 to about 1×10.sup.6M.sup.−1 s.sup.−1, about 0.5×10.sup.6 M.sup.−1 s.sup.−1, about 1×10.sup.5M.sup.−1 s.sup.−1, about 0.5×10.sup.5 M.sup.−1 s.sup.−1, about 1×10.sup.4 M.sup.−1, s.sup.−1 about 0.5×10.sup.4 M.sup.−1 s.sup.−1, about 1×10.sup.3 M.sup.−1 s.sup.−1, or about 0.5×10.sup.3 M.sup.−1 s.sup.−1 (inclusive); about 0.5×10.sup.3 M.sup.−1 s.sup.−1 to about 1×10.sup.6M.sup.−1 s.sup.−1, about 0.5×10.sup.6 M.sup.−1, s.sup.−1 about 1×10.sup.5M.sup.−1 s.sup.−1, about 0.5×10.sup.5 M.sup.−1 s.sup.−1, about 1×10.sup.4 M.sup.−1 s.sup.−1, about 0.5×10.sup.4 M.sup.−1 s.sup.−1, or about 1×10.sup.3 M.sup.−1 s.sup.−1 (inclusive); about 1×10.sup.3 M.sup.−1 s.sup.−1 to about 1×10.sup.6M.sup.−1 s.sup.−1, about 0.5×10.sup.6M.sup.−1 s.sup.−1 about 1×10.sup.5M.sup.−1 s.sup.−1, about 0.5×10.sup.5 M.sup.−1 s.sup.−1, about 1×10.sup.4 M.sup.−1 s.sup.−1, or about 0.5×10.sup.4 M.sup.−1 s.sup.−1 (inclusive); about 0.5×10.sup.4 M.sup.−1 s.sup.−1 to about 1×10.sup.6M.sup.−1 s.sup.−1, about 0.5×10.sup.6 M.sup.−1 s.sup.−1, about 1×10.sup.5M.sup.−1 s.sup.−1, about 0.5×10.sup.5 M.sup.−1 s.sup.−1, or about 1×10.sup.4M.sup.−1 s.sup.−1 (inclusive); about 1×10.sup.4 M.sup.−1 s.sup.−1 to about 1×10.sup.6 M.sup.−1 s.sup.−1, about 0.5×10.sup.6 M.sup.−1 s.sup.−1, about 1×10.sup.5M.sup.−1 s.sup.−1, or about 0.5×10.sup.5 M.sup.−1 s.sup.−1 (inclusive); about 0.5×10.sup.5 M.sup.−1 s.sup.−1 to about 1×10.sup.6 M.sup.−1 s.sup.−1, about 0.5×10.sup.6 M.sup.−1 s.sup.−1, or about 1×10.sup.5 M.sup.−1 s.sup.−1 (inclusive); about 1×10.sup.5M.sup.−1 s.sup.−1 to about 1×10.sup.6M.sup.−1 s.sup.−1, or about 0.5×10.sup.6 M.sup.−1 s.sup.−1 (inclusive); or about 0.5×10.sup.6 M.sup.−1 s.sup.−1 to about 1×10.sup.6M.sup.−1 s.sup.−1 (inclusive), e.g., as measured in phosphate buffered saline using surface plasmon resonance (SPR).

    Fusion Proteins

    [3591] In some embodiments, the anti-TNFα agent is a fusion protein (e.g., an extracellular domain of a TNFR fused to a partner peptide, e.g., an Fc region of an immunoglobulin, e.g., human IgG) (see, e.g., Deeg et al., Leukemia 16(2):162, 2002; Peppel et al., J. Exp. Med. 174(6):1483-1489, 1991) or a soluble TNFR (e.g., TNFR1 or TNFR2) that binds specifically to TNFα. In some embodiments, the anti-TNFα agent includes or is a soluble TNFα receptor (e.g., Bjornberg et al., Lymphokine Cytokine Res. 13(3):203-211, 1994; Kozak et al., Am. J. Physiol. Reg. Integrative Comparative Physiol. 269(1):R23-R29, 1995; Tsao et al., Eur Respir 14(3):490-495, 1999; Watt et al., J Leukoc Biol. 66(6):1005-1013, 1999; Mohler et al., J. Immunol. 151(3):1548-1561, 1993; Nophar et al., EMBO J 9(10):3269, 1990; Piguet et al., Eur. Respiratory 7(3):515-518, 1994; and Gray et al., Proc. Natl. Acad. Sci. U.S.A. 87(19):7380-7384, 1990). In some embodiments, the anti-TNFα agent includes or is etanercept (Enbrel™) (see, e.g., WO 91/03553 and WO 09/406,476, incorporated by reference herein). In some embodiments, the anti-TNFα agent inhibitor includes or is r-TBP-I (e.g., Gradstein et al., J. Acquir. Immune Defic. Syndr. 26(2): 111-117, 2001).

    Inhibitory Nucleic Acids

    [3592] Inhibitory nucleic acids that can decrease the expression of AP-1, ASK1, CD14, c-jun, ERK1/2, IκB, IKK, IRAK, JNK, LBP, MAPK, MEK1/2, MEKK1/4, MEKK4/7, MEKK 3/6, MK2, MyD88, NF-κB, NIK, p38, PKR, rac, ras, raf, RIP, TNFα, TNFR1, TNFR2, TRADD, TRAF2, TRAF6, or TTP mRNA expression in a mammalian cell include antisense nucleic acid molecules, i.e., nucleic acid molecules whose nucleotide sequence is complementary to all or part of a AP-1, ASK1, CD14, c-jun, ERK1/2, IκB, IKK, IRAK, JNK, LBP, MAPK, MEK1/2, MEKK1/4, MEKK4/7, MEKK 3/6, MK2, MyD88, NF-κB, NIK, p38, PKR, rac, ras, raf, RIP, TNFα, TNFR1, TNFR2, TRADD, TRAF2, TRAF6, or TTP mRNA (e.g., complementary to all or a part of any one of SEQ ID NOs: 1-37).

    TABLE-US-00008 Human TNFα CDS (SEQ ID NO: 1) ATGAGCACTGAAAGCATGATCCGGGACGTGGAGCTGGCCGAGGAGGCGC TCCCCAAGAAGACAGGGGGGCCCCAGGGCTCCAGGCGGTGCTTGTTCCT CAGCCTCTTCTCCTTCCTGATCGTGGCAGGCGCCACCACGCTCTTCTGC CTGCTGCACTTTGGAGTGATCGGCCCCCAGAGGGAAGAGTTCCCCAGGG ACCTCTCTCTAATCAGCCCTCTGGCCCAGGCAGTCAGATCATCTTCTCG AACCCCGAGTGACAAGCCTGTAGCCCATGTTGTAGCAAACCCTCAAGCT GAGGGGCAGCTCCAGTGGCTGAACCGCCGGGCCAATGCCCTCCTGGCCA ATGGCGTGGAGCTGAGAGATAACCAGCTGGTGGTGCCATCAGAGGGCCT GTACCTCATCTACTCCCAGGTCCTCTTCAAGGGCCAAGGCTGCCCCTCC ACCCATGTGCTCCTCACCCACACCATCAGCCGCATCGCCGTCTCCTACC AGACCAAGGTCAACCTCCTCTCTGCCATCAAGAGCCCCTGCCAGAGGGA GACCCCAGAGGGGGCTGAGGCCAAGCCCTGGTATGAGCCCATCTATCTG GGAGGGGTCTTCCAGCTGGAGAAGGGTGACCGACTCAGCGCTGAGATCA ATCGGCCCGACTATCTCGACTTTGCCGAGTCTGGGCAGGTCTACTTTGG GATCATTGCCCTGTGA Human TNFR1 CDS (SEQ ID NO: 2) ATGGGCCTCTCCACCGTGCCTGACCTGCTGCTGCCACTGGTGCTCCTGG AGCTGTTGGTGGGAATATACCCCTCAGGGGTTATTGGACTGGTCCCTCA CCTAGGGGACAGGGAGAAGAGAGATAGTGTGTGTCCCCAAGGAAAATAT ATCCACCCTCAAAATAATTCGATTTGCTGTACCAAGTGCCACAAAGGAA CCTACTTGTACAATGACTGTCCAGGCCCGGGGCAGGATACGGACTGCAG GGAGTGTGAGAGCGGCTCCTTCACCGCTTCAGAAAACCACCTCAGACAC TGCCTCAGCTGCTCCAAATGCCGAAAGGAAATGGGTCAGGTGGAGATCT CTTCTTGCACAGTGGACCGGGACACCGTGTGTGGCTGCAGGAAGAACCA GTACCGGCATTATTGGAGTGAAAACCTTTTCCAGTGCTTCAATTGCAGC CTCTGCCTCAATGGGACCGTGCACCTCTCCTGCCAGGAGAAACAGAACA CCGTGTGCACCTGCCATGCAGGTTTCTTTCTAAGAGAAAACGAGTGTGT CTCCTGTAGTAACTGTAAGAAAAGCCTGGAGTGCACGAAGTTGTGCCTA CCCCAGATTGAGAATGTTAAGGGCACTGAGGACTCAGGCACCACAGTGC TGTTGCCCCTGGTCATTTTCTTTGGTCTTTGCCTTTTATCCCTCCTCTT CATTGGTTTAATGTATCGCTACCAACGGTGGAAGTCCAAGCTCTACTCC ATTGTTTGTGGGAAATCGACACCTGAAAAAGAGGGGGAGCTTGAAGGAA CTACTACTAAGCCCCTGGCCCCAAACCCAAGCTTCAGTCCCACTCCAGG CTTCACCCCCACCCTGGGCTTCAGTCCCGTGCCCAGTTCCACCTTCACC TCCAGCTCCACCTATACCCCCGGTGACTGTCCCAACTTTGCGGCTCCCC GCAGAGAGGTGGCACCACCCTATCAGGGGGCTGACCCCATCCTTGCGAC AGCCCTCGCCTCCGACCCCATCCCCAACCCCCTTCAGAAGTGGGAGGAC AGCGCCCACAAGCCACAGAGCCTAGACACTGATGACCCCGCGACGCTGT ACGCCGTGGTGGAGAACGTGCCCCCGTTGCGCTGGAAGGAATTCGTGCG GCGCCTAGGGCTGAGCGACCACGAGATCGATCGGCTGGAGCTGCAGAAC GGGCGCTGCCTGCGCGAGGCGCAATACAGCATGCTGGCGACCTGGAGGC GGCGCACGCCGCGGCGCGAGGCCACGCTGGAGCTGCTGGGACGCGTGCT CCGCGACATGGACCTGCTGGGCTGCCTGGAGGACATCGAGGAGGCGCTT TGCGGCCCCGCCGCCCTCCCGCCCGCGCCCAGTCTTCTCAGATGA Human TNFR2 CDS (SEQ ID NO: 3) ATTCTTCCCCTGGTGGCCATGGGACCCAGGTCAATGTCACCTGCATCGT GAACGTCTGTAGCAGCTCTGACCACAGCTCACAGTGCTCCTCCCAAGCC AGCTCCACAATGGGAGACACAGATTCCAGCCCCTCGGAGTCCCCGAAGG ACGAGCAGGTCCCCTTCTCCAAGGAGGAATGTGCCTTTCGGTCACAGCT GGAGACGCCAGAGACCCTGCTGGGGAGCACCGAAGAGAAGCCCCTGCCC CTTGGAGTGCCTGATGCTGGGATGAAGCCCAGTTAA Human TRADD CDS (SEQ ID NO: 4) ATGGCAGCTGGGCAAAATGGGCACGAAGAGTGGGTGGGCAGCGCATACC TGTTTGTGGAGTCCTCGCTGGACAAGGTGGTCCTGTCGGATGCCTACGC GCACCCCCAGCAGAAGGTGGCAGTGTACAGGGCTCTGCAGGCTGCCTTG GCAGAGAGCGGCGGGAGCCCGGACGTGCTGCAGATGCTGAAGATCCACC GCAGCGACCCGCAGCTGATCGTGCAGCTGCGATTCTGCGGGCGGCAGCC CTGTGGCCGCTTCCTCCGCGCCTACCGCGAGGGGGCGCTGCGCGCCGCG CTGCAGAGGAGCCTGGCGGCCGCGCTCGCCCAGCACTCGGTGCCGCTGC AACTGGAGCTGCGCGCCGGCGCCGAGCGGCTGGACGCTTTGCTGGCGGA CGAGGAGCGCTGTTTGAGTTGCATCCTAGCCCAGCAGCCCGACCGGCTC CGGGATGAAGAACTGGCTGAGCTGGAGGATGCGCTGCGAAATCTGAAGT GCGGCTCGGGGGCCCGGGGTGGCGACGGGGAGGTCGCTTCGGCCCCCTT GCAGCCCCCGGTGCCCTCTCTGTCGGAGGTGAAGCCGCCGCCGCCGCCG CCACCTGCCCAGACTTTTCTGTTCCAGGGTCAGCCTGTAGTGAATCGGC CGCTGAGCCTGAAGGACCAACAGACGTTCGCGCGCTCTGTGGGTCTCAA ATGGCGCAAGGTGGGGCGCTCACTGCAGCGAGGCTGCCGGGCGCTGCGG GACCCGGCGCTGGACTCGCTGGCCTACGAGTACGAGCGCGAGGGACTGT ACGAGCAGGCCTTCCAGCTGCTGCGGCGCTTCGTGCAGGCCGAGGGCCG CCGCGCCACGCTGCAGCGCCTGGTGGAGGCACTCGAGGAGAACGAGCTC ACCAGCCTGGCAGAGGACTTGCTGGGCCTGACCGATCCCAATGGCGGCC TGGCCTAG Human TRAF2 CDS (SEQ ID NO: 5) ATGGCTGCAGCTAGCGTGACCCCCCCTGGCTCCCTGGAGTTGCTACAGC CCGGCTTCTCCAAGACCCTCCTGGGGACCAAGCTGGAAGCCAAGTACCT GTGCTCCGCCTGCAGAAACGTCCTCCGCAGGCCCTTCCAGGCGCAGTGT GGCCACCGGTACTGCTCCTTCTGCCTGGCCAGCATCCTCAGCTCTGGGC CTCAGAACTGTGCTGCCTGTGTTCACGAGGGCATATATGAAGAAGGCAT TTCTATTTTAGAAAGCAGTTCGGCCTTCCCAGATAATGCTGCCCGCAGG GAGGTGGAGAGCCTGCCGGCCGTCTGTCCCAGTGATGGATGCACCTGGA AGGGGACCCTGAAAGAATACGAGAGCTGCCACGAAGGCCGCTGCCCGCT CATGCTGACCGAATGTCCCGCGTGCAAAGGCCTGGTCCGCCTTGGTGAA AAGGAGCGCCACCTGGAGCACGAGTGCCCGGAGAGAAGCCTGAGCTGCC GGCATTGCCGGGCACCCTGCTGCGGAGCAGACGTGAAGGCGCACCACGA GGTCTGCCCCAAGTTCCCCTTAACTTGTGACGGCTGCGGCAAGAAGAAG ATCCCCCGGGAGAAGTTTCAGGACCACGTCAAGACTTGTGGCAAGTGTC GAGTCCCTTGCAGATTCCACGCCATCGGCTGCCTCGAGACGGTAGAGGG TGAGAAACAGCAGGAGCACGAGGTGCAGTGGCTGCGGGAGCACCTGGCC ATGCTACTGAGCTCGGTGCTGGAGGCAAAGCCCCTCTTGGGAGACCAGA GCCACGCGGGGTCAGAGCTCCTGCAGAGGTGCGAGAGCCTGGAGAAGAA GACGGCCACTTTTGAGAACATTGTCTGCGTCCTGAACCGGGAGGTGGAG AGGGTGGCCATGACTGCCGAGGCCTGCAGCCGGCAGCACCGGCTGGACC AAGACAAGATTGAAGCCCTGAGTAGCAAGGTGCAGCAGCTGGAGAGGAG CATTGGCCTCAAGGACCTGGCGATGGCTGACTTGGAGCAGAAGGTCTTG GAGATGGAGGCATCCACCTACGATGGGGTCTTCATCTGGAAGATCTCAG ACTTCGCCAGGAAGCGCCAGGAAGCTGTGGCTGGCCGCATACCCGCCAT CTTCTCCCCAGCCTTCTACACCAGCAGGTACGGCTACAAGATGTGTCTG CGTATCTACCTGAACGGCGACGGCACCGGGCGAGGAACACACCTGTCCC TCTTCTTTGTGGTGATGAAGGGCCCGAATGACGCCCTGCTGCGGTGGCC CTTCAACCAGAAGGTGACCTTAATGCTGCTCGACCAGAATAACCGGGAG CACGTGATTGACGCCTTCAGGCCCGACGTGACTTCATCCTCTTTTCAGA GGCCAGTCAACGACATGAACATCGCAAGCGGCTGCCCCCTCTTCTGCCC CGTCTCCAAGATGGAGGCAAAGAATTCCTACGTGCGGGACGATGCCATC TTCATCAAGGCCATTGTGGACCTGACAGGGCTCTAA Human AP-1 CDS (SEQ ID NO: 6) ATGGAAACACCCTTCTACGGCGATGAGGCGCTGAGCGGCCTGGGCGGCG GCGCCAGTGGCAGCGGCGGCAGCTTCGCGTCCCCGGGCCGCTTGTTCCC CGGGGCGCCCCCGACGGCCGCGGCCGGCAGCATGATGAAGAAGGACGCG CTGACGCTGAGCCTGAGTGAGCAGGTGGCGGCAGCGCTCAAGCCTGCGG CCGCGCCGCCTCCTACCCCCCTGCGCGCCGACGGCGCCCCCAGCGCGGC ACCCCCCGACGGCCTGCTCGCCTCTCCCGACCTGGGGCTGCTGAAGCTG GCCTCCCCCGAGCTCGAGCGCCTCATCATCCAGTCCAACGGGCTGGTCA CCACCACGCCGACGAGCTCACAGTTCCTCTACCCCAAGGTGGCGGCCAG CGAGGAGCAGGAGTTCGCCGAGGGCTTCGTCAAGGCCCTGGAGGATTTA CACAAGCAGAACCAGCTCGGCGCGGGCGCGGCCGCTGCCGCCGCCGCCG CCGCCGCCGGGGGGCCCTCGGGCACGGCCACGGGCTCCGCGCCCCCCGG CGAGCTGGCCCCGGCGGCGGCCGCGCCCGAAGCGCCTGTCTACGCGAAC CTGAGCAGCTACGCGGGCGGCGCCGGGGGCGCGGGGGGCGCCGCGACGG TCGCCTTCGCTGCCGAACCTGTGCCCTTCCCGCCGCCGCCACCCCCAGG CGCGTTGGGGCCGCCGCGCCTGGCTGCGCTCAAGGACGAGCCACAGACG GTGCCCGACGTGCCGAGCTTCGGCGAGAGCCCGCCGTTGTCGCCCATCG ACATGGACACGCAGGAGCGCATCAAGGCGGAGCGCAAGCGGCTGCGCAA CCGCATCGCCGCCTCCAAGTGCCGCAAGCGCAAGCTGGAGCGCATCTCG CGCCTGGAAGAGAAAGTGAAGACCCTCAAGAGTCAGAACACGGAGCTGG CGTCCACGGCGAGCCTGCTGCGCGAGCAGGTGGCGCAGCTCAAGCAGAA AGTCCTCAGCCACGTCAACAGCGGCTGCCAGCTGCTGCCCCAGCACCAG GTGCCCGCGTACTGA Human ASK1 CDS (SEQ ID NO: 7) ATGAGCACGGAGGCGGACGAGGGCATCACTTTCTCTGTGCCACCCTTCG CCCCCTCGGGCTTCTGCACCATCCCCGAGGGCGGCATCTGCAGGAGGGG AGGAGCGGCGGCGGTGGGCGAGGGCGAGGAGCACCAGCTGCCACCGCCG CCGCCGGGCAGTTTCTGGAACGTGGAGAGCGCCGCTGCCCCTGGCATCG GTTGTCCGGCGGCCACCTCCTCGAGCAGTGCCACCCGAGGCCGGGGCAG CTCTGTTGGCGGGGGCAGCCGACGGACCACGGTGGCATATGTGATCAAC GAAGCGAGCCAAGGGCAACTGGTGGTGGCCGAGAGCGAGGCCCTGCAGA GCTTGCGGGAGGCGTGCGAGACAGTGGGCGCCACCCTGGAACCCTGCAT TTTGGGAAACTCGACTTTGGAGAAACCACCGTGCTGGACCGCTTTTACA ATGCAGATATTGCGGTGGTGGAGATGAGCGATGCCTTCCGGCAGCCGTC CTTGTTTTACCACCTTGGGGTGAGAGAAAGTTTCAGCATGGCCAACAAC ATCATCCTCTACTGCGATACTAACTCGGACTCTCTGCAGTCACTGAAGG AAATCATTTGCCAGAAGAATACTATGTGCACTGGGAACTACACCTTTGT TCCTTACATGATAACTCCACATAACAAAGTCTACTGCTGTGACAGCAGC TTCATGAAGGGGTTGACAGAGCTCATGCAACCGAACTTCGAGCTGCTTC TTGGACCCATCTGCTTACCTCTTGTGGATCGTTTTATTCAACTTTTGAA GGTGGCACAAGCAAGTTCTAGCCAGTACTTCCGGGAATCTATACTCAAT GACATCAGGAAAGCTCGTAATTTATACACTGGTAAAGAATTGGCAGCTG AGTTGGCAAGAATTCGGCAGCGAGTAGATAATATCGAAGTCTTGACAGC AGATATTGTCATAAATCTGTTACTTTCCTACAGAGATATCCAGGACTAT GATTCTATTGTGAAGCTGGTAGAGACTTTAGAAAAACTGCCAACCTTTG ATTTGGCCTCCCATCACCATGTGAAGTTTCATTATGCATTTGCACTGAA TAGGAGAAATCTCCCTGGTGACAGAGCAAAAGCTCTTGATATTATGATT CCCATGGTGCAAAGCGAAGGACAAGTTGCTTCAGATATGTATTGCCTAG TTGGTCGAATCTACAAAGATATGTTTTTGGACTCTAATTTCACGGACAC TGAAAGCAGAGACCATGGAGCTTCTTGGTTCAAAAAGGCATTTGAATCT GAGCCAACACTACAGTCAGGAATTAATTATGCGGTCCTCCTCCTGGCAG CTGGACACCAGTTTGAATCTTCCTTTGAGCTCCGGAAAGTTGGGGTGAA GCTAAGTAGTCTTCTTGGTAAAAAGGGAAACTTGGAAAAACTCCAGAGC TACTGGGAAGTTGGATTTTTTCTGGGGGCCAGCGTCCTAGCCAATGACC ACATGAGAGTCATTCAAGCATCTGAAAAGCTTTTTAAACTGAAGACACC AGCATGGTACCTCAAGTCTATTGTAGAGACAATTTTGATATATAAGCAT TTTGTGAAACTGACCACAGAACAGCCTGTGGCCAAGCAAGAACTTGTGG ACTTTTGGATGGATTTCCTGGTCGAGGCCACAAAGACAGATGTTACTGT GGTTAGGTTTCCAGTATTAATATTAGAACCAACCAAAATCTATCAACCT TCTTATTTGTCTATCAACAATGAAGTTGAGGAAAAGACAATCTCTATTT GGCACGTGCTTCCTGATGACAAGAAAGGTATACATGAGTGGAATTTTAG TGCCTCTTCTGTCAGGGGAGTGAGTATTTCTAAATTTGAAGAAAGATGC TGCTTTCTTTATGTGCTTCACAATTCTGATGATTTCCAAATCTATTTCT GTACAGAACTTCATTGTAAAAAGTTTTTTGAGATGGTGAACACCATTAC CGAAGAGAAGGGGAGAAGCACAGAGGAAGGAGACTGTGAAAGTGACTTG CTGGAGTATGACTATGAATATGATGAAAATGGTGACAGAGTCGTTTTAG GAAAAGGCACTTATGGGATAGTCTACGCAGGTCGGGACTTGAGCAACCA AGTCAGAATTGCTATTAAGGAAATCCCAGAGAGAGACAGCAGATACTCT CAGCCCCTGCATGAAGAAATAGCATTGCATAAACACCTGAAGCACAAAA ATATTGTCCAGTATCTGGGCTCTTTCAGTGAGAATGGTTTCATTAAAAT CTTCATGGAGCAGGTCCCTGGAGGAAGTCTTTCTGCTCTCCTTCGTTCC AAATGGGGTCCATTAAAAGACAATGAGCAAACAATTGGCTTTTATACAA AGCAAATACTGGAAGGATTAAAATATCTCCATGACAATCAGATAGTTCA CCGGGACATAAAGGGTGACAATGTGTTGATTAATACCTACAGTGGTGTT CTCAAGATCTCTGACTTCGGAACATCAAAGAGGCTTGCTGGCATAAACC CCTGTACTGAAACTTTTACTGGTACCCTCCAGTATATGGCACCAGAAAT AATAGATAAAGGACCAAGAGGCTACGGAAAAGCAGCAGACATCTGGTCT CTGGGCTGTACAATCATTGAAATGGCCACAGGAAAACCCCCATTTTATG AACTGGGAGAACCACAAGCAGCTATGTTCAAGGTGGGAATGTTTAAAGT CCACCCTGAGATCCCAGAGTCCATGTCTGCAGAGGCCAAGGCATTCATA CTGAAATGTTTTGAACCAGATCCTGACAAGAGAGCCTGTGCTAACGACT TGCTTGTTGATGAGTTTTTAAAAGTTTCAAGCAAAAAGAAAAAGACACA ACCTAAGCTTTCAGCTCTTTCAGCTGGATCAAATGAATATCTCAGGAGT ATATCCTTGCCGGTACCTGTGCTGGTGGAGGACACCAGCAGCAGCAGTG AGTACGGCTCAGTTTCACCCGACACGGAGTTGAAAGTGGACCCCTTCTC TTTCAAAACAAGAGCCAAGTCCTGCGGAGAAAGAGATGTCAAGGGAATT CGGACACTCTTTTTGGGCATTCCAGATGAGAATTTTGAAGATCACAGTG CTCCTCCTTCCCCTGAAGAAAAAGATTCTGGATTCTTCATGCTGAGGAA GGACAGTGAGAGGCGAGCTACCCTTCACAGGATCCTGACGGAAGACCAA GACAAAATTGTGAGAAACCTAATGGAATCTTTAGCTCAGGGGGCTGAAG AACCGAAACTAAAATGGGAACACATCACAACCCTCATTGCAAGCCTCAG AGAATTTGTGAGATCCACTGACCGAAAAATCATAGCCACCACACTGTCA AAGCTGAAACTGGAGCTGGACTTCGACAGCCATGGCATTAGCCAAGTCC AGGTGGTACTCTTTGGTTTTCAAGATGCTGTCAATAAAGTTCTTCGGAA TCATAACATCAAGCCGCACTGGATGTTTGCCTTAGACAGTATCATTCGG AAGGCGGTACAGACAGCCATTACCATCCTGGTTCCAGAACTAAGGCCAC ATTTCAGCCTTGCATCTGAGAGTGATACTGCTGATCAAGAAGACTTGGA TGTAGAAGATGACCATGAGGAACAGCCTTCAAATCAAACTGTCCGAAGA CCTCAGGCTGTCATTGAAGATGCTGTGGCTACCTCAGGCGTGAGCACGC TCAGTTCTACTGTGTCTCATGATTCCCAGAGTGCTCACCGGTCACTGAA TGTACAGCTTGGAAGGATGAAAATAGAAACCAATAGATTACTGGAAGAA TTGGTTCGGAAAGAGAAAGAATTACAAGCACTCCTTCATCGAGCTATTG AAGAAAAAGACCAAGAAATTAAACACCTGAAGCTTAAGTCCCAACCCAT AGAAATTCCTGAATTGCCTGTATTTCATCTAAATTCTTCTGGCACAAAT ACTGAAGATTCTGAACTTACCGACTGGCTGAGAGTGAATGGAGCTGATG AAGACACTATAAGCCGGTTTTTGGCTGAAGATTATACACTATTGGATGT TCTCTACTATGTTACACGTGATGACTTAAAATGCTTGAGACTAAGGGGA GGGATGCTGTGCACACTGTGGAAGG CTATCATTGACTTTCGAAACAAA CAGACTTGA Human CD14 CDS (SEQ ID NO: 8) ATGGAGCGCGCGTCCTGCTTGTTGCTGCTGCTGCTGCCGCTGGTGCACG TCTCTGCGACCACGCCAGAACCTTGTGAGCTGGACGATGAAGATTTCCG CTGCGTCTGCAACTTCTCCGAACCTCAGCCCGACTGGTCCGAAGCCTTC CAGTGTGTGTCTGCAGTAGAGGTGGAGATCCATGCCGGCGGTCTCAACC TAGAGCCGTTTCTAAAGCGCGTCGATGCGGACGCCGACCCGCGGCAGTA TGCTGACACGGTCAAGGCTCTCCGCGTGCGGCGGCTCACAGTGGGAGCC GCACAGGTTCCTGCTCAGCTACTGGTAGGCGCCCTGCGTGTGCTAGCGT ACTCCCGCCTCAAGGAACTGACGCTCGAGGACCTAAAGATAACCGGCAC CATGCCTCCGCTGCCTCTGGAAGCCACAGGACTTGCACTTTCCAGCTTG CGCCTACGCAACGTGTCGTGGGCGACAGGGCGTTCTTGGCTCGCCGAGC TGCAGCAGTGGCTCAAGCCAGGCCTCAAGGTACTGAGCATTGCCCAAGC ACACTCGCCTGCCTTTTCCTGCGAACAGGTTCGCGCCTTCCCGGCCCTT ACCAGCCTAGACCTGTCTGACAATCCTGGACTGGGCGAACGCGGACTGA TGGCGGCTCTCTGTCCCCACAAGTTCCCGGCCATCCAGAATCTAGCGCT GCGCAACACAGGAATGGAGACGCCCACAGGCGTGTGCGCCGCACTGGCG GCGGCAGGTGTGCAGCCCCACAGCCTAGACCTCAGCCACAACTCGCTGC GCGCCACCGTAAACCCTAGCGCTCCGAGATGCATGTGGTCCAGCGCCCT GAACTCCCTCAATCTGTCGTTCGCTGGGCTGGAACAGGTGCCTAAAGGA CTGCCAGCCAAGCTCAGAGTGCTCGATCTCAGCTGCAACAGACTGAACA GGGCGCCGCAGCCTGACGAGCTGCCCGAGGTGGATAACCTGACACTGGA CGGGAATCCCTTCCTGGTCCCTGGAACTGCCCTCCCCCACGAGGGCTCA ATGAACTCCGGCGTGGTCCCAGCCTGTGCACGTTCGACCCTGTCGGTGG GGGTGTCGGGAACCCTGGTGCTGCTCCAAGGGGCCCGGGGCTTTGCCTA A Human ERK1 CDS (SEQ ID NO: 9) ATGGCGGCGGCGGCGGCTCAGGGGGGCGGGGGCGGGGAGCCCCGTAGAA CCGAGGGGGTCGGCCCGGGGGTCCCGGGGGAGGTGGAGATGGTGAAGGG GCAGCCGTTCGACGTGGGCCCGCGCTACACGCAGTTGCAGTACATCGGC GAGGGCGCGTACGGCATGGTCAGCTCGGCCTATGACCACGTGCGCAAGA CTCGCGTGGCCATCAAGAAGATCAGCCCCTTCGAACATCAGACCTACTG CCAGCGCACGCTCCGGGAGATCCAGATCCTGCTGCGCTTCCGCCATGAG AATGTCATCGGCATCCGAGACATTCTGCGGGCGTCCACCCTGGAAGCCA TGAGAGATGTCTACATTGTGCAGGACCTGATGGAGACTGACCTGTACAA GTTGCTGAAAAGCCAGCAGCTGAGCAATGACCATATCTGCTACTTCCTC TACCAGATCCTGCGGGGCCTCAAGTACATCCACTCCGCCAACGTGCTCC ACCGAGATCTAAAGCCCTCCAACCTGCTCATCAACACCACCTGCGACCT TAAGATTTGTGATTTCGGCCTGGCCCGGATTGCCGATCCTGAGCATGAC CACACCGGCTTCCTGACGGAGTATGTGGCTACGCGCTGGTACCGGGCCC CAGAGATCATGCTGAACTCCAAGGGCTATACCAAGTCCATCGACATCTG GTCTGTGGGCTGCATTCTGGCTGAGATGCTCTCTAACCGGCCCATCTTC CCTGGCAAGCACTACCTGGATCAGCTCAACCACATTCTGGGCATCCTGG GCTCCCCATCCCAGGAGGACCTGAATTGTATCATCAACATGAAGGCCCG AAACTACCTACAGTCTCTGCCCTCCAAGACCAAGGTGGCTTGGGCCAAG CTTTTCCCCAAGTCAGACTCCAAAGCCCTTGACCTGCTGGACCGGATGT TAACCTTTAACCCCAATAAACGGATCACAGTGGAGGAAGCGCTGGCTCA CCCCTACCTGGAGCAGTACTATGACCCGACGGATGAGCCAGTGGCCGAG GAGCCCTTCACCTTCGCCATGGAGCTGGATGACCTACCTAAGGAGCGGC TGAAGGAGCTCATCTTCCAGGAGACAGCACGCTTCCAGCCCGGAGTGCT GGAGGCCCCCTAG Human ERK2 CDS (SEQ ID NO: 10) ATGGCGGCGGCGGCGGCGGCGGGCGCGGGCCCGGAGATGGTCCGCGGGC AGGTGTTCGACGTGGGGCCGCGCTACACCAACCTCTCGTACATCGGCGA GGGCGCCTACGGCATGGTGTGCTCTGCTTATGATAATGTCAACAAAGTT CGAGTAGCTATCAAGAAAATCAGCCCCTTTGAGCACCAGACCTACTGCC AGAGAACCCTGAGGGAGATAAAAATCTTACTGCGCTTCAGACATGAGAA CATCATTGGAATCAATGACATTATTCGAGCACCAACCATCGAGCAAATG AAAGATGTATATATAGTACAGGACCTCATGGAAACAGATCTTTACAAGC TCTTGAAGACACAACACCTCAGCAATGACCATATCTGCTATTTTCTCTA CCAGATCCTCAGAGGGTTAAAATATATCCATTCAGCTAACGTTCTGCAC CGTGACCTCAAGCCTTCCAACCTGCTGCTCAACACCACCTGTGATCTCA AGATCTGTGACTTTGGCCTGGCCCGTGTTGCAGATCCAGACCATGATCA CACAGGGTTCCTGACAGAATATGTGGCCACACGTTGGTACAGGGCTCCA GAAATTATGTTGAATTCCAAGGGCTACACCAAGTCCATTGATATTTGGT CTGTAGGCTGCATTCTGGCAGAAATGCTTTCTAACAGGCCCATCTTTCC AGGGAAGCATTATCTTGACCAGCTGAACCACATTTTGGGTATTCTTGGA TCCCCATCACAAGAAGACCTGAATTGTATAATAAATTTAAAAGCTAGGA ACTATTTGCTTTCTCTTCCACACAAAAATAAGGTGCCATGGAACAGGCT GTTCCCAAATGCTGACTCCAAAGCTCTGGACTTATTGGACAAAATGTTG ACATTCAACCCACACAAGAGGATTGAAGTAGAACAGGCTCTGGCCCACC CATATCTGGAGCAGTATTACGACCCGAGTGACGAGCCCATCGCCGAAGC ACCATTCAAGTTCGACATGGAATTGGATGACTTGCCTAAGGAAAAGCTC AAAGAACTAATTTTTGAAGAGACTGCTAGATTCCAGCCAGGATACAGAT CTTAA Human IKK CDS (SEQ ID NO: 11) ATGTTTTCAGGGGGGTGTCATAGCCCCGGGTTTGGCCGCCCCAGCCCCG CCTTCCCCGCCCCGGGGAGCCCGCCCCCTGCCCCGCGTCCCTGCCGACA GGAAACAGGTGAGCAGATTGCCATCAAGCAGTGCCGGCAGGAGCTCAGC CCCCGGAACCGAGAGCGGTGGTGCCTGGAGATCCAGATCATGAGAAGGC TGACCCACCCCAATGTGGTGGCTGCCCGAGATGTCCCTGAGGGGATGCA GAACTTGGCGCCCAATGACCTGCCCCTGCTGGCCATGGAGTACTGCCAA GGAGGAGATCTCCGGAAGTACCTGAACCAGTTTGAGAACTGCTGTGGTC TGCGGGAAGGTGCCATCCTCACCTTGCTGAGTGACATTGCCTCTGCGCT TAGATACCTTCATGAAAACAGAATCATCCATCGGGATCTAAAGCCAGAA AACATCGTCCTGCAGCAAGGAGAACAGAGGTTAATACACAAAATTATTG ACCTAGGATATGCCAAGGAGCTGGATCAGGGCAGTCTTTGCACATCATT CGTGGGGACCCTGCAGTACCTGGCCCCAGAGCTACTGGAGCAGCAGAAG TACACAGTGACCGTCGACTACTGGAGCTTCGGCACCCTGGCCTTTGAGT GCATCACGGGCTTCCGGCCCTTCCTCCCCAACTGGCAGCCCGTGCAGTG GCATTCAAAAGTGCGGCAGAAGAGTGAGGTGGACATTGTTGTTAGCGAA GACTTGAATGGAACGGTGAAGTTTTCAAGCTCTTTACCCTACCCCAATA ATCTTAACAGTGTCCTGGCTGAGCGACTGGAGAAGTGGCTGCAACTGAT GCTGATGTGGCACCCCCGACAGAGGGGCACGGATCCCACGTATGGGCCC AATGGCTGCTTCAAGGCCCTGGATGACATCTTAAACTTAAAGCTGGTTC ATATCTTGAACATGGTCACGGGCACCATCCACACCTACCCTGTGACAGA GGATGAGAGTCTGCAGAGCTTGAAGGCCAGAATCCAACAGGACACGGGC ATCCCAGAGGAGGACCAGGAGCTGCTGCAGGAAGCGGGCCTGGCGTTGA TCCCCGATAAGCCTGCCACTCAGTGTATTTCAGACGGCAAGTTAAATGA GGGCCACACATTGGACATGGATCTTGTTTTTCTCTTTGACAACAGTAAA ATCACCTATGAGACTCAGATCTCCCCACGGCCCCAACCTGAAAGTGTCA GCTGTATCCTTCAAGAGCCCAAGAGGAATCTCGCCTTCTTCCAGCTGAG GAAGGTGTGGGGCCAGGTCTGGCACAGCATCCAGACCCTGAAGGAAGAT TGCAACCGGCTGCAGCAGGGACAGCGAGCCGCCATGATGAATCTCCTCC GAAACAACAGCTGCCTCTCCAAAATGAAGAATTCCATGGCTTCCATGTC TCAGCAGCTCAAGGCCAAGTTGGATTTCTTCAAAACCAGCATCCAGATT GACCTGGAGAAGTACAGCGAGCAAACCGAGTTTGGGATCACATCAGATA AACTGCTGCTGGCCTGGAGGGAAATGGAGCAGGCTGTGGAGCTCTGTGG GCGGGAGAACGAAGTGAAACTCCTGGTAGAACGGATGATGGCTCTGCAG ACCGACATTGTGGACTTACAGAGGAGCCCCATGGGCCGGAAGCAGGGGG GAACGCTGGACGACCTAGAGGAGCAAGCAAGGGAGCTGTACAGGAGACT AAGGGAAAAACCTCGAGACCAGCGAACTGAGGGTGACAGTCAGGAAATG GTACGGCTGCTGCTTCAGGCAATTCAGAGCTTCGAGAAGAAAGTGCGAG TGATCTATACGCAGCTCAGTAAAACTGTGGTTTGCAAGCAGAAGGCGCT GGAACTGTTGCCCAAGGTGGAAGAGGTGGTGAGCTTAATGAATGAGGAT GAGAAGACTGTTGTCCGGCTGCAGGAGAAGCGGCAGAAGGAGCTCTGGA ATCTCCTGAAGATTGCTTGTAGCAAGGTCCGTGGTCCTGTCAGTGGAAG CCCGGATAGCATGAATGCCTCTCGACTTAGCCAGCCTGGGCAGCTGATG TCTCAGCCCTCCACGGCCTCCAACAGCTTACCTGAGCCAGCCAAGAAGA GTGAAGAACTGGTGGCTGAAGCACATAACCTCTGCACCCTGCTAGAAAA TGCCATACAGGACACTGTGAGGGAACAAGACCAGAGTTTCACGGCCCTA GACTGGAGCTGGTTACAGACGGAAGAAGAAGAGCACAGCTGCCTGGAGC AGGCCTCATGA Human IκB CDS (SEQ ID NO: 12) ATGTTCCAGGCGGCCGAGCGCCCCCAGGAGTGGGCCATGGAGGGCCCCC GCGACGGGCTGAAGAAGGAGCGGCTACTGGACGACCGCCACGACAGCGG CCTGGACTCCATGAAAGACGAGGAGTACGAGCAGATGGTCAAGGAGCTG CAGGAGATCCGCCTCGAGCCGCAGGAGGTGCCGCGCGGCTCGGAGCCCT GGAAGCAGCAGCTCACCGAGGACGGGGACTCGTTCCTGCACTTGGCCAT CATCCATGAAGAAAAGGCACTGACCATGGAAGTGATCCGCCAGGTGAAG GGAGACCTGGCCTTCCTCAACTTCCAGAACAACCTGCAGCAGACTCCAC TCCACTTGGCTGTGATCACCAACCAGCCAGAAATTGCTGAGGCACTTCT GGGAGCTGGCTGTGATCCTGAGCTCCGAGACTTTCGAGGAAATACCCCC CTACACCTTGCCTGTGAGCAGGGCTGCCTGGCCAGCGTGGGAGTCCTGA CTCAGTCCTGCACCACCCCGCACCTCCACTCCATCCTGAAGGCTACCAA CTACAATGGCCACACGTGTCTACACTTAGCCTCTATCCATGGCTACCTG GGCATCGTGGAGCTTTTGGTGTCCTTGGGTGCTGATGTCAATGCTCAGG AGCCCTGTAATGGCCGGACTGCCCTTCACCTCGCAGTGGACCTGCAAAA TCCTGACCTGGTGTCACTCCTGTTGAAGTGTGGGGCTGATGTCAACAGA GTTACCTACCAGGGCTATTCTCCCTACCAGCTCACCTGGGGCCGCCCAA GCACCCGGATACAGCAGCAGCTGGGCCAGCTGACACTAGAAAACCTTCA GATGCTGCCAGAGAGTGAGGATGAGGAGAGCTATGACACAGAGTCAGAG TTCACGGAGTTCACAGAGGACGAGCTGCCCTATGATGACTGTGTGTTTG GAGGCCAGCGTCTGACGTT ATGA Human IRAK CDS (SEQ ID NO: 13) ATGGCCGGGGGGCCGGGCCCGGGGGAGCCCGCAGCCCCCGGCGCCCAGC ACTTCTTGTACGAGGTGCCGCCCTGGGTCATGTGCCGCTTCTACAAAGT GATGGACGCCCTGGAGCCCGCCGACTGGTGCCAGTTCGCCGCCCTGATC GTGCGCGACCAGACCGAGCTGCGGCTGTGCGAGCGCTCCGGGCAGCGCA CGGCCAGCGTCCTGTGGCCCTGGATCAACCGCAACGCCCGTGTGGCCGA CCTCGTGCACATCCTCACGCACCTGCAGCTGCTCCGTGCGCGGGACATC ATCACAGCCTGGCACCCTCCCGCCCCGCTTCCGTCCCCAGGCACCACTG CCCCGAGGCCCAGCAGCATCCCTGCACCCGCCGAGGCCGAGGCCTGGAG CCCCCGGAAGTTGCCATCCTCAGCCTCCACCTTCCTCTCCCCAGCTTTT CCAGGCTCCCAGACCCATTCAGGGCCTGAGCTCGGCCTGGTCCCAAGCC CTGCTTCCCTGTGGCCTCCACCGCCATCTCCAGCCCCTTCTTCTACCAA GCCAGGCCCAGAGAGCTCAGTGTCCCTCCTGCAGGGAGCCCGCCCCTTT CCGTTTTGCTGGCCCCTCTGTGAGATTTCCCGGGGCACCCACAACTTCT CGGAGGAGCTCAAGATCGGGGAGGGTGGCTTTGGGTGCGTGTACCGGGC GGTGATGAGGAACACGGTGTATGCTGTGAAGAGGCTGAAGGAGAACGCT GACCTGGAGTGGACTGCAGTGAAGCAGAGCTTCCTGACCGAGGTGGAGC AGCTGTCCAGGTTTCGTCACCCAAACATTGTGGACTTTGCTGGCTACTG TGCTCAGAACGGCTTCTACTGCCTGGTGTACGGCTTCCTGCCCAACGGC TCCCTGGAGGACCGTCTCCACTGCCAGACCCAGGCCTGCCCACCTCTCT CCTGGCCTCAGCGACTGGACATCCTTCTGGGTACAGCCCGGGCAATTCA GTTTCTACATCAGGACAGCCCCAGCCTCATCCATGGAGACATCAAGAGT TCCAACGTCCTTCTGGATGAGAGGCTGACACCCAAGCTGGGAGACTTTG GCCTGGCCCGGTTCAGCCGCTTTGCCGGGTCCAGCCCCAGCCAGAGCAG CATGGTGGCCCGGACACAGACAGTGCGGGGCACCCTGGCCTACCTGCCC GAGGAGTACATCAAGACGGGAAGGCTGGCTGTGGACACGGACACCTTCA GCTTTGGGGTGGTAGTGCTAGAGACCTTGGCTGGTCAGAGGGCTGTGAA GACGCACGGTGCCAGGACCAAGTATCTGAAAGACCTGGTGGAAGAGGAG GCTGAGGAGGCTGGAGTGGCTTTGAGAAGCACCCAGAGCACACTGCAAG CAGGTCTGGCTGCAGATGCCTGGGCTGCTCCCATCGCCATGCAGATCTA CAAGAAGCACCTGGACCCCAGGCCCGGGCCCTGCCCACCTGAGCTGGGC CTGGGCCTGGGCCAGCTGGCCTGCTGCTGCCTGCACCGCCGGGCCAAAA GGAGGCCTCCTATGACCCAGGTGTACGAGAGGCTAGAGAAGCTGCAGGC AGTGGTGGCGGGGGTGCCCGGGCATTCGGAGGCCGCCAGCTGCATCCCC CCTTCCCCGCAGGAGAACTCCTACGTGTCCAGCACTGGCAGAGCCCACA GTGGGGCTGCTCCATGGCAGCCCCTGGCAGCGCCATCAGGAGCCAGTGC CCAGGCAGCAGAGCAGCTGCAGAGAGGCCCCAACCAGCCCGTGGAGAGT GACGAGAGCCTAGGCGGCCTCTCTGCTGCCCTGCGCTCCTGGCACTTGA CTCCAAGCTGCCCTCTGGACCCAGCACCCCTCAGGGAGGCCGGCTGTCC TCAGGGGGACACGGCAGGAGAATCGAGCTGGGGGAGTGGCCCAGGATCC CGGCCCACAGCCGTGGAAGGACTGGCCCTTGGCAGCTCTGCATCATCGT CGTCAGAGCCACCGCAGATTATCATCAACCCTGCCCGACAGAAGATGGT CCAGAAGCTGGCCCTGTACGAGGATGGGGCCCTGGACAGCCTGCAGCTG CTGTCGTCCAGCTCCCTCCCAGGCTTGGGCCTGGAACAGGACAGGCAGG GGCCCGAAGAAAGTGATGAATTTCAGAGCTGA Human JNK CDS (SEQ ID NO: 14) ATGAGCAGAAGCAAGCGTGACAACAATTTTTATAGTGTAGAGATTGGAG ATTCTACATTCACAGTCCTGAAACGATATCAGAATTTAAAACCTATAGG CTCAGGAGCTCAAGGAATAGTATGCGCAGCTTATGATGCCATTCTTGAA AGAAATGTTGCAATCAAGAAGCTAAGCCGACCATTTCAGAATCAGACTC ATGCCAAGCGGGCCTACAGAGAGCTAGTTCTTATGAAATGTGTTAATCA CAAAAATATAATTGGCCTTTTGAATGTTTTCACACCACAGAAATCCCTA GAAGAATTTCAAGATGTTTACATAGTCATGGAGCTCATGGATGCAAATC TTTGCCAAGTGATTCAGATGGAGCTAGATCATGAAAGAATGTCCTACCT TCTCTATCAGATGCTGTGTGGAATCAAGCACCTTCATTCTGCTGGAATT ATTCATCGGGACTTAAAGCCCAGTAATATAGTAGTAAAATCTGATTGCA CTTTGAAGATTCTTGACTTCGGTCTGGCCAGGACTGCAGGAACGAGTTT TATGATGACGCCTTATGTAGTGACTCGCTACTACAGAGCACCCGAGGTC ATCCTTGGCATGGGCTACAAGGAAAACGTTGACATTTGGTCAGTTGGGT GCATCATGGGAGAAATGATCAAAGGTGGTGTTTTGTTCCCAGGTACAGA TCATATTGATCAGTGGAATAAAGTTATTGAACAGCTTGGAACACCATGT CCTGAATTCATGAAGAAACTGCAACCAACAGTAAGGACTTACGTTGAAA ACAGACCTAAATATGCTGGATATAGCTTTGAGAAACTCTTCCCTGATGT CCTTTTCCCAGCTGACTCAGAACACAACAAACTTAAAGCCAGTCAGGCA AGGGATTTGTTATCCAAAATGCTGGTAATAGATGCATCTAAAAGGATCT CTGTAGATGAAGCTCTCCAACACCCGTACATCAAGTCTGGTATGATCCT TCTGAAGCAGAAGCTCCACCACCAAAGATCCCTGACAAGCAGTTAGATG AAAGGGAACACACAATAGAAGAGTGGAAAGAATTGATATATAAGGAAGT TATGGACTTGGAGGAGAGAACCAAGAATGGAGTTATACGGGGGCAGCCC TCTCCTTTAGGTGCAGCAGTGATCAATGGCTCTCAGCATCCATCATCAT CGTCGTCTGTCAATGATGTGTCTTCAATGTCAACAGATCCGACTTTGGC CTCTGATACAGACAGCAGTCTAGAAGCAGCAGCTGGGCCTCTGGGCTGC TGTAGATGA Human LBP CDS (SEQ ID NO: 15) ATGGGGGCCTTGGCCAGAGCCCTGCCGTCCATACTGCTGGCATTGCTGC TTACGTCCACCCCAGAGGCTCTGGGTGCCAACCCCGGCTTGGTCGCCAG GATCACCGACAAGGGACTGCAGTATGCGGCCCAGGAGGGGCTATTAGCT CTGCAGAGTGAGCTGCTCAGGATCACGCTGCCTGACTTCACCGGGGACT TGAGGATCCCCCACGTCGGCCGTGGGCGCTATGAGTTCCACAGCCTGAA CATCCACAGCTGTGAGCTGCTTCACTCTGCGCTGAGGCCTGTCCCTGGC CAGGGCCTGAGTCTCAGCATCTCCGACTCCTCCATCCGGGTCCAGGGCA GGTGGAAGGTGCGCAAGTCATTCTTCAAACTACAGGGCTCCTTTGATGT CAGTGTCAAGGGCATCAGCATTTCGGTCAACCTCCTGTTGGGCAGCGAG TCCTCCGGGAGGCCCACAGTTACTGCCTCCAGCTGCAGCAGTGACATCG CTGACGTGGAGGTGGACATGTCGGGAGACTTGGGGTGGCTGTTGAACCT CTTCCACAACCAGATTGAGTCCAAGTTCCAGAAAGTACTGGAGAGCAGG ATTTGCGAAATGATCCAGAAATCGGTGTCCTCCGATCTACAGCCTTATC TCCAAACTCTGCCAGTTACAACAGAGATTGACAGTTTCGCCGACATTGA TTATAGCTTAGTGGAAGCCCCTCGGGCAACAGCCCAGATGCTGGAGGTG ATGTTTAAGGGTGAAATCTTTCATCGTAACCACCGTTCTCCAGTTACCC TCCTTGCTGCAGTCATGAGCCTTCCTGAGGAACACAACAAAATGGTCTA CTTTGCCATCTCGGATTATGTCTTCAACACGGCCAGCCTGGTTTATCAT GAGGAAGGATATCTGAACTTCTCCATCACAGATGACATGATACCGCCTG ACTCTAATATCCGACTGACCACCAAGTCCTTCCGACCCTTCGTCCCACG GTTAGCCAGGCTCTACCCCAACATGAACCTGGAACTCCAGGGATCAGTG CCCTCTGCTCCGCTCCTGAACTTCAGCCCTGGGAATCTGTCTGTGGACC CCTATATGGAGATAGATGCCTTTGTGCTCCTGCCCAGCTCCAGCAAGGA GCCTGTCTTCCGGCTCAGTGTGGCCACTAATGTGTCCGCCACCTTGACC TTCAATACCAGCAAGATCACTGGGTTCCTGAAGCCAGGAAAGGTAAAAG TGGAACTGAAAGAATCCAAAGTTGGACTATTCAATGCAGAGCTGTTGGA AGCGCTCCTCAACTATTACATCCTTAACACCCTCTACCCCAAGTTCAAT GATAAGTTGGCCGAAGGCTTCCCCCTTCCTCTGCTGAAGCGTGTTCAGC TCTACGACCTTGGGCTGCAGATCCATAAGGACTTCCTGTTCTTGGGTGC CAATGTCCAATACATGAGAGTTTGA Human MEK1 CDS (SEQ ID NO: 16) ATGCCCAAGAAGAAGCCGACGCCCATCCAGCTGAACCCGGCCCCCGACG GCTCTGCAGTTAACGGGACCAGCTCTGCGGAGACCAACTTGGAGGCCTT GCAGAAGAAGCTGGAGGAGCTAGAGCTTGATGAGCAGCAGCGAAAGCGC CTTGAGGCCTTTCTTACCCAGAAGCAGAAGGTGGGAGAACTGAAGGATG ACGACTTTGAGAAGATCAGTGAGCTGGGGGCTGGCAATGGCGGTGTGGT GTTCAAGGTCTCCCACAAGCCTTCTGGCCTGGTCATGGCCAGAAAGCTA ATTCATCTGGAGATCAAACCCGCAATCCGGAACCAGATCATAAGGGAGC TGCAGGTTCTGCATGAGTGCAACTCTCCGTACATCGTGGGCTTCTATGG TGCGTTCTACAGCGATGGCGAGATCAGTATCTGCATGGAGCACATGGAT GGAGGTTCTCTGGATCAAGTCCTGAAGAAAGCTGGAAGAATTCCTGAAC AAATTTTAGGAAAAGTTAGCATTGCTGTAATAAAAGGCCTGACATATCT GAGGGAGAAGCACAAGATCATGCACAGAGATGTCAAGCCCTCCAACATC CTAGTCAACTCCCGTGGGGAGATCAAGCTCTGTGACTTTGGGGTCAGCG GGCAGCTCATCGACTCCATGGCCAACTCCTTCGTGGGCACAAGGTCCTA CATGTCGCCAGAAAGACTCCAGGGGACTCATTACTCTGTGCAGTCAGAC ATCTGGAGCATGGGACTGTCTCTGGTAGAGATGGCGGTTGGGAGGTATC CCATCCTCCTCCAGATGCCAAGGAGCTGGAGCTGATGTTTGGGTGCCAG GTGGAAGGAGATGCGGCTGAGACCCCACCCAGGCCAAGGACCCCCGGGA GGCCCCTTAGCTCATACGGAATGGACAGCCGACCTCCCATGGCAATTTT TGAGTTGTTGGATTACATAGTCAACGAGCCTCCTCCAAAACTGCCCAGT GGAGTGTTCAGTCTGGAATTTCAAGATTTTGTGAATAAATGCTTAATAA AAAACCCCGCAGAGAGAGCAGATTTGAAGCAACTCATGGTTCATGCTTT TATCAAGAGATCTGATGCTGAGGAAGTGGATTTTGCAGGTTGGCTCTGC TCCACCATCGGCCTTAACCAGCCCAGC ACACCAACCCATGCTGCTGGC GTCTAA Human MEK2 CDS (SEQ ID NO: 17) ATGCTGGCCCGGAGGAAGCCGGTGCTGCCGGCGCTCACCATCAACCCTA CCATCGCCGAGGGCCCATCCCCTACCAGCGAGGGCGCCTCCGAGGCAAA CCTGGTGGACCTGCAGAAGAAGCTGGAGGAGCTGGAACTTGACGAGCAG CAGAAGAAGCGGCTGGAAGCCTTTCTCACCCAGAAAGCCAAGGTCGGCG AACTCAAAGACGATGACTTCGAAAGGATCTCAGAGCTGGGCGCGGGCAA CGGCGGGGTGGTCACCAAAGTCCAGCACAGACCCTCGGGCCTCATCATG GCCAGGAAGCTGATCCACCTTGAGATCAAGCCGGCCATCCGGAACCAGA TCATCCGCGAGCTGCAGGTCCTGCACGAATGCAACTCGCCGTACATCGT GGGCTTCTACGGGGCCTTCTACAGTGACGGGGAGATCAGCATTTGCATG GAACACATGGACGGCGGCTCCCTGGACCAGGTGCTGAAAGAGGCCAAGA GGATTCCCGAGGAGATCCTGGGGAAAGTCAGCATCGCGGTTCTCCGGGG CTTGGCGTACCTCCGAGAGAAGCACCAGATCATGCACCGAGATGTGAAG CCCTCCAACATCCTCGTGAACTCTAGAGGGGAGATCAAGCTGTGTGACT TCGGGGTGAGCGGCCAGCTCATCGACTCCATGGCCAACTCCTTCGTGGG CACGCGCTCCTACATGGCTCCGGAGCGGTTGCAGGGCACACATTACTCG GTGCAGTCGGACATCTGGAGCATGGGCCTGTCCCTGGTGGAGCTGGCCG TCGGAAGGTACCCCATCCCCCCGCCCGACGCCAAAGAGCTGGAGGCCAT CTTTGGCCGGCCCGTGGTCGACGGGGAAGAAGGAGAGCCTCACAGCATC TCGCCTCGGCCGAGGCCCCCCGGGCGCCCCGTCAGCGGTCACGGGATGG ATAGCCGGCCTGCCATGGCCATCTTTGAACTCCTGGACTATATTGTGAA CGAGCCACCTCCTAAGCTGCCCAACGGTGTGTTCACCCCCGACTTCCAG GAGTTTGTCAATAAATGCCTCATCAAGAACCCAGCGGAGCGGGCGGACC TGAAGATGCTCACAAACCACACCTTCATCAAGCGGTCCGAGGTGGAAGA AGTGGATTTTGCCGGCTGGTTGTGTAAAACCCTGCGGCTGAACCAGCCC GGCACACCCACGCGCACCGCCGTGTGA Human MEK3 CDS (SEQ ID NO: 18) ATGTCCAAGCCACCCGCACCCAACCCCACACCCCCCCGGAACCTGGACT CCCGGACCTTCATCACCATTGGAGACAGAAACTTTGAGGTGGAGGCTGA TGACTTGGTGACCATCTCAGAACTGGGCCGTGGAGCCTATGGGGTGGTA GAGAAGGTGCGGCACGCCCAGAGCGGCACCATCATGGCCGTGAAGCGGA TCCGGGCCACCGTGAACTCACAGGAGCAGAAGCGGCTGCTCATGGACCT GGACATCAACATGCGCACGGTCGACTGTTTCTACACTGTCACCTTCTAC GGGGCACTATTCAGAGAGGGAGACGTGTGGATCTGCATGGAGCTCATGG ACACATCCTTGGACAAGTTCTACCGGAAGGTGCTGGATAAAAACATGAC AATTCCAGAGGACATCCTTGGGGAGATTGCTGTGTCTATCGTGCGGGCC CTGGAGCATCTGCACAGCAAGCTGTCGGTGATCCACAGAGATGTGAAGC CCTCCAATGTCCTTATCAACAAGGAGGGCCATGTGAAGATGTGTGACTT TGGCATCAGTGGCTACTTGGTGGACTCTGTGGCCAAGACGATGGATGCC GGCTGCAAGCCCTACATGGCCCCTGAGAGGATCAACCCAGAGCTGAACC AGAAGGGCTACAATGTCAAGTCCGACGTCTGGAGCCTGGGCATCACCAT GATTGAGATGGCCATCCTGCGGTTCCCTTACGAGTCCTGGGGGACCCCG TTCCAGCAGCTGAAGCAGGTGGTGGAGGAGCCGTCCCCCCAGCTCCCAG CCGACCGTTTCTCCCCCGAGTTTGTGGACTTCACTGCTCAGTGCCTGAG GAAGAACCCCGCAGAGCGTATGAGCTACCTGGAGCTGATGGAGCACCCC TTCTTCACCTTGCACAAAACCAAGAAGACGGACATTGCTGCCTTCGTGA AGGAGATCCTGGGAGAAGACTCATAG Human MEK6 CDS (SEQ ID NO: 19) ATGTCTCAGTCGAAAGGCAAGAAGCGAAACCCTGGCCTTAAAATTCCAA AAGAAGCATTTGAACAACCTCAGACCAGTTCCACACCACCTCGAGATTT AGACTCCAAGGCTTGCATTTCTATTGGAAATCAGAACTTTGAGGTGAAG GCAGATGACCTGGAGCCTATAATGGAACTGGGACGAGGTGCGTACGGGG TGGTGGAGAAGATGCGGCACGTGCCCAGCGGGCAGATCATGGCAGTGAA GCGGATCCGAGCCACAGTAAATAGCCAGGAACAGAAACGGCTACTGATG GATTTGGATATTTCCATGAGGACGGTGGACTGTCCATTCACTGTCACCT TTTATGGCGCACTGTTTCGGGAGGGTGATGTGTGGATCTGCATGGAGCT CATGGATACATCACTAGATAAATTCTACAAACAAGTTATTGATAAAGGC CAGACAATTCCAGAGGACATCTTAGGGAAAATAGCAGTTTCTATTGTAA AAGCATTAGAACATTTACATAGTAAGCTGTCTGTCATTCACAGAGACGT CAAGCCTTCTAATGTACTCATCAATGCTCTCGGTCAAGTGAAGATGTGC GATTTTGGAATCAGTGGCTACTTGGTGGACTCTGTTGCTAAAACAATTG ATGCAGGTTGCAAACCATACATGGCCCCTGAAAGAATAAACCCAGAGCT CAACCAGAAGGGATACAGTGTGAAGTCTGACATTTGGAGTCTGGGCATC ACGATGATTGAGTTGGCCATCCTTCGATTTCCCTATGATTCATGGGGAA CTCCATTTCAGCAGCTCAAACAGGTGGTAGAGGAGCCATCGCCACAACT CCCAGCAGACAAGTTCTCTGCAGAGTTTGTTGACTTTACCTCACAGTGC TTAAAGAAGAATTCCAAAGAACGGCCTACATACCCAGAGCTAATGCAAC ATCCATTTTTCACCCTACATGAATCCAAAGGAACAGATGTGGCATCTTT TGTAAAACTGATTCTTGGAGACTAA Human MEKK1 CDS (SEQ ID NO: 20) ATGGCGGCGGCGGCGGGGAATCGCGCCTCGTCGTCGGGATTCCCGGGCG CCAGGGCTACGAGCCCTGAGGCAGGCGGCGGCGGAGGAGCCCTCAAGGC GAGCAGCGCGCCCGCGGCTGCCGCGGGACTGCTGCGGGAGGCGGGCAGC GGGGGCCGCGAGCGGGCGGACTGGCGGCGGCGGCAGCTGCGCAAAGTGC GGAGTGTGGAGCTGGACCAGCTGCCTGAGCAGCCGCTCTTCCTTGCCGC CTCACCGCCGGCCTCCTCGACTTCCCCGTCGCCGGAGCCCGCGGACGCA GCGGGGAGTGGGACCGGCTTCCAGCCTGTGGCGGTGCCGCCGCCCCACG GAGCCGCGAGCCGCGGCGGCGCCCACCTTACCGAGTCGGTGGCGGCGCC GGACAGCGGCGCCTCGAGTCCCGCAGCGGCCGAGCCCGGGGAGAAGCGG GCGCCCGCCGCCGAGCCGTCTCCTGCAGCGGCCCCCGCCGGTCGTGAGA TGGAGAATAAAGAAACTCTCAAAGGGTTGCACAAGATGGATGATCGTCC AGAGGAACGAATGATCAGGGAGAAACTGAAGGCAACCTGTATGCCAGCC TGGAAGCACGAATGGTTGGAAAGGAGAAATAGGCGAGGGCCTGTGGTGG TAAAACCAATCCCAGTTAAAGGAGATGGATCTGAAATGAATCACTTAGC AGCTGAGTCTCCAGGAGAGGTCCAGGCAAGTGCGGCTTCACCAGCTTCC AAAGGCCGACGCAGTCCTTCTCCTGGCAACTCCCCATCAGGTCGCACAG TGAAATCAGAATCTCCAGGAGTAAGGAGAAAAAGAGTTTCCCCAGTGCC TTTTCAGAGTGGCAGAATCACACCACCCCGAAGAGCCCCTTCACCAGAT GGCTTCTCACCATATAGCCCTGAGGAAACAAACCGCCGTGTTAACAAAG TGATGCGGGCCAGACTGTACTTACTGCAGCAGATAGGGCCTAACTCTTT CCTGATTGGAGGAGACAGCCCAGACAATAAATACCGGGTGTTTATTGGG CCTCAGAACTGCAGCTGTGCACGTGGAACATTCTGTATTCATCTGCTAT TTGTGATGCTCCGGGTGTTTCAACTAGAACCTTCAGACCCAATGTTATG GAGAAAAACTTTAAAGAATTTTGAGGTTGAGAGTTTGTTCCAGAAATAT CACAGTAGGCGTAGCTCAAGGATCAAAGCTCCATCTCGTAACACCATCC AGAAGTTTGTTTCACGCATGTCAAATTCTCATACATTGTCATCATCTAG TACTTCTACGTCTAGTTCAGAAAACAGCATAAAGGATGAAGAGGAACAG ATGTGTCCTATTTGCTTGTTGGGCATGCTTGATGAAGAAAGTCTTACAG TGTGTGAAGACGGCTGCAGGAACAAGCTGCACCACCACTGCATGTCAAT TTGGGCAGAAGAGTGTAGAAGAAATAGAGAACCTTTAATATGTCCCCTT TGTAGATCTAAGTGGAGATCTCATGATTTCTACAGCCACGAGTTGTCAA GTCCTGTGGATTCCCCTTCTTCCCTCAGAGCTGCACAGCAGCAAACCGT ACAGCAGCAGCCTTTGGCTGGATCACGAAGGAATCAAGAGAGCAATTTT AACCTTACTCATTATGGAACTCAGCAAATCCCTCCTGCTTACAAAGATT TAGCTGAGCCATGGATTCAGGTGTTTGGAATGGAACTCGTTGGCTGCTT ATTTTCTAGAAACTGGAATGTGAGAGAGATGGCCCTCAGGCGTCTTTCC CATGATGTCAGTGGGGCCCTGCTGTTGGCAAATGGGGAGAGCACTGGAA ATTCTGGGGGCAGCAGTGGAAGCAGCCCGAGTGGGGGAGCCACCAGTGG GTCTTCCCAGACCAGTATCTCAGGAGATGTGGTGGAGGCATGCTGCAGC GTTCTGTCAATGGTCTGTGCTGACCCTGTCTACAAAGTGTACGTTGCTG CTTTAAAAACATTGAGAGCCATGCTGGTATATACTCCTTGCCACAGTTT AGCGGAAAGAATCAAACTTCAGAGACTTCTCCAGCCAGTTGTAGACACC ATCCTAGTCAAATGTGCAGATGCCAATAGCCGCACAAGTCAGCTGTCCA TATCAACACTGTTGGAACTGTGCAAAGGCCAAGCAGGAGAGTTGGCAGT TGGCAGAGAAATACTAAAAGCTGGATCCATTGGTATTGGTGGTGTTGAT TATGTCTTAAATTGTATTCTTGGAAACCAAACTGAATCAAACAATTGGC AAGAACTTCTTGGCCGCCTTTGTCTTATAGATAGACTGTTGTTGGAATT TCCTGCTGAATTTTATCCTCATATTGTCAGTACTGATGTTTCACAAGCT GAGCCTGTTGAAATCAGGTATAAGAAGCTGCTGTCCCTCTTAACCTTTG CTTTGCAGTCCATTGATAATTCCCACTCAATGGTTGGCAAACTTTCCAG AAGGATCTACTTGAGTTCTGCAAGAATGGTTACTACAGTACCCCATGTG TTTTCAAAACTGTTAGAAATGCTGAGTGTTTCCAGTTCCACTCACTTCA CCAGGATGCGTCGCCGTTTGATGGCTATTGCAGATGAGGTGGAAATTGC CGAAGCCATCCAGTTGGGCGTAGAAGACACTTTGGATGGTCAACAGGAC AGCTTCTTGCAGGCATCTGTTCCCAACAACTATCTGGAAACCACAGAGA ACAGTTCCCCTGAGTGCACAGTCCATTTAGAGAAAACTGGAAAAGGATT ATGTGCTACAAAATTGAGTGCCAGTTCAGAGGACATTTCTGAGAGACTG GCCAGCATTTCAGTAGGACCTTCTAGTTCAACAACAACAACAACAACAA CAACAGAGCAACCAAAGCCAATGGTTCAAACAAAAGGCAGACCCCACAG TCAGTGTTTGAACTCCTCTCCTTTATCTCATCATTCCCAATTAATGTTT CCAGCCTTGTCAACCCCTTCTTCTTCTACCCCATCTGTACCAGCTGGCA CTGCAACAGATGTCTCTAAGCATAGACTTCAGGGATTCATTCCCTGCAG AATACCTTCTGCATCTCCTCAAACACAGCGCAAGTTTTCTCTACAATTC CACAGAAACTGTCCTGAAAACAAAGACTCAGATAAACTTTCCCCAGTCT TTACTCAGTCAAGACCCTTGCCCTCCAGTAACATACACAGGCCAAAGCC ATCTAGACCTACCCCAGGTAATACAAGTAAACAGGGAGATCCCTCAAAA AATAGCATGACACTTGATCTGAACAGTAGTTCCAAATGTGATGACAGCT TTGGCTGTAGCAGCAATAGTAGTAATGCTGTTATACCCAGTGACGAGAC AGTGTTCACCCCAGTAGAGGAGAAATGCAGATTAGATGTCAATACAGAG CTCAACTCCAGTATTGAGGACCTTCTTGAAGCATCTATGCCTTCAAGTG ATACAACAGTAACTTTTAAGTCAGAAGTTGCTGTCCTGTCTCCTGAAAA GGCTGAAAATGATGATACCTACAAAGATGATGTGAATCATAATCAAAAG TGCAAAGAGAAGATGGAAGCTGAAGAAGAAGAAGCTTTAGCAATTGCCA TGGCAATGTCAGCGTCTCAGGATGCCCTCCCCATAGTTCCTCAGCTGCA GGTTGAAAATGGAGAAGATATCATCATTATTCAACAGGATACACCAGAG ACTCTACCAGGACATACCAAAGCAAAACAACCGTATAGAGAAGACACTG AATGGCTGAAAGGTCAACAGATAGGCCTTGGAGCATTTTCTTCTTGTTA TCAGGCTCAAGATGTGGGAACTGGAACTTTAATGGCTGTTAAACAGGTG ACTTATGTCAGAAACACATCTTCTGAGCAAGAAGAAGTAGTAGAAGCAC TAAGAGAAGAGATAAGAATGATGAGCCATCTGAATCATCCAAACATCAT TAGGATGTTGGGAGCCACGTGTGAGAAGAGCAATTACAATCTCTTCATT GAATGGATGGCAGGGGGATCGGTGGCTCATTTGCTGAGTAAATATGGAG CCTTCAAAGAATCAGTAGTTATTAACTACACTGAACAGTTACTCCGTGG CCTTTCGTATCTCCATGAAAACCAAATCATTCACAGAGATGTCAAAGGT GCCAATTTGCTAATTGACAGCACTGGTCAGAGACTAAGAATTGCAGATT TTGGAGCTGCAGCCAGGTTGGCATCAAAAGGAACTGGTGCAGGAGAGTT TCAGGGACAATTACTGGGGACAATTGCATTTATGGCACCTGAGGTACTA AGAGGTCAACAGTATGGAAGGAGCTGTGATGTATGGAGTGTTGGCTGTG CTATTATAGAAATGGCTTGTGCAAAACCACCATGGAATGCAGAAAAACA CTCCAATCATCTTGCTTTGATATTTAAGATTGCTAGTGCAACTACTGCT CCATCGATCCCTTCACATTTGTCTCCTGGTTTACGAGATGTGGCTCTTC GTTGTTTAGAACTTCAACCTCAGGACAGACCTCCATCAAGAGAGCTACT GAAGCATCCAGTCTTTCGTACTACATGGTAG Human MEKK 3 CDS (SEQ ID NO: 21) ATGGACGAACAGGAGGCATTGAACTCAATCATGAACGATCTGGTGGCCCT CCAGATGAACCGACGTCACCGGATGCCTGGATATGAGACCATGAAGAACA AAGACACAGGTCACTCAAATAGGCAGAAAAAACACAACAGCAGCAGCTCA GCCCTTCTGAACAGCCCCACAGTAACAACAAGCTCATGTGCAGGGGCCAG TGAGAAAAAGAAATTTTTGAGTGACGTCAGAATCAAGTTCGAGCACAACG GGGAGAGGCGAATTATAGCGTTCAGCCGGCCTGTGAAATATGAAGATGTG GAGCACAAGGTGACAACAGTATTTGGACAACCTCTTGATCTACATTACAT GAACAATGAGCTCTCCATCCTGCTGAAAAACCAAGATGATCTTGATAAAG CAATTGACATTTTAGATAGAAGCTCAAGCATGAAAAGCCTTAGGATATTG CTGTTGTCCCAGGACAGAAACCATAACAGTTCCTCTCCCCACTCTGGGGT GTCCAGACAGGTGCGGATCAAGGCTTCCCAGTCCGCAGGGGATATAAATA CTATCTACCAGCCCCCCGAGCCCAGAAGCAGGCACCTCTCTGTCAGCTCC CAGAACCCTGGCCGAAGCTCACCTCCCCCTGGCTATGTTCCTGAGCGGCA GCAGCACATTGCCCGGCAGGGGTCCTACACCAGCATCAACAGTGAGGGGG AGTTCATCCCAGAGACCAGCGAGCAGTGCATGCTGGATCCCCTGAGCAGT GCAGAAAATTCCTTGTCTGGAAGCTGCCAATCCTTGGACAGGTCAGCAGA CAGCCCATCCTTCCGGAAATCACGAATGTCCCGTGCCCAGAGCTTCCCTG ACAACAGACAGGAATACTCAGATCGGGAAACTCAGCTTTATGACAAAGGG GTCAAAGGTGGAACCTACCCCCGGCGCTACCACGTGTCTGTGCACCACAA GGACTACAGTGATGGCAGAAGAACATTTCCCCGAATACGGCGTCATCAAG GCAACTTGTTCACCCTGGTGCCCTCCAGCCGCTCCCTGAGCACAAATGGC GAGAACATGGGTCTGGCTGTGCAATACCTGGACCCCCGTGGGCGCCTGCG GAGTGCGGACAGCGAGAATGCCCTCTCTGTGCAGGAGAGGAATGTGCCAA CCAAGTCTCCCAGTGCCCCCATCAACTGGCGCCGGGGAAAGCTCCTGGGC CAGGGTGCCTTCGGCAGGGTCTATTTGTGCTATGACGTGGACACGGGACG TGAACTTGCTTCCAAGCAGGTCCAATTTGATCCAGACAGTCCTGAGACAA GCAAGGAGGTGAGTGCTCTGGAGTGCGAGATCCAGTTGCTAAAGAACTTG CAGCATGAGCGCATCGTGCAGTACTATGGCTGTCTGCGGGACCGCGCTGA GAAGACCCTGACCATCTTCATGGAGTACATGCCAGGGGGCTCGGTGAAAG ACCAGTTGAAGGCTTACGGTGCTCTGACAGAGAGCGTGACCCGAAAGTAC ACGCGGCAGATCCTGGAGGGCATGTCCTACCTGCACAGCAACATGATTGT TCACCGGGACATTAAGGGAGCCAACATCCTCCGAGACTCTGCTGGGAATG TAAAGCTGGGGGACTTTGGGGCCAGCAAACGCCTGCAGACGATCTGTATG TCGGGGACGGGCATGCGCTCCGTCACTGGCACACCCTACTGGATGAGCCC TGAGGTGATCAGCGGCGAGGGCTATGGAAGGAAAGCAGACGTGTGGAGCC TGGGCTGCACTGTGGTGGAGATGCTGACAGAGAAACCACCGTGGGCAGAG TATGAAGCTATGGCCGCCATCTTCAAGATTGCCACCCAGCCCACCAATCC TCAGCTGCCCTCCCACATCTCTGAACATGGCCGGGACTTCCTGAGGCGCA TTTTTGTGGAGGCTCGCCAGAGACCTTCAGCTGAGGAGCTGCTCACACAC CACTTTGCACAGCTCATGTACTGA Human MEKK4 CDS (SEQ ID NO: 22) ATGAGAGAAGCCGCTGCCGCGCTGGTCCCTCCTCCCGCCTTTGCCGTCAC GCCTGCCGCCGCCATGGAGGAGCCGCCGCCACCGCCGCCGCCGCCACCAC CGCCACCGGAACCCGAGACCGAGTCAGAACCCGAGTGCTGCTTGGCGGCG AGGCAAGAGGGCACATTGGGAGATTCAGCTTGCAAGAGTCCTGAATCTGA TCTAGAAGACTTCTCCGATGAAACAAATACAGAGAATCTTTATGGTACCT CTCCCCCCAGCACACCTCGACAGATGAAACGCATGTCAACCAAACATCAG AGGAATAATGTGGGGAGGCCAGCCAGTCGGTCTAATTTGAAAGAAAAAAT GAATGCACCAAATCAGCCTCCACATAAAGACACTGGAAAAACAGTGGAGA ATGTGGAAGAATACAGCTATAAGCAGGAGAAAAAGATCCGAGCAGCTCTT AGAACAACAGAGCGTGATCATAAAAAAAATGTACAGTGCTCATTCATGTT AGACTCAGTGGGTGGATCTTTGCCAAAAAAATCAATTCCAGATGTGGATC TCAATAAGCCTTACCTCAGCCTTGGCTGTAGCAATGCTAAGCTTCCAGTA TCTGTGCCCATGCCTATAGCCAGACCTGCACGCCAGACTTCTAGGACTGA CTGTCCAGCAGATCGTTTAAAGTTTTTTGAAACTTTACGACTTTTGCTAA AGCTTACCTCAGTCTCAAAGAAAAAAGACAGGGAGCAAAGAGGACAAGAA AATACGTCTGGTTTCTGGCTTAACCGATCTAACGAACTGATCTGGTTAGA GCTACAAGCCTGGCATGCAGGACGGACAATTAACGACCAGGACTTCTTTT TATATACAGCCCGTCAAGCCATCCCAGATATTATTAATGAAATCCTTACT TTCAAAGTCGACTATGGGAGCTTCGCCTTTGTTAGAGATAGAGCTGGTTT TAATGGTACTTCAGTAGAAGGGCAGTGCAAAGCCACTCCTGGAACAAAGA TTGTAGGTTACTCAACACATCATGAGCATCTCCAACGCCAGAGGGTCTCA TTTGAGCAGGTAAAACGGATAATGGAGCTGCTAGAGTACATAGAAGCACT TTATCCATCATTGCAGGCTCTTCAGAAGGACTATGAAAAATATGCTGCAA AAGACTTCCAGGACAGGGTGCAGGCACTCTGTTTGTGGTTAAACATCACA AAAGACTTAAATCAGAAATTAAGGATTATGGGCACTGTTTTGGGCATCAA GAATTTATCAGACATTGGCTGGCCAGTGTTTGAAATCCCTTCCCCTCGAC CATCCAAAGGTAATGAGCCGGAGTATGAGGGTGATGACACAGAAGGAGAA TTAAAGGAGTTGGAAAGTAGTACGGATGAGAGTGAAGAAGAACAAATCTC TGATCCTAGGGTACCGGAAATCAGACAGCCCATAGATAACAGCTTCGACA TCCAGTCGCGGGACTGCATATCCAAGAAGCTTGAGAGGCTCGAATCTGAG GATGATTCTCTTGGCTGGGGAGCACCAGACTGGAGCACAGAAGCAGGCTT TAGTAGACATTGTCTGACTTCTATTTATAGACCATTTGTAGACAAAGCAC TGAAGCAGATGGGGTTAAGAAAGTTAATTTTAAGACTTCACAAGCTAATG GATGGTTCCTTGCAAAGGGCACGTATAGCATTGGTAAAGAACGATCGTCC AGTGGAGTTTTCTGAATTTCCAGATCCCATGTGGGGTTCAGATTATGTGC AGTTGTCAAGGACACCACCTTCATCTGAGGAGAAATGCAGTGCTGTGTCG TGGGAGGAGCTGAAGGCCATGGATTTACCTTCATTCGAACCTGCCTTCCT AGTTCTCTGCCGAGTCCTTCTGAATGTCATACATGAGTGTCTGAAGTTAA GATTGGAGCAGAGACCTGCTGGAGAACCATCTCTCTTGAGTATTAAGCAG CTGGTGAGAGAGTGTAAGGAGGTCCTGAAGGGCGGCCTGCTGATGAAGCA GTACTACCAGTTCATGCTGCAGGAGGTTCTGGAGGACTTGGAGAAGCCCG ACTGCAACATTGACGCTTTTGAAGAGGATCTACATAAAATGCTTATGGTG TATTTTGATTACATGAGAAGCTGGATCCAAATGCTACAGCAATTACCTCA AGCATCGCATAGTTTAAAAAATCTGTTAGAAGAAGAATGGAATTTCACCA AAGAAATAACTCATTACATACGGGGAGGAGAAGCACAGGCCGGGAAGCTT TTCTGTGACATTGCAGGAATGCTGCTGAAATCTACAGGAAGTTTTTTAGA ATTTGGCTTACAGGAGAGCTGTGCTGAATTTTGGACTAGTGCGGATGACA GCAGTGCTTCCGACGAAATCAGGAGGTCTGTTATAGAGATCAGTCGAGCC CTGAAGGAGCTCTTCCATGAAGCCAGAGAAAGGGCTTCCAAAGCACTTGG ATTTGCTAAAATGTTGAGAAAGGACCTGGAAATAGCAGCAGAATTCAGGC TTTCAGCCCCAGTTAGAGACCTCCTGGATGTTCTGAAATCAAAACAGTAT GTCAAGGTGCAAATTCCTGGGTTAGAAAACTTGCAAATGTTTGTTCCAGA CACTCTTGCTGAGGAGAAGAGTATTATTTTGCAGTTACTCAATGCAGCTG CAGGAAAGGACTGTTCAAAAGATTCAGATGACGTACTCATCGATGCCTAT CTGCTTCTGACCAAGCACGGTGATCGAGCCCGTGATTCAGAGGACAGCTG GGGCACCTGGGAGGCACAGCCTGTCAAAGTCGTGCCTCAGGTGGAGACTG TTGACACCCTGAGAAGCATGCAGGTGGATAATCTTTTACTAGTTGTCATG CAGTCTGCGCATCTCACAATTCAGAGAAAAGCTTTCCAGCAGTCCATTGA GGGACTTATGACTCTGTGCCAGGAGCAGACATCCAGTCAGCCGGTCATCG CCAAAGCTTTGCAGCAGCTGAAGAATGATGCATTGGAGCTATGCAACAGG ATAAGCAATGCCATTGACCGCGTGGACCACATGTTCACATCAGAATTTGA TGCTGAGGTTGATGAATCTGAATCTGTCACCTTGCAACAGTACTACCGAG AAGCAATGATTCAGGGGTACAATTTTGGATTTGAGTATCATAAAGAAGTT GTTCGTTTGATGTCTGGGGAGTTTAGACAGAAGATAGGAGACAAATATAT AAGCTTTGCCCGGAAGTGGATGAATTATGTCCTGACTAAATGTGAGAGTG GTAGAGGTACAAGACCCAGGTGGGCGACTCAAGGATTTGATTTTCTACAA GCAATTGAACCTGCCTTTATTTCAGCTTTACCAGAAGATGACTTCTTGAG TTTACAAGCCTTGATGAATGAATGCATTGGCCATGTCATAGGAAAACCAC ACAGTCCTGTTACAGGTTTGTACCTTGCCATTCATCGGAACAGCCCCCGT CCTATGAAGGTACCTCGATGCCATAGTGACCCTCCTAACCCACACCTCAT TATCCCCACTCCAGAGGGATTCAGCACTCGGAGCATGCCTTCCGACGCGC GGAGCCATGGCAGCCCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGTT GCTGCCAGTCGGCCCAGCCCCTCTGGTGGTGACTCTGTGCTGCCCAAATC CATCAGCAGTGCCCATGATACCAGGGGTTCCAGCGTTCCTGAAAATGATC GATTGGCTTCCATAGCTGCTGAATTGCAGTTTAGGTCCCTGAGTCGTCAC TCAAGCCCCACGGAGGAGCGAGATGAACCAGCATATCCAAGAGGAGATTC AAGTGGGTCCACAAGAAGAAGTTGGGAACTTCGGACACTAATCAGCCAGA GTAAAGATACTGCTTCTAAACTAGGACCCATAGAAGCTATCCAGAAGTCA GTCCGATTGTTTGAAGAAAAGAGGTACCGAGAAATGAGGAGAAAGAATAT CATTGGTCAAGTTTGTGATACGCCTAAGTCCTATGATAATGTTATGCACG TTGGCTTGAGGAAGGTGACCTTCAAATGGCAAAGAGGAAACAAAATTGGA GAAGGCCAGTATGGGAAGGTGTACACCTGCATCAGCGTCGACACCGGGGA GCTGATGGCCATGAAAGAGATTCGATTTCAACCTAATGACCATAAGACTA TCAAGGAAACTGCAGACGAATTGAAAATATTCGAAGGCATCAAACACCCC AATCTGGTTCGGTATTTTGGTGTGGAGCTCCATAGAGAAGAAATGTACAT CTTCATGGAGTACTGCGATGAGGGGACTTTAGAAGAGGTGTCAAGGCTGG GACTTCAGGAACATGTGATTAGGCTGTATTCAAAGCAGATCACCATTGCG ATCAACGTCCTCCATGAGCATGGCATAGTCCACCGTGACATTAAAGGTGC CAATATCTTCCTTACCTCATCTGGATTAATCAAACTGGGAGATTTTGGAT GTTCAGTAAAGCTCAAAAACAATGCCCAGACCATGCCTGGTGAAGTGAAC AGCACCCTGGGGACAGCAGCATACATGGCACCTGAAGTCATCACTCGTGC CAAAGGAGAGGGCCATGGGCGTGCGGCCGACATCTGGAGTCTGGGGTGTG TTGTCATAGAGATGGTGACTGGCAAGAGGCCTTGGCATGAGTATGAGCAC AACTTTCAAATTATGTATAAAGTGGGGATGGGACATAAGCCACCAATCCC TGAAAGATTAAGCCCTGAAGGAAAGGACTTCCTTTCTCACTGCCTTGAGA GTGACCCAAAGATGAGATGGACCGCCAGCCAGCTCCTCGACCATTCGTTT GTCAAGGTTTGCACAGATGAAGAATG Human MEKK 6 CDS (SEQ ID NO: 23) ATGGCGGGGCCGTGTCCCCGGTCCGGGGCGGAGCGCGCCGGCAGCTGCTG GCAGGACCCGCTGGCCGTGGCGCTGAGCCGGGGCCGGCAGCTCGCGGCGC CCCCGGGCCGGGGCTGCGCGCGGAGCCGGCCGCTCAGCGTGGTCTACGTG CTGACCCGGGAGCCGCAGCCCGGGCTCGAGCCTCGGGAGGGAACCGAGGC GGAGCCGCTGCCCCTGCGCTGCCTGCGCGAGGCTTGCGCGCAGGTCCCCC GGCCGCGGCCGCCCCCGCAGCTGCGCAGCCTGCCCTTCGGGACGCTGGAG CTAGGCGACACCGCGGCTCTGGATGCCTTCTACAACGCGGATGTGGTGGT GCTGGAGGTGAGCAGCTCGCTGGTACAGCCCTCCCTGTTCTACCACCTTG GTGTGCGTGAGAGCTTCAGCATGACCAACAATGTGCTCCTCTGCTCCCAG GCCGACCTCCCTGACCTGCAGGCCCTGCGGGAGGATGTTTTCCAGAAGAA CTCGGATTGCGTTGGCAGCTACACACTGATCCCCTATGTGGTGACGGCCA CTGGTCGGGTGCTGTGTGGTGATGCAGGCCTTCTGCGGGGCCTGGCTGAT GGGCTGGTACAGGCTGGAGTGGGGACCGAGGCCCTGCTCACTCCCCTGGT GGGCCGGCTTGCCCGCCTGCTGGAGGCCACACCCACAGACTCTTGTGGCT ATTTCCGGGAGACCATTCGGCGGGACATCCGGCAGGCGCGGGAGCGGTTC AGTGGGCCACAGCTGCGGCAGGAGCTGGCTCGCCTGCAGCGGAGACTGGA CAGCGTGGAGCTGCTGAGCCCCGACATCATCATGAACTTGCTGCTCTCCT ACCGCGATGTGCAGGACTACTCGGCCATCATTGAGCTGGTGGAGACGCTG CAGGCCTTGCCCACCTGTGATGTGGCCGAGCAGCATAATGTCTGCTTCCA CTACACTTTTGCCCTCAACCGGAGGAACAGGCCTGGGGACCGGGCGAAGG CCCTGTCTGTGCTGCTGCCGCTGGTACAGCTTGAGGGCTCTGTGGCGCCC GATCTGTACTGCATGTGTGGCCGTATCTACAAGGACATGTTCTTCAGCTC GGGTTTCCAGGATGCTGGGCACCGGGAGCAGGCCTATCACTGGTATCGCA AGGCTTTTGACGTAGAGCCCAGCCTTCACTCAGGCATCAATGCAGCTGTG CTCCTCATTGCTGCCGGGCAGCACTTTGAGGATTCCAAAGAGCTCCGGCT AATAGGCATGAAGCTGGGCTGCCTGCTGGCCCGCAAAGGCTGCGTGGAGA AGATGCAGTATTACTGGGATGTGGGTTTCTACCTGGGAGCCCAGATCCTC GCCAATGACCCCACCCAGGTGGTGCTGGCTGCAGAGCAGCTGTATAAGCT CAATGCCCCCATATGGTACCTGGTGTCCGTGATGGAGACCTTCCTGCTCT ACCAGCACTTCAGGCCCACGCCAGAGCCCCCTGGAGGGCCACCACGCCGT GCCCACTTCTGGCTCCACTTCTTGCTACAGTCCTGCCAACCATTCAAGAC AGCCTGTGCCCAGGGCGACCAGTGCTTGGTGCTGGTCCTGGAGATGAACA AGGTGCTGCTGCCTGCAAAGCTCGAGGTTCGGGGTACTGACCCAGTAAGC ACAGTGACCCTGAGCCTGCTGGAGCCTGAGACCCAGGACATTCCCTCCAG CTGGACCTTCCCAGTCGCCTCCATATGCGGAGTCAGCGCCTCAAAGCGCG ACGAGCGCTGCTGCTTCCTCTATGCACTCCCCCCGGCTCAGGACGTCCAG CTGTGCTTCCCCAGCGTAGGGCACTGCCAGTGGTTCTGCGGCCTGATCCA GGCCTGGGTGACGAACCCGGATTCCACGGCGCCCGCGGAGGAGGCGGAGG GCGCGGGGGAGATGTTGGAGTTTGATTATGAGTACACGGAGACGGGCGAG CGGCTGGTGCTGGGCAAGGGCACGTATGGGGTGGTGTACGCGGGCCGCGA TCGCCACACGAGGGTGCGCATCGCCATCAAGGAGATCCCGGAGCGGGACA GCAGGTTCTCTCAGCCCCTGCATGAAGAGATCGCTCTTCACAGACGCCTG CGCCACAAGAACATAGTGCGCTATCTGGGCTCAGCTAGCCAGGGCGGCTA CCTTAAGATCTTCATGGAGGAAGTGCCTGGAGGCAGCCTGTCCTCCTTGC TGCGGTCGGTGTGGGGACCCCTGAAGGACAACGAGAGCACCATCAGTTTC TACACCCGCCAGATCCTGCAGGGACTTGGCTACTTGCACGACAACCACAT CGTGCACAGGGACATAAAAGGGGACAATGTGCTGATCAACACCTTCAGTG GGCTGCTCAAGATTTCTGACTTCGGCACCTCCAAGCGGCTGGCAGGCATC ACACCTTGCACTGAGACCTTCACAGGAACTCTGCAGTATATGGCCCCAGA AATCATTGACCAGGGCCCACGCGGGTATGGGAAAGCAGCTGACATCTGGT CACTGGGCTGCACTGTCATTGAGATGGCCACAGGTCGCCCCCCCTTCCAC GAGCTCGGGAGCCCACAGGCTGCCATGTTTCAGGTGGGTATGTACAAGGT CCATCCGCCAATGCCCAGCTCTCTGTCGGCCGAGGCCCAAGCCTTTCTCC TCCGAACTTTTGAGCCAGACCCCCGCCTCCGAGCCAGCGCCCAGACACTG CTGGGGGACCCCTTCCTGCAGCCTGGGAAAAGGAGCCGCAGCCCCAGCTC CCCACGACATGCTCCACGGCCCTCAGATGCCCCTTCTGCCAGTCCCACTC CTTCAGCCAACTCAACCACCCAGTCTCAGACATTCCCGTGCCCTCAGGCA CCCTCTCAGCACCCACCCAGCCCCCCGAAGCGCTGCCTCAGTTATGGGGG CACCAGCCAGCTCCGGGTGCCCGAGGAGCCTGCGGCCGAGGAGCCTGCGT CTCCGGAGGAGAGTTCGGGGCTGAGCCTGCTGCACCAGGAGAGCAAGCGT CGGGCCATGCTGGCCGCAGTATTGGAGCAGGAGCTGCCAGCGCTGGCGGA GAATCTGCACCAGGAGCAGAAGCAAGAGCAGGGGGCCCGTCTGGGCAGAA ACCATGTGGAAGAGCTGCTGCGCTGCCTCGGGGCACACATCCACACTCCC AACCGCCGGCAGCTCGCCCAGGAGCTGCGGGCGCTGCAAGGACGGCTGAG GGCCCAGGGCCTTGGGCCTGCGCTTCTGCACAGACCGCTGTTTGCCTTCC CGGATGCGGTGAAGCAGATCCTCCGCAAGCGCCAGATCCGTCCACACTGG ATGTTCGTTCTGGACTCACTGCTCAGCCGTGCTGTGCGGGCAGCCCTGGG TGTGCTAGGACCGGAGGTGGAGAAGGAGGCGGTCTCACCGAGGTCAGAGG AGCTGAGTAATGAAGGGGACTCCCAGCAGAGCCCAGGCCAGCAGAGCCCG CTTCCGGTGGAGCCCGAGCAGGGCCCCGCTCCTCTGATGGTGCAGCTGAG CCTCTTGAGGGCAGAGACTGATCGGCTGCGCGAAATCCTGGCGGGGAAGG AACGGGAGTACCAGGCCCTGGTGCAGCGGGCTCTACAGCGGCTGAATGAG GAAGCCCGGACCTATGTCCTGGCCCCAGAGCCTCCAACTGCTCTTTCAAC GGACCAGGGCCTGGTGCAGTGGCTACAGGAACTGAATGTGGATTCAGGCA CCATCCAAATGCTGTTGAACCATAGCTTCACCCTCCACACTCTGCTCACC TATGCCACTCGAGATGACCTCATCTACACCCGCATCAGGGGAGGGATGGT ATGCCGCATCTGGAGGGCCATCTTGGCACAGCGAGCAGGATCCACACCAG TCACCTCTGGACCCTGA Human MEKK7 CDS (SEQ ID NO: 24) ATGTCTACAGCCTCTGCCGCCTCCTCCTCCTCCTCGTCTTCGGCCGGTGA GATGATCGAAGCCCCTTCCCAGGTCCTCAACTTTGAAGAGATCGACTACA AGGAGATCGAGGTGGAAGAGGTTGTTGGAAGAGGAGCCTTTGGAGTTGTT TGCAAAGCTAAGTGGAGAGCAAAAGATGTTGCTATTAAACAAATAGAAAG TGAATCTGAGAGGAAAGCGTTTATTGTAGAGCTTCGGCAGTTATCCCGTG TGAACCATCCTAATATTGTAAAGCTTTATGGAGCCTGCTTGAATCCAGTG TGTCTTGTGATGGAATATGCTGAAGGGGGCTCTTTATATAATGTGCTGCA TGGTGCTGAACCATTGCCATATTATACTGCTGCCCACGCAATGAGTTGGT GTTTACAGTGTTCCCAAGGAGTGGCTTATCTTCACAGCATGCAACCCAAA GCGCTAATTCACAGGGACCTGAAACCACCAAACTTACTGCTGGTTGCAGG GGGGACAGTTCTAAAAATTTGTGATTTTGGTACAGCCTGTGACATTCAGA CACACATGACCAATAACAAGGGGAGTGCTGCTTGGATGGCACCTGAAGTT TTTGAAGGTAGTAATTACAGTGAAAAATGTGACGTCTTCAGCTGGGGTAT TATTCTTTGGGAAGTGATAACGCGTCGGAAACCCTTTGATGAGATTGGTG GCCCAGCTTTCCGAATCATGTGGGCTGTTCATAATGGTACTCGACCACCA CTGATAAAAAATTTACCTAAGCCCATTGAGAGCCTGATGACTCGTTGTTG GTCTAAAGATCCTTCCCAGCGCCCTTCAATGGAGGAAATTGTGAAAATAA TGACTCACTTGATGCGGTACTTTCCAGGAGCAGATGAGCCATTACAGTAT CCTTGTCAGTATTCAGATGAAGGACAGAGCAACTCTGCCACCAGTACAGG CTCATTCATGGACATTGCTTCTACAAATACGAGTAACAAAAGTGACACTA ATATGGAGCAAGTTCCTGCCACAAATGATACTATTAAGCGCTTAGAATCA AAATTGTTGAAAAATCAGGCAAAGCAACAGAGTGAATCTGGACGTTTAAG CTTGGGAGCCTCCCGTGGGAGCAGTGTGGAGAGCTTGCCCCCAACCTCTG AGGGCAAGAGGATGAGTGCTGACATGTCTGAAATAGAAGCTAGGATCGCC GCAACCACAGGCAACGGACAGCCAAGACGTAGATCCATCCAAGACTTGAC TGTAACTGGAACAGAACCTGGTCAGGTGAGCAGTAGGTCATCCAGTCCCA GTGTCAGAATGATTACTACCTCAGGACCAACCTCAGAAAAGCCAACTCGA AGTCATCCATGGACCCCTGATGATTCCACAGATACCAATGGATCAGATAA CTCCATCCCAATGGCTTATCTTACACTGGATCACCAACTACAGCCTCTAG CACCGTGCCCAAACTCCAAAGAATCTATGGCAGTGTTTGAACAGCATTGT AAAATGGCACAAGAATATATGAAAGTTCAAACAGAAATTGCATTGTTATT ACAGAGAAAGCAAGAACTAGTTGCAGAACTGGACCAGGATGAAAAGGACC AGCAAAATACATCTCGCCTGGTACAGGAACATAAAAAGCTTTTAGATGAA AACAAAAGCCTTTCTACTTACTACCAGCAATGCAAAAAACAACTAGAGGT CATCAGAAGTCAGCAGCAGAAACGACAAGGCACTTCATGA Human MK2 CDS (SEQ ID NO: 25) ATGCTGTCCAACTCCCAGGGCCAGAGCCCGCCGGTGCCGTTCCCCGCCCC GGCCCCGCCGCCGCAGCCCCCCACCCCTGCCCTGCCGCACCCCCCGGCGC AGCCGCCGCCGCCGCCCCCGCAGCAGTTCCCGCAGTTCCACGTCAAGTCC GGCCTGCAGATCAAGAAGAACGCCATCATCGATGACTACAAGGTCACCAG CCAGGTCCTGGGGCTGGGCATCAACGGCAAAGTTTTGCAGATCTTCAACA AGAGGACCCAGGAGAAATTCGCCCTCAAAATGCTTCAGGACTGCCCCAAG GCCCGCAGGGAGGTGGAGCTGCACTGGCGGGCCTCCCAGTGCCCGCACAT CGTACGGATCGTGGATGTGTACGAGAATCTGTACGCAGGGAGGAAGTGCC TGCTGATTGTCATGGAATGTTTGGACGGTGGAGAACTCTTTAGCCGAATC CAGGATCGAGGAGACCAGGCATTCACAGAAAGAGAAGCATCCGAAATCAT GAAGAGCATCGGTGAGGCCATCCAGTATCTGCATTCAATCAACATTGCCC ATCGGGATGTCAAGCCTGAGAATCTCTTATACACCTCCAAAAGGCCCAAC GCCATCCTGAAACTCACTGACTTTGGCTTTGCCAAGGAAACCACCAGCCA CAACTCTTTGACCACTCCTTGTTATACACCGTACTATGTGGCTCCAGAAG TGCTGGGTCCAGAGAAGTATGACAAGTCCTGTGACATGTGGTCCCTGGGT GTCATCATGTACATCCTGCTGTGTGGGTATCCCCCCTTCTACTCCAACCA CGGCCTTGCCATCTCTCCGGGCATGAAGACTCGCATCCGAATGGGCCAGT ATGAATTTCCCAACCCAGAATGGTCAGAAGTATCAGAGGAAGTGAAGATG CTCATTCGGAATCTGCTGAAAACAGAGCCCACCCAGAGAATGACCATCAC CGAGTTTATGAACCACCCTTGGATCATGCAATCAACAAAGGTCCCTCAAA CCCCACTGCACACCAGCCGGGTCCTGAAGGAGGACAAGGAGCGGTGGGAG GATGTCAAGGGGTGTCTTCATGACAAGAACAGCGACCAGGCCACTTGGCT GACCAGGTTGTGA Human MyD88 CDS (SEQ ID NO: 26) ATGCGACCCGACCGCGCTGAGGCTCCAGGACCGCCCGCCATGGCTGCAGG AGGTCCCGGCGCGGGGTCTGCGGCCCCGGTCTCCTCCACATCCTCCCTTC CCCTGGCTGCTCTCAACATGCGAGTGCGGCGCCGCCTGTCTCTGTTCTTG AACGTGCGGACACAGGTGGCGGCCGACTGGACCGCGCTGGCGGAGGAGAT GGACTTTGAGTACTTGGAGATCCGGCAACTGGAGACACAAGCGGACCCCA CTGGCAGGCTGCTGGACGCCTGGCAGGGACGCCCTGGCGCCTCTGTAGGC CGACTGCTCGAGCTGCTTACCAAGCTGGGCCGCGACGACGTGCTGCTGGA GCTGGGACCCAGCATTGAGGAGGATTGCCAAAAGTATATCTTGAAGCAGC AGCAGGAGGAGGCTGAGAAGCCTTTACAGGTGGCCGCTGTAGACAGCAGT GTCCCACGGACAGCAGAGCTGGCGGGCATCACCACACTTGATGACCCCCT GGGGCATATGCCTGAGCGTTTCGATGCCTTCATCTGCTATTGCCCCAGCG ACATCCAGTTTGTGCAGGAGATGATCCGGCAACTGGAACAGACAAACTAT CGACTGAAGTTGTGTGTGTCTGACCGCGATGTCCTGCCTGGCACCTGTGT CTGGTCTATTGCTAGTGAGCTCATCGAAAAGAGGTTGGCTAGAAGGCCAC GGGGTGGGTGCCGCCGGATGGTGGTGGTTGTCTCTGATGATTACCTGCAG AGCAAGGAATGTGACTTCCAGACCAAATTTGCACTCAGCCTCTCTCCAGG TGCCCATCAGAAGCGACTGATCCCCATCAAGTACAAGGCAATGAAGAAAG AGTTCCCCAGCATCCTGAGGTTCATCACTGTCTGCGACTACACCAACCCC TGCACCAAATCTTGGTTCTGGACTCGCCTTGCCAAGGCCTTGTCCCTGCC CTGA Human NF-κB CDS (SEQ ID NO: 27) ATGGCAGAAGATGATCCATATTTGGGAAGGCCTGAACAAATGTTTCATTT GGATCCTTCTTTGACTCATACAATATTTAATCCAGAAGTATTTCAACCAC AGATGGCACTGCCAACAGATGGCCCATACCTTCAAATATTAGAGCAACCT AAACAGAGAGGATTTCGTTTCCGTTATGTATGTGAAGGCCCATCCCATGG TGGACTACCTGGTGCCTCTAGTGAAAAGAACAAGAAGTCTTACCCTCAGG TCAAAATCTGCAACTATGTGGGACCAGCAAAGGTTATTGTTCAGTTGGTC ACAAATGGAAAAAATATCCACCTGCATGCCCACAGCCTGGTGGGAAAACA CTGTGAGGATGGGATCTGCACTGTAACTGCTGGACCCAAGGACATGGTGG TCGGCTTCGCAAACCTGGGTATACTTCATGTGACAAAGAAAAAAGTATTT GAAACACTGGAAGCACGAATGACAGAGGCGTGTATAAGGGGCTATAATCC TGGACTCTTGGTGCACCCTGACCTTGCCTATTTGCAAGCAGAAGGTGGAG GGGACCGGCAGCTGGGAGATCGGGAAAAAGAGCTAATCCGCCAAGCAGCT CTGCAGCAGACCAAGGAGATGGACCTCAGCGTGGTGCGGCTCATGTTTAC AGCTTTTCTTCCGGATAGCACTGGCAGCTTCACAAGGCGCCTGGAACCCG TGGTATCAGACGCCATCTATGACAGTAAAGCCCCCAATGCATCCAACTTG AAAATTGTAAGAATGGACAGGACAGCTGGATGTGTGACTGGAGGGGAGGA AATTTATCTTCTTTGTGACAAAGTTCAGAAAGATGACATCCAGATTCGAT TTTATGAAGAGGAAGAAAATGGTGGAGTCTGGGAAGGATTTGGAGATTTT TCCCCCACAGATGTTCATAGACAATTTGCCATTGTCTTCAAAACTCCAAA GTATAAAGATATTAATATTACAAAACCAGCCTCTGTGTTTGTCCAGCTTC GGAGGAAATCTGACTTGGAAACTAGTGAACCAAAACCTTTCCTCTACTAT CCTGAAATCAAAGATAAAGAAGAAGTGCAGAGGAAACGTCAGAAGCTCAT GCCCAATTTTTCGGATAGTTTCGGCGGTGGTAGTGGTGCTGGAGCTGGAG GCGGAGGCATGTTTGGTAGTGGCGGTGGAGGAGGGGGCACTGGAAGTACA GGTCCAGGGTATAGCTTCCCACACTATGGATTTCCTACTTATGGTGGGAT TACTTTCCATCCTGGAACTACTAAATCTAATGCTGGGATGAAGCATGGAA CCATGGACACTGAATCTAAAAAGGACCCTGAAGGTTGTGACAAAAGTGAT GACAAAAACACTGTAAACCTCTTTGGGAAAGTTATTGAAACCACAGAGCA AGATCAGGAGCCCAGCGAGGCCACCGTTGGGAATGGTGAGGTCACTCTAA CGTATGCAACAGGAACAAAAGAAGAGAGTGCTGGAGTTCAGGATAACCTC TTTCTAGAGAAGGCTATGCAGCTTGCAAAGAGGCATGCCAATGCCCTTTT CGACTACGCGGTGACAGGAGACGTGAAGATGCTGCTGGCCGTCCAGCGCC ATCTCACTGCTGTGCAGGATGAGAATGGGGACAGTGTCTTACACTTAGCA ATCATCCACCTTCATTCTCAACTTGTGAGGGATCTACTAGAAGTCACATC TGGTTTGATTTCTGATGACATTATCAACATGAGAAATGATCTGTACCAGA CGCCCTTGCACTTGGCAGTGATCACTAAGCAGGAAGATGTGGTGGAGGAT TTGCTGAGGGCTGGGGCCGACCTGAGCCTTCTGGACCGCTTGGGTAACTC TGTTTTGCACCTAGCTGCCAAAGAAGGACATGATAAAGTTCTCAGTATCT TACTCAAGCACAAAAAGGCAGCACTACTTCTTGACCACCCCAACGGGGAC GGTCTGAATGCCATTCATCTAGCCATGATGAGCAATAGCCTGCCATGTTT GCTGCTGCTGGTGGCCGCTGGGGCTGACGTCAATGCTCAGGAGCAGAAGT CCGGGCGCACAGCACTGCACCTGGCTGTGGAGCACGACAACATCTCATTG GCAGGCTGCCTGCTCCTGGAGGGTGATGCCCATGTGGACAGTACTACCTA CGATGGAACCACACCCCTGCATATAGCAGCTGGGAGAGGGTCCACCAGGC TGGCAGCTCTTCTCAAAGCAGCAGGAGCAGATCCCCTGGTGGAGAACTTT GAGCCTCTCTATGACCTGGATGACTCTTGGGAAAATGCAGGAGAGGATGA AGGAGTTGTGCCTGGAACCACGCCTCTAGATATGGCCACCAGCTGGCAGG TATTTGACATATTAAATGGGAAACCATATGAGCCAGAGTTTACATCTGAT GATTTACTAGCACAAGGAGACATGAAACAGCTGGCTGAAGATGTGAAGCT GCAGCTGTATAAGTTACTAGAAATTCCTGATCCAGACAAAAACTGGGCTA CTCTGGCGCAGAAATTAGGTCTGGGGATACTTAATAATGCCTTCCGGCTG AGTCCTGCTCCTTCCAAAACACTTATGGACAACTATGAGGTCTCTGGGGG TACAGTCAGAGAGCTGGTGGAGGCCCTGAGACAAATGGGCTACACCGAAG CAATTGAAGTGATCCAGGCAGCCTCCAGCCCAGTGAAGACCACCTCTCAG GCCCACTCGCTGCCTCTCTCGCCTGCCTCCACAAGGCAGCAAATAGACGA GCTCCGAGACAGTGACAGTGTCTGCGACAGCGGCGTGGAGACATCCTTCC GCAAACTCAGCTTTACCGAGTCTCTGACCAGTGGTGCCTCACTGCTAACT CTCAACAAAATGCCCCATGATTATGGGCAGGAAGGACCTCTAGAAGGCAA AATTTAG Human NIK CDS (SEQ ID NO: 28) ATGGCAGTGATGGAAATGGCCTGCCCAGGTGCCCCTGGCTCAGCAGTGGG GCAGCAGAAGGAACTCCCCAAAGCCAAGGAGAAGACGCCGCCACTGGGGA AGAAACAGAGCTCCGTCTACAAGCTTGAGGCCGTGGAGAAGAGCCCTGTG TTCTGCGGAAAGTGGGAGATCCTGAATGACGTGATTACCAAGGGCACAGC CAAGGAAGGCTCCGAGGCAGGGCCAGCTGCCATCTCTATCATCGCCCAGG CTGAGTGTGAGAATAGCCAAGAGTTCAGCCCCACCTTTTCAGAACGCATT TTCATCGCTGGGTCCAAACAGTACAGCCAGTCCGAGAGTCTTGATCAGAT CCCCAACAATGTGGCCCATGCTACAGAGGGCAAAATGGCCCGTGTGTGTT GGAAGGGAAAGCGTCGCAGCAAAGCCCGGAAGAAACGGAAGAAGAAGAGC TCAAAGTCCCTGGCTCATGCAGGAGTGGCCTTGGCCAAACCCCTCCCCAG GACCCCTGAGCAGGAGAGCTGCACCATCCCAGTGCAGGAGGATGAGTCTC CACTCGGCGCCCCATATGTTAGAAACACCCCGCAGTTCACCAAGCCTCTG AAGGAACCAGGCCTTGGGCAACTCTGTTTTAAGCAGCTTGGCGAGGGCCT ACGGCCGGCTCTGCCTCGATCAGAACTCCACAAACTGATCAGCCCCTTGC AATGTCTGAACCACGTGTGGAAACTGCACCACCCCCAGGACGGAGGCCCC CTGCCCCTGCCCACGCACCCCTTCCCCTATAGCAGACTGCCTCATCCCTT CCCATTCCACCCTCTCCAGCCCTGGAAACCTCACCCTCTGGAGTCCTTCC TGGGCAAACTGGCCTGTGTAGACAGCCAGAAACCCTTGCCTGACCCACAC CTGAGCAAACTGGCCTGTGTAGACAGTCCAAAGCCCCTGCCTGGCCCACA CCTGGAGCCCAGCTGCCTGTCTCGTGGTGCCCATGAGAAGTTTTCTGTGG AGGAATACCTAGTGCATGCTCTGCAAGGCAGCGTGAGCTCAGGCCAGGCC CACAGCCTGACCAGCCTGGCCAAGACCTGGGCAGCAAGGGGCTCCAGATC CCGGGAGCCCAGCCCCAAAACTGAGGACAACGAGGGTGTCCTGCTCACTG AGAAACTCAAGCCAGTGGATTATGAGTACCGAGAAGAAGTCCACTGGGCC ACGCACCAGCTCCGCCTGGGCAGAGGCTCCTTCGGAGAGGTGCACAGGAT GGAGGACAAGCAGACTGGCTTCCAGTGCGCTGTCAAAAAGGTGCGGCTGG AAGTATTTCGGGCAGAGGAGCTGATGGCATGTGCAGGATTGACCTCACCC AGAATTGTCCCTTTGTATGGAGCTGTGAGAGAAGGGCCTTGGGTCAACAT CTTCATGGAGCTGCTGGAAGGTGGCTCCCTGGGCCAGCTGGTCAAGGAGC AGGGCTGTCTCCCAGAGGACCGGGCCCTGTACTACCTGGGCCAGGCCCTG GAGGGTCTGGAATACCTCCACTCACGAAGGATTCTGCATGGGGACGTCAA AGCTGACAACGTGCTCCTGTCCAGCGATGGGAGCCACGCAGCCCTCTGTG ACTTTGGCCATGCTGTGTGTCTTCAACCTGATGGCCTGGGAAAGTCCTTG CTCACAGGGGACTACATCCCTGGCACAGAGACCCACATGGCTCCGGAGGT GGTGCTGGGCAGGAGCTGCGACGCCAAGGTGGATGTCTGGAGCAGCTGCT GTATGATGCTGCACATGCTCAACGGCTGCCACCCCTGGACTCAGTTCTTC CGAGGGCCGCTCTGCCTCAAGATTGCCAGCGAGCCTCCGCCTGTGAGGGA GATCCCACCCTCCTGCGCCCCTCTCACAGCCCAGGCCATCCAAGAGGGGC TGAGGAAAGAGCCCATCCACCGCGTGTCTGCAGCGGAGCTGGGAGGGAAG GTGAACCGGGCACTACAGCAAGTGGGAGGTCTGAAGAGCCCTTGGAGGGG AGAATATAAAGAACCAAGACATCCACCGCCAAATCAAGCCAATTACCACC AGACCCTCCATGCCCAGCCGAGAGAGCTTTCGCCAAGGGCCCCAGGGCCC CGGCCAGCTGAGGAGACAACAGGCAGAGCCCCTAAGCTCCAGCCTCCTCT CCCACCAGAGCCCCCAGAGCCAAACAAGTCTCCTCCCTTGACTTTGAGCA AGGAGGAGTCTGGGATGTGGGAACCCTTACCTCTGTCCTCCCTGGAGCCA GCCCCTGCCAGAAACCCCAGCTCACCAGAGCGGAAAGCAACCGTCCCGGA GCAGGAACTGCAGCAGCTGGAAATAGAATTATTCCTCAACAGCCTGTCCC AGCCATTTTCTCTGGAGGAGCAGGAGCAAATTCTCTCGTGCCTCAGCATC GACAGCCTCTCCCTGTCGGATGACAGTGAGAAGAACCCATCAAAGGCCTC TCAAAGCTCGCGGGACACCCTGAGCTCAGGCGTACACTCCTGGAGCAGCC AGGCCGAGGCTCGAAGCTCCAGCTGGAACATGGTGCTGGCCCGGGGGCGG CCCACCGACACCCCAAGCTATTTCAATGGTGTGAAAGTCCAAATACAGTC TCTTAATGGTGAACACCTGCACATCCGGGAGTTCCACCGGGTCAAAGTGG GAGACATCGCCACTGGCATCAGCAGCCAGATCCCAGCTGCAGCCTTCAGC TTGGTCACCAAAGACGGGCAGCCTGTTCGCTACGACATGGAGGTGCCAGA CTCGGGCATCGACCTGCAGTGCACACTGGCCCCTGATGGCAGCTTCGCCT GGAGCTGGAGGGTCAAGCATGGCCAGCTGGAGAACAGGCCCTAA Human p38 CDS (SEQ ID NO: 29) ATGTCTCAGGAGAGGCCCACGTTCTACCGGCAGGAGCTGAACAAGACAAT CTGGGAGGTGCCCGAGCGTTACCAGAACCTGTCTCCAGTGGGCTCTGGCG CCTATGGCTCTGTGTGTGCTGCTTTTGACACAAAAACGGGGTTACGTGTG GCAGTGAAGAAGCTCTCCAGACCATTTCAGTCCATCATTCATGCGAAAAG AACCTACAGAGAACTGCGGTTACTTAAACATATGAAACATGAAAATGTGA TTGGTCTGTTGGACGTTTTTACACCTGCAAGGTCTCTGGAGGAATTCAAT GATGTGTATCTGGTGACCCATCTCATGGGGGCAGATCTGAACAACATTGT GAAATGTCAGAAGCTTACAGATGACCATGTTCAGTTCCTTATCTACCAAA TTCTCCGAGGTCTAAAGTATATACATTCAGCTGACATAATTCACAGGGAC CTAAAACCTAGTAATCTAGCTGTGAATGAAGACTGTGAGCTGAAGATTCT GGATTTTGGACTGGCTCGGCACACAGATGATGAAATGACAGGCTACGTGG CCACTAGGTGGTACAGGGCTCCTGAGATCATGCTGAACTGGATGCATTAC AACCAGACAGTTGATATTTGGTCAGTGGGATGCATAATGGCCGAGCTGTT GACTGGAAGAACATTGTTTCCTGGTACAGACCATATTAACCAGCTTCAGC AGATTATGCGTCTGACAGGAACACCCCCCGCTTATCTCATTAACAGGATG CCAAGCCATGAGGCAAGAAACTATATTCAGTCTTTGACTCAGATGCCGAA GATGAACTTTGCGAATGTATTTATTGGTGCCAATCCCCTGGCTGTCGACT TGCTGGAGAAGATGCTTGTATTGGACTCAGATAAGAGAATTACAGCGGCC CAAGCCCTTGCACATGCCTACTTTGCTCAGTACCACGATCCTGATGATGA ACCAGTGGCCGATCCTTATGATCAGTCCTTTGAAAGCAGGGACCTCCTTA TAGATGAGTGGAAAAGCCTGACCTATGATGAAGTCATCAGCTTTGTGCCA CCACCCCTTGACCAAGAAGAGATGGAGTCCTGA Human PKR CDS (SEQ ID NO: 30) ATGGCTGGTGATCTTTCAGCAGGTTTCTTCATGGAGGAACTTAATACATA CCGTCAGAAGCAGGGAGTAGTACTTAAATATCAAGAACTGCCTAATTCAG GACCTCCACATGATAGGAGGTTTACATTTCAAGTTATAATAGATGGAAGA GAATTTCCAGAAGGTGAAGGTAGATCAAAGAAGGAAGCAAAAAATGCCGC AGCCAAATTAGCTGTTGAGATACTTAATAAGGAAAAGAAGGCAGTTAGTC CTTTATTATTGACAACAACGAATTCTTCAGAAGGATTATCCATGGGGAAT TACATAGGCCTTATCAATAGAATTGCCCAGAAGAAAAGACTAACTGTAAA TTATGAACAGTGTGCATCGGGGGTGCATGGGCCAGAAGGATTTCATTATA AATGCAAAATGGGACAGAAAGAATATAGTATTGGTACAGGTTCTACTAAA CAGGAAGCAAAACAATTGGCCGCTAAACTTGCATATCTTCAGATATTATC AGAAGAAACCTCAGTGAAATCTGACTACCTGTCCTCTGGTTCTTTTGCTA CTACGTGTGAGTCCCAAAGCAACTCTTTAGTGACCAGCACACTCGCTTCT GAATCATCATCTGAAGGTGACTTCTCAGCAGATACATCAGAGATAAATTC TAACAGTGACAGTTTAAACAGTTCTTCGTTGCTTATGAATGGTCTCAGAA ATAATCAAAGGAAGGCAAAAAGATCTTTGGCACCCAGATTTGACCTTCCT GACATGAAAGAAACAAAGTATACTGTGGACAAGAGGTTTGGCATGGATTT TAAAGAAATAGAATTAATTGGCTCAGGTGGATTTGGCCAAGTTTTCAAAG CAAAACACAGAATTGACGGAAAGACTTACGTTATTAAACGTGTTAAATAT AATAACGAGAAGGCGGAGCGTGAAGTAAAAGCATTGGCAAAACTTGATCA TGTAAATATTGTTCACTACAATGGCTGTTGGGATGGATTTGATTATGATC CTGAGACCAGTGATGATTCTCTTGAGAGCAGTGATTATGATCCTGAGAAC AGCAAAAATAGTTCAAGGTCAAAGACTAAGTGCCTTTTCATCCAAATGGA ATTCTGTGATAAAGGGACCTTGGAACAATGGATTGAAAAAAGAAGAGGCG AGAAACTAGACAAAGTTTTGGCTTTGGAACTCTTTGAACAAATAACAAAA GGGGTGGATTATATACATTCAAAAAAATTAATTCATAGAGATCTTAAGCC AAGTAATATATTCTTAGTAGATACAAAACAAGTAAAGATTGGAGACTTTG GACTTGTAACATCTCTGAAAAATGATGGAAAGCGAACAAGGAGTAAGGGA ACTTTGCGATACATGAGCCCAGAACAGATTTCTTCGCAAGACTATGGAAA GGAAGTGGACCTCTACGCTTTGGGGCTAATTCTTGCTGAACTTCTTCATG TATGTGACACTGCTTTTGAAACATCAAAGTTTTTCACAGACCTACGGGAT GGCATCATCTCAGATATATTTGATAAAAAAGAAAAAACTCTTCTACAGAA ATTACTCTCAAAGAAACCTGAGGATCGACCTAACACATCTGAAATACTAA GGACCTTGACTGTGTGGAAGAAAAGCCCAGAGAAAAATGAACGACACACA TGTTAG Human Rac CDS (SEQ ID NO: 31) ATGAGCGACGTGGCTATTGTGAAGGAGGGTTGGCTGCACAAACGAGGGGA GTACATCAAGACCTGGCGGCCACGCTACTTCCTCCTCAAGAATGATGGCA CCTTCATTGGCTACAAGGAGCGGCCGCAGGATGTGGACCAACGTGAGGCT CCCCTCAACAACTTCTCTGTGGCGCAGTGCCAGCTGATGAAGACGGAGCG GCCCCGGCCCAACACCTTCATCATCCGCTGCCTGCAGTGGACCACTGTCA TCGAACGCACCTTCCATGTGGAGACTCCTGAGGAGCGGGAGGAGTGGACA ACCGCCATCCAGACTGTGGCTGACGGCCTCAAGAAGCAGGAGGAGGAGGA GATGGACTTCCGGTCGGGCTCACCCAGTGACAACTCAGGGGCTGAAGAGA TGGAGGTGTCCCTGGCCAAGCCCAAGCACCGCGTGACCATGAACGAGTTT GAGTACCTGAAGCTGCTGGGCAAGGGCACTTTCGGCAAGGTGATCCTGGT GAAGGAGAAGGCCACAGGCCGCTACTACGCCATGAAGATCCTCAAGAAGG AAGTCATCGTGGCCAAGGACGAGGTGGCCCACACACTCACCGAGAACCGC GTCCTGCAGAACTCCAGGCACCCCTTCCTCACAGCCCTGAAGTACTCTTT CCAGACCCACGACCGCCTCTGCTTTGTCATGGAGTACGCCAACGGGGGCG AGCTGTTCTTCCACCTGTCCCGGGAGCGTGTGTTCTCCGAGGACCGGGCC CGCTTCTATGGCGCTGAGATTGTGTCAGCCCTGGACTACCTGCACTCGGA GAAGAACGTGGTGTACCGGGACCTCAAGCTGGAGAACCTCATGCTGGACA AGGACGGGCACATTAAGATCACAGACTTCGGGCTGTGCAAGGAGGGGATC AAGGACGGTGCCACCATGAAGACCTTTTGCGGCACACCTGAGTACCTGGC CCCCGAGGTGCTGGAGGACAATGACTACGGCCGTGCAGTGGACTGGTGGG GGCTGGGCGTGGTCATGTACGAGATGATGTGCGGTCGCCTGCCCTTCTAC AACCAGGACCATGAGAAGCTTTTTGAGCTCATCCTCATGGAGGAGATCCG CTTCCCGCGCACGCTTGGTCCCGAGGCCAAGTCCTTGCTTTCAGGGCTGC TCAAGAAGGACCCCAAGCAGAGGCTTGGCGGGGGCTCCGAGGACGCCAAG GAGATCATGCAGCATCGCTTCTTTGCCGGTATCGTGTGGCAGCACGTGTA CGAGAAGAAGCTCAGCCCACCCTTCAAGCCCCAGGTCACGTCGGAGACTG ACACCAGGTATTTTGATGAGGAGTTCACGGCCCAGATGATCACCATCACA CCACCTGACCAAGATGACAGCATGGAGTGTGTGGACAGCGAGCGCAGGCC CCACTTCCCCCAGTTCTCCTACTCGGCCAGCGGCACGGCCTGA Human Raf CDS (SEQ ID NO: 32) ATGGCTAGCAAACGAAAATCTACAACTCCATGCATGGTTCGGACATCACA AGTAGTAGAACAAGATGTGCCCGAGGAAGTAGACAGGGCCAAAGAGAAAG GAATCGGCACACCACAGCCTGACGTGGCCAAGGACAGTTGGGCAGCAGAA CTTGAAAACTCTTCCAAAGAAAACGAAGTGATAGAGGTGAAATCTATGGG GGAAAGCCAGTCCAAAAAACTCCAAGGTGGTTATGAGTGCAAATACTGCC CCTACTCCACGCAAAACCTGAACGAGTTCACGGAGCATGTCGACATGCAG CATCCCAACGTGATTCTCAACCCCCTCTACGTGTGTGCAGAATGTAACTT CACAACCAAAAAGTACGACTCCCTATCCGACCACAACTCCAAGTTCCATC CCGGGGAGGCCAACTTCAAGCTGAAGTTAATTAAACGCAATAATCAAACT GTCTTGGAACAGTCCATCGAAACCACCAACCATGTCGTGTCCATCACCAC CAGTGGCCCTGGAACTGGTGACAGTGATTCTGGGATCTCGGTGAGTAAAA CCCCCATCATGAAGCCTGGAAAACCAAAAGCGGATGCCAAGAAGGTGCCC AAGAAGCCCGAGGAGATCACCCCCGAGAACCACGTGGAAGGGACCGCCCG CCTGGTGACAGACACAGCTGAGATCCTCTCGAGACTCGGCGGGGTGGAGC TCCTCCAAGACACATTAGGACACGTCATGCCTTCTGTACAGCTGCCACCA AATATCAACCTTGTGCCCAAGGTCCCTGTCCCACTAAATACTACCAAATA CAACTCTGCCCTGGATACAAATGCCACGATGATCAACTCTTTCAACAAGT TTCCTTACCCGACCCAGGCTGAGTTGTCCTGGCTGACAGCTGCCTCCAAA CACCCAGAGGAGCACATCAGAATCTGGTTTGCCACCCAGCGCTTAAAGCA TGGCATCAGCTGGTCCCCAGAAGAGGTGGAGGAGGCCCGGAAGAAGATGT TCAACGGCACCATCCAGTCAGTACCCCCGACCATCACTGTGCTGCCCGCC CAGTTGGCCCCCACAAAGGTGACGCAGCCCATCCTCCAGACGGCTCTACC GTGCCAGATCCTCGGCCAGACTAGCCTGGTGCTGACTCAGGTGACCAGCG GGTCAACAACCGTCTCTTGCTCCCCCATCACACTTGCCGTGGCAGGAGTC ACCAACCATGGCCAGAAGAGACCCTTGGTGACTCCCCAAGCTGCCCCCGA ACCCAAGCGTCCACACATCGCTCAGGTGCCAGAGCCCCCACCCAAGGTGG CCAACCCCCCGCTCACACCAGCCAGTGACCGCAAGAAGACAAAGGAGCAG ATAGCACATCTCAAGGCCAGCTTTCTCCAGAGCCAGTTCCCTGACGATGC CGAGGTTTACCGGCTCATCGAGGTGACTGGCCTTGCCAGGAGCGAGATCA AGAAGTGGTTCAGTGACCACCGATATCGGTGTCAAAGGGGCATCGTCCAC ATCACCAGCGAATCCCTTGCCAAAGACCAGTTGGCCATCGCGGCCTCCCG ACACGGTCGCACGTATCATGCGTACCCAGACTTTGCCCCCCAGAAGTTCA AAGAGAAAACACAGGGTCAGGTTAAAATCTTGGAAGACAGCTTTTTGAAA AGTTCTTTTCCTACCCAAGCAGAACTGGATCGGCTAAGGGTGGAGACCAA GCTGAGCAGGAGAGAGATCGACTCCTGGTTCTCGGAGAGGCGGAAGCTTC GAGACAGCATGGAACAAGCTGTCTTGGATTCCATGGGGTCTGGCAAAAAA GGCCAAGATGTGGGAGCCCCCAATGGTGCTCTGTCTCGACTCGACCAGCT CTCCGGTGCCCAGTTAACAAGTTCTCTGCCCAGCCCTTCGCCAGCAATTG CAAAAAGTCAAGAACAGGTTCATCTCCTGAGGAGCACGTTTGCAAGAACC CAGTGGCCTACTCCCCAGGAGTACGACCAGTTAGCGGCCAAGACTGGCCT GGTCCGAACTGAGATTGTGCGTTGGTTCAAGGAGAACAGATGCTTGCTGA AAACGGGAACCGTGAAGTGGATGGAGCAGTACCAGCACCAGCCCATGGCA GATGATCACGGCTACGATGCCGTAGCAAGGAAAGCAACAAAACCCATGGC CGAGAGCCCAAAGAACGGGGGTGATGTGGTTCCACAATATTACAAGGACC CCAAAAAGCTCTGCGAAGAGGACTTGGAGAAGTTGGTGACCAGGGTAAAA GTAGGCAGCGAGCCAGCAAAAGACTGTTTGCCAGCAAAGCCCTCAGAGGC CACCTCAGACCGGTCAGAGGGCAGCAGCCGGGACGGCCAGGGTAGCGACG AGAACGAGGAGTCGAGCGTTGTGGATTACGTGGAGGTGACGGTCGGGGAG GAGGATGCGATCTCAGATAGATCAGATAGCTGGAGTCAGGCTGCGGCAGA AGGTGTGTCGGAACTGGCTGAATCAGACTCCGACTGCGTCCCTGCAGAGG CTGGCCAGGCCTAG Human K-Ras CDS (SEQ ID NO: 33) ATGACTGAATATAAACTTGTGGTAGTTGGAGCTGGTGGCGTAGGCAAGAG TGCCTTGACGATACAGCTAATTCAGAATCATTTTGTGGACGAATATGATC CAACAATAGAGGATTCCTACAGGAAGCAAGTAGTAATTGATGGAGAAACC TGTCTCTTGGATATTCTCGACACAGCAGGTCAAGAGGAGTACAGTGCAAT GAGGGACCAGTACATGAGGACTGGGGAGGGCTTTCTTTGTGTATTTGCCA TAAATAATACTAAATCATTTGAAGATATTCACCATTATAGAGAACAAATT AAAAGAGTTAAGGACTCTGAAGATGTACCTATGGTCCTAGTAGGAAATAA ATGTGATTTGCCTTCTAGAACAGTAGACACAAAACAGGCTCAGGACTTAG CAAGAAGTTATGGAATTCCTTTTATTGAAACATCAGCAAAGACAAGACAG GGTGTTGATGATGCCTTCTATACATTAGTTCGAGAAATTCGAAAACATAA AGAAAAGATGAGCAAAGATGGTAAAAAGAAGAAAAAGAAGTCAAAGACAA AGTGTGTAATTATGTAA Human N-Ras CDS (SEQ ID NO: 34) ATGACTGAGTACAAACTGGTGGTGGTTGGAGCAGGTGGTGTTGGGAAAAG CGCACTGACAATCCAGCTAATCCAGAACCACTTTGTAGATGAATATGATC CCACCATAGAGGATTCTTACAGAAAACAAGTGGTTATAGATGGTGAAACC TGTTTGTTGGACATACTGGATACAGCTGGACAAGAAGAGTACAGTGCCAT GAGAGACCAATACATGAGGACAGGCGAAGGCTTCCTCTGTGTATTTGCCA TCAATAATAGCAAGTCATTTGCGGATATTAACCTCTACAGGGAGCAGATT AAGCGAGTAAAAGACTCGGATGATGTACCTATGGTGCTAGTGGGAAACAA GTGTGATTTGCCAACAAGGACAGTTGATACAAAACAAGCCCACGAACTGG CCAAGAGTTACGGGATTCCATTCATTGAAACCTCAGCCAAGACCAGACAG GGTGTTGAAGATGCTTTTTACACACTGGTAAGAGAAATACGCCAGTACCG AATGAAAAAACTCAACAGCAGTGATGATGGGACTCAGGGTTGTATGGGAT TGCCATGTGTGGTGATGTAA Human RIP CDS (SEQ ID NO: 35) ATGCAACCAGACATGTCCTTGAATGTCATTAAGATGAAATCCAGTGACTT CCTGGAGAGTGCAGAACTGGACAGCGGAGGCTTTGGGAAGGTGTCTCTGT GTTTCCACAGAACCCAGGGACTCATGATCATGAAAACAGTGTACAAGGGG CCCAACTGCATTGAGCACAACGAGGCCCTCTTGGAGGAGGCGAAGATGAT GAACAGACTGAGACACAGCCGGGTGGTGAAGCTCCTGGGCGTCATCATAG AGGAAGGGAAGTACTCCCTGGTGATGGAGTACATGGAGAAGGGCAACCTG ATGCACGTGCTGAAAGCCGAGATGAGTACTCCGCTTTCTGTAAAAGGAAG GATAATTTTGGAAATCATTGAAGGAATGTGCTACTTACATGGAAAAGGCG TGATACACAAGGACCTGAAGCCTGAAAATATCCTTGTTGATAATGACTTC CACATTAAGATCGCAGACCTCGGCCTTGCCTCCTTTAAGATGTGGAGCAA ACTGAATAATGAAGAGCACAATGAGCTGAGGGAAGTGGACGGCACCGCTA AGAAGAATGGCGGCACCCTCTACTACATGGCGCCCGAGCACCTGAATGAC GTCAACGCAAAGCCCACAGAGAAGTCGGATGTGTACAGCTTTGCTGTAGT ACTCTGGGCGATATTTGCAAATAAGGAGCCATATGAAAATGCTATCTGTG AGCAGCAGTTGATAATGTGCATAAAATCTGGGAACAGGCCAGATGTGGAT GACATCACTGAGTACTGCCCAAGAGAAATTATCAGTCTCATGAAGCTCTG CTGGGAAGCGAATCCGGAAGCTCGGCCGACATTTCCTGGCATTGAAGAAA AATTTAGGCCTTTTTATTTAAGTCAATTAGAAGAAAGTGTAGAAGAGGAC GTGAAGAGTTTAAAGAAAGAGTATTCAAACGAAAATGCAGTTGTGAAGAG AATGCAGTCTCTTCAACTTGATTGTGTGGCAGTACCTTCAAGCCGGTCAA ATTCAGCCACAGAACAGCCTGGTTCACTGCACAGTTCCCAGGGACTTGGG ATGGGTCCTGTGGAGGAGTCCTGGTTTGCTCCTTCCCTGGAGCACCCACA AGAAGAGAATGAGCCCAGCCTGCAGAGTAAACTCCAAGACGAAGCCAACT ACCATCTTTATGGCAGCCGCATGGACAGGCAGACGAAACAGCAGCCCAGA CAGAATGTGGCTTACAACAGAGAGGAGGAAAGGAGACGCAGGGTCTCCCA TGACCCTTTTGCACAGCAAAGACCTTACGAGAATTTTCAGAATACAGAGG GAAAAGGCACTGCTTATTCCAGTGCAGCCAGTCATGGTAATGCAGTGCAC CAGCCCTCAGGGCTCACCAGCCAACCTCAAGTACTGTATCAGAACAATGG ATTATATAGCTCACATGGCTTTGGAACAAGACCACTGGATCCAGGAACAG CAGGTCCCAGAGTTTGGTACAGGCCAATTCCAAGTCATATGCCTAGTCTG CATAATATCCCAGTGCCTGAGACCAACTATCTAGGAAATACACCCACCAT GCCATTCAGCTCCTTGCCACCAACAGATGAATCTATAAAATATACCATAT ACAATAGTACTGGCATTCAGATTGGAGCCTACAATTATATGGAGATTGGT GGGACGAGTTCATCACTACTAGACAGCACAAATACGAACTTCAAAGAAGA GCCAGCTGCTAAGTACCAAGCTATCTTTGATAATACCACTAGTCTGACGG ATAAACACCTGGACCCAATCAGGGAAAATCTGGGAAAGCACTGGAAAAAC TGTGCCCGTAAACTGGGCTTCACACAGTCTCAGATTGATGAAATTGACCA TGACTATGAGCGAGATGGACTGAAAGAAAAGGTTTACCAGATGCTCCAAA AGTGGGTGATGAGGGAAGGCATAAAGGGAGCCACGGTGGGGAAGCTGGCC CAGGCGCTCCACCAGTGTTCCAGGATCGACCTTCTGAGCAGCTTGATTTA CGTCAGCCAGAACTAA Human TRAF6 CDS (SEQ ID NO: 36) ATGAGTCTGCTAAACTGTGAAAACAGCTGTGGATCCAGCCAGTCTGAAAG TGACTGCTGTGTGGCCATGGCCAGCTCCTGTAGCGCTGTAACAAAAGATG ATAGTGTGGGTGGAACTGCCAGCACGGGGAACCTCTCCAGCTCATTTATG GAGGAGATCCAGGGATATGATGTAGAGTTTGACCCACCCCTGGAAAGCAA GTATGAATGCCCCATCTGCTTGATGGCATTACGAGAAGCAGTGCAAACGC CATGCGGCCATAGGTTCTGCAAAGCCTGCATCATAAAATCAATAAGGGAT GCAGGTCACAAATGTCCAGTTGACAATGAAATACTGCTGGAAAATCAACT ATTTCCAGACAATTTTGCAAAACGTGAGATTCTTTCTCTGATGGTGAAAT GTCCAAATGAAGGTTGTTTGCACAAGATGGAACTGAGACATCTTGAGGAT CATCAAGCACATTGTGAGTTTGCTCTTATGGATTGTCCCCAATGCCAGCG TCCCTTCCAAAAATTCCATATTAATATTCACATTCTGAAGGATTGTCCAA GGAGACAGGTTTCTTGTGACAACTGTGCTGCATCAATGGCATTTGAAGAT AAAGAGATCCATGACCAGAACTGTCCTTTGGCAAATGTCATCTGTGAATA CTGCAATACTATACTCATCAGAGAACAGATGCCTAATCATTATGATCTAG ACTGCCCTACAGCCCCAATTCCATGCACATTCAGTACTTTTGGTTGCCAT GAAAAGATGCAGAGGAATCACTTGGCACGCCACCTACAAGAGAACACCCA GTCACACATGAGAATGTTGGCCCAGGCTGTTCATAGTTTGAGCGTTATAC CCGACTCTGGGTATATCTCAGAGGTCCGGAATTTCCAGGAAACTATTCAC CAGTTAGAGGGTCGCCTTGTAAGACAAGACCATCAAATCCGGGAGCTGAC TGCTAAAATGGAAACTCAGAGTATGTATGTAAGTGAGCTCAAACGAACCA TTCGAACCCTTGAGGACAAAGTTGCTGAAATCGAAGCACAGCAGTGCAAT GGAATTTATATTTGGAAGATTGGCAACTTTGGAATGCATTTGAAATGTCA AGAAGAGGAGAAACCTGTTGTGATTCATAGCCCTGGATTCTACACTGGCA AACCCGGGTACAAACTGTGCATGCGCTTGCACCTTCAGTTACCGACTGCT CAGCGCTGTGCAAACTATATATCCCTTTTTGTCCACACAATGCAAGGAGA ATATGACAGCCACCTCCCTTGGCCCTTCCAGGGTACAATACGCCTTACAA TTCTTGATCAGTCTGAAGCACCTGTAAGGCAAAACCACGAAGAGATAATG GATGCCAAACCAGAGCTGCTTGCTTTCCAGCGACCCACAATCCCACGGAA CCCAAAAGGTTTTGGCTATGTAACTTTTATGCATCTGGAAGCCCTAAGAC AAAGAACTTTCATTAAGGATGACACATTATTAGTGCGCTGTGAGGTCTCC ACCCGCTTTGACATGGGTAGCCTTCGGAGGGAGGGTTTTCAGCCACGAAG TACTGATGCAGGGGTATAG Human TTP CDS (SEQ ID NO: 37) ATGGCCAACCGTTACACCATGGATCTGACTGCCATCTACGAGAGCCTCCT GTCGCTGAGCCCTGACGTGCCCGTGCCATCCGACCATGGAGGGACTGAGT CCAGCCCAGGCTGGGGCTCCTCGGGACCCTGGAGCCTGAGCCCCTCCGAC TCCAGCCCGTCTGGGGTCACCTCCCGCCTGCCTGGCCGCTCCACCAGCCT AGTGGAGGGCCGCAGCTGTGGCTGGGTGCCCCCACCCCCTGGCTTCGCAC CGCTGGCTCCCCGCCTGGGCCCTGAGCTGTCACCCTCACCCACTTCGCCC ACTGCAACCTCCACCACCCCCTCGCGCTACAAGACTGAGCTATGTCGGAC CTTCTCAGAGAGTGGGCGCTGCCGCTACGGGGCCAAGTGCCAGTTTGCCC ATGGCCTGGGCGAGCTGCGCCAGGCCAATCGCCACCCCAAATACAAGACG GAACTCTGTCACAAGTTCTACCTCCAGGGCCGCTGCCCCTACGGCTCTCG CTGCCACTTCATCCACAACCCTAGCGAAGACCTGGCGGCCCCGGGCCACC CTCCTGTGCTTCGCCAGAGCATCAGCTTCTCCGGCCTGCCCTCTGGCCGC CGGACCTCACCACCACCACCAGGCCTGGCCGGCCCTTCCCTGTCCTCCAG CTCCTTCTCGCCCTCCAGCTCCCCACCACCACCTGGGGACCTTCCACTGT CACCCTCTGCCTTCTCTGCTGCCCCTGGCACCCCCCTGGCTCGAAGAGAC CCCACCCCAGTCTGTTGCCCCTCCTGCCGAAGGGCCACTCCTATCAGCGT CTGGGGGCCCTTGGGTGGCCTGGTTCGGACCCCCTCTGTACAGTCCCTGG GATCCGACCCTGATGAATATGCCAGCAGCGGCAGCAGCCTGGGGGGCTCT GACTCTCCCGTCTTCGAGGCGGGAGTTTTTGCACCACCCCAGCCCGTGGC AGCCCCCCGGCGACTCCCCATCTTCAATCGCATCTCTGTTTCTGAGTGA

    [3593] An antisense nucleic acid molecule can be complementary to all or part of a non-coding region of the coding strand of a nucleotide sequence encoding an AP-1, ASK1, CD14, c-jun, ERK1/2, IκB, IKK, IRAK, JNK, LBP, MAPK, MEK1/2, MEKK1/4, MEKK4/7, MEKK 3/6, MK2, MyD88, NF-κB, NIK, p38, PKR, rac, ras, raf, RIP, TNFα, TNFR1, TNFR2, TRADD, TRAF2, TRAF6, or TTPMEKK1 protein. Non-coding regions (5′ and 3′ untranslated regions) are the 5′ and 3′ sequences that flank the coding region in a gene and are not translated into amino acids.

    [3594] Based upon the sequences disclosed herein, one of skill in the art can easily choose and synthesize any of a number of appropriate antisense nucleic acids to target a nucleic acid encoding an AP-1, ASK1, CD14, c-jun, ERK1/2, IκB, IKK, IRAK, JNK, LBP, MAPK, MEK1/2, MEKK1/4, MEKK4/7, MEKK 3/6, MK2, MyD88, NF-κB, NIK, p38, PKR, rac, ras, raf, RIP, TNFα, TNFR1, TNFR2, TRADD, TRAF2, TRAF6, or TTP protein described herein. Antisense nucleic acids targeting a nucleic acid encoding an AP-1, ASK1, CD14, c-jun, ERK1/2, IκB, IKK, IRAK, JNK, LBP, MAPK, MEK1/2, MEKK1/4, MEKK4/7, MEKK 3/6, MK2, MyD88, NF-κB, NIK, p38, PKR, rac, ras, raf, RIP, TNFα, TNFR1, TNFR2, TRADD, TRAF2, TRAF6, or TTPMEKK1 protein can be designed using the software available at the Integrated DNA Technologies website.

    [3595] An antisense nucleic acid can be, for example, about 5, 10, 15, 18, 20, 22, 24, 25, 26, 28, 30, 32, 35, 36, 38, 40, 42, 44, 45, 46, 48, or 50 nucleotides or more in length. An antisense oligonucleotide can be constructed using enzymatic ligation reactions and chemical synthesis using procedures known in the art. For example, an antisense nucleic acid can be chemically synthesized using variously modified nucleotides or naturally occurring nucleotides designed to increase the physical stability of the duplex formed between the antisense and sense nucleic acids, e.g., phosphorothioate derivatives and acridine substituted nucleotides or to increase the biological stability of the molecules.

    [3596] Examples of modified nucleotides which can be used to generate an antisense nucleic acid include 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 2-methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil, queosine, 2-thiocytosine, 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5-(carboxyhydroxylmethyl) uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6-isopentenyladenine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D-mannosylqueosine, 5′-methoxycarboxymethyluracil, 5-methoxyuracil, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methylester, uracil-5-oxyacetic acid (v), 5-methyl-2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl) uracil, (acp3)w, and 2,6-diaminopurine. Alternatively, the antisense nucleic acid can be produced biologically using an expression vector into which a nucleic acid has been subcloned in an antisense orientation (i.e., RNA transcribed from the inserted nucleic acid will be of an antisense orientation to a target nucleic acid of interest).

    [3597] The antisense nucleic acid molecules described herein can be prepared in vitro and administered to a subject, e.g., a human subject. Alternatively, they can be generated in situ such that they hybridize with or bind to cellular mRNA and/or genomic DNA encoding an AP-1, ASK1, CD14, c-jun, ERK1/2, IκB, IKK, IRAK, JNK, LBP, MAPK, MEK1/2, MEKK1/4, MEKK4/7, MEKK 3/6, MK2, MyD88, NF-κB, NIK, p38, PKR, rac, ras, raf, RIP, TNFα, TNFR1, TNFR2, TRADD, TRAF2, TRAF6, or TTP protein to thereby inhibit expression, e.g., by inhibiting transcription and/or translation. The hybridization can be by conventional nucleotide complementarities to form a stable duplex, or, for example, in the case of an antisense nucleic acid molecule that binds to DNA duplexes, through specific interactions in the major groove of the double helix. The antisense nucleic acid molecules can be delivered to a mammalian cell using a vector (e.g., an adenovirus vector, a lentivirus, or a retrovirus).

    [3598] An antisense nucleic acid can be an α-anomeric nucleic acid molecule. An α-anomeric nucleic acid molecule forms specific double-stranded hybrids with complementary RNA in which, contrary to the usual, (3-units, the strands run parallel to each other (Gaultier et al., Nucleic Acids Res. 15:6625-6641, 1987). The antisense nucleic acid can also comprise a chimeric RNA-DNA analog (Inoue et al., FEBS Lett. 215:327-330, 1987) or a 2′-O-methylribonucleotide (Inoue et al., Nucleic Acids Res. 15:6131-6148, 1987).

    [3599] Another example of an inhibitory nucleic acid is a ribozyme that has specificity for a nucleic acid encoding an AP-1, ASK1, CD14, c-jun, ERK1/2, IκB, IKK, IRAK, JNK, LBP, MAPK, MEK1/2, MEKK1/4, MEKK4/7, MEKK 3/6, MK2, MyD88, NF-κB, NIK, p38, PKR, rac, ras, raf, RIP, TNFα, TNFR1, TNFR2, TRADD, TRAF2, TRAF6, or TTP mRNA, e.g., specificity for any one of SEQ ID NOs: 1-37). Ribozymes are catalytic RNA molecules with ribonuclease activity that are capable of cleaving a single-stranded nucleic acid, such as an mRNA, to which they have a complementary region. Thus, ribozymes (e.g., hammerhead ribozymes (described in Haselhoff and Gerlach, Nature 334:585-591, 1988)) can be used to catalytically cleave mRNA transcripts to thereby inhibit translation of the protein encoded by the mRNA. An AP-1, ASK1, CD14, c-jun, ERK1/2, IκB, IKK, IRAK, JNK, LBP, MAPK, MEK1/2, MEKK1/4, MEKK4/7, MEKK 3/6, MK2, MyD88, NF-κB, NIK, p38, PKR, rac, ras, raf, RIP, TNFα, TNFR1, TNFR2, TRADD, TRAF2, TRAF6, or TTP mRNA can be used to select a catalytic RNA having a specific ribonuclease activity from a pool of RNA molecules. See, e.g., Bartel et al., Science 261:1411-1418, 1993.

    [3600] Alternatively, a ribozyme having specificity for an AP-1, ASK1, CD14, c-jun, ERK1/2, IκB, IKK, IRAK, JNK, LBP, MAPK, MEK1/2, MEKK1/4, MEKK4/7, MEKK 3/6, MK2, MyD88, NF-κB, NIK, p38, PKR, rac, ras, raf, RIP, TNFα, TNFR1, TNFR2, TRADD, TRAF2, TRAF6, or TTP mRNA can be designed based upon the nucleotide sequence of any of the AP-1, ASK1, CD14, c-jun, ERK1/2, IκB, IKK, IRAK, JNK, LBP, MAPK, MEK1/2, MEKK1/4, MEKK4/7, MEKK 3/6, MK2, MyD88, NF-κB, NIK, p38, PKR, rac, ras, raf, RIP, TNFα, TNFR1, TNFR2, TRADD, TRAF2, TRAF6, or TTP mRNA sequences disclosed herein. For example, a derivative of a Tetrahymena L-19 IVS RNA can be constructed in which the nucleotide sequence of the active site is complementary to the nucleotide sequence to be cleaved in an AP-1, ASK1, CD14, c-jun, ERK1/2, IκB, IKK, IRAK, JNK, LBP, MAPK, MEK1/2, MEKK1/4, MEKK4/7, MEKK 3/6, MK2, MyD88, NF-κB, NIK, p38, PKR, rac, ras, raf, RIP, TNFα, TNFR1, TNFR2, TRADD, TRAF2, TRAF6, or TTP mRNA (see, e.g., U.S. Pat. Nos. 4,987,071 and 5,116,742).

    [3601] An inhibitory nucleic acid can also be a nucleic acid molecule that forms triple helical structures. For example, expression of an AP-1, ASK1, CD14, c-jun, ERK1/2, IκB, IKK, IRAK, JNK, LBP, MAPK, MEK1/2, MEKK1/4, MEKK4/7, MEKK 3/6, MK2, MyD88, NF-κB, p38, PKR, rac, ras, raf, RIP, TNFα, TNFR1, TNFR2, TRADD, TRAF2, TRAF6, or TTP polypeptide can be inhibited by targeting nucleotide sequences complementary to the regulatory region of the gene encoding the AP-1, ASK1, CD14, c-jun, ERK1/2, IκB, IKK, IRAK, JNK, LBP, MAPK, MEK1/2, MEKK1/4, MEKK4/7, MEKK 3/6, MK2, MyD88, NF-κB, NIK, p38, PKR, rac, ras, raf, RIP, TNFα, TNFR1, TNFR2, TRADD, TRAF2, TRAF6, or TTP polypeptide (e.g., the promoter and/or enhancer, e.g., a sequence that is at least 1 kb, 2 kb, 3 kb, 4 kb, or 5 kb upstream of the transcription initiation start state) to form triple helical structures that prevent transcription of the gene in target cells. See generally Maher, Bioassays 14(12):807-15, 1992; Helene, Anticancer Drug Des. 6(6):569-84, 1991; and Helene, Ann. N.Y. Acad. Sci. 660:27-36, 1992.

    [3602] In various embodiments, inhibitory nucleic acids can be modified at the sugar moiety, the base moiety, or phosphate backbone to improve, e.g., the solubility, stability, or hybridization, of the molecule. For example, the deoxyribose phosphate backbone of the nucleic acids can be modified to generate peptide nucleic acids (see, e.g., Hyrup et al., Bioorganic Medicinal Chem. 4(1):5-23, 1996). Peptide nucleic acids (PNAs) are nucleic acid mimics, e.g., DNA mimics, in which the deoxyribose phosphate backbone is replaced by a pseudopeptide backbone and only the four natural nucleobases are retained. The neutral backbone of PNAs allows for specific hybridization to RNA and DNA under conditions of low ionic strength. PNA oligomers can be synthesized using standard solid phase peptide synthesis protocols (see, e.g., Perry-O'Keefe et al., Proc. Natl. Acad. Sci. U.S.A. 93:14670-675, 1996). PNAs can be used as antisense or antigene agents for sequence-specific modulation of gene expression by, e.g., inducing transcription or translation arrest or inhibiting replication.

    Small Molecules

    [3603] In some embodiments, the anti-TNFα agent is a small molecule. In some embodiments, the small molecule is a tumor necrosis factor-converting enzyme (TACE) inhibitor (e.g., Moss et al., Nature Clinical Practice Rheumatology 4: 300-309, 2008). In some embodiments, the anti-TNFα agent is C.sub.87 (Ma et al., J. Biol. Chem. 289(18):12457-66, 2014). In some embodiments, the small molecule is LMP-420 (e.g., Haraguchi et al., AIDS Res. Ther. 3:8, 2006). In some embodiments, the TACE inhibitor is TMI-005 and BMS-561392. Additional examples of small molecule inhibitors are described in, e.g., He et al., Science 310(5750):1022-1025, 2005.

    [3604] In some examples, the anti-TNFα agent is a small molecule that inhibits the activity of one of AP-1, ASK1, IKK, JNK, MAPK, MEKK 1/4, MEKK4/7, MEKK 3/6, NIK, TRADD, RIP, NF-κB, and TRADD in a cell (e.g., in a cell obtained from a subject, a mammalian cell).

    [3605] In some examples, the anti-TNFα agent is a small molecule that inhibits the activity of one of CD14, MyD88 (see, e.g., Olson et al., Scientific Reports 5:14246, 2015), ras (e.g., Baker et al., Nature 497:577-578, 2013), raf (e.g., vemurafenib (PLX4032, RG7204), sorafenib tosylate, PLX-4720, dabrafenib (GSK2118436), GDC-0879, RAF265 (CHIR-265), AZ 628, NVP-BHG712, SB590885, ZM 336372, sorafenib, GW5074, TAK-632, CEP-32496, encorafenib (LGX818), CCT196969, LY3009120, R05126766 (CH5126766), PLX7904, and MLN2480).

    [3606] In some examples, the anti-TNFα agent TNFα inhibitor is a small molecule that inhibits the activity of one of MK2 (PF 3644022 and PHA 767491), JNK (e.g., AEG 3482, BI 78D3, CEP 1347, c-JUN peptide, IQ 15, JIP-1 (153-163), SP600125, SU 3327, and TCS JNK6o), c-jun (e.g., AEG 3482, BI 78D3, CEP 1347, c-JUN peptide, IQ 1S, JIP-1 (153-163), SP600125, SU 3327, and TCS JNK6o), MEK3/6 (e.g., Akinleye et al., J. Hematol. Oncol. 6:27, 2013), p38 (e.g., AL 8697, AMG 548, BIRB 796, CMPD-1, DBM 1285 dihydrochloride, EO 1428, JX 401, ML 3403, Org 48762-0, PH 797804, RWJ 67657, SB 202190, SB 203580, SB 239063, SB 706504, SCIO 469, SKF 86002, SX 011, TA 01, TA 02, TAK 715, VX 702, and VX 745), PKR (e.g., 2-aminopurine or CAS 608512-97-6), TTP (e.g., CAS 329907-28-0), MEK1/2 (e.g., Facciorusso et al., Expert Review Gastroentrol. Hepatol. 9:993-1003, 2015), ERK1/2 (e.g., Mandal et al., Oncogene 35:2547-2561, 2016), NIK (e.g., Mortier et al., Bioorg. Med. Chem. Lett. 20:4515-4520, 2010), IKK (e.g., Reilly et al., Nature Med. 19:313-321, 2013), IκB (e.g., Suzuki et al., Expert. Opin. Invest. Drugs 20:395-405, 2011), NF-κB (e.g., Gupta et al., Biochim. Biophys. Acta 1799(10-12):775-787, 2010), rac (e.g., U.S. Pat. No. 9,278,956), MEK4/7, IRAK (Chaudhary et al., J. Med. Chem. 58(1):96-110, 2015), LBP (see, e.g., U.S. Pat. No. 5,705,398), and TRAF6 (e.g., 3-[(2,5-Dimethylphenyl)amino]-1-phenyl-2-propen-1-one).

    [3607] In some embodiments of any of the methods described herein, the inhibitory nucleic acid can be about 10 nucleotides to about 50 nucleotides (e.g., about 10 nucleotides to about 45 nucleotides, about 10 nucleotides to about 40 nucleotides, about 10 nucleotides to about 35 nucleotides, about 10 nucleotides to about 30 nucleotides, about 10 nucleotides to about 28 nucleotides, about 10 nucleotides to about 26 nucleotides, about 10 nucleotides to about 25 nucleotides, about 10 nucleotides to about 24 nucleotides, about 10 nucleotides to about 22 nucleotides, about 10 nucleotides to about 20 nucleotides, about 10 nucleotides to about 18 nucleotides, about 10 nucleotides to about 16 nucleotides, about 10 nucleotides to about 14 nucleotides, about 10 nucleotides to about 12 nucleotides, about 12 nucleotides to about 50 nucleotides, about 12 nucleotides to about 45 nucleotides, about 12 nucleotides to about 40 nucleotides, about 12 nucleotides to about 35 nucleotides, about 12 nucleotides to about 30 nucleotides, about 12 nucleotides to about 28 nucleotides, about 12 nucleotides to about 26 nucleotides, about 12 nucleotides to about 25 nucleotides, about 12 nucleotides to about 24 nucleotides, about 12 nucleotides to about 22 nucleotides, about 12 nucleotides to about 20 nucleotides, about 12 nucleotides to about 18 nucleotides, about 12 nucleotides to about 16 nucleotides, about 12 nucleotides to about 14 nucleotides, about 15 nucleotides to about 50 nucleotides, about 15 nucleotides to about 45 nucleotides, about 15 nucleotides to about 40 nucleotides, about 15 nucleotides to about 35 nucleotides, about 15 nucleotides to about 30 nucleotides, about 15 nucleotides to about 28 nucleotides, about 15 nucleotides to about 26 nucleotides, about 15 nucleotides to about 25 nucleotides, about 15 nucleotides to about 24 nucleotides, about 15 nucleotides to about 22 nucleotides, about 15 nucleotides to about 20 nucleotides, about 15 nucleotides to about 18 nucleotides, about 15 nucleotides to about 16 nucleotides, about 16 nucleotides to about 50 nucleotides, about 16 nucleotides to about 45 nucleotides, about 16 nucleotides to about 40 nucleotides, about 16 nucleotides to about 35 nucleotides, about 16 nucleotides to about 30 nucleotides, about 16 nucleotides to about 28 nucleotides, about 16 nucleotides to about 26 nucleotides, about 16 nucleotides to about 25 nucleotides, about 16 nucleotides to about 24 nucleotides, about 16 nucleotides to about 22 nucleotides, about 16 nucleotides to about 20 nucleotides, about 16 nucleotides to about 18 nucleotides, about 18 nucleotides to about 20 nucleotides, about 20 nucleotides to about 50 nucleotides, about 20 nucleotides to about 45 nucleotides, about 20 nucleotides to about 40 nucleotides, about 20 nucleotides to about 35 nucleotides, about 20 nucleotides to about 30 nucleotides, about 20 nucleotides to about 28 nucleotides, about 20 nucleotides to about 26 nucleotides, about 20 nucleotides to about 25 nucleotides, about 20 nucleotides to about 24 nucleotides, about 20 nucleotides to about 22 nucleotides, about 24 nucleotides to about 50 nucleotides, about 24 nucleotides to about 45 nucleotides, about 24 nucleotides to about 40 nucleotides, about 24 nucleotides to about 35 nucleotides, about 24 nucleotides to about 30 nucleotides, about 24 nucleotides to about 28 nucleotides, about 24 nucleotides to about 26 nucleotides, about 24 nucleotides to about 25 nucleotides, about 26 nucleotides to about 50 nucleotides, about 26 nucleotides to about 45 nucleotides, about 26 nucleotides to about 40 nucleotides, about 26 nucleotides to about 35 nucleotides, about 26 nucleotides to about 30 nucleotides, about 26 nucleotides to about 28 nucleotides, about 28 nucleotides to about 50 nucleotides, about 28 nucleotides to about 45 nucleotides, about 28 nucleotides to about 40 nucleotides, about 28 nucleotides to about 35 nucleotides, about 28 nucleotides to about 30 nucleotides, about 30 nucleotides to about 50 nucleotides, about 30 nucleotides to about 45 nucleotides, about 30 nucleotides to about 40 nucleotides, about 30 nucleotides to about 38 nucleotides, about 30 nucleotides to about 36 nucleotides, about 30 nucleotides to about 34 nucleotides, about 30 nucleotides to about 32 nucleotides, about 32 nucleotides to about 50 nucleotides, about 32 nucleotides to about 45 nucleotides, about 32 nucleotides to about 40 nucleotides, about 32 nucleotides to about 35 nucleotides, about 35 nucleotides to about 50 nucleotides, about 35 nucleotides to about 45 nucleotides, about 35 nucleotides to about 40 nucleotides, about 40 nucleotides to about 50 nucleotides, about 40 nucleotides to about 45 nucleotides, about 42 nucleotides to about 50 nucleotides, about 42 nucleotides to about 45 nucleotides, or about 45 nucleotides to about 50 nucleotides) in length. One skilled in the art will appreciate that inhibitory nucleic acids may comprises at least one modified nucleic acid at either the 5′ or 3′ end of DNA or RNA.

    [3608] In some embodiments, the inhibitory nucleic acid can be formulated in a liposome, a micelle (e.g., a mixed micelle), a nanoemulsion, or a microemulsion, a solid nanoparticle, or a nanoparticle (e.g., a nanoparticle including one or more synthetic polymers). Additional exemplary structural features of inhibitory nucleic acids and formulations of inhibitory nucleic acids are described in US 2016/0090598.

    [3609] In some embodiments, the inhibitory nucleic acid (e.g., any of the inhibitory nucleic acid described herein) can include a sterile saline solution (e.g., phosphate-buffered saline (PBS)). In some embodiments, the inhibitory nucleic acid (e.g., any of the inhibitory nucleic acid described herein) can include a tissue-specific delivery molecule (e.g., a tissue-specific antibody).

    [3610] Compound Preparation and Biological Assays

    [3611] As can be appreciated by the skilled artisan, methods of synthesizing the compounds of the formulae herein will be evident to those of ordinary skill in the art. Synthetic chemistry transformations and protecting group methodologies (protection and deprotection) useful in synthesizing the compounds described herein are known in the art and include, for example, those such as described in R. Larock, Comprehensive Organic Transformations, VCH Publishers (1989); T. W. Greene and RGM. Wuts, Protective Groups in Organic Synthesis, 2d. Ed., John Wiley and Sons (1991); L. Fieser and M. Fieser, Fieser and Fieser's Reagents for Organic Synthesis, John Wiley and Sons (1994); and L. Paquette, ed., Encyclopedia of Reagents for Organic Synthesis, John Wiley and Sons (1995), and subsequent editions thereof.

    PREPARATIVE EXAMPLES

    [3612] The following abbreviations have the indicated meanings: [3613] ACN=acetonitrile [3614] BTC=trichloromethyl chloroformate [3615] Boc=t-butyloxy carbonyl [3616] Davephos=cyclohexylphosphino-2′-(N,N-dimethylamino)biphenyl [3617] DCM=dichloromethane [3618] DEA=diethylamine [3619] DMF=N,N-dimethylformamide [3620] DMSO=dimethyl sulfoxide [3621] DIEA=N,N-diisopropylethylamine [3622] DPPA=diphenylphosphoryl azide [3623] dppf=1,1′-Bis(diphenylphosphino)ferrocene [3624] EtOH=ethanol [3625] HATU=1-[Bis(dimethylamino)methylene]-1H-1,2,3-triazolo[4,5-b]pyridinium 3-oxid hexafluorophosphate [3626] Hex=hexane [3627] HPLC=high performance liquid chromatography [3628] LC-MS=liquid chromatography-mass spectrometry [3629] LiHMDS=lithium bis(trimethylsilyl)amide [3630] LDA=lithium diisopropylamide [3631] M=mol/L [3632] Me=methyl [3633] MeOH=methanol [3634] MSA=methanesulfonic acid [3635] NBS=N-bromosuccinimide [3636] NCS=N-chlorosuccinimide [3637] NMR=nuclear magnetic resonance [3638] Pd(dppf)Cl.sub.2=dichloro[1,1′-bis(diphenylphosphino)ferrocene]palladium [3639] Ph=phenyl [3640] PPh.sub.3Cl.sub.2=dichlorotriphenylphosphorane [3641] Py=pyridine [3642] RT=room temperature [3643] Rt=Retention time [3644] R.sub.f=Retardation factor [3645] Sat.=saturated [3646] TBAF=tetrabutylammonium fluoride [3647] TBS=tert-butyldimethylsilyl [3648] TBSCl=tert-butyldimethylsilyl chloride [3649] TBDPSCl=tert-butyldiphenylsilyl chloride [3650] TEA=triethylamine [3651] TFA=trifluoroacetic acid [3652] THF=tetrahydrofuran [3653] TLC=thin layer chromatography [3654] TsOH=4-methylbenzenesulfonic acid [3655] UV=ultraviolet

    General

    [3656] The progress of reactions was often monitored by TLC or LC-MS. The identity of the products was often confirmed by LC-MS. The LC-MS was recorded using one of the following methods.

    [3657] Method A: Shim-pack XR-ODS, C18, 3×50 mm, 2.5 um column, 1.0 uL injection, 1.5 mL/min flow rate, 90-900 amu scan range, 190-400 nm UV range, 5-100% (1.1 min), 100% (0.6 min) gradient with ACN (0.05% TFA) and water (0.05% TFA), 2 minute total run time.

    [3658] Method B: Kinetex EVO, C18, 3×50 mm, 2.2 um column, 1.0 uL injection, 1.5 mL/min flow rate, 90-900 amu scan range, 190-400 nm UV range, 10-95% (1.1 min), 95% (0.6 min) gradient with ACN and water (0.5% NH.sub.4HCO3), 2 minute total run time.

    [3659] Method C: Shim-pack XR-ODS, C18, 3×50 mm, 2.5 um column, 1.0 uL injection, 1.5 mL/min flow rate, 90-900 amu scan range, 190-400 nm UV range, 5-100% (2.1 min), 100% (0.6 min) gradient with ACN (0.05% TFA) and water (0.05% TFA), 3 minute total run time.

    [3660] Method D: Kinetex EVO, C18, 3×50 mm, 2.2 um column, 1.0 uL injection, 1.5 mL/min flow rate, 90-900 amu scan range, 190-400 nm UV range, 10-95% (2.1 min), 95% (0.6 min) gradient with ACN and water (0.5% NH.sub.4HCO3), 3 minute total run time.

    [3661] Method F: Phenomenex, CHO-7644, Onyx Monolithic C18, 50×4.6 mm, 10.0 uL injection, 1.5 mL/min flow rate, 100-1500 amu scan range, 220 and 254 nm UV detection, 5% with ACN (0.1% TFA) to 100% water (0.1% TFA) over 9.5 min, with a stay at 100% (ACN, 0.1% TFA) for 1 min, then equilibration to 5% (ACN, 0.1% TFA) over 1.5 min.

    [3662] The final targets were purified by Prep-HPLC. The Prep-HPLC was carried out using the following method.

    [3663] Method E: Prep-HPLC: Column, XBridge Shield RP18 OBD (19×250 mm, 10 um); mobile phase, Water (10 mmol/L NH.sub.4HCO.sub.3) and ACN, UV detection 254/210 nm.

    [3664] Method G: Prep-HPLC: Higgins Analytical Proto 200, C18 Column, 250×20 mm, 10 um; mobile phase, Water (0.1% TFA) and ACN (0.1% TFA), UV detection 254/210 nm.

    [3665] NMR was recorded on BRUKER NMR 300.03 MHz, DUL-C-H, ULTRASHIELD™ 300, AVANCE II 300 B-ACS™ 120 or BRUKER NMR 400.13 MHz, BBFO, ULTRASHIELD™ 400, AVANCE III 400, B-ACS™ 120 or BRUKER AC 250 NMR instrument with TMS as reference measured in ppm (part per million).

    [3666] Racemic compounds of this invention can be resolved to give individual enantiomers using a variety of known methods. For example, chiral stationary phases can used and the elution conditions can include normal phase or super-critical fluid with or without acidic or basic additives. Enantiomerically pure acids or bases can be used to form diatereomeric salts with the racemic compounds whereby pure enantiomers can be obtained by fractional crystallization. The racemates can also be derivatized with enantiomerically pure auxiliary reagents to form diastereomeric mixtures that can be separated. The auxiliary is then removed to give pure enantiomers.

    Schemes for the Preparation of Final Targets:

    [3667] Schemes 1-3 below illustrate several conditions used for coupling of sulfonimidamide 1 or 5 and isocyanate 2 to afford aminocarbonyl sulfonimidamide 4 via 3 or 6 after deprotection. As used in the schemes, rings “A” and “B” may be substituted as disclosed herein.

    ##STR00792##

    ##STR00793##

    ##STR00794##

    ##STR00795##

    ##STR00796##

    [3668] Scheme 4 below illustrates the coupling between sulfonimidamide 7 and isocyanate 2 to provide sulfonimidamide 8.

    ##STR00797##

    ##STR00798##

    [3669] Scheme 5 below illustrates the conversion of carboxylic acid 9 through Curtius rearrangement to isocyanate 2 via acyl azide 10, whereupon coupling between 2 and sulfonimidamide 5 affords aminocarbonyl sulfonimidamide 4.

    ##STR00799##

    [3670] Schemes for the Preparation of Sulfonimidamide Intermediates 1-29:

    [3671] Schemes below illustrate the preparation of sulfonamide intermediates.

    ##STR00800##

    ##STR00801##

    N′-(tert-butyl dim ethyl silyl)-4-(2-hydroxypropan-2-yl)-5-methylfuran-2-sulfonimidamide

    Step 1: Methyl 5-(chlorosulfonyl)-2-methylfuran-3-carboxylate

    [3672] Into a 500-mL 3-necked round-bottom flask was placed methyl 2-methylfuran-3-carboxylate (7 g, 50 mmol) in CHCl.sub.3 (200 mL). This was followed by the addition of chlorosulfonic acid (11.6 g, 100 mmol) dropwise with stirring at −10° C. The reaction mixture was stirred for 48 h at RT, after which the system was cooled to −10° C. Then to the above was added phosphorus pentachloride (22.9 g, 110 mmol). The resulting solution was stirred for 0.5 h at 50° C. and then was quenched by pouring onto 200 mL of water/ice. The resulting mixture was extracted with 3×200 mL of DCM. The organic layers were combined and dried over anhydrous Na.sub.2SO.sub.4, and then concentrated under vacuum. This resulted in 7.5 g (crude, 63%) of the title compound as light brown oil. The crude product was used in the next step.

    Step 2: Methyl 2-methyl-5-sulfamoylfuran-3-carboxylate

    [3673] Into a 250-mL round-bottom flask was placed a solution of methyl 5-(chlorosulfonyl)-2-methylfuran-3-carboxylate (7.5 g, crude) in DCM (75 mL). To the above was added a saturated solution of ammonia in DCM (50 mL). The resulting solution was stirred for 3 h at RT and then was concentrated under vacuum. The residue was applied onto a silica gel column and eluted with a gradient of ethyl acetate/petroleum ether (1:4 to 1:2). This resulted in 5.0 g (46% over two steps) of the title compound as a light yellow solid. MS-ESI: 218.0 (M−1).

    Step 3: 4-(2-Hydroxypropan-2-yl)-5-methylfuran-2-sulfonamide

    [3674] Into a 250-mL 3-necked round-bottom flask purged with and maintained under nitrogen was placed a solution of methyl 2-methyl-5-sulfamoylfuran-3-carboxylate (3.7 g, 16.9 mmol) in THF (100 mL). This was followed by the addition of MeMgBr (3 M in THF, 25 mL) dropwise with stirring at −10° C. The resulting mixture was stirred for 10 h at RT and then was quenched by the addition of 50 mL of NH.sub.4Cl (sat.). The resulting solution was extracted with 3×50 mL of ethyl acetate. The organic layers were combined and dried over anhydrous Na.sub.2SO.sub.4, then concentrated under vacuum. The residue was applied onto a silica gel column and eluted with a gradient of ethyl acetate/petroleum ether (1:3 to 1:1). This resulted in 2.6 g (75%) of the title compound as a light yellow solid. MS-ESI: 218.0 (M−1).

    Step 4: N-(tert-butyldimethylsilyl)-4-(2-hydroxypropan-2-yl)-5-methylfuran-2-sulfonamide

    [3675] Into a 250-mL round-bottom flask purged with and maintained under nitrogen was placed 4-(2-hydroxypropan-2-yl)-5-methylfuran-2-sulfonamide (1.0 g, 4.56 mmol), DCM (100 mL), 1H-imidazole (612 mg, 9.12 mmol), and TBSCl (3.4 g, 22.6 mmol). The resulting solution was stirred for 14 h at RT and then was diluted with 100 mL of water. The resulting mixture was extracted with 3×50 mL of DCM and the organic layers were combined and concentrated under vacuum. The residue was applied onto a silica gel column and eluted with a gradient of ethyl acetate/petroleum ether (1:10 to 1:3). This resulted in 1.4 g (92%) of the title compound as a white solid. MS-ESI: 332.0 (M−1).

    Step 5: N′-(tert-butyldimethylsilyl)-4-(2-hydroxypropan-2-yl)-5-methylfuran-2-sulfonimidamide

    [3676] Into a 250-mL 3-necked round-bottom flask purged with and maintained under nitrogen was placed PPh.sub.3Cl.sub.2 (3.0 g, 10.2 mmol) in CHCl.sub.3 (100 mL). This was followed by the addition of TEA (2.06 g, 20.4 mmol) dropwise with stirring at RT. After stirred at 0° C. for 10 min, to the above was added a solution of N-(tert-butyldimethylsilyl)-4-(2-hydroxypropan-2-yl)-5-methylfuran-2-sulfonamide (2.3 g, 6.8 mmol) in CHCl.sub.3 (10 mL) dropwise with stirring at 0° C. The resulting solution was allowed to react for 30 min at 0° C. To the mixture was added a saturated solution of ammonia in DCM (10 mL) at 0° C. The resulting solution was stirred for 2 h at RT. The reaction was then quenched by the addition of 100 mL of water. The resulting solution was extracted with 3×50 mL of DCM and the organic layers combined and concentrated under vacuum. The residue was applied onto a silica gel column and eluted with a gradient of ethyl acetate/petroleum ether (1:10 to 1:3). This resulted in 0.80 g (52.8%) of the title compound as a light yellow solid. MS-ESI: 333.0 (M+1).

    ##STR00802##

    ##STR00803##

    N′-(tert-butyldimethylsilyl)-5-(2-hydroxypropan-2-yl)thiazole-2-sulfonimidamide

    Step 1: Methyl 2-mercaptothiazole-5-carboxylate

    [3677] Into a 250-mL round-bottom flask was placed methyl 2-bromothiazole-5-carboxylate (10 g, 45 mmol), EtOH (100 mL), and sodium hydrogensulfide (5 g, 89 mmol). The resulting solution was stirred for 2 h at 80° C. and then was cooled to 0° C. with a water/ice bath. The pH value of the solution was adjusted to 3 with aq. HCl (1 N). The solids were collected by filtration. This resulted in 6 g (76%) of the title compound as a light yellow solid. MS-ESI: 176.0 (M+1).

    Step 2: Methyl 2-(chlorosulfonyl)thiazole-5-carboxylate

    [3678] Into a 250-mL round-bottom flask was placed methyl 2-mercaptothiazole-5-carboxylate (6 g, 34 mmol) and acetic acid (60 mL). This was followed by the addition of sodium hypochlorite (60 mL, 8%-10% wt.) in portions at 0° C. The resulting solution was stirred for 1 h at RT and then was diluted with 100 mL of water. The solution was extracted with 3×50 mL of DCM. The organic layers were combined and dried over anhydrous Na.sub.2SO.sub.4, then concentrated under vacuum. This resulted in 5 g (crude, 60%) of the title compound as yellow oil. The crude product was used in the next step.

    [3679] Step 3-6 used similar procedure for converting compound 12 to Intermediate 1 shown in Scheme 6 to afford Intermediate 2. MS-ESI: 336.1 (M+1)

    ##STR00804##

    ##STR00805##

    [3680] N′-(tert-butyl di methyl si lyl)-5-(2-hydroxypropan-2-yl)thiazole-2-sulfonimidamide

    Step 1: Methyl 2-mercaptothiazole-5-carboxylate

    [3681] Into a 2-L round-bottom flask was placed methyl 2-bromothiazole-5-carboxylate (100 g, 450 mmol), EtOH (1000 mL), sodium hydrogensulfide (50 g, 890 mmol). The resulting solution was stirred for 2 h at 80° C. and then was cooled to 0° C. with a water/ice bath. The pH value of the solution was adjusted to 3 with hydrogen chloride (1 N). The solids were collected by filtration. This resulted in 63.2 g (80%) of the title compound as a light yellow solid. MS-ESI: 176.0 (M+1).

    Step 2: Methyl 2-(chlorosulfonyl)thiazole-5-carboxylate

    [3682] Into a 1-L round-bottom flask was placed methyl 2-mercaptothiazole-5-carboxylate (30 g, 170 mmol) and acetic acid (300 mL). This was followed by the addition of sodium hypochlorite (300 mL, 8%-10% wt.) in portions at 0° C. The resulting solution was stirred for 2 h at RT and then was diluted with 500 mL of water. The solution was extracted with 3×300 mL of DCM and the combined organic layers were washed with 2×300 mL of brine and dried over anhydrous Na.sub.2SO.sub.4. The crude product as a yellow solution in DCM was used in the next step.

    Step 3: Methyl 2-sulfamoylthiazole-5-carboxylate

    [3683] Into a 2-L round-bottom flask was placed methyl 2-(chlorosulfonyl)thiazole-5-carboxylate as a crude solution in DCM (900 mL). To the solution was introduced NH.sub.3 (g) below 0° C. for 20 minutes. The resulting solution was stirred for 1 h at RT and then concentrated under vacuum. The residue was applied onto a silica gel column and eluted with ethyl acetate/petroleum ether (1:5 to 1:3). This resulted in 23 g (75%, 2 steps) of the title compound as a white solid. MS-ESI: 223.0 (M+1).

    Step 4: 5-(2-Hydroxypropan-2-yl)thiazole-2-sulfonamide

    [3684] Into a 500-mL round-bottom flask purged with and maintained under nitrogen was placed a solution of methyl 2-sulfamoylthiazole-5-carboxylate (15 g, 67.5 mmol) in THF (150 mL). This was followed by the addition of MeMgBr/THF (3 M, 90 mL) dropwise with stirring at 0° C. The resulting solution was stirred for 14 h at RT and then was quenched by the addition of 100 mL of NH.sub.4Cl (sat.). The resulting solution was extracted with 3×150 mL of DCM. The organic layers were combined and dried over anhydrous Na.sub.2SO.sub.4, then concentrated under vacuum. The residue was applied onto a silica gel column and eluted with ethyl acetate/petroleum ether (1:5 to 1:3). This resulted in 11.5 g (78%) of the title compound as a white solid. MS-ESI: 223.0 (M+1), 221.0 (M−1) in positive and negative ion mode, respectively.

    Step 5: N-(tert-butyldimethylsilyl)-5-(2-hydroxypropan-2-yl)thiazole-2-sulfonamide

    [3685] Into a 250-mL 3-necked round-bottom flask purged with and maintained under nitrogen was placed a solution of 5-(2-hydroxypropan-2-yl)thiazole-2-sulfonamide (5 g, 22.5 mmol) in THF (100 mL). Then to the above was added NaH (60% wt, 1.8 g, 45.0 mmol) in portions in an ice/water bath. After stirring for 20 minutes in a water/ice bath, this was followed by the addition of a solution of TBSCl (4.1 g, 27.2 mmol) in THF (10 mL) dropwise with stirring at 0° C. The resulting solution was stirred for 4 h at RT. The reaction was quenched with sat. NH.sub.4Cl (100 mL). The resulting solution was extracted with 3×100 mL of ethyl acetate and the combined organic layers were dried over Na.sub.2SO.sub.4 and concentrated under vacuum. The crude solid was washed with ethyl acetate/hexane (1:5) (2×100 mL). This resulted in 6.81 g (90%) of the title compound as a yellow solid. MS-ESI: 337.1 (M+1), 335.1 (M−1) in positive and negative ion mode, respectively.

    Step 6: N′-(tert-butyldimethylsilyl)-5-(2-hydroxypropan-2-yl)thiazole-2-sulfonimidamide

    [3686] Into a 100-mL 3-necked round-bottom flask purged with and maintained under nitrogen was placed a solution of PPh.sub.3Cl.sub.2 (3 g, 9.0 mmol) in CHCl.sub.3 (100 mL). This was followed by the addition of DIEA (1.54 g, 11.9 mmol) dropwise with stirring at RT. The resulting solution was stirred for 10 min at RT. This was followed by the addition of a solution of N-(tert-butyldimethylsilyl)-5-(2-hydroxypropan-2-yl)thiazole-2-sulfonamide (2.0 g, 5.9 mmol) in CHCl.sub.3 (30 mL) dropwise with stirring in an ice/water bath. The resulting solution was stirred for 30 min in an ice/water bath. To the above was introduced NH.sub.3 (g) below 0° C. for 15 minutes. The resulting solution was stirred for 20 minutes at RT. The solids were filtered out and the filtrate was concentrated and the residue was dissolved in 300 mL of ethyl acetate. The solution was washed with brine (2×100 mL), dried over Na.sub.2SO.sub.4 and concentrated under vacuum. The crude solid was washed with CHCl.sub.3 (100 mL). Then the filtrate was concentrated under vacuum and the residue was further purified by a silica gel column with ethyl acetate/petroleum ether (1:10 to 1:3). The original washed solid and solid from silica gel purification were combined. This resulted in 1.2 g (60%) of the title compound as a white solid. MS-ESI: 336.1 (M+1). .sup.1H-NMR (300 MHz, DMSO-d6) δ 7.66 (s, 1H), 7.12 (s, 2H), 5.78 (s, 1H), 1.51 (s, 6H), 0.86 (s, 9H), 0.02 (s, 3H), 0.01 (s, 3H).

    TABLE-US-00009 TABLE 2 The Intermediate in the following Table was prepared using the similar procedures for converting compound 16 to Intermediate 2 shown in Scheme 7B starting from ethyl 5-bromo-4-methylthiazole-2-carboxylate. Exact Intermediate # Structure IUPAC Name Mass[M + H].sup.+ Intermediate 3 [00806]embedded image N′-(tert-butyldimethylsilyl)-2-(2- hydroxypropan-2-yl)-4- methylthiazole-5-sulfonimidamide 350.2

    ##STR00807##

    ##STR00808##

    N′-(tert-butyldimethyl silyl)-4-(2-hydroxypropan-2-yl)-5-methylthiophene-2-sulfonimidamide

    [3687] Steps 1-3 used similar procedures for converting compound 11 to compound 14 shown in Scheme 6 to afford compound 25 from compound 22. MS-ESI: 234.0 (M−1).

    [3688] Steps 4-5 used similar procedure for converting compound 20 to Intermediate 2 shown in Scheme 7B to afford Intermediate 4 from compound 25. MS-ESI: 349.1 (M+1).

    TABLE-US-00010 TABLE 3 The Intermediate in the following Table was prepared using similar procedure as shown in Scheme 8 above for converting compound 22 to Intermediate 4 starting from the appropriate materials. Exact Intermediate # Structure IUPAC Name Mass[M + H].sup.+ Intermediate 5 [00809]embedded image N′-(tert-butyldimethylsilyl)-5-(2- hydroxypropan-2-yl)thiophene-2- sulfonimidamide 335.1 Intermediate 6 [00810]embedded image N′-(tert-butyldimethylsilyl)-4-(2- hydroxypropan-2-yl)thiophene-2- sulfonimidamide 335.1 Intermediate 7 [00811]embedded image N′-(tert-butyldimethylsilyl)-5-(2- hydroxypropan-2-yl)-3- methylthiophene-2-sulfonimidamide 349.1 Intermediate 8 [00812]embedded image N′-(tert-butyldimethylsilyl)-5-(2- hydroxypropan-2-yl)-4- methylthiophene-2-sulfonimidamide 349.1 Intermediate 9 [00813]embedded image N′-(tert-butyldimethylsilyl)-3-fluoro- 5-(2-hydroxypropan-2-yl)thiophene- 2-sulfonimidamide 353.1 Intermediate 10 [00814]embedded image N′-(tert-butyldimethylsilyl)-4-(2- hydroxypropan-2-yl)furan-2- sulfonimidamide 319.1

    ##STR00815##

    ##STR00816##

    N′-(tert-butyldimethyl silyl)-2-fluoro-4-(2-hydroxypropan-2-yl)benzene sulfonimidamide

    Step 1: Methyl 4-(chlorosulfonyl)-3-fluorobenzoate

    [3689] Into a 1 L round-bottom flask was placed a solution of methyl 4-amino-3-fluorobenzoate (10 g, 59.1 mmol) in aq. HCl (6 N, 200 mL). This was followed by the addition of a solution of NaNO.sub.2 (6.1 g, 88.8 mmol) in water (20 mL) dropwise with stirring at 0° C. The resulting solution was stirred for 30 min at 0° C. The above mixture was added to a saturated solution of SO.sub.2 in AcOH (200 mL) dropwise with stirring at 0° C. Then to the above was added CuCl.sub.2 (8.0 g, 59.6 mmol). The resulting solution was stirred for 1 h at RT and was then quenched by the addition of 200 mL of water. The resulting solution was extracted with 3×200 mL of DCM. The organic layers were combined, dried over anhydrous Na.sub.2SO.sub.4 and concentrated under vacuum. This resulted in 10 g (67%) of the title compound as yellow oil. The product was used in the next step without further purification.

    Step 2: Methyl 3-fluoro-4-sulfamoylbenzoate

    [3690] Into a 1000 mL round bottom flask was placed a solution of methyl 4-(chlorosulfonyl)-3-fluorobenzoate solution (10 g, 39.5 mmol) in DCM (50 mL). This was followed by the addition of a saturated solution of ammonia in DCM (500 mL) in portions with stirring at 0° C. The resulting solution was stirred for 1 h at 0° C. The resulting solution was concentrated and the residue was purified with SiO.sub.2-gel column and diluted with ethyl acetate/petroleum ether (1:2 to 1:1). This resulted in 8.28 g (90%) of the title compound as yellow solid. MS-ESI: 232.1 (M−1).

    Step 3: 2-Fluoro-4-(2-hydroxypropan-2-yl)benzenesulfonamide

    [3691] Into a 1 L 3-necked round-bottom flask was placed a solution of methyl 3-fluoro-4-sulfamoylbenzoate (8.28 g 35.5 mmol) in THF (500 mL). This was followed by the addition of MeMgBr/THF (3 M, 60 mL) dropwise with stirring at 0° C. The resulting solution was stirred overnight at RT and then was quenched by the addition of 100 mL of sat. NH.sub.4C.sub.1. The resulting solution was extracted with 3×200 mL of ethyl acetate and the combined organic layers were concentrated under vacuum. The residue was applied onto a silica gel column and eluted with ethyl acetate/petroleum ether (1:2 to 1:1). This resulted 7.45 g (89.9%) of the title compound as a white solid. MS-ESI: 233.1 (M+1).

    Step 4: N-(tert-butyldimethylsilyl)-2-fluoro-4-(2-hydroxypropan-2-yl)benzenesulfonamide

    [3692] Into a 500 mL round bottom flask was placed a solution of 2-fluoro-4-(2-hydroxypropan-2-yl)benzenesulfonamide (7.45 g 31.9 mmol) in THF (200 mL). This was followed by the addition of NaH (60% wt, 1.91 g, 79.6 mmol). The mixture was stirred at 0° C. for 0.5 h. This was followed by the addition of the solution of TBSC1 (7.19 g, 47.9 mmol) in THF (50 mL) dropwise. The resulting solution was stirred at RT overnight. The reaction was quenched with ice-water (100 mL); the resulting solution was extracted with EtOAc (3×200 mL). The combined organic layers were dried over anhydrous Na.sub.2SO.sub.4 and concentrated under vacuum. The residue was purified with SiO.sub.2-gel column and eluted with ethyl acetate/petroleum ether (1:5 to 1:2). This resulted 10 g (90%) of the title compound as a white solid. MS-ESI: 348.1 (M+1).

    Step 5: N′-(tert-butyldimethylsilyl)-2-fluoro-4-(2-hydroxypropan-2-yl)benzenesulfonimidamide

    [3693] Into a 1 L 3-necked round-bottom flask purged with and maintained under nitrogen was placed a solution of PPh.sub.3Cl.sub.2 (19.2 g, 57.6 mmol) in CHCl.sub.3 (100 mL). This was followed by the addition of DIEA (7.4 g, 57.6 mmol) dropwise with stirring at 0° C. After stirred at 0° C. for 10 min, to the above was added a solution of N′-(tert-butyldimethylsilyl)-2-fluoro-4-(2-hydroxypropan-2-yl)benzenesulfonimidamide (10 g, 28.8 mmol) in CHCl.sub.3 (100 mL) dropwise with stirring at 0° C. The resulting solution was allowed to react for 30 min at 0° C. To the mixture was added a saturated solution of ammonia in DCM (500 mL) at 0° C. The resulting solution was stirred for 2 h at RT. The solids were filtered out, and the filtrate was dilute with 100 mL of water. The resulting solution was extracted with 3×200 mL of DCM and the combined organic layers were dried over anhydrous Na.sub.2SO.sub.4 concentrated under vacuum. The residue was applied onto a silica gel column and eluted with a gradient of ethyl acetate/petroleum ether (1:10 to 1:3). This resulted in 5 g (50%) of the title compound as a light yellow solid. MS-ESI: 347.2 (M+1).

    TABLE-US-00011 TABLE 4 The Intermediates in the following Table were prepared using similar procedure as shown in Scheme 9 above for converting compound 27 to Intermediate 11 starting from the appropriate materials. Exact Intermediate # Structure IUPAC Name Mass[M + H].sup.+ Intermediate 12 [00817]embedded image N′-(tert-butyldimethylsilyl)-4-(2- hydroxypropan-2-yl)-2- methylbenzenesulfonimidamide 343.2 Intermediate 13 [00818]embedded image N′-(tert-butyldimethylsilyl)-3-(2- hydroxypropan-2-yl) benzenesulfonimidamide 329.1 Intermediate 14 [00819]embedded image N′-(tert-butyldimethylsilyl)-4-(2- hydroxypropan-2-yl)-3- methylbenzenesulfonimidamide 343.2 Intermediate 15 [00820]embedded image N′-(tert-butyldimethylsilyl)-4- fluoro-3-(2-hydroxypropan-2- yl)benzenesulfonimidamide 347.2 Intermediate 16 [00821]embedded image N′-(tert-butyldimethylsilyl)-3- fluoro-5-(2-hydroxypropan-2- yl)benzenesulfonimidamide 347.2 Intermediate 17 [00822]embedded image N′-(tert-butyldimethylsilyl)- 3-fluoro-4-(2-hydroxypropan-2- yl)benzenesulfonimidamide 347.2 Intermediate 18 [00823]embedded image N′-(tert-butyldimethylsilyl)- 2-chloro-4-(2-hydroxypropan- 2-yl)benzenesulfonimidamide 363.1

    TABLE-US-00012 TABLE 5 The Intermediate in the following Table was prepared using similar procedure as shown in Scheme 9 above for converting compound 28 to Intermediate 11 starting from methyl 4-(chlorosulfonyl)benzoate. Exact Intermediate # Structure IUPAC Name Mass[M + H].sup.+ Intermediate 19 [00824]embedded image N′-(tert-butyldimethylsilyl)-4- (2-hydroxypropan-2-yl) benzenesulfonimidamide 329.2

    ##STR00825##

    ##STR00826##

    N′-(tert-butyldimethylsilyl)-1-isopropyl-1H-pyrazole-3-sulfonimidamide Step 1: 1-Isopropyl-3-nitro-1H-pyrazole

    [3694] Into a 250-mL round-bottom flask was placed a solution of 3-nitro-1H-pyrazole (10 g, 88.4 mmol) in DMF (100 mL). This was followed by the addition of NaH (60% wt., 3.9 g, 97.5 mmol) in portions at 0° C. The resulting solution was stirred for 0.5 h at 0° C. This was followed by the addition of 2-bromopropane (14.1 g, 114.6 mmol) dropwise with stirring at 0° C. in 10 min. The resulting solution was stirred for 16 h at RT and then was quenched by the addition of 100 mL of water. The resulting solution was extracted with 3×100 mL of ethyl acetate. The organic layers were combined and dried over anhydrous Na.sub.2SO.sub.4, then concentrated under vacuum. The residue was applied onto a silica gel column and eluted with a gradient of ethyl acetate/petroleum ether (1:5 to 1:3). This resulted in 11.8 g (86%) of the title compound as yellow oil. MS-ESI: 156.1 (M+1).

    Step 2: 3-Amino-1-(propan-2-yl)-1H-pyrazole

    [3695] Into a 250-mL round-bottom flask was placed a solution of 1-isopropyl-3-nitro-1H-pyrazole (10.8 g, 69.6 mmol) in MeOH (100 mL). Then Pd/C (10% wt., 1.5 g) was added. The flask was evacuated and flushed three times with hydrogen. The mixture was stirred for 24 h at RT under an atmosphere of hydrogen. The solids were filtered out. The resulting filtrate was concentrated under vacuum. This resulted in 7.27 g (83%) of the title compound as yellow oil. MS-ESI: 126.1 (M+1).

    [3696] Steps 3-4 used similar procedures for converting compound 27 to compound 29 shown in Scheme 9 to afford compound 50 from compound 48. MS-ESI: 188.0 (M−1).

    [3697] Steps 5-6 were using the similar procedures for converting compound 30 to Intermediate 11 shown in Scheme 9 to afford Intermediate 18 from compound 50. MS-ESI: 303.2 (M+1).

    TABLE-US-00013 TABLE 6 The Intermediate in the following Table was prepared using similar procedure as shown in Scheme 10 above for converting compound 48 to Intermediate 18 starting from the appropriate materials. Exact Intermediate # Structure IUPAC Name Mass[M + H].sup.+ Intermediate 21 [00827]embedded image N′-(tert-butyldimethylsilyl)-4- (methylsulfonyl) benzenesulfonimidamide 349.1 Intermediate 22 [00828]embedded image N′-(tert-butyldimethylsilyl)-3- (methylsulfonyl) benzenesulfonimidamide 349.1

    ##STR00829## ##STR00830##

    ##STR00831##

    N′-(tert-butyldimethylsilyl)-4-((dimethylamino)methyl)benzenesulfonimidamide

    Step 1: 4-Nitrobenzoyl Chloride

    [3698] Into a 500-mL round-bottom flask was placed 4-nitrobenzoic acid (20 g, 120 mmol), DCM (200 mL), and DMF (0.2 mL). This was followed by the addition of oxalyl chloride (15 mL, 177.1 mmol) dropwise with stirring at 0° C. The resulting solution was stirred for 4 h at RT and then was concentrated under vacuum. This resulted in 22 g (crude) of the title compound as yellow oil. The crude product was used in the next step.

    Step 2: N,N-dimethyl-4-nitrobenzamide

    [3699] Into a 500-mL round-bottom flask was placed dimethylamine hydrochloride (6.5 g, 79.7 mmol), DCM (200 mL), and TEA (50 mL). This was followed by the addition of 4-nitrobenzoyl chloride (22 g, 119 mmol) dropwise with stirring at 0° C. The resulting solution was stirred for 6 h at RT and then was concentrated under vacuum. The resulting mixture was washed with 2×50 mL of water. The solids were collected by filtration. This resulted in 16 g (69% over two steps) of the title compound as a white solid. MS-ESI: 195.1 (M+1).

    Step 3: 4-Amino-N,N-dimethylbenzamide

    [3700] Into a 250-mL round-bottom flask was placed N,N-dimethyl-4-nitrobenzamide (16 g, 82.4 mmol), MeOH (100 mL). Then Pd/C (10% wt., 1 g) was added. The flask was evacuated and flushed three times with hydrogen. The resulting solution was stirred for 12 h at RT under an atmosphere of hydrogen. The solids were filtered out. The resulting filtrate was concentrated under vacuum. This resulted in 13 g (96%) of the title compound as a white solid. MS-ESI: 165.1 (M+1). Steps 4-5 used similar procedures for converting compound 27 to compound 29 shown in Scheme 9 to afford compound 43 from compound 41. MS-ESI: 229.1 (M+1).

    Step 6: 4-((Dimethylamino)methyl)benzenesulfonamide

    [3701] Into a 100-mL round-bottom flask purged with and maintained under nitrogen was placed a solution of N,N-dimethyl-4-sulfamoylbenzamide (1.8 g, 7.9 mmol) in THF (50 mL). This was followed by the addition of 9-BBN (5.8 g) in portions at 0° C. The resulting solution was stirred for 12 h at 70° C. and then was quenched by the addition of 20 mL of water/ice. The resulting solution was extracted with 3×100 mL of ethyl acetate and the organic layers were combined. The resulting mixture was washed with 200 mL of water and then the organic layer was concentrated under vacuum. The residue was applied onto a silica gel column and eluted with a gradient of DCM/MeOH (20:1 to 15:1). This resulted in 1 g (59%) of the title compound as a white solid. MS-ESI: 215.1 (M+1).

    [3702] Steps 7-8 were using the similar procedures for converting compound 30 to Intermediate 11 shown in Scheme 9 to afford Intermediate 23 from compound 44. MS-ESI: 328.2 (M+1).

    ##STR00832##

    ##STR00833##

    N′-(tert-butyldimethylsilyl)-3-((dimethylamino)methyl)benzenesulfonimidamide

    Step 1: 3-amino-N,N-dimethylbenzamide

    [3703] Into a 1000-mL round-bottom flask was placed dimethylamine as a hydrochloride salt (16.3 g, 200 mmol) in DCM (500 mL), DIEA (25.83 mg, 200 mmol). To the above was added 3-aminobenzoic acid (13.7 g, 100 mmol), HATU (57 g, 150 mmol). The resulting solution was stirred for 1 h at RT. The reaction was then quenched by the addition of 500 mL of NH.sub.4Cl (aq.). The resulting solution was extracted with 3×500 ml of ethyl acetate and the organic layers combined and dried over anhydrous sodium sulfate and concentrated. The residue was applied onto a silica gel column and eluted with a gradient of DCM/methanol (50:1 to 20:1). This resulted in 13.14 g (80%) of the title compound as a yellow solid. MS-ESI: 165.1 (M+1).

    [3704] Steps 2-6 used the similar procedures for converting compound 41 to Intermediate 23 shown in Scheme 11 to afford Intermediate 24 from compound 47. MS-ESI: 328.2 (M+1).

    ##STR00834## ##STR00835##

    ##STR00836##

    [3705] N′-(tert-butyldimethylsilyl)-4-((dimethylamino)methyl)-2-fluorobenzenesulfonimidamide Steps 1-5 used similar procedures for converting compound 38 to compound 43 shown in Scheme 11 to afford compound 57. MS-ESI: 247.0 (M+1).

    Step 6: 4-((Dimethylamino)methyl)-2-fluorobenzenesulfonamide

    [3706] Into a 1-L round-bottom flask was placed a solution of 3-fluoro-N,N-dimethyl-4-sulfamoylbenzamide (19.3 g, 78.4 mmol) in THF (200 mL). This was followed by the addition of LiAlH.sub.4 (8.8 g, 231.9 mmol) in portions at 0° C. The resulting solution was stirred for 12 h at RT and then was quenched by the addition of 10 mL of water. The resulting mixture was concentrated under vacuum. The residue was applied onto a silica gel column and eluted with a gradient of ethyl acetate/petroleum ether (6:1 to 8:1). This resulted in 7.0 g (38%) of the title compound as a white solid. MS-ESI: 233.1 (M+1).

    [3707] Steps 7-8 used similar procedures for converting compound 44 to Intermediate 23 shown in Scheme 11 to afford Intermediate 25. MS-ESI: 346.2 (M+1).

    ##STR00837## ##STR00838##

    ##STR00839##

    N′-(tert-butyldimethyl silyl)-4-(2-hydroxypropan-2-yl)thiazole-2-sulfonimidamide

    Step 1: (2-Bromothiazol-4-yl)methanol

    [3708] Into a 500-mL round-bottom flask was placed a solution of ethyl 2-bromothiazole-4-carboxylate (14 g, 59.3 mmol), EtOH (200 mL). This was followed by the addition of NaBH.sub.4 (2.3 g, 60.5 mmol) in portions at 0° C. The resulting solution was stirred for 3 h at RT and then was quenched by the addition of 100 mL of water. The resulting solution was extracted with 2×200 mL of DCM. The organic layers were combined, dried over anhydrous Na.sub.2SO.sub.4 and then concentrated under vacuum. This resulted in 10.0 g (87%) of the title compound as colorless oil. MS-ESI: 195.9, 193.9 (M+1).

    Step 2: 2-Bromothiazole-4-carbaldehyde

    [3709] Into a 250-mL round-bottom flask was placed a solution of (2-bromothiazol-4-yl)methanol (10.0 g, 51.5 mmol) in DCM (100 mL). To the solution was added Dess-Martin reagent (24.0 g, 56.6 mmol). The resulting solution was stirred for 2 h at RT and then was concentrated under vacuum. The residue was applied onto a silica gel column and eluted with a gradient of ethyl acetate/petroleum ether (1:50 to 1:20). This resulted in 8.0 g (81%) of the title compound as yellow oil. MS-ESI: 193.9, 191.9 (M+1).

    Step 3: 1-(2-Bromothiazol-4-yl)ethanol

    [3710] Into a 250-mL 3-necked round-bottom flask purged with and maintained under nitrogen was placed a solution of 2-bromothiazole-4-carbaldehyde (8 g, 41.7 mmol) in THF (100 mL). This was followed by the addition of MeMgBr (3 M in THF, 15 mL) dropwise with stirring at 0° C. The resulting solution was stirred for 2 h at RT and then was quenched by the addition of 100 mL of NH.sub.4Cl (sat.). The resulting solution was extracted with 3×100 mL of DCM and the combined organic layers were concentrated under vacuum. The residue was applied onto a silica gel column and eluted with a gradient of ethyl acetate/petroleum ether (1:10 to 1:5). This resulted in 6.0 g (69%) of the title compound as brown oil. MS-ESI: 209.9, 207.9 (M+1).

    Step 4: 2-Bromo-4-(1-(tert-butyldiphenylsilyloxy)ethyl)thiazole

    [3711] Into a 250-mL round-bottom flask was placed a solution of 1-(2-bromothiazol-4-yl)ethanol (6.0 g, 28.8 mmol) and 1H-imidazole (4.0 g, 58.8 mmol) in DMF (50 mL). To the solution was added TBDPSCl (8.7 g, 31.6 mmol). The resulting solution was stirred for 12 h at RT and then was diluted with 100 mL of water. The resulting solution was extracted with 3×100 mL of DCM and the combined organic layers were concentrated under vacuum. The residue was applied onto a silica gel column and eluted with a gradient of ethyl acetate/petroleum ether (1:100 to 1:50). This resulted in 10.0 g (78%) of the title compound as light yellow oil. MS-ESI: 448.1, 446.1 (M+1).

    Step 5: 4-(1-(Tert-butyldiphenylsilyloxy)ethyl)thiazole-2-sulfonyl chloride

    [3712] Into a 250-mL 3-necked round-bottom flask purged with and maintained under nitrogen was placed a solution of 2-bromo-4-(1-(tert-butyldiphenylsilyloxy)ethyl)thiazole (10.0 g, 22.4 mmol) in THF (100 mL). This was followed by the addition of n-BuLi (2.5 M in THF, 11 mL) dropwise with stirring at −78° C. The resulting solution was stirred for 30 min at −78° C. To the above SO.sub.2 gas was introduced. The reaction was warmed to RT and stirred for 30 min and then was concentrated under vacuum. The residue was dissolved in DCM (100 mL) and then NCS (3.6 g, 26.9 mmol) was added. The resulting solution was stirred for 30 min at RT and then was concentrated under vacuum. This resulted in 8.0 g (crude, 77%) of the title compound as a white solid. The crude product was used in the next step.

    Step 6: N-tert-butyl-4-(1-(tert-butyldiphenylsilyloxy)ethyl)thiazole-2-sulfonamide

    [3713] Into a 100-mL round-bottom flask purged with and maintained under nitrogen was placed a solution of 4-(1-(tert-butyldiphenylsilyloxy)ethyl)thiazole-2-sulfonyl chloride (8.0 g, 17.2 mmol) in DCM (50 mL). To the solution were added TEA (3.5 g, 34.6 mmol) and 2-methylpropan-2-amine (1.9 g, 26.0 mmol). The resulting solution was stirred for 2 h at RT and then was concentrated under vacuum. The residue was applied onto a silica gel column and eluted with a gradient of ethyl acetate/petroleum ether (1:15 to 1:5). This resulted in 8.0 g (71%, 2 steps) of the title compound as brown oil. MS-ESI: 503.2 (M+1).

    Step 7: N-tert-butyl-4-(1-hydroxyethyl)thiazole-2-sulfonamide

    [3714] Into a 250-mL round-bottom flask was placed a solution of N-tert-butyl-4-(1-(tert-butyldiphenylsilyloxy)ethyl)thiazole-2-sulfonamide (8.0 g, 15.9 mmol) in THF (100 mL). To the solution was added TBAF (9.6 g, 292.5 mmol). The resulting solution was stirred for 2 h at RT and then was diluted with 100 mL of water. The resulting solution was extracted with 3×100 mL of DCM and the combined organic layers were concentrated under vacuum. The residue was applied onto a silica gel column and eluted with a gradient of ethyl acetate/petroleum ether (1:10 to 1:3). This resulted in 4.0 g (95%) of the title compound as light yellow oil. MS-ESI: 265.1 (M+1).

    Step 8: 4-Acetyl-N-tert-butylthiazole-2-sulfonamide

    [3715] Into a 100-mL round-bottom flask was placed a solution of N-tert-butyl-4-(1-hydroxyethyl)thiazole-2-sulfonamide (4.0 g, 15.1 mmol) in DCM (50 mL). To the solution was added Dess-Martin reagent (7.1 g, 16.6 mmol). The resulting solution was stirred for 2 h at RT and then was concentrated under vacuum. The residue was applied onto a silica gel column and eluted with a gradient of ethyl acetate/petroleum ether (1:10 to 1:3). This resulted in 3.5 g (88%) of the title compound as light yellow oil. MS-ESI: 363.0 (M+1).

    Step 9: 4-Acetylthiazole-2-sulfonamide

    [3716] Into a 100-mL round-bottom flask was placed a solution of 4-acetyl-N-tert-butylthiazole-2-sulfonamide (3.5 g, 13.3 mmol) in DCM (5 mL). To the solution was added TFA (20 mL). The resulting solution was stirred for 14 h at 40° C. and then was concentrated under vacuum. The residue was applied onto a silica gel column and eluted with a gradient of ethyl acetate/petroleum ether (1:10 to 1:3). This resulted in 2.5 g (91%) of the title compound as a gray solid. MS-ESI: 207.0 (M+1).

    [3717] Steps 10-12 used similar procedures for converting compound 29 to Intermediate 11 shown in Scheme 9 to afford Intermediate 26 from compound 69. MS-ESI: 336.1 (M+1).

    ##STR00840## ##STR00841##

    ##STR00842##

    N′-(tert-butyldimethylsilyl)-2-(2-hydroxypropan-2-yl)thiazole-5-sulfonimidamide

    Step 1: 1-(Thiazol-2-yl)ethanol

    [3718] Into a 500-mL round-bottom flask was placed 1-(thiazol-2-yl)ethanone (20 g, 157 mmol), EtOH (200 mL). This was followed by the addition of NaBH.sub.4 (3 g, 81.3 mmol) in portions at 0° C. The resulting solution was stirred for 2 h at RT and then was quenched by the addition of 10 mL of NH.sub.4Cl (sat.). The resulting solution was diluted with 200 mL of water and extracted with 2×200 mL of DCM. The organic layers were combined and dried over anhydrous Na.sub.2SO.sub.4, then concentrated under vacuum. This resulted in 20 g (98%) of the title compound as light yellow oil. MS-ESI: 130.0 (M+1).

    Step 2: 2-(1-(Tert-butyldiphenylsilyloxy)ethyl)thiazole

    [3719] Into a 500-mL round-bottom flask was placed 1-(thiazol-2-yl)ethanol (20 g, 154.8 mmol), DMF (150 mL), 1H-imidazole (20.5 g, 301 mmol). This was followed by the addition of TBDPSCl (46 g, 167 mmol) dropwise with stirring at 0° C. The resulting solution was stirred for 2 h at RT and then was diluted with 300 mL of water. The resulting solution was extracted with 3×200 mL of DCM. The organic layers were combined and concentrated under vacuum. The residue was applied onto a silica gel column and eluted with a gradient of ethyl acetate/petroleum ether (1:100 to 1:80). This resulted in 55 g (97%) of the title compound as colorless oil. MS-ESI: 368.1 (M+1).

    Step 3: 2-(1-(Tert-butyldiphenylsilyloxy)ethyl)thiazole-5-sulfonyl chloride

    [3720] Into a 500-mL 3-necked round-bottom flask purged with and maintained under nitrogen was placed a solution of 2-(1-(tert-butyldiphenylsilyloxy)ethyl)thiazole (30 g, 81.6 mmol) in THF (200 mL). This was followed by the addition of n-BuLi (2.5 M in THF, 35.2 mL) dropwise with stirring at −78° C. The resulting solution was stirred for 0.5 h at −78° C. and then SO.sub.2 was introduced into the above reaction mixture. The reaction was slowly warmed to RT and then NCS (12.8 g, 95.86 mmol) was added. The resulting solution was stirred for 1 h at RT. The solids were filtered out. The resulting filtrate was concentrated under vacuum. This resulted in 30 g (crude, 79%) of the title compound as brown oil. The crude product was used in the next step.

    Step 4: N-tert-butyl-2-(1-(tert-butyldiphenylsilyloxy)ethyl)thiazole-5-sulfonamide

    [3721] Into a 500-mL round-bottom flask was placed 2-(1-(tert-butyldiphenylsilyloxy)ethyl)thiazole-5-sulfonyl chloride (crude, 30 g, 64.37 mmol), DCM (200 mL), TEA (13 g, 128.47 mmol). This was followed by the addition of 2-methylpropan-2-amine (5.6 g, 76.6 mmol) dropwise with stirring at 0° C. The resulting solution was stirred for 2 h at RT and then was concentrated under vacuum. The residue was applied onto a silica gel column and eluted with a gradient of ethyl acetate/petroleum ether (1:30 to 1:20). This resulted in 25 g (61% over two steps) of the title compound as brown oil. MS-ESI: 503.2 (M+1).

    Step 5: N-tert-butyl-2-(1-hydroxyethyl)thiazole-5-sulfonamide

    [3722] Into a 500-mL round-bottom flask was placed N-tert-butyl-2-(1-(tert-butyldiphenylsilyloxy)ethyl)thiazole-5-sulfonamide (25 g, 49.7 mmol), THF (200 mL), TBAF (30 g, 99.67 mmol). The resulting solution was stirred for 2 h at RT and then was diluted with 200 mL of water. The resulting solution was extracted with 3×200 mL of DCM. The organic layers were combined and concentrated under vacuum. The residue was applied onto a silica gel column and eluted with a gradient of ethyl acetate/petroleum ether (1:20 to 1:10). This resulted in 12 g (91%) of the title compound as light yellow oil. MS-ESI: 265.1 (M+1).

    Step 6: 2-Acetyl-N-tert-butylthiazole-5-sulfonamide

    [3723] Into a 500-mL round-bottom flask was placed N-tert-butyl-2-(1-hydroxyethyl)thiazole-5-sulfonamide (12 g, 45.4 mmol), DCM (200 mL). To this solution was added Dess-Martin reagent (20 g, 47.2 mmol) in portions at RT. The resulting solution was stirred for 2 h at RT and then was concentrated under vacuum. The residue was applied onto a silica gel column and eluted with a gradient of ethyl acetate/petroleum ether (1:20 to 1:10). This resulted in 9 g (76%) of the title compound as a light yellow solid. MS-ESI: 263.0 (M+1).

    Step 7: 2-Acetylthiazole-5-sulfonamide

    [3724] Into a 100-mL round-bottom flask was placed 2-acetyl-N-tert-butylthiazole-5-sulfonamide (7 g, 26.7 mmol), TFA (20 mL). The resulting solution was stirred for 14 h at 70° C. and then was concentrated under vacuum. The residue was applied onto a silica gel column and eluted with a gradient of ethyl acetate/petroleum ether (1:5 to 1:3). This resulted in 5 g (91%) of the title compound as a yellow solid. MS-ESI: 207.0 (M+1).

    Step 8: 2-(2-Hydroxypropan-2-yl)thiazole-5-sulfonamide

    [3725] Into a 500-mL 3-necked round-bottom flask purged with and maintained under nitrogen was placed 2-acetylthiazole-5-sulfonamide (5 g, 24.3 mmol), THF (100 mL). This was followed by the addition of MeMgBr (3 M in THF, 8.1 mL, 24.3 mmol) dropwise with stirring at 0° C. The resulting solution was stirred for 14 h at RT and then was quenched by the addition of 100 mL of NH.sub.4Cl (sat.). The resulting solution was extracted with 2×150 mL of DCM. The organic layers were combined and concentrated under vacuum. The residue was applied onto a silica gel column and eluted with a gradient of ethyl acetate/petroleum ether (1:5 to 1:3). This resulted in 2.9 g (54%) of the title compound as a light yellow solid. MS-ESI: 223.0 (M+1).

    [3726] Steps 9-10 used similar procedures for converting compound 14 to Intermediate 1 shown in Scheme 6 to afford Intermediate 27 from compound 80. MS-ESI: 336.1 (M+1).

    ##STR00843##

    ##STR00844##

    N′-(tert-butyldimethyl silyl)-2-(2-hydroxypropan-2-yl)thiazole-5-sulfonimidamide

    Step 1: 2-(2-Methyl-1,3-dioxolan-2-yl)thiazole

    [3727] Into a 500-mL round-bottom flask was placed a solution of 1-(thiazol-2-yl)ethanone (20 g, 157.0 mmol) in toluene (300 mL) and ethane-1,2-diol (19.5 g, 314 mmol). To the solution was added TsOH (2.7 g, 15.7 mmol). The resulting solution was refluxed overnight and water was separated from the solution during the reflux. The resulting solution was diluted with 200 mL of water and extracted with 2×100 mL of ethyl acetate. The organic layers were combined, dried over anhydrous Na.sub.2SO.sub.4, and then concentrated under vacuum. This resulted in 26.6 g (99%) of the title compound as light yellow oil. MS-ESI: 172.0 (M+1).

    Step 2: 2-(2-Methyl-1,3-dioxolan-2-yl)thiazole-5-sulfonamide

    [3728] Into a 500-mL 3-necked round-bottom flask purged with and maintained under nitrogen was placed a solution of 2-(2-methyl-1,3-dioxolan-2-yl)thiazole (14 g, 81.6 mmol) in THF (200 mL). This was followed by the addition of n-BuLi (2.5 M in THF, 35.2 mL, 88.0 mmol) dropwise with stirring at −78° C. The resulting solution was stirred for 0.5 h at −78° C. and then SO.sub.2 was introduced into the above reaction mixture. The reaction was slowly warmed to RT and then NCS (12.8 g, 95.86 mmol) was added. The resulting solution was stirred for 1 h at RT. The solids were filtered out. The resulting filtrate was concentrated under vacuum and then was diluted in DCM (160 mL). To the above was added a saturated solution of ammonia in DCM (300 mL). The resulting solution was stirred for 3 h at RT and then was concentrated under vacuum. The residue was applied onto a silica gel column and eluted with a gradient of ethyl acetate/petroleum ether (1:20 to 1:5). This resulted in 12.5 g (61%) of the title compound as a yellow solid. MS-ESI: 251.0 (M+1).

    Step 3: 2-Acetylthiazole-5-sulfonamide

    [3729] Into a 250-mL round-bottom flask was placed a solution of 2-(2-methyl-1,3-dioxolan-2-yl)thiazole-5-sulfonamide (12.5 g, 50.0 mmol) in THF (125 mL). To the above was added aq. HCl (4 N, 50.0 mL). The resulting solution was stirred for 6 h at 70° C. The resulting solution was diluted with 100 mL of water and extracted with 2×200 mL of ethyl acetate. The organic layers were combined, dried over anhydrous Na.sub.2SO.sub.4, then concentrated under vacuum. The residue was applied onto a silica gel column and eluted with a gradient of ethyl acetate/petroleum ether (1:2 to 1:1). This resulted in 9.3 g (90%) of the title compound as a yellow solid. MS-ESI: 207.0 (M+1). Steps 4-6 used the same procedures for converting compound 19 to Intermediate 2 shown in Scheme 7B to afford Intermediate 27 from compound 84. MS-ESI: 336.1 (M+1).

    ##STR00845##

    ##STR00846##

    N′-(tert-butoxycarbonyl)-2-(2-hydroxypropan-2-yl)thiazole-5-sulfonimidamide

    Step 1: 2-(Thiazol-2-yl)propan-2-ol

    [3730] Into a 10-L 4-necked round-bottom flask purged with and maintained under nitrogen was placed a solution of 1-(thiazol-2-yl)ethanone (200 g, 1.6 mol) in THF (4 L). This was followed by the addition of MeMgBr (3 M in THF, 942 mL) dropwise with stirring at 0° C. The mixture was stirred at 0° C. for 2 h. After warmed the mixture to RT, the solution was stirred for an additional 16 h. Then the reaction was quenched by the addition of 3 L of NH.sub.4Cl (sat.). The resulting solution was extracted with 3×1 L of ethyl acetate. The organic layers were combined, dried over anhydrous Na.sub.2SO.sub.4, then concentrated under vacuum. The residue was applied onto a silica gel column and eluted with a gradient of ethyl acetate/petroleum ether (1:3 to 1:1). This resulted in 210 g (93%) of the title compound as a brown oil. MS-ESI: 144.0 (M+1).

    Step 2: Lithium 2-(2-hydroxypropan-2-yl)thiazole-5-sulfinate

    [3731] Into a 10-L 4-necked round-bottom flask purged with and maintained under nitrogen was placed a solution of 2-(thiazol-2-yl)propan-2-ol (50 g, 349.0 mmol) in THF (1.5 L). This was followed by the addition of n-BuLi (2.5 M in hexane, 350 mL) dropwise with stirring at −78° C. The mixture was stirred at −78° C. for 1 h. Then SO.sub.2 was bubbled into the mixture for 15 min below −30° C. The mixture was stirred for an additional 1 h at RT and then was concentrated under vacuum. This resulted in 87 g (crude) of the title compound as a light yellow solid. The crude product was used directly in the next step.

    Step 3: Methyl 2-(2-hydroxypropan-2-yl)thiazole-5-sulfinate

    [3732] Into a 2-L 3-necked round-bottom flask, lithium 2-(2-hydroxypropan-2-yl)thiazole-5-sulfinate (87 g, crude) was dissolved in anhydrous MeOH (500 mL). Then SOCl.sub.2 (43 g, 360 mmol) was added to the mixture dropwise with stirring at 0° C. The mixture was stirred overnight at RT and then was concentrated under vacuum. The residue was diluted with 500 mL of ethyl acetate. The resulting solution was washed with 2×200 mL of water and 2×200 mL of brine. The solution was dried over anhydrous Na.sub.2SO.sub.4, then concentrated under vacuum. This resulted in 72 g (crude) of the title compound as light yellow oil. The crude product was used directly in the next step.

    Step 4: 2-(2-Hydroxypropan-2-yl)thiazole-5-sulfinamide

    [3733] Into a 10-L 4-necked round-bottom flask purged with and maintained under nitrogen was placed a solution of methyl 2-(2-hydroxypropan-2-yl)thiazole-5-sulfinate (72 g, 326 mmol) in THF (500 mL). Then to the above NH.sub.3 (0.5 M in THF, 2.0 L) was added. After cooling to −78° C., LiHMDS (1 M in THF, 2.0 L) was added to the mixture dropwise with stirring. Then the mixture was stirred at −78° C. for 2 h. The reaction was quenched by the addition of 500 mL of NH.sub.4Cl (sat.). The resulting solution was extracted with 3×300 mL of ethyl acetate. The organic layers were combined, dried over anhydrous Na.sub.2SO.sub.4, then concentrated under vacuum. This resulted in 32 g [3734] (crude) of the title compound as brown oil. The crude product was used directly in the next step.

    Step 5: Tert-butyl 2-(2-hydroxypropan-2-yl)thiazol-5-ylsulfinylcarbamate

    [3735] Into a 1-L 3-necked round-bottom flask purged with and maintained under nitrogen was placed a solution of 2-(2-hydroxypropan-2-yl)thiazole-5-sulfinamide (32 g, crude) in THF (300 mL). This was followed by the addition of LDA (2 M in THF, 116 mL) dropwise with string at 0° C. The mixture was stirred at 0° C. for 1 h, then (Boc).sub.2O (33.8 g, 155 mmol) was added in portions at 0° C. The mixture was warmed to RT and stirred for an additional 2 h. The reaction was quenched with 200 mL of ice-water (200 mL), and the pH value of the solution was adjusted to 6 with HCOOH. The resulting solution was extracted with 3×200 mL of ethyl acetate. The organic layers were combined, dried over anhydrous Na.sub.2SO.sub.4, then concentrated under vacuum. The residue was applied onto a silica gel column and eluted with a gradient of ethyl acetate/petroleum ether (1:2 to 1:1). This resulted in 19 g (18%, 4 steps) of the title compound as a white solid.

    Step 6: N-(tert-butyldimethylsilyl)-2-(2-hydroxypropan-2-yl)thiazole-5-sulfonimidamide

    [3736] Into a 1-L 3-necked round-bottom flask purged with and maintained under nitrogen, tert-butyl 2-(2-hydroxypropan-2-yl)thiazol-5-ylsulfinylcarbamate (19 g, 62 mmol) was dissolved in fresh distilled ACN (200 mL). Then to the above solution was added NCS (9.8 g, 74 mmol) in portions. The mixture was stirred for 1 h at RT and then NH.sub.3 was bubbled in the mixture for 15 min. The mixture was stirred at RT for 2 h and then was concentrated under vacuum. The residue was applied onto a silica gel column and eluted with a gradient of ethyl acetate/petroleum ether (1:2 to 1:1). This resulted in 13 g (65%) of the title compound as a white solid.

    ##STR00847##

    ##STR00848##

    4-(2-Hydroxypropan-2-yl)-N′-methylthiophene-2-sulfonimidamide

    [3737] Step 1 used the procedures for converting compound 15 to Intermediate 1 shown in Scheme 6 to afford compound 93 by substituting ammonia with methylamine. MS-ESI: 349.1 (M+1).

    Step 2: 4-(2-Hydroxypropan-2-yl)-N′-methylthiophene-2-sulfonimidamide

    [3738] Into a 25-mL round-bottom flask purged with under nitrogen was placed a solution of N′-(tert-butyldimethylsilyl)-4-(2-hydroxypropan-2-yl)-N-methylthiophene-2-sulfonimidamide (500 mg, 1.43 mmol) in DCM (10 mL). To the solution was added HF/Py (70% wt., 200 mg). The resulting solution was stirred for 2 h at RT. The pH value of the solution was adjusted to 8 with aq. Na.sub.2CO.sub.3 (5% wt.). The resulting solution was extracted with 3×10 mL of ethyl acetate. The organic layers were combined, dried over anhydrous Na.sub.2SO.sub.4, then concentrated under vacuum. This resulted in 300 mg (89%) of the title compound as brown oil. MS-ESI: 235.0 (M+1).

    Schemes for the Preparation of Isocyanate Intermediates 30-58

    [3739] Schemes below illustrate the synthesis of isocyanates.

    ##STR00849##

    ##STR00850##

    4-Fluoro-2,6-diisopropylbenzenamine

    Step 1: 4-Fluoro-2,6-bis(prop-1-en-2-yl)aniline

    [3740] Into a 500-mL round-bottom flask purged with and maintained under nitrogen was placed 2,6-dibromo-4-fluoroaniline (15 g, 55.8 mmol), dioxane (150 mL), water (15 mL), Cs.sub.2CO.sub.3 (55 g, 169 mmol), 4,4,5,5-tetramethyl-2-(prop-1-en-2-yl)-1,3,2-dioxaborolane (25 g, 149 mmol), and Pd(dppf)C.sub.12 (4 g, 5.47 mmol). The resulting solution was stirred for 15 h at 100° C. and then was concentrated under vacuum. The residue was applied onto a silica gel column and eluted with a gradient of ethyl acetate/petroleum ether (1:10 to 1:8). This resulted in 9.2 g (86%) of the title compound as brown oil. MS-ESI: 192.1 (M+1).

    Step 2: 4-Fluoro-2,6-bis(propan-2-yl)aniline

    [3741] Into a 500-mL round-bottom flask was placed 4-fluoro-2,6-bis(prop-1-en-2-yl)aniline (9.2 g, 48.1 mmol), and MeOH (200 mL). Then Pd/C (10% wt., 900 mg) was added. The flask was evacuated and flushed three times with hydrogen. The resulting solution was stirred for 12 h at RT under an atmosphere of hydrogen. The solids were filtered out. The resulting filtrate was concentrated under vacuum. The residue was applied onto a silica gel column and eluted with a gradient of ethyl acetate/petroleum ether (1:10 to 1:8). This resulted in 7.2 g (77%) of the title compound as brown oil. MS-ESI: 196.1 (M+1).

    ##STR00851##

    ##STR00852##

    4-Amino-2-fluoro-3,5-diisopropylbenzonitrile

    Step 1: 4-Amino-3,5-dibromo-2-fluorobenzonitrile

    [3742] Into a 1-L round-bottom flask was placed 4-amino-2-fluorobenzonitrile (25 g, 184 mmol), ACN (500 mL), and NBS (81.7 g, 459 mmol). The resulting solution was stirred overnight at 75° C. and then was concentrated under vacuum. The residue was applied onto a silica gel column and eluted with a gradient of ethyl acetate/petroleum ether (1:100 to 1:98). This resulted in 50 g (93%) of the title compound as brown oil. MS-ESI: 294.9/292.9/296.9 (M+1).

    [3743] Steps 2-3 used similar procedures for converting compound 94 to Intermediate 30 shown in Scheme 18 to afford Intermediate 31 from compound 97. MS-ESI: 221.1 (M+1).

    ##STR00853##

    ##STR00854##

    4-(Difluoromethoxy)-2,6-diisopropylbenzenamine

    Step 1: 2,6-Dibromo-4-(difluoromethoxy)benzenamine

    [3744] Into a 100-mL round-bottom flask was placed 4-(difluoromethoxy)benzenamine (3 g, 18.9 mmol), ACN (30 mL), and NBS (7.7 g, 43.3 mmol). The resulting solution was stirred overnight at RT and then was concentrated under vacuum. The residue was applied onto a silica gel column and eluted with a gradient of ethyl acetate/petroleum ether (1:30 to 1:20). This resulted in 2.9 g (48%) of the title compound as brown oil. MS-ESI: 317.9/315.9/319.9 (M+1).

    [3745] Steps 2-3 used similar procedures for converting compound 94 to Intermediate 30 shown in Scheme 18 to afford Intermediate 32 from compound 100″. MS-ESI: 244.1 (M+1).

    ##STR00855## ##STR00856##

    ##STR00857##

    4-(Difluoromethoxy)-2-ethyl-6-isopropylbenzenamine

    Step 1: 2-Bromo-4-(difluoromethoxy)benzenamine

    [3746] Into a 250-mL round-bottom flask purged with and maintained under nitrogen was placed 4-(difluoromethoxy)benzenamine (10 g, 62.8 mmol), ACN (100 mL), and NBS (5.59 g, 31.4 mmol). The resulting solution was stirred for 1 h RT and then was concentrated under vacuum. The residue was applied onto a silica gel column and eluted with a gradient of ethyl acetate/petroleum ether (1:20 to 1:10). This resulted in 7.9 g (53%) of the title compound as red oil. MS-ESI: 238.0/240.0 (M+1).

    Step 2: 4-(Difluoromethoxy)-2-(prop-1-en-2-yl)benzenamine

    [3747] Into a 250-mL round-bottom flask purged with and maintained under nitrogen was placed 2-bromo-4-(difluoromethoxy)benzenamine (7.9 g, 33.2 mmol), dioxane (100 mL), water (10 mL), Cs.sub.2CO.sub.3 (32.46 g, 99.63 mmol), 4,4,5,5-tetramethyl-2-(prop-1-en-2-yl)-1,3,2-dioxaborolane (8.36 g, 49.8 mmol), and Pd(dppf)C.sub.12 (1.21 g, 1.65 mmol). The resulting solution was stirred overnight at 90° C. The solids were filtered out. The filtrate was concentrated under vacuum. The residue was applied onto a silica gel column and eluted with a gradient of ethyl acetate/petroleum ether (1:30 to 1:20). This resulted in 5.3 g (80%) of the title compound as a yellow solid. MS-ESI: 200.1 (M+1).

    Step 3: 4-(Difluoromethoxy)-2-isopropylbenzenamine

    [3748] Into a 250-mL round-bottom flask was placed 4-(difluoromethoxy)-2-(prop-1-en-2-yl)benzenamine (5.3 g, 26.6 mmol) in MeOH (100 mL). Then Pd/C (10% wt., 500 mg) was added.

    [3749] The flask was evacuated and filled three times with hydrogen. The resulting solution was stirred for 3 h at RT under hydrogen. The solids were filtered out. The resulting filtrate was concentrated under vacuum. This resulted in 5.15 g (96%) of the title compound as red oil. MS-ESI: 202.1 (M+1).

    Step 4: 2-Bromo-4-(difluoromethoxy)-6-isopropylbenzenamine

    [3750] Into a 500-mL round-bottom flask was placed 4-(difluoromethoxy)-2-isopropylbenzenamine (5.15 g, 25.6 mmol), CHCl.sub.3 (200 mL), Fe turnings (500 mg), and Bra (4.45 g, 27.9 mmol). The resulting mixture was stirred overnight at 70° C. and then was quenched by the addition of 200 mL of water. The resulting solution was extracted with 3×100 mL of DCM and the organic layers combined and concentrated under vacuum. The residue was applied onto a silica gel column and eluted with a gradient of ethyl acetate/petroleum ether (1:30 to 1:20). This resulted in 6.98 g (97%) of the title compound as dark red oil. MS-ESI: 280.0/282.0 (M+1).

    Step 5: 4-(Difluoromethoxy)-2-isopropyl-6-vinylbenzenamine

    [3751] Into a 250-mL round-bottom flask purged with and maintained under nitrogen was placed 2-bromo-4-(difluoromethoxy)-6-isopropylbenzenamine (3 g, 10.7 mmol), dioxane (100 mL), water (10 mL), Cs.sub.2CO.sub.3 (10.47 g, 32.13 mmol), 4,4,5,5-tetramethyl-2-vinyl-1,3,2-dioxaborolane (2.47 g, 16.0 mmol), and Pd(dppf)C.sub.12 (784 mg, 1.07 mmol). The resulting solution was stirred overnight at 90° C. and then was concentrated under vacuum. The residue was applied onto a silica gel column and eluted with a gradient of ethyl acetate/petroleum ether (1:30 to 1:20). This resulted in 2.3 g (94%) of the title compound as dark green oil. MS-ESI: 228.1 (M+1).

    Step 6: 4-(Difluoromethoxy)-2-ethyl-6-isopropylbenzenamine

    [3752] Into a 250-mL round-bottom flask was placed 4-(difluoromethoxy)-2-isopropyl-6-vinylbenzenamine (2.3 g, 10.1 mmol), MeOH (100 mL). Then Pd/C (10% wt., 200 mg) was added. The flask was evacuated and filled three times with hydrogen. The resulting solution was stirred overnight at RT under hydrogen. The solids were filtered out. The filtrate was concentrated under vacuum. This resulted in 2.2 g (95%) of the title compound as red oil. MS-ESI: 230.1 (M+1).

    TABLE-US-00014 TABLE 7 The Intermediate 34 in the following Table was prepared from compound 105″ using similar procedure as shown in Scheme 21 above for converting compound 105″ to 106″. Exact Intermediate # Structure IUPAC Name Mass[M + H].sup.+ Intermediate 34 [00858]embedded image 2-Cyclopropyl-4-(difluoromethoxy)- 6-isopropylbenzenamine 242.1

    ##STR00859##

    ##STR00860##

    4-Amino-5-cyclopropyl-2-fluoro-3-isopropylbenzonitrile

    Step 1: 4-Amino-5-bromo-2-fluorobenzonitrile

    [3753] Into a 250-mL round-bottom flask was placed a solution of 4-amino-2-fluorobenzonitrile (9 g, 66.1 mmol) in ACN (120 mL). Then NBS (12.4 g, 69.7 mmol) was added. The resulting solution was stirred overnight at 80° C. and then was concentrated under vacuum. The residue was applied onto a silica gel column and eluted with a gradient of ethyl acetate/petroleum ether (1:20 to 1:10). This resulted in 10.9 g (77%) of the title compound as a yellow solid. MS-ESI: 215.0/217.0 (M+1). .sup.1H NMR (300 MHz, DMSO-d6) δ 7.89 (d, J=6.0 Hz, 1H), 6.69 (br s, 2H), 6.63 (d, J=12.0 Hz, 1H).

    Step 2: 4-Amino-5-cyclopropyl-2-fluorobenzonitrile

    [3754] Into a 250-mL round-bottom flask purged with and maintained under nitrogen was placed a solution of 4-amino-5-bromo-2-fluorobenzonitrile (6.37 g, 29.6 mmol) in dioxane (70 mL) and water (10 mL). To the solution were added Cs.sub.2CO.sub.3 (9.7 g, 29.8 mmol), cyclopropylboronic acid (3.8 g, 44.2 mmol) and Pd(dppf)C.sub.12 (1.08 g, 1.48 mmol). The resulting solution was stirred overnight at 90° C. and then was concentrated under vacuum. The residue was applied onto a silica gel column and eluted with a gradient of ethyl acetate/petroleum ether (1:10 to 1:5). This resulted in 5.03 g (96%) of the title compound as a yellow solid. MS-ESI: 177.1 (M+1).

    Step 3: 4-Amino-3-bromo-5-cyclopropyl-2-fluorobenzonitrile

    [3755] Into a 250-mL round-bottom flask was placed a solution of 4-amino-5-cyclopropyl-2-fluorobenzonitrile (5.03 g, 28.7 mmol) in ACN (50 mL). To the solution was added NBS (5.6 g, 31.5 mmol). The resulting solution was stirred overnight at 80° C. and then was concentrated under vacuum. The residue was applied onto a silica gel column and eluted with a gradient of ethyl acetate/petroleum ether (1:10 to 1:5). This resulted in 6.972 g (96%) of the title compound as a yellow solid. MS-ESI: 255.0/257.0 (M+1).

    Step 4: 4-Amino-5-cyclopropyl-2-fluoro-3-(prop-1-en-2-yl)benzonitrile

    [3756] Into a 250-mL round-bottom flask purged with and maintained under nitrogen was placed a solution of 4-amino-3-bromo-5-cyclopropyl-2-fluorobenzonitrile (6.972 g, 27.33 mmol) in dioxane (120 mL) and water (20 mL). To the solution were added 4,4,5,5-tetramethyl-2-(prop-1-en-2-yl)-1,3,2-dioxaborolane (6.9 g, 41.00 mmol), Cs.sub.2CO.sub.3 (13.4 g, 41.00 mmol) and Pd(dppf)C.sub.12 (0.4 g, 0.55 mmol). The resulting solution was stirred overnight at 80° C. and then was concentrated under vacuum. The residue was applied onto a silica gel column and eluted with a gradient of ethyl acetate/petroleum ether (1:10 to 1:5). This resulted in 4.73 g (80%) of the title compound as a yellow solid. MS-ESI: 217.1 (M+1).

    Step 5: 4-Amino-5-cyclopropyl-2-fluoro-3-isopropylbenzonitrile

    [3757] Into a 250-mL round-bottom flask was placed a solution of 4-amino-5-cyclopropyl-2-fluoro-3-(prop-1-en-2-yl)benzonitrile (4.73 g, 21.97 mmol), MeOH (100 mL). To the solution was added AcOH (0.5 mL). Then Pd/C (10% wt., 500 mg) was added. The flask was evacuated and filled three times with hydrogen. The resulting solution was stirred for 4 h at 40° C. under an atmosphere of hydrogen. The solids were filtered out. The filtrate was concentrated under vacuum. This resulted in 4.71 g (99%) of the title compound as a light yellow solid. MS-ESI: 219.1 (M+1).

    ##STR00861## ##STR00862##

    ##STR00863##

    8-Fluoro-1,2,3,5,6,7-hexahydro-s-indacen-4-amine

    Step 1: 3-Chloro-1-(2,3-dihydro-1H-inden-5-yl)propan-1-one

    [3758] Into a 3-L round-bottom flask was placed a solution of AlCl.sub.3 (111 g, 834 mmol) in DCM (1200 mL). This was followed by the addition of a solution of 2,3-dihydro-1H-indene (90 g, 762 mmol) and 3-chloropropanoyl chloride (96.3 g, 759 mmol) in DCM (300 mL) dropwise with stirring at −10° C. in 30 min. The resulting solution was stirred for 16 h at RT. Then the reaction mixture was added dropwise to cold HCl (3 N, 1200 mL) over 45 min at −10° C. The resulting solution was extracted with 3×600 mL of DCM and the organic layers were combined, dried over anhydrous Na.sub.2SO.sub.4, then concentrated under vacuum. This resulted in 160.5 g (crude) of the title compound as a yellow solid. The crude product was used in the next step.

    Step 2: 1,2,3,5,6,7-Hexahydro-s-indacen-1-one

    [3759] Into a 1-L round-bottom flask was placed a solution of 3-chloro-1-(2,3-dihydro-1H-inden-5-yl)propan-1-one (160.5 g, 759 mmol) in conc. H.sub.2SO.sub.4 (900 mL). The resulting solution was stirred for 16 h at 55° C. and then was quenched by adding the reaction mixture carefully to 4500 mL of water/ice. The solids were collected by filtration and dried over infrared lamp for 24 h. The crude mixture was purified by chromatography and eluted with ethyl acetate/petroleum ether (1:100). This resulted in 10 g (7.6%) of 1,6,7,8-tetrahydro-as-indacen-3(2H)-one (compound 113″a) and 112.2 g (85%) of the title compound (compound 113″) as a yellow solid. .sup.1H NMR (400 MHz, DMSO-d.sub.6) δ 7.44 (s, 1H), 7.39 (s, 1H), 3.13-2.79 (m, 8H), 2.70-2.55 (m, 2H), 2.20-1.90 (m, 2H). .sup.1H NMR (400 MHz, DMSO-d.sub.6) δ 7.49 (d, J=7.7 Hz, 1H), 7.31 (d, J=7.7 Hz, 1H), 3.19-2.98 (m, 4H), 2.93-2.80 (m, 3H), 2.68-2.54 (m, 2H), 2.15-1.95 (m, 2H).

    Step 3: 4-nitro-2,3,6,7-tetrahydro-s-indacen-1(511)-one (114) (Major) and 8-nitro-2,3,6,7-tetrahydro-s-indacen-1(511)-one (115) (Minor)

    [3760] Into a 1-L round-bottom flask was placed a solution of 1,2,3,5,6,7-hexahydro-s-indacen-1-one (80 g, 464.5 mmol) in H.sub.2SO.sub.4 (500 mL). Then HNO.sub.3 (58.5 g, 929 mmol) was added dropwise over 1 h at 0° C. The resulting solution was stirred for 1 hr at 0° C. The reaction mixture was slowly added to a mixture of water/ice (1000 mL) and DCM (500 mL) with ice bath cooling. The organic layer was collected, dried over Na.sub.2SO.sub.4 and concentrated under vacuum. This resulted in 90 g (90%) of the mixture of 4-nitro-2,3,6,7-hexahydro-s-indacen-1-one and 8-nitro-2,3,6,7-tetrahydro-s-indacen-1(5H)-one as a yellow solid.

    Step 4: 1,2,3,5,6,7-hexahydro-s-indacen-4-amine

    [3761] Into a 1-L round-bottom flask was placed a solution of the mixture of 4-nitro-1,2,3,5,6,7-hexahydro-s-indacen-1-one and 8-nitro-2,3,6,7-tetrahydro-s-indacen-1(5H)-one (21.7 g, 100 mmol) in MeOH (300 mL). To the solution was added MSA (11.5 g, 120 mmol). Then Pd(OH).sub.2/C (20% wt, 5.5 g) was added. The flask was evacuated and filled three times with hydrogen. The resulting mixture was stirred for 16 h at RT under hydrogen (50 psi). The solids were filtered out and washed with methanol. The methanol filtrate and wash was diluted with water (500 mL) and the pH was adjusted to 10.6 with 2N NaOH. The resulting slurry was filtered and the crude solids were recrystallized from methanol/water (9:1) with heating. This resulted in 13.7 g (79%) of the title compound as an off-white solid.

    Step 5: 8-Nitro-1,2,3,5,6,7-hexahydro-s-indacen-4-amine

    [3762] Into a 500-mL round-bottom flask was placed 1,2,3,5,6,7-hexahydro-s-indacen-4-amine (8 g, 46.2 mmol), EtOH (200 mL), and 2,3,5,6-tetrabromo-4-methyl-4-nitrocyclohexa-2,5-dienone (21.6 g, 46.1 mmol). The resulting solution was stirred for 12 h at RT and then was concentrated under vacuum. The residue was applied onto a silica gel column and eluted with a gradient of ethyl acetate/petroleum ether (1:50 to 1:30). This resulted in 5 g (50%) of the title compound as a yellow solid. MS-ESI: 219.1 (M+1).

    Step 6: 4-Fluoro-8-nitro-1,2,3,5,6,7-hexahydro-s-indacene

    [3763] Into a 100-mL round-bottom flask was placed 8-nitro-1,2,3,5,6,7-hexahydro-s-indacen-4-amine (5 g, 22.9 mmol) and HF/Py (70% wt., 20 mL). This was followed by the addition of 3-methylbutyl nitrite (3 g, 25.6 mmol) dropwise with stirring at 0° C. The resulting solution was stirred for 2 h at RT and then was diluted with 50 mL of water. The resulting solution was extracted with 3×50 mL of DCM. The organic layers were combined and dried over anhydrous Na.sub.2SO.sub.4, then concentrated under vacuum. This resulted in 4 g (crude, 79%) of the title compound as brown oil.

    Step 7: 8-Fluoro-1,2,3,5,6,7-hexahydro-s-indacen-4-amine

    [3764] Into a 100-mL round-bottom flask was placed 4-fluoro-8-nitro-1,2,3,5,6,7-hexahydro-s-indacene (4 g, 18.1 mmol) in MeOH (50 mL). Then Pd/C (10% wt., 0.5 g) was added. The flask was evacuated and filled three times with hydrogen. The resulting mixture was stirred for 12 h at RT under an atmosphere of hydrogen. The solids were filtered out and the filtrate was concentrated under vacuum. The residue was applied onto a silica gel column and eluted with a gradient of ethyl acetate/petroleum ether (1:10 to 1:5). This resulted in 2 g (46%, 2 steps) of the title compound as a white solid. MS-ESI: 192.1 (M+1).

    ##STR00864##

    ##STR00865##

    Step 1: 4-nitro-2,3,6,7-tetrahydro-s-indacen-1(5H)-one

    [3765] Into a 1-L round-bottom flask was placed a solution of 1,2,3,5,6,7-hexahydro-s-indacen-1-one (40 g, 232 mmol) in H.sub.2SO.sub.4 (250 mL). Then HNO.sub.3 (29 g, 464 mmol) was added dropwise over 1 h at 0° C. The resulting solution was stirred for 1 hr at 0° C. The reaction mixture was slowly added to a mixture of water/ice (500 mL) and DCM (250 mL) with ice bath cooling. The organic layer was collected, dried over anhydrous Na.sub.2SO.sub.4 and concentrated under vacuum. The crude product was purified by silica gel column with a gradient of ethyl acetate and petroleum ether (1:50 to 1:1). This resulted in minor product 5 g (10%) of the title compound and major product 30 g (60%) of 8-nitro-2,3,6,7-tetrahydro-s-indacen-1(5H)-one both as a yellow solid.

    Step 2: 1-methylene-4-nitro-1,2,3,5,6,7-hexahydro-s-indacene

    [3766] Into a 250-mL round-bottom flask was placed a solution of methyltriphenylphosphanium bromide (16.4 g, 46.04 mmol) and t-BuOK (5.2 g, 46.0 mmol) in THF (150 mL) at 0° C. The resulting solution was stirred for 30 min at 0° C. Then the solution of 4-nitro-1,2,3,5,6,7-hexahydro-s-indacen-1-one (5 g, 23.0 mmol) in THF (10 mL) was added dropwise to the reaction mixture at 0° C. The resulting solution was stirred overnight at RT. The resulting mixture was concentrated. The residue was applied onto a silica gel column with ethyl acetate/petroleum ether (1:10). This resulted in 2.6 g (52%) of the title compound as a green solid.

    Step 3: 1-methyl-1,2,3,5,6,7-hexahydro-s-indacen-4-amine

    [3767] Into a 100-mL round-bottom flask was placed a solution of 1-methylidene-4-nitro-1,2,3,5,6,7-hexahydro-s-indacene (2.6 g, 12.1 mmol) in MeOH (20 mL), Pd/C (10% wt, 300 mg) was added. The flask was evacuated and filled three times with hydrogen, then H.sub.2 (g) was introduced in with a balloon. The resulting solution was stirred for 2 h at RT. The Pd/C catalyst was filtered out. The filtrate was concentrated. This resulted in 2 g of the title compound as red oil.

    TABLE-US-00015 TABLE 8 Intermediate 38 in the following Table was prepared from Compound 114″ using similar procedure as shown in Scheme 24 above for converting compound 115″ to intermediate 37. Exact Intermediate # Structure IUPAC Name Mass[M + H].sup.+ Intermediate 38 [00866]embedded image 3-methyl-1,2,3,5,6,7-hexahydro- s-indacen-4-amine 188.1

    ##STR00867##

    ##STR00868##

    8-Chloro-1,2,3,5,6,7-hexahydro-s-indacen-4-amine

    Step 1: 8-Chloro-1,2,3,5,6,7-hexahydro-s-indacen-4-amine

    [3768] Into a 50-mL round-bottom flask was placed a solution of 1,2,3,5,6,7-hexahydro-s-indacen-4-amine (1.73 g, 9.99 mmol) in DMF (10 mL). To the solution was added NCS (1.47 g, 11.0 mmol). The resulting solution was stirred overnight at RT and then was diluted with 30 mL of DCM. The resulting mixture was washed with 3×10 mL of water and the organic layer was concentrated under vacuum. The residue was applied onto a silica gel column and eluted with a gradient of ethyl acetate/petroleum ether (1:20 to 1:10). This resulted in 1.88 g (91%) of the title compound as a yellow solid. MS-ESI: 208.1/210.1 (M+1).

    ##STR00869##

    ##STR00870##

    8-Amino-1,2,3,5,6,7-hexahydro-s-indacene-4-carbonitrile

    Step 1: 8-Bromo-1,2,3,5,6,7-hexahydro-s-indacen-4-amine

    [3769] Into a 100-mL round-bottom flask was placed a solution of 1,2,3,5,6,7-hexahydro-s-indacen-4-amine (2.6 g, 15.0 mmol) in DMF (30 mL). To the solution was added NBS (2.9 g, 16.3 mmol). The resulting solution was stirred for 12 h at RT and then was diluted with 80 mL of ethyl acetate.

    [3770] The resulting mixture was washed with 3×20 mL of water and concentrated under vacuum. The residue was applied onto a silica gel column and eluted with a gradient of ethyl acetate/petroleum ether (1:30 to 1:20). This resulted in 3.0 g (79%) of the title compound as a brown solid. MS-ESI: 252.0, 254.0 (M+1).

    Step 2: 8-Amino-1,2,3,5,6,7-hexahydro-s-indacene-4-carbonitrile

    [3771] Into a 50-mL round-bottom flask purged with and maintained under nitrogen was placed a solution of 8-bromo-1,2,3,5,6,7-hexahydro-s-indacen-4-amine (725 mg, 2.88 mmol) in DMF (10 mL). To the solution were added t-BuOK (330 mg, 2.90 mmol), CuCN (386 mg, 4.32 mmol), and Pd(dppf)C.sub.12 (424 mg, 0.58 mmol). The resulting solution was stirred for 12 h at 120° C. and then was diluted with 20 mL of water. The resulting solution was extracted with 3×20 mL ethyl acetate. The organic layers were combined, dried over anhydrous Na.sub.2SO.sub.4, then concentrated under vacuum. The residue was applied onto a silica gel column and eluted with a gradient of ethyl acetate/petroleum ether (1:60 to 1:40). This resulted in 192 mg (34%) of the title compound as a yellow solid. MS-ESI: 199.1 (M+1).

    ##STR00871##

    ##STR00872##

    4-Amino-3,5-diisopropylbenzonitrile

    Step 1: 4-Amino-3,5-diisopropylbenzonitrile

    [3772] Into a 100-mL round-bottom flask purged with and maintained under nitrogen was placed a solution of 4-bromo-2,6-diisopropylbenzenamine (5.1 g, 19.9 mmol) in DMF (30 mL). To the solution were added Zn(CN).sub.2 (2.80 g, 23.9 mmol), Pd(dppf)C.sub.12 (732 mg, 1.00 mmol) and t-BuOK (3.36 g, 29.9 mmol). The resulting mixture was stirred for 16 h at 120° C. and then was diluted with 30 mL of water. The solution was extracted with 3×30 mL of ethyl acetate and the combined organic layers were concentrated under vacuum. The residue was applied onto a silica gel column and eluted with a gradiente of ethyl acetate/petroleum ether (1:30 to 1:20). This resulted in 3.2 g (80%) of the title compound as a yellow solid. MS-ESI: 203.1 (M+1).

    ##STR00873##

    ##STR00874##

    8-(Difluoromethoxy)-1,2,3,5,6,7-hexahydro-s-indacen-4-amine

    Step 1: 1,2,3,5,6,7-Hexahydro-s-indacene

    [3773] Into a 1-L round-bottom flask was placed a solution of 1,2,3,5,6,7-hexahydro-s-indacen-1-one (37.2 g, 216 mmol) and MSA (42 g, 437.5 mmol) in MeOH (300 mL). Then Pd(OH).sub.2/C (20% wt, 8 g) was added. The flask was evacuated and filled three times with hydrogen. The resulting solution was stirred for 16 h at RT under an atmosphere of hydrogen. The solids were filtered out. The resulting mixture was concentrated under vacuum. The residue was applied onto a silica gel column and eluted with a gradient of ethyl acetate/petroleum ether (1:150 to 1:100). This resulted in 27.1 g (79%) of the title compound as a white solid.

    Step 2: 4-Bromo-1,2,3,5,6,7-hexahydro-s-indacene

    [3774] Into a 500-mL 3-necked round-bottom flask purged with and maintained under nitrogen was placed a solution of 1,2,3,5,6,7-hexahydro-s-indacene (15 g, 94.8 mmol) in CCl.sub.4 (200 mL). Then 12 (1.2 g, 4.72 mmol) was added. This was followed by the addition of a solution of Bra (16 g, 100 mmol) in CCl.sub.4 (50 mL) dropwise with stirring at 0° C. in 10 min. The resulting solution was stirred for 2 h at 0° C. The reaction was then quenched by the addition of 150 mL of NH.sub.4Cl (sat.). The resulting solution was extracted with 3×150 mL of DCM and the combined organic layers were dried over anhydrous Na.sub.2SO.sub.4 and concentrated under vacuum. The crude product was purified by silica gel column with a gradient of ethyl acetate/hexane (1:500 to 1:100). This resulted in 19 g (85%) of the title compound as yellow oil. .sup.1H NMR (300 MHz, DMSO-d.sub.6) δ 7.02 (s, 1H), 2.95-2.75 (m, 8H), 2.03-2.01 (m, 4H)

    Step 3: 1,2,3,5,6,7-Hexahydro-s-indacen-4-ol

    [3775] Into a 500-mL 3-necked round-bottom flask purged with and maintained under nitrogen was placed a solution of 4-bromo-1,2,3,5,6,7-hexahydro-s-indacene (5 g, 21.08 mmol) in THF (150 mL). This was followed by the addition of n-BuLi (2.5 M in hexane, 10 mL) dropwise with stirring at −78° C. The resulting solution was stirred for 30 min at −78° C. Then to the above was added trimethyl borate (2.6 g, 25.30 mmol) dropwise with stirring at −78° C. The reaction was warmed to RT slowly and then was stirred for 1 h at RT. Then to the mixture was added AcOH (2.0 mL, 33.20 mmol) and H.sub.2O.sub.2 (1.0 mL, 28.88 mmol) dropwise with stirring at RT. The resulting solution was stirred for 2 h at RT and then was quenched by the addition of 200 mL of NH.sub.4Cl (sat.). The resulting solution was extracted with 3×200 mL of DCM. The organic layers were combined and dried over anhydrous Na.sub.2SO.sub.4, then concentrated under vacuum. The residue was applied onto a silica gel column and eluted with a gradient of ethyl acetate/petroleum ether (1:7 to 1:5). This resulted in 1.9 g (52%) of the title compound as an off-white solid. MS-ESI: 175.1 (M+1).

    Step 4: 8-Nitro-1,2,3,5,6,7-hexahydro-s-indacen-4-ol

    [3776] Into a 250-mL round-bottom flask purged with and maintained under nitrogen was placed a solution of 1,2,3,5,6,7-hexahydro-s-indacen-4-ol (1.9 g, 10.9 mmol) in EtOH (100 mL). To the solution was added 2,3,5,6-tetrabromo-4-methyl-4-nitrocyclohexa-2,5-dienone (6.1 g, 13.1 mmol). The resulting solution was stirred overnight at RT and then was concentrated under vacuum. The residue was applied onto a silica gel column and eluted with a gradient of ethyl acetate/petroleum ether (1:5 to 1:3). This resulted in 1.1 g (46%) of the title compound as a light yellow solid. MS-ESI: 218.1 (M−1).

    Step 5: 4-(Difluoromethoxy)-8-nitro-1,2,3,5,6,7-hexahydro-s-indacene

    [3777] Into a 100-mL round-bottom flask purged with and maintained under nitrogen was placed a solution of 8-nitro-1,2,3,5,6,7-hexahydro-s-indacen-4-ol (1.1 g, 5.0 mmol) in DMF (20 mL) and water (2 mL). To the solution were added K2CO.sub.3 (1.4 g, 10.0 mmol) and sodium 2-chloro-2,2-difluoroacetate (1.5 g, 10.0 mmol). The resulting solution was stirred for 1 h at 120° C. and then was diluted with 20 mL of water. The pH value of the solution was adjusted to 7 with aq. HCl (1 N). The resulting solution was extracted with 3×20 mL of DCM. The organic layers were combined and dried over anhydrous Na.sub.2SO.sub.4, then concentrated under vacuum. The residue was applied onto a silica gel column and eluted with a gradient of ethyl acetate/petroleum ether (1:2 to 1:3). This resulted in 0.55 g (41%) of the title compound as a light yellow solid. MS-ESI: 270.1 (M+1).

    Step 6: 8-(Difluoromethoxy)-1,2,3,5,6,7-hexahydro-s-indacen-4-amine

    [3778] Into a 100-mL round-bottom flask was placed a solution of 4-(difluoromethoxy)-8-nitro-1,2,3,5,6,7-hexahydro-s-indacene (550 mg, 2.0 mmol) in MeOH (10 mL). Then Pd/C (10% wt., 100 mg) was added. The flask was evacuated and filled three times with hydrogen. The resulting solution was stirred for 12 h at RT under an atmosphere of hydrogen. The solids were filtered out. The resulting filtrate was concentrated under vacuum. This resulted in 460 mg (94%) of the title compound as a light yellow solid. MS-ESI: 240.1 (M+1).

    ##STR00875##

    ##STR00876##

    Step 1: 2,6-Dibromo-4-chloro-3-fluoroaniline

    [3779] Into a 500-mL round-bottom flask was placed 4-chloro-3-fluoroaniline (5.08 g, 34.9 mmol), ACN (200 mL), and NBS (18.69 g, 105.0 mmol). The resulting solution was stirred for 12 h at RT and then was concentrated under vacuum. The residue was applied onto a silica gel column and eluted with a gradient of ethyl acetate/petroleum ether (1:200 to 1:100). This resulted in 9.7 g (92%) of the title compound as a light yellow solid. MS-ESI: 303.8/305.8/301.8 (M+1).

    Step 2: 4-Chloro-3-fluoro-2,6-bis(prop-1-en-2-yl)aniline

    [3780] Into a 500-mL round-bottom flask purged with and maintained under nitrogen was placed a solution of 2,6-dibromo-4-chloro-3-fluoroaniline (9.03 g, 29.8 mmol) in 1,4-dioxane (200 mL) and water (20 mL). To the solution were added 4,4,5,5-tetramethyl-2-(prop-1-en-2-yl)-1,3,2-dioxaborolane (15.12 g, 89.98 mmol), Cs.sub.2CO.sub.3 (29.34 g, 90.1 mmol) and Pd(dppf)C.sub.12 (2.20 g, 3.0 mmol). The resulting solution was stirred for 12 h at 90° C. and then was concentrated under vacuum. The residue was applied onto a silica gel column and eluted with a gradient of ethyl acetate/petroleum ether (1:30 to 1:20). This resulted in 4.3 g (64%) of the title compound as yellow oil. MS-ESI: 226.1, 228.1 (M+1).

    Step 3: 3-Fluoro-2,6-bis(propan-2-yl)aniline

    [3781] Into a 100-mL round-bottom flask was placed a solution of 4-chloro-3-fluoro-2,6-bis(prop-1-en-2-yl)aniline (1 g, 4.4 mmol) in MeOH (15 mL). Then Pd/C (10% wt., 100 mg) was added. The flask was evacuated and filled three times with hydrogen. The resulting solution was stirred for 3 h at RT under an atmosphere of hydrogen. The solids were filtered out. The resulting filtrate was concentrated under vacuum. The residue was applied onto a silica gel column and eluted with a gradient of ethyl acetate/petroleum ether (1:5 to 1:3). This resulted in 700 mg (81%) of the title compound as light yellow oil. MS-ESI: 196.1 (M+1).

    ##STR00877##

    ##STR00878##

    4-Isocyanato-1,2,3,5,6,7-hexahydro-s-indacene

    Step 1: 4-Isocyanato-1,2,3,5,6,7-hexahydro-s-indacene

    [3782] Into a 50-mL round-bottom flask purged with and maintained under nitrogen was placed 1,2,3,5,6,7-hexahydro-s-indacen-4-amine (64 mg, 0.4 mmol), THF (5 mL) and BTC (37 mg, 0.1 mmol). The resulting solution was stirred for 2 h at 65° C. and then was concentrated under vacuum. This resulted in 75 mg (crude) of the title compound as light brown oil. The crude product was used directly in the next step.

    TABLE-US-00016 TABLE 9 The Intermediates in the following Table were prepared using similar procedure as shown in Scheme 30 above for converting compound 130″ to Intermediate 44. Intermediate # Structure IUPAC Name Intermediate 45 [00879]embedded image 5-Fluoro-2-isocyanato-1,3-diisopropylbenzene Intermediate 46 [00880]embedded image 2-Fluoro-4-isocyanato-3,5-diisopropylbenzonitrile Intermediate 47 [00881]embedded image 5-(Difluoromethoxy)-2-isocyanato-1,3- diisopropylbenzene Intermediate 48 [00882]embedded image 5-(Difluoromethoxy)-1-ethyl-2-isocyanato-3- isopropylbenzene Intermediate 49 [00883]embedded image 1-Cyclopropyl-5-(difluoromethoxy)-2-isocyanato- 3-isopropylbenzene Intermediate 50 [00884]embedded image 4-Chloro-8-isocyanato-1,2,3,5,6,7-hexahydro-s- indacene Intermediate 51 [00885]embedded image 4-Fluoro-8-isocyanato-1,2,3,5,6,7-hexahydro-s- indacene Intermediate 52 [00886]embedded image 5-Cyclopropyl-2-fluoro-4-isocyanato-3- isopropylbenzonitrile Intermediate 53 [00887]embedded image 4-Isocyanato-3,5-diisopropylbenzonitrile Intermediate 54 [00888]embedded image 1,2,3,5,6,7-Hexahydro-8-isocyanato-s-indacene- 4-carbonitrile Intermediate 55 [00889]embedded image 4-(Difluoromethoxy)-1,2,3,5,6,7-hexahydro-8- isocyanato-s-indacene Intermediate 56 [00890]embedded image 1-Fluoro-3-isocyanato-2,4-diisopropylbenzene Intermediate 57 [00891]embedded image l,2,3,5,6,7-Hexahydro-8-isocyanato-1-methyl-s- indacene Intermediate 58 [00892]embedded image l,2,3,5,6,7-Hexahydro-4-isocyanato-1-methyl-s- indacene

    [3783] The following schemes illustrate additional general methods for the synthesis of compounds of Formula AA:

    ##STR00893##

    ##STR00894##

    ##STR00895##

    ##STR00896##

    ##STR00897##

    ##STR00898##

    ##STR00899##

    [3784] Scheme for the preparation of Sulfonimidamide Intermediates: Schemes below illustrate the preparation of sulfonimidamide intermediates 59-88 and 112-113.

    ##STR00900## ##STR00901##

    ##STR00902##

    N′-(tert-butyldimethylsilyl)-5-(2-hydroxypropan-2-yl)-1-phenyl-1H-pyrazole-3-sulfonimidamide

    Step 1: Ethyl 3-nitro-1-phenyl-1H-pyrazole-5-carboxylate

    [3785] Into a 250-mL round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed ethyl 3-nitro-1H-pyrazole-5-carboxylate (5.0 g, 27.0 mmol), THF (150 mL), phenylboronic acid (6.6 g, 54.1 mmol), Cu(OAc).sub.2 (7.38 g, 40.6 mmol), and pyridine (8.54 g, 108 mmol). The resulting solution was stirred overnight at RT. The resulting mixture was concentrated under vacuum. The residue was eluted from a silica gel column with ethyl acetate/petroleum ether (1:1). This resulted in 3.1 g (44%) of the title compound as an off-white solid. MS-ESI: 262 (M+1).

    Step 2: Ethyl 3-amino-1-phenyl-1H-pyrazole-5-carboxylate

    [3786] Into a 100-mL round-bottom flask, was placed ethyl 3-nitro-1-phenyl-1H-pyrazole-5-carboxylate (3.92 g, 15.0 mmol), MeOH (50 mL), and Pd/C (wet 10% wt., 400 mg). The flask was evacuated and filled three times with hydrogen. The resulting solution was stirred overnight at RT. The solids were filtered out. The resulting mixture was concentrated under vacuum. This resulted in 2.8 g (81%) of the title compound as a light yellow solid. MS-ESI: 232 (M+1).

    Step 3: Ethyl 3-(chlorosulfonyl)-1-phenyl-1H-pyrazole-5-carboxylate

    [3787] Into a 100-mL round-bottom flask, was placed ethyl 3-amino-1-phenyl-1H-pyrazole-5-carboxylate (1.8 g, 7.78 mmol), HCl (cc. 6.0 mol/L, 15 mL). This was followed by the addition of a solution of NaNO.sub.2 (646 mg, 9.36 mmol) in water (2.0 mL) dropwise with stirring at −10° C. The resulting solution was stirred for 30 min at −10° C. The above mixture was added to a saturated solution of SO.sub.2 in AcOH (20 mL) dropwise with stirring at 0° C. Then to the above was added CuCl.sub.2 (1.05 g, 7.81 mmol). The resulting solution was stirred for 1 h at RT. The reaction was then quenched by the addition of 30 mL of water. The resulting solution was extracted with 3×30 mL of DCM and the organic layers combined and dried over anhydrous sodium sulfate and concentrated under vacuum. This resulted in 2.2 g (90%) of the title compound as a light yellow solid.

    Step 4: Ethyl 1-phenyl-3-sulfamoyl-1H-pyrazole-5-carboxylate

    [3788] Into a 100-mL round-bottom flask, was placed a solution of ethyl 3-(chlorosulfonyl)-1-phenyl-1H-pyrazole-5-carboxylate (2.2 g, 6.99 mmol) in DCM (10 mL). Then to the above was introduced NH.sub.3 gas bubbled at 0° C. for 10 min. The resulting solution was stirred for 2 h at RT. The resulting mixture was concentrated under vacuum. The residue was eluted from a silica gel column with ethyl acetate/petroleum ether (1:1). This resulted in 1.07 g (52%) of the title compound as a light yellow solid. MS-ESI: 296 (M+1).

    Step 5: 5-(2-Hydroxypropan-2-yl)-1-phenyl-1H-pyrazole-3-sulfonamide

    [3789] Into a 100-mL 3-necked round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed a solution of ethyl 1-phenyl-3-sulfamoyl-1H-pyrazole-5-carboxylate (1.65 g, 5.59 mmol) in THF (30 mL). This was followed by the addition of MeMgBr/THF (3.0 M, 18.6 mL) dropwise with stirring at 0° C. The resulting solution was stirred overnight at RT. The reaction was then quenched by the addition of 30 mL of NH.sub.4Cl (sat.). The resulting solution was extracted with 3×30 mL of DCM and the organic layers combined and dried over anhydrous sodium sulfate and concentrated under vacuum. The residue was eluted from a silica gel column with ethyl acetate/petroleum ether (2:1). This resulted in 1.35 g (86%) of the title compound as a yellow solid. MS-ESI: 282 (M+1).

    Step 6: N-(tert-butyldimethylsilyl)-5-(2-hydroxypropan-2-yl)-1-phenyl-1H-pyrazole-3-sulfonamide

    [3790] Into a 100-mL round-bottom flask, was placed 5-(2-hydroxypropan-2-yl)-1-phenyl-1H-pyrazole-3-sulfonamide (500 mg, 1.78 mmol), THF (10 mL). This was followed by the addition of sodium hydride (60% wt. oil dispersion, 86 mg, 3.58 mmol) in portions at 0° C. Then to the above was added TBSCl (538 mg, 3.57 mmol). The resulting solution was stirred for 2 h at RT. The reaction was then quenched by the addition of 10 mL of water. The resulting solution was extracted with 3×10 mL of DCM. The organic layers were combined, dried over anhydrous sodium sulfate, and concentrated under vacuum. The residue was eluted from a silica gel column with ethyl acetate/petroleum ether (1:2). This resulted in 660 mg (94%) of the title compound as a light yellow solid. MS-ESI: 396 (M+1).

    Step 7: N′-(tert-butyldimethylsilyl)-5-(2-hydroxypropan-2-yl)-1-phenyl-1H-pyrazole-3-sulfonimidamide

    [3791] Into a 100-mL 3-necked round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed the solution of PPh.sub.3Cl.sub.2 (1.67 g, 5.01 mmol) in chloroform (30 mL). This was followed by the addition of DIEA (1.29 g, 9.98 mmol) dropwise with stirring at RT. The resulting solution was stirred for 10 min at RT and the reaction system was cooled to 0° C. To this was added a solution of N-(tert-butyldimethyl silyl)-5-(2-hydroxypropan-2-yl)-1-phenyl-1H-pyrazole-3-sulfonamide (660 mg, 1.67 mmol) in chloroform (3.0 mL) dropwise with stirring at 0° C. The resulting solution was stirred for 30 min at 0° C. To the mixture was added introduced NH.sub.3 gas bubble for 15 min at 0° C. The resulting solution was stirred for 2 h at RT. The resulting solution was diluted with 30 mL of water. The resulting solution was extracted with 3×30 mL of DCM and the organic layers combined and dried over anhydrous sodium sulfate and concentrated under vacuum. The residue was eluted from a silica gel column with ethyl acetate/petroleum ether (1:1). This resulted in 530 mg (81%) of the title compound as a light yellow solid. MS-ESI: 395 (M+1).

    ##STR00903##

    ##STR00904##

    N′-(tert-butyldimethylsilyl)-4-(2-hydroxypropan-2-yl)-5-methylthiazole-2-sulfonimidamide

    [3792] Steps 1-6 used similar procedures for converting compound 16 to intermediate 2 shown in Scheme 7B to afford intermediate 60 from compound 151″. MS-ESI: 350 (M+1).

    ##STR00905## ##STR00906##

    ##STR00907##

    N-methyl-N-(4-sulfamoylbenzyl)acetamide

    [3793] ##STR00908##

    N-(4-(N′-(tert-butyldimethyl silyl)sulfamidimidoyl)benzyl)-N-methylacetamide

    Step 1: N-benzyl-N-methylacetamide

    [3794] Into a 1.0 L round-bottom flask were added benzyl(methyl)amine (10 g, 82.5 mmol) and DCM (500 mL) at 0° C. To this stirred solution were added DIEA (21.3 g, 165 mmol) and acetyl chloride (9.72 g, 124 mmol) in portions at 0° C. The resulting mixture was stirred for 4 h at RT. The resulting mixture was concentrated under reduced pressure. The residue was eluted from a silica gel column with ethyl acetate/petroleum ether (1:1) to afford the title compound (13 g, 96.5%) as a yellow oil. MS-ESI: 164 (M+1).

    Step 2: 4-((N-methylacetamido)methyl)benzenesulfonyl chloride

    [3795] Into a 250 mL round-bottom flask were added N-benzyl-N-methylacetamide (3.0 g, 18.4 mmol,) and DCM (6.0 mL) at 0° C. To this stirred solution were added C.sub.1SO.sub.20H (6.0 mL) in one portion at 0° C. The resulting mixture was stirred for 3 h at RT. The reaction was quenched by the addition of water/ice (150 mL) at 0° C. The resulting solution was extracted with 3×150 mL of DCM and the organic layers combined and dried over anhydrous sodium sulfate and concentrated under vacuum. The crude product of the title compound (2.2 g, 45.7%)) was used in the next step directly without further purification.

    Step 3: N-methyl-N-(4-sulfamoylbenzyl)acetamide

    [3796] Into a 250 mL round-bottom flask were added 4-[(N-methylacetamido)methyl]benzene-1-sulfonyl chloride (2.2 g, 8.41 mmol) and DCM (3.0 mL) at 0° C. To this stirred solution were added NH.sub.3 (g) in DCM (40 mL) dropwise at 0° C. The resulting mixture was stirred overnight at RT. The resulting mixture was concentrated under reduced pressure. The residue was eluted from a silica gel column with ethyl acetate/petroleum ether (1:1) to afford the minor compound 159B (122 mg, 6.1%) and the title compound (1.9 g, 93.3%) both as white solids. MS-ESI: 243 (M+1).

    [3797] Step 4-6 used similar procedures for converting compound 148″ to intermediate 59 shown in Scheme 36 to afford intermediate 62 from intermediate 61. MS-ESI: 356 (M+1)

    TABLE-US-00017 TABLE 10 Intermediate 62B in the following Table was prepared using the similar procedures for converting compound 157″ to Intermediate 62 shown in Scheme 38 from compound 159″B which 5 was separated from step 3 in Scheme 38. The Intermediate 63 was prepared using similar procedures for converting compound 157″ to Intermediate 62 shown in Scheme 38 from appropriate starting materials. Exact Intermediate # Structure IUPAC Name Mass[M + H].sup.+ Intermediate 62B [00909]embedded image N-(3-(N′-(tert-butyldimethylsilyl) sulfamimidoyl)benzyl)-N- methylacetamide 356 Intermediate 63 [00910]embedded image N′-(tert-butyldimethylsilyl)-2-fluoro- 4-methoxybenzenesulfonimidamide 319

    ##STR00911##

    ##STR00912##

    4-((Methylamino)methyl)benzenesulfonamide

    [3798] ##STR00913##

    N-(4-(N′-(tert-butyldimethyl silyl)sulfamimidoyl)benzyl)-N-methylpent-4-ynamide

    Step 1: 4-((Methylamino)methyl)benzenesulfonamide

    [3799] Into a 500-mL sealed tube, was placed N-methyl-N-[(4-sulfamoylphenyl)methyl]acetamide (5.0 g), hydrogen chloride (200 mL, 12 M). The resulting solution was stirred for 16 h at 100° C. in an oil bath. The resulting mixture was concentrated. This resulted in 5.0 g of the title compound as an off-white crude solid. MS-ESI: 201 (M+1)

    Step 2: N-methyl-N-(4-sulfamoylbenzyl)pent-4-ynamide

    [3800] Into a 250 mL round-bottom flask was placed 4-((methylamino)methyl)benzenesulfonamide (4.0 g, 20 mmol) in DMF (40 mL). To this stirred solution was added HATU (6.33 g, 16.7 mmol), DIEA (5.16 g, 40 mmol) and pent-4-ynoic acid (2.16 g, 22 mmol). Then the mixture was stirred overnight RT. The resulting solution was diluted with 40 mL of water. The resulting solution was extracted with 3×50 mL of ethyl acetate and the organic layers combined and dried over anhydrous sodium sulfate and concentrated under vacuum. The residue was eluted from a silica gel column with ethyl acetate/petroleum ether (1:1). This resulted in 2.97 g (53%) of the title compound as a light yellow solid. MS-ESI: 281 (M+1).

    [3801] Steps 3-5 used similar procedures for converting Intermediate 61 to Intermediate 62 shown in Scheme 38 to afford Intermediate 65 from compound 163″. MS-ESI: 394 (M+1).

    ##STR00914##

    ##STR00915##

    Tert-butyl 4-(N′-(tert-butyldimethylsilyl)sulfamimidoyl)benzyl(methyl)carbamate

    [3802] ##STR00916##

    N′-((1,2,3,5,6,7-hexahydro-s-indacen-4-yl)carbamoyl)-4-((methylamino)methyl)benzenesulfonimidamide

    Step 1: Tert-butyl methyl(4-sulfamoylbenzyl)carbamate

    [3803] Into a 250-mL round-bottom flask, was placed 4-[(methylamino)methyl]benzene-1-sulfonamide (5.0 g, 25 mmol) in DCM (100 mL). To this stirred solution was added di-tert-butyl dicarbonate (6.0 g, 27.5 mmol). The resulting solution was stirred for 5 h at RT. The resulting mixture was concentrated. The residue was eluted from a silica gel column with ethyl acetate/petroleum ether (1:1). This resulted in 5.0 g (66.7%) of the title compound as a light yellow solid. MS-ESI: 301 (M+1).

    [3804] Steps 2-4 used similar procedures for converting compound 148″ to intermediate 59 shown in Scheme 36 to afford Intermediate 66 from compound 166″. MS-ESI: 414 (M+1).

    Step 5: Tert-butyl(4-(N-(tert-butyldimethylsilyl)-N′-((1,2,3,5,6,7-hexahydro-s-indacen-4-yl)carbamoyl)-sulfamidimidoyl)benzyl)(methyl)carbamate

    [3805] Into a 50-mL round-bottom flask, was placed tert-butyl (4-(N′-(tert-butyldimethylsilyl)sulfamidimidoyl)benzyl)(methyl)carbamate (500 mg, 1.21 mmol) in THF (15 mL). To this stirred solution was added 4-isocyanato-1,2,3,5,6,7-hexahydro-s-indacene (343 mg, 1.81 mmol) and NaH (60% wt. oil dispersion, 96.8 mg, 2.42 mmol). The resulting solution was stirred for 3 h at RT. The reaction was quenched by the addition of MeOH (10 mL). This resulted in 500 mg (67.5%) of the title compound as a white crude solid. MS-ESI: 613 (M+1).

    Step 6: N′-(1,2,3,5,6,7-hexahydro-s-indacen-4-ylcarbamoyl)-4-((methylamino)methyl)benzenesulfonimidamide

    [3806] Into a 50-mL round-bottom flask was placed tert-butyl N-[(4-[[(tert-butyldimethylsilyl)amino]([[(1,2,3,5,6,7-hexahydro-s-indacen-4-yl)carbamoyl]imino])oxo-λ.sup.6-sulfanyl]phenyl)methyl]-N-methylcarbamate (90 mg) and HCl in dioxane (4 M, 5.0 mL). The resulting solution was stirred for 16 h at RT. The resulting mixture was concentrated. The crude product was purified by Prep-HPLC with the following conditions: Column, Sunfire Prep C18 OBD, 10 um, 19*250 mm; mobile phase A: water (0.05% TFA) and B: ACN (20% to 50% gradient of B over 17 min); Detector, UV 220/254 nm. This resulted in 30 mg of the title compound as a white solid. MS-ESI: 399 (M+1).

    ##STR00917##

    ##STR00918##

    N′-(tert-butyldimethylsilyl)-6-(2-hydroxypropan-2-yl)-2-methylpyridine-3-sulfonimidamide

    Step 1: Methyl 5-amino-6-methylpicolinate

    [3807] Into a 50-mL seal tube was placed methyl 6-bromo-2-methylpyridin-3-amine (500 mg, 2.67 mmol) in MeOH (15 mL) and Pd(OAc).sub.2 (120 mg, 0.53 mmol), dppf (444 mg, 0.80 mmol), TEA (809 mg, 8.01 mmol). The seal tube was evacuated and flushed three times with CO. The resulting solution was stirred for 5 h at 100° C. under 10 atm of CO. Then the solution was concentrated under vacuum. The residue was eluted from a silica gel column with ethyl acetate/petroleum ether (1:1). This resulted in 351 mg (79.2%) of the title compound as a light yellow solid. MS-ESI: 167 (M+1). Steps 2-4 used similar procedures for converting compound 27 to Intermediate 30 shown in Scheme 9 to afford compound 176″ from compound 173″. MS-ESI: 231 (M+1). Steps 5-6 used similar procedures for converting compound 148″ to intermediate 59 shown in Scheme 36 to afford Intermediate 70 from compound 176″. MS-ESI: 344 (M+1).

    TABLE-US-00018 TABLE 11 The Intermediates in the following Table were prepared using the similar procedures for converting compound 172″ to Intermediate 70 shown in Scheme 42 from appropriate starting materials. Exact Intermediate # Structure IUPAC Name Mass[M + H].sup.+ Intermediate 71 [00919]embedded image N′-(tert-butyldimethylsilyl)-6-(2- hydroxypropan-2-yl)pyridine-3- sulfonimidamide 330

    ##STR00920##

    ##STR00921##

    N′-(tert-butyldimethyl silyl)-4-(2-methoxypropan-2-yl)benzenesulfonimidamide

    Step 1: 1-Bromo-4-(2-methoxypropan-2-yl)benzene

    [3808] Into a 250-mL round-bottom flask, was placed a solution of 2-(4-bromophenyl)propan-2-ol (10 g, 46.5 mmol) in THF (50 mL). To this stirred solution was added NaH (60% wt. oil dispersion, 5.19 g, 93 mmol) at 0° C. The resulting solution was stirred for 30 min at 0° C. To this stirred solution was added MeI (6.60 g, 46.5 mmol) dropwise with stirring at 0° C. The resulting solution was allowed to react for an additional 15 h at RT. The resulting solution was quenched with 40 mL of water. The resulting solution was extracted with 3×50 mL of ethyl acetate and the organic layers combined and dried over anhydrous sodium sulfate and concentrated under vacuum. The residue was eluted from a silica gel column with ethyl acetate/petroleum ether (15/85). This resulted in 8.5 g (50.3%) of the title compound as a yellow solid.

    Step 2: 4-(2-Methoxypropan-2-yl)benzenesulfinic acid

    [3809] Into a 250-mL 3-necked round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed a solution of 1-bromo-4-(2-methoxypropan-2-yl)benzene (5.0 g, 21.8 mmol) in THF (50 mL). To this stirred solution was added n-BuLi (13 mL, 32.7 mmol, 2.5 M) dropwise with stirring at −78° C. The resulting solution was stirred for 30 min at −78° C. SO.sub.2(g) was introduced into the stirring solution at −78° C. The resulting solution was allowed to react for an additional 60 min at RT. The resulting mixture was concentrated. This resulted in 6.0 g (crude) of the title compound as a yellow solid. MS-ESI: 213 (M−1)

    Step 3: 4-(2-Methoxypropan-2-yl)benzenesulfonyl chloride

    [3810] Into a 50-mL round-bottom flask, was placed 4-(2-methoxypropan-2-yl)benzene-1-sulfinic acid (4.9 g, 22.9 mmol) in THF (50 mL). To this stirred solution was added NCS (4.58 g, 34.3 mmol). The resulting solution was stirred for 30 min at 0° C. The mixture was allowed to react for an additional 60 min at RT. NH.sub.3 (g) was introduced into the reaction solution. The resulting solution was allowed to react for an additional 120 min at RT. The resulting mixture was concentrated. The residue was eluted from a silica gel column with ethyl acetate/petroleum ether (1/4). This resulted in 4.3 g (82%) of the title compound as a yellow solid.

    Step 4: 4-(2-Methoxypropan-2-yl)benzenesulfonamide

    [3811] Into a 250-mL round-bottom flask was placed 4-(2-methoxypropan-2-yl)benzene-1-sulfonyl chloride (4.3 g, 17.3 mmol) in DCM (50 mL). NH.sub.3 (g) was introduced into the reaction solution at 0° C. The resulting solution was stirred for 180 min at RT. The resulting mixture was concentrated. The residue was eluted from a silica gel column with ethyl acetate/petroleum ether (1/3). This resulted in 3.9 g (98.5%) of the title compound as a yellow solid. MS-ESI: 230 (M+1).

    Step 5: N-(tert-butyldimethylsilyl)-4-(2-methoxypropan-2-yl)benzenesulfonamide

    [3812] Into a 100-mL round-bottom flask, was placed a solution of 4-(2-methoxypropan-2-yl)benzene-1-sulfonamide (4.0 g, 17.5 mmol) in THF (40 mL). To this stirred solution was added NaH (1.4 g, 34.9 mmol, 60% wt. oil dispersion) and TBSCl (3.16 g, 21 mmol) at 0° C. The resulting solution was allowed to react with stirring for 15 h at RT. The resulting solution was quenched with 40 mL of water. The resulting solution was extracted with 3×50 mL of ethyl acetate and the organic layers combined and dried over anhydrous sodium sulfate and concentrated under vacuum. The residue was eluted from a silica gel column with ethyl acetate/petroleum ether (30/70). This resulted in 2.3 g (38.4%) of the title compound as a yellow solid. MS-ESI: 344 (M+1)

    Step 6: N′-(tert-butyldimethylsilyl)-4-(2-methoxypropan-2-yl)benzenesulfonimidamide

    [3813] Into a 500-mL 3-necked round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed the solution of PPh.sub.3Cl.sub.2 (12.4 g, 37.3 mmol) in chloroform (150 mL). This was followed by the addition of DIEA (9.63 g, 74.5 mmol) dropwise with stirring at RT. The resulting solution was stirred for 10 min at RT and the reaction system was cooled to 0° C. To this was added a solution of N-(tert-butyldimethylsilyl)-4-(2-methoxypropan-2-yl)benzene-1-sulfonamide (3.2 g, 9.31 mmol) in chloroform (30 mL) dropwise with stirring at 0° C. The resulting solution was stirred for 30 min at 0° C. To the mixture was introduced NH.sub.3 gas bubble for 15 min at 0° C. The resulting solution was stirred for 2 h at RT. The resulting solution was diluted with 100 mL of water. The resulting solution was extracted with 3×200 mL of DCM and the organic layers combined and dried over anhydrous sodium sulfate and concentrated under vacuum. The residue was eluted from a silica gel column with ethyl acetate/petroleum ether (36/64). This resulted in 1.4 g (36.5%) of the title compound as a yellow solid. MS-ESI: 343 (M+1)

    ##STR00922##

    ##STR00923##

    N′-(tert-butyldimethylsilyl)-5-((dimethylamino)methyl)pyridine-2-sulfonimidamide

    Step 1: (6-Bromopyridin-3-yl)-N,N-dimethylmethanamine

    [3814] Into a 500-mL 3-necked round-bottom flask purged and maintained with an inert atmosphere of nitrogen, were placed Ti(OEt).sub.4 (12.3 g, 53.8 mmol) and dimethylamine (4.85 g, 108 mmol) in Me OH (50 mL) at RT. To a stirred solution was added 6-bromopyridine-3-carbaldehyde (5.0 g, 26. 9 mmol) in MeOH (30 mL) dropwise at 0° C. Then the reaction solution was stirred at RT for 3 h. NaBH.sub.4 (1.02 g, 26.9 mmol) was added to the mixture and the resulting solution was stirred over night at RT. The reaction was quenched by the addition of water/ice (30 mL) at 0° C. The result in g mixture was concentrated under reduced pressure. Then the resulting mixture extracted with ethyl acetate (3×50 mL) and the organic layers combined and dried over anhydrous sodium sulfate and concentrated under vacuum. The residue was eluted from a silica gel column with ethyl acetate/petroleum ether (5:1) to afford the title compound (3.5 g, 60.5%) as a yellow oil. MS-ESI: 216/218 (M+1).

    [3815] Steps 2-6 used similar procedures for converting compound 179″ to Intermediate 72 shown in Scheme 43 to afford Intermediate 73 from compound 185. MS-ESI: 329 (M+1).

    TABLE-US-00019 TABLE 12 The Intermediates in the following Table were prepared using the similar procedures for converting compound 184″ to Intermediate 73 shown in Scheme 44 from appropriate starting materials. Exact Intermediate # Structure IUPAC Name Mass[M + H].sup.+ Intermediate 74 [00924]embedded image N′-(tert-butyldimethylsilyl)-6- ((dimethylamino)methyl)pyridine- 3-sulfonimidamide 329

    ##STR00925##

    ##STR00926##

    N′-(tert-butyldimethylsilyl)-1-methyl-1H-indazole-5-sulfonimidamide

    [3816] Steps 1-6 used similar procedures for converting compound 179″ to Intermediate 72 shown in Scheme 43 to afford Intermediate 75 from compound 190″. MS-ESI: 325 (M+1).

    ##STR00927##

    ##STR00928##

    N′-(tert-butyldimethylsilyl)-4-(2-(dimethylamino)propan-2-yl)benzenesulfonimidamide

    Step 1: 4-(Prop-1-en-2-yl)benzenesulfonamide

    [3817] Into a 250-mL round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed 4-bromobenzene-1-sulfonamide (5.0 g, 21.2 mmol) in dioxane (100 mL) and H.sub.2O (15 mL). To this stirred solution was added 4,4,5,5-tetramethyl-2-(prop-1-en-2-yl)-1,3,2-dioxaborolane (14.2 g, 84.7 mmol), Pd(dppf)C.sub.12 (4.65 g, 6.35 mmol) and Cs.sub.2CO.sub.3 (13.8 g, 42.4 mmol). The resulting solution was stirred for 15 h at 100° C. The resulting mixture was concentrated under reduced pressure. The residue was eluted from a silica gel column with ethyl acetate/petroleum ether (40/60). This resulted in 3.6 g (86.2%) of the title compound as a yellow solid. MS-ESI: 198 (M+1).

    Step 2: 2-Chloro-N-(2-(4-sulfamoylphenyl)propan-2-yl)acetamide

    [3818] Into a 1.0-L round-bottom flask, was placed 4-(prop-1-en-2-yl)benzene-1-sulfonamide (5.0 g, 25.4 mmol) in H.sub.2SO.sub.4 (50 mL) and AcOH (250 mL). To the stirred solution was added 2-chloroacetonitrile (38.3 g, 507 mmol). The resulting solution was stirred for 30 min at 0° C. The resulting solution was allowed to react for an additional 15 h at RT. The pH value of the solution was adjusted to 7 with Na.sub.2CO.sub.3 (5.0 M). Then the resulting mixture was extracted with ethyl acetate (3×200 mL) and the organic layers combined and dried over anhydrous sodium sulfate and concentrated under vacuum. The residue was eluted from a silica gel column with ethyl acetate/petroleum ether (2/3). This resulted in 4.2 g (57%) of the title compound as yellow oil. MS-ESI: 291 (M+1).

    Step 3: 4-(2-Aminopropan-2-yl)benzenesulfonamide

    [3819] Into a 250-mL round-bottom flask, was placed 2-chloro-N-[2-(4-sulfamoylphenyl)propan-2-yl]acetamide (4.2 g, 14.5 mmol) in CH.sub.3COOH (15 mL) and ethanol (75 mL). To this stirred solution was added thiourea (1.32 g, 17.3 mmol). The resulting solution was stirred for 16 h at 85° C. The resulting mixture was washed with 100 ml of H.sub.2O and extracted with 3×250 mL of ethyl acetate and the organic layers combined and dried over anhydrous sodium sulfate and concentrated under vacuum. This resulted in 2.3 g (54.3%) of the title compound as a yellow solid. MS-ESI: 215 (M+1).

    Step 4: 4-(2-(Dimethylamino)propan-2-yl)benzenesulfonamide

    [3820] Into a 250-mL round-bottom flask, was placed 4-(2-aminopropan-2-yl)benzene-1-sulfonamide (2.14 g, 9.99 mmol) in MeOH (50 mL). To this stirred solution was added HCHO (37% wt., 599 mg, 20 mmol) and NaBH.sub.3CN (1.86 g, 30 mmol). The resulting solution was stirred for 120 min at RT. The resulting mixture was diluted with 100 mL of water and extracted with 3×250 mL of ethyl acetate and the organic layers combined and dried over anhydrous sodium sulfate and concentrated under vacuum The residue was eluted from a silica gel column with ethyl acetate/petroleum ether (30/70). This resulted in 1.0 g (41.3%) of the title compound as a yellow solid. MS-ESI: 243 (M+1).

    [3821] Steps 5-7 used similar procedures for converting compound 148″ to intermediate 59 shown in Scheme 36 to afford Intermediate 76 from compound 200. MS-ESI: 356 (M+1).

    ##STR00929##

    ##STR00930##

    N′-(tert-butyl dimethylsilyl)-4-(1-(dimethylamino)ethyl)benzenesulfonimidamide

    Step 1: (E)-4-(1-((tert-butylsulfinyl)imino)ethyl)benzenesulfonamide

    [3822] Into a 250-mL 3-necked round-bottom flask purged and maintained with an inert atmosphere of nitrogen was added 2-methylpropane-2-sulfinamide (3.04 g, 25.1 mmol) in THF (50 mL). To this stirred solution was added Ti(OEt).sub.4(11.5 g, 50.2 mmol) and 4-acetylbenzene-1-sulfonamide (5.0 g, 25.1 mmol) in portions at RT. The resulting mixture was stirred for overnight at 70° C. under nitrogen atmosphere. The reaction was quenched with Water (20 mL) at 0° C. The resulting mixture was extracted with ethyl acetate (3×30 mL). The combined organic layers were dried over anhydrous Na.sub.2SO.sub.4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with ethyl acetate/petroleum ether (1:1) to afford the title compound (5.0 g, 75.8%) as a yellow solid. MS-ESI: 303 (M+1).

    Step 2: 4-(1-((Tert-butylsulfinyl)amino)ethyl)benzenesulfonamide

    [3823] Into a 500 mL round-bottom flask were added 4-[(1E)-1-[(2-methylpropane-2-sulfinyl)imino]ethyl]benzene-1-sulfonamide (4.65 g, 15.4 mmol) in THF (200 mL) at RT. To this stirred solution was added NaBH.sub.4 (1.16 g, 30.8 mmol) in portions at 0° C. under nitrogen atmosphere. The resulting mixture was stirred for 4 h at RT under nitrogen atmosphere. The reaction was quenched by the addition of HCl (2M, 50 mL) at 0° C. The resulting mixture was extracted with ethyl acetate (3×50 mL). The combined organic layers were dried over anhydrous Na.sub.2SO.sub.4. After filtration, the filtrate was concentrated under reduced pressure to afford the title compound (4.5 g, 96.1%) as a white solid. MS-ESI: 305 (M+1).

    Step 3: 4-(1-Aminoethyl)benzenesulfonamide

    [3824] Into a 250 mL round-bottom flask were added 4-[1-[(2-methylpropane-2-sulfinyl)amino]ethyl]benzene-1-sulfonamide (4.4 g, 14.5 mmol) and MeOH (50 mL) at room temperature. To this stirred solution was added HCl (gas) in 1,4-dioxane (8.0 mL, 26.3 mmol) in one portions at RT. The resulting mixture was stirred overnight at RT. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography with the following conditions (column, C18 silica gel; mobile phase, MeCN in water, 10% to 50% gradient in 10 min; detector, UV 254 nm.) to afford the title compound (2.6 g, 89.7%) as a white solid. MS-ESI: 201 (M+1).

    Step 4: 4-(1-(Dimethylamino)ethyl)benzenesulfonamide

    [3825] Into a 250 mL round-bottom flask was added 4-(1-aminoethyl)benzene-1-sulfonamide (2.0 g, 9.99 mmol) and MeOH (60 mL) at RT. To this stirred solution was added HCHO (37% wt., 1.61 g, 53.6 mmol) and NaBH.sub.3CN (1.25 g, 20 mmol) in portions at RT. The resulting mixture was stirred overnight at RT. The reaction solution was diluted with 100 mL of water and extracted with 3×100 mL of ethyl acetate and the organic layers combined and dried over anhydrous sodium sulfate and concentrated under vacuum. The residue was eluted from a silica gel column with ethyl acetate/petroleum ether. The residue was purified by silica gel column chromatography, eluted with ethyl acetate/petroleum ether (1:2) to afford the title compound (1.5 g, 65.8%) as a white solid. MS-ESI: 229 (M+1).

    [3826] Steps 5-7 used similar procedures for converting compound 148″ to intermediate 59 shown in Scheme 36 to afford Intermediate 77 from compound 207″. MS-ESI: 342 (M+1).

    ##STR00931##

    ##STR00932##

    4-(2-Hydroxypropan-2-yl)-N,N-dimethylthiophene-2-sulfonimidamide

    Step 1: N′-(tert-butyldimethylsilyl)-4-(2-hydroxypropan-2-yl)-N,N-dimethylthiophene-2-sulfonimidamide

    [3827] Into a 50-mL 3-necked round-bottom flask, was placed N-(tert-butyldimethylsilyl)-4-(2-hydroxypropan-2-yl) thiophene-2-sulfonoimidamide (300 mg, 0.90 mmol) in THF (3.0 mL). To the solution were added NaH (60% wt. oil dispersion, 53.8 mg, 1.35 mmol) at −10° C. in ethanol/ice bath. To the solution were added iodomethane (0.50 mL) dropwise with stirring at 0° C. in 30 min. The resulting solution was stirred for 30 min at RT. The reaction was then quenched by the addition of NH.sub.4C.sub.1 (aq.). The resulting solution was extracted with 3×20 mL of ethyl acetate and the organic layers combined, dried over anhydrous sodium sulfate and concentrated under vacuum. The residue was eluted from a silica gel column with ethyl acetate/petroleum ether (1:5). This resulted in 252 mg (77.5%) of the title compound as a white solid. MS-ESI: 363 (M+1).

    Step 2: N′-(tert-butyldimethylsilyl)-4-(2-hydroxypropan-2-yl)-N,N-dimethylthiophene-2-sulfonimidamide

    [3828] Into a 50-mL round-bottom flask, was placed N-(tert-butyldimethylsilyl)-4-(2-hydroxypropan-2-yl)-N,N-dimethylthiophene-2-sulfonoimidamide (200 mg, 0.55 mmol) in THF (10 mL). To the solution was added HF/Py (70% wt., 0.10 mL) dropwise with stirring at RT. The resulting solution was stirred for 60 min at RT. The resulting mixture was concentrated under vacuum. The resulting solution was extracted with ethyl acetate (3×10 mL), the organic layers combined and dried over anhydrous sodium sulfate. The residue was eluted from a silica gel column with ethyl acetate. This resulted in 127 mg (92.7%) of the title compound as a white solid. MS-ESI: 249 (M+1).

    ##STR00933##

    ##STR00934##

    2-(2-Hydroxypropan-2-yl)-N-methylthiazole-5-sulfonimidamide

    Step 1: Tert-butyl (chloro(2-(2-hydroxypropan-2-yl)thiazol-5-yl)(oxo)-λ.SUP.6.-sulfaneylidene)carbamate

    [3829] Into a 1.0-L round-bottom flask, was placed tert-butyl N-[[2-(2-hydroxypropan-2-yl)-1,3-thiazol-5-yl]sulfinyl]carbamate (100 g, 326 mmol) in ACN (500 mL). To the stirred solution was added NCS (65.4 g, 490 mmol). The resulting solution was stirred for 2 h at RT. The resulted solution was concentrated. This resulted in 120 g (crude) of the title compound as yellow oil. MS-ESI: 341/343 (M+1).

    Step 2: Tert-butyl((2-(2-hydroxypropan-2-yl)thiazol-5-yl)(methylamino)(oxo)-λ.SUP.6.-sulfaneylidene) carbamate

    [3830] Into a 250-mL round-bottom flask, was placed tert-butyl (chloro(2-(2-hydroxypropan-2-yl)thiazol-5-yl)(oxo)-λ.sup.6-sulfaneylidene)carbamate (10 g, 29.3 mmol) in THF (100 mL). To the stirred solution was added CH.sub.3NH.sub.2 (1.82 g, 58.6 mmol). The resulting solution was stirred for 2 h at RT. The resulted solution was concentrated. The residue was eluted from a silica gel column with ethyl acetate/petroleum ether (1:1). This resulted in 6.1 g (62%) of the title compound as a yellow solid. MS-ESI: 336 (M+1).

    Step 3: 2-(2-Hydroxypropan-2-yl)-N′-methylthiazole-5-sulfonimidamide

    [3831] Into a 100-mL round-bottom flask, was placed tert-butyl((2-(2-hydroxypropan-2-yl)thiazol-5-yl)(methylamino)(oxo)-λ.sup.6-sulfaneylidene) carbamate (3.0 g, 8.94 mmol) in HCl (gas) in 1,4-dioxane (8 mL, 26.3 mmol) in one portion at RT. The resulting solution was stirred for 60 min at RT. The resulting mixture was concentrated under vacuum. This resulted in 2.10 g (crude) of the title compound as a yellow solid. MS-ESI: 236 (M+1).

    ##STR00935##

    ##STR00936##

    Tert-butyl (amino(2-(2-methoxypropan-2-yl)thiazol-5-yl)(oxo)-λ.SUP.6.-sulfaneylidene)carbamate

    Step 1: Methyl 2-(2-methoxypropan-2-yl)thiazole-5-sulfinate

    [3832] Into a 1-L round-bottom flask, was placed a solution of methyl 2-(2-hydroxypropan-2-yl)-1,3-thiazole-5-sulfinate (40 g, 181 mmol) in THF (500 mL). To this stirred solution was added NaH (60% wt. oil dispersion, 7.95 g, 199 mmol) in three portions at 0° C. in an ice/ethanol bath. To this reaction solution was added MeI (51.3 g, 362 mmol) dropwise with stirring at 0° C. in an ice/ethanol bath. The resulting solution was stirred for 3 h at RT. The reaction was then quenched by the addition of water (50 mL) at 0° C. The resulting solution was extracted with 3×300 mL of ethyl acetate and the organic layers combined and dried over anhydrous sodium sulfate and concentrated under vacuum. This resulted in 32 g (75.3%) of the title compound as a white solid. MS-ESI: 236 (M+1).

    Step 2: 2-(2-Methoxypropan-2-yl)thiazole-5-sulfinamide

    [3833] Into a 1-L 3-necked round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed a solution of methyl 2-(2-methoxypropan-2-yl)-1,3-thiazole-5-sulfinate (20 g, 85 mmol) in THF (500 mL). This was followed by the addition of KHMDS (500 mL, 1.0 mole, 2 M) dropwise with stirring at −78° C. in a liquid nitrogen/ethanol bath. The resulting solution was stirred for 3 h at −78° C. in a liquid nitrogen/ethanol bath. The reaction was quenched by the addition of water (50 mL). The resulting solution was extracted with 3×300 mL of ethyl acetate dried over anhydrous sodium sulfate and concentrated under vacuum. The residue was eluted from a silica gel column with ethyl acetate/petroleum ether (1:3). This resulted in 14 g (74.8%) of the title compound as a white solid. MS-ESI: 221.0 (M+1).

    Step 3: Tert-butyl ((2-(2-methoxypropan-2-yl)thiazol-5-yl)sulfinyl)carbamate

    [3834] Into a 500-mL round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed a solution of 2-(2-methoxypropan-2-yl)-1,3-thiazole-5-sulfinamide (10 g, 45.4 mmol) in THF (250 mL). To this stirred solution was added NaH (60% wt. oil dispersion, 3.63 g, 90.8 mmol) in three times at 0° C. in an ice/ethanol bath. To this solution was added Boc.sub.2O (9.91 g, 45.4 mmol) in portions at 0° C. in an ice/ethanol bath. The resulting solution was stirred for 3 h at RT. The reaction was then quenched by the addition of water (50 mL). The resulting solution was extracted with 3×300 mL of ethyl acetate concentrated under vacuum. This resulted in 12 g (82.5%) of the title compound as a white solid. MS-ESI: 321.1 (M+1).

    Step 4: Tert-butyl (chloro(2-(2-methoxypropan-2-yl)thiazol-5-yl)(oxo)-λ.SUP.6.-sulfaneylidene)carbamate

    [3835] Into a 500-mL round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed a solution of tert-butyl N-[[2-(2-methoxypropan-2-yl)-1,3-thiazol-5-yl]sulfinyl]carbamate (11 g, 34.3 mmol) in THF (200 mL). NCS (13.8 g, 103 mmol) was added to the reaction solution in one portion at RT. The resulting solution was stirred for 3 h at RT. This reaction solution was used to the next step directly without further purification.

    Step 5: Tert-butyl (amino(2-(2-methoxypropan-2-yl)thiazol-5-yl)(oxo)-λ.SUP.6.-sulfaneylidene)carbamate

    [3836] Into a 500-mL round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed a solution of tert-butyl N-[[2-(2-methoxypropan-2-yl)-1,3-thiazol-5-yl]sulfinyl]carbamate (9.0 g, 28.9 mmol) in THF (200 mL). To the mixture was added introduced NH.sub.3 gas bubble for 15 min at 0° C. The resulting solution was stirred for 1 h at RT. The resulting mixture was concentrated. The residue was eluted from a silica gel column with ethyl acetate/petroleum ether (1:1). This resulted in 7 g (72.3%) of the title compound as a white solid. MS-ESI: 336.1 (M+1).

    ##STR00937##

    ##STR00938##

    N′-(tert-butyldimethylsilyl)-6-isobutylpyridine-3-sulfonimidamide

    [3837] Steps 1-2 used similar procedures for converting compound 27 to Intermediate 29 shown in Scheme 9 to afford compound 219″ from compound 217″. MS-ESI: 238 (M+1).

    Step 3: 6-(2-Methylprop-1-enyl)pyridine-3-sulfonamide

    [3838] Into a 500 mL round-bottom flash were added 6-bromopyridine-3-sulfonamide (5.5 g, 23.2 mmol) and dioxane (150 mL) and water (15 mL) at RT. To this solution was added Pd(dppf)C.sub.12 (1.7 g, 2.32 mmol), Cs.sub.2CO.sub.3 (15.1 g, 46.4 mmol) and 4,4,5,5-tetramethyl-2-(2-methylprop-1-en-1-yl)-1,3,2-dioxaborolane (8.45 g, 46.4 mmol) in one portion at RT under nitrogen atmosphere. The resulting mixture was stirred overnight at 100° C. under nitrogen atmosphere. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography with ethyl acetate/petroleum ether (1:1) to afford title compound (4.0 g, 81.2%) as a light yellow oil. MS-ESI: 213 (M+1).

    Step 4: 6-Isobutylpyridine-3-sulfonamide

    [3839] Into a 250 mL 3-necked round-bottom flask was added 6-(2-methylprop-1-en-1-yl)pyridine-3-sulfonamide (4 g, 18.8 mmol) and MeOH (100 mL) at RT under nitrogen atmosphere. To this stirred solution was added Pd/C (wet 10% wt., 900 mg). The flask was evacuated and filled three times with hydrogen. The resulting mixture was stirred overnight at RT under hydrogen atmosphere. The resulting mixture was filtered; the filter cake was washed with MeOH (3×20 mL). The filtrate was concentrated under reduced pressure. The crude product of the title compound (3.8 g) was used to the next step directly without further purification. MS-ESI: 215 (M+1). Steps 5-7 used similar procedures for converting compound 148″ to intermediate 59 shown in Scheme 36 to afford intermediate 81 from compound 221″. MS-ESI: 328 (M+1).

    TABLE-US-00020 TABLE 13 The Intermediates in the following Table were prepared using the similar procedures for converting compound 217″ to Intermediate 81 shown in Scheme 51 from appropriate starting materials. Intermediate Exact Mass # Structure IUPAC Name [M + H].sup.+ Intermediate 82 [00939]embedded image N′-(tert-butyldimethylsilyl)-4- isobutylbenzenesulfonimidamide 327

    ##STR00940## ##STR00941##

    ##STR00942##

    N-(tert-butyldimethylsilyl)-4-((tert-butyldimethylsilyloxy)methyl)benzenesulfonimidamide

    Example 233 (Compound 342)

    [3840] ##STR00943##

    N′-((1,2,3,5,6,7-hexahydro-s-indacen-4-yl)carbamoyl)-4-(hydroxymethyl)benzene sulfonimidamide

    Step 1: 4-(Hydroxymethyl)benzenesulfonamide

    [3841] Into a 100-mL round-bottom flask, was placed 4-sulfamoylbenzoic acid (1.0 g, 4.97 mmol) in THF (15 mL). This was followed by the addition of BH.sub.3-THF (14.3 mL, 149 mmol) dropwise with stirring at 0° C. in an ice/ethanol bath. The resulting solution was stirred for 12 h at RT. The reaction was then quenched by the addition of HCl (50 mL, 2 M) dropwise in an ice bath and stirred for 1 h at RT. The mixture was extracted with 8×50 mL of ethyl acetate. The organic layers were combined and concentrated. This resulted in 800 mg (86%) of the title compound as a yellow solid. MS-ESI: 188 (M+1).

    [3842] Steps 2-3 used similar procedures for converting compound 148″ to Intermediate 59 shown in Scheme 36 to afford Intermediate 83 from compound 225″. MS-ESI: 415 (M+1). Steps 4-5 used similar procedures for converting compound 166″ to Intermediate 67 shown in Scheme 40A to afford compound Example 233 from Intermediate 83. MS-ESI: 386 (M+1).

    Intermediate 84

    [3843] ##STR00944##

    4-(Bromomethyl)-N′-(1,2,3,5,6,7-hexahydro-s-indacen-4-ylcarbamoyl)benzenesulfonimidamide

    Step 6: 4-(Bromomethyl)-N′-(1,2,3,5,6,7-hexahydro-s-indacen-4-ylcarbamoyl)benzenesulfonimidamide

    [3844] Into a 250-mL round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed 1-[amino[4-(hydroxymethyl)phenyl]oxo-λ.sup.6-sulfanylidene]-3-(1,2,3,5,6,7-hexahydro-s-indacen-4-yl)urea (1.0 g, 2.59 mmol) in THF (50 mL). To the stirred solution was added PBr.sub.3 (702 mg, 2.59 mmol) in portions. The resulting solution was stirred for 3 h at RT. The solids were collected by filtration. This resulted in 500 mg (43%) of the title compound as a white solid. MS-ESI: 449/411 (M+1).

    ##STR00945##

    ##STR00946##

    N′-(tert-butyldimethylsilyl)-2-methyl-1,2,3,4-tetrahydroisoquinoline-6-sulfonimidamide

    Step 1: 6-Bromo-2-methyl-1,2,3,4-tetrahydroisoquinoline

    [3845] Into a 250-mL round-bottom flask, was placed 6-bromo-1,2,3,4-tetrahydroisoquinoline (6.0 g, 28.3 mmol) in MeOH (100 mL) under N.sub.2. To the stirred solution was added HCHO (1.02 g, 34 mmol) in portions at RT. The resulting solution was stirred for 4 h, then NaBH.sub.3CN (3.56 g, 56.6 mmol) was added in portions at RT. The resulting solution was stirred overnight at RT. The reaction was then quenched by the addition of water (100 mL) and extracted with 3×150 mL ethyl acetate. The organic layers were combined and dried over anhydrous sodium sulfate and concentrated under vacuum. The crude product was eluted from a silica gel column with acetate/petroleum ether (1:1). This resulted in 5 g (78.2%) of the title compound as a white solid. MS-ESI: 226/228 (M+1).

    [3846] Steps 2-5 used similar procedures for converting compound 185″ to Intermediate 173″ shown in Scheme 44 to afford Intermediate 85 from compound 229. MS-ESI: 238 (M+1).

    ##STR00947##

    ##STR00948##

    N′-(tert-butyldimethylsilyl)-2-methyl-1,2,3,4-tetrahydroisoquinoline-7-sulfonimidamide

    Step 1: 1-(3,4-Dihydroisoquinolin-2(1H)-yl)-2,2,2-trifluoroethanone

    [3847] Into a 250-mL round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed 1,2,3,4-tetrahydroisoquinoline (8.0 g, 60.1 mmol) and 2,2,2-trifluoroacetic anhydride (25.2 g, 120 mmol). The resulting solution was stirred for 12 h at RT. The reaction was then quenched by the addition of 100 mL of water/ice. The resulting solution was extracted with 3×100 mL of ethyl acetate and the organic layers were combined and dried over anhydrous sodium sulfate and concentrated under vacuum. This resulted in 10 g (72.6%) of the title compound as a yellow solid. MS-ESI: 230 (M+1).

    [3848] Steps 2-3 used similar procedures for converting compound 158″ to Intermediate 61 shown in Scheme 38 to afford compound 236″ from compound 234″. MS-ESI: 309 (M+1).

    Step 4: 1,2,3,4-Tetrahydroisoquinoline-7-sulfonamide

    [3849] Into a 100-mL round-bottom flask, was placed 2-(2,2,2-trifluoroacetyl)-1,2,3,4-tetrahydroisoquinoline-7-sulfonamide (8.0 g, 26 mmol) in ethanol (12 mL) and H.sub.2O (60 mL). To the stirred solution was added KOH (7.28 g, 123 mmol) in one portion at RT. The resulting solution was stirred for 12 h at RT. The resulting mixture was concentrated. The crude product was applied onto a silica gel column with DCM/MeOH (10:1). This resulted in 5.0 g (90.8%) of the title compound as a light yellow solid.

    [3850] Step 5 used similar procedures for converting compound 228″ to compound 229″ shown in Scheme 53 to afford compound 238″ from compound 237″. MS-ESI: 227 (M+1).

    [3851] Steps 6-7 used similar procedures for converting compound 148″ to intermediate 59 shown in Scheme 36 to afford intermediate 86 from compound 238″. MS-ESI: 340 (M+1).

    ##STR00949##

    ##STR00950##

    N′-(tert-butyldimethylsilyl)-2-methyl-1,2,3,4-tetrahydroisoquinoline-7-sulfonimidamide

    Step 1: 4-((Dimethylamino)methyl)-2-methoxybenzenesulfonamide

    [3852] Into a 50-mL round-bottom flask, was placed 4-[(dimethylamino)methyl]-2-fluorobenzene-1-sulfonamide (1 g, 4.31 mmol) and DMF (10 mL, 0.14 mmol). Then to the above was added sodium methoxide (2.16 g, 40 mmol). The resulting solution was stirred for 12 h at RT. The reaction was then quenched by the addition of 5.0 mL of water. The residue was eluted from a C18 column with ACN:H.sub.2O (3:7). This resulted in 800 mg (76.1%) of the title compound as a yellow solid. MS-ESI: 245 (M+1).

    [3853] Steps 2-3 used similar procedures for converting compound 148″ to intermediate 59 shown in Scheme 36 to afford intermediate 87 from compound 240″. MS-ESI: 358 (M+1).

    ##STR00951## ##STR00952##

    ##STR00953##

    N′-(tert-butyldimethylsilyl)-5-((dimethylamino)methyl)-3-fluorothiophene-2-sulfonimidamide

    Step 1: (4-Fluorothiophen-2-yl)methanol

    [3854] Into a 1000-mL round-bottom flask, was placed methyl 4-fluorothiophene-2-carboxylate (10 g, 62.4 mmol) in ethanol (300 mL). Then to the above solution was added NaBH.sub.4 (4.62 g, 125 mmol) in portions at 0° C. in an ice/ethanol bath. The resulting solution was stirred for 30 min at 0° C. and then the reaction solution was allowed to react for an additional 16 h at RT. The reaction was then quenched by the addition of 50 mL of water. Then the mixture was concentrated and extracted with 3×100 mL of ethyl acetate and the organic layers were combined and dried over anhydrous sodium sulfate and concentrated under vacuum. This resulted in 6.4 g (77.6%) of the title compound as white oil. MS-ESI: 133 (M+1)

    Step 2: 2-(Bromomethyl)-4-fluorothiophene

    [3855] Into a 250-mL round-bottom flask, was placed (4-fluorothiophen-2-yl)methanol (8.5 g, 64.3 mmol) in DCM (70 mL). To the stirred solution was added PBr.sub.3 (19.2 g, 70.8 mmol) dropwise at 0° C. in an ice/ethanol bath. The resulting solution was stirred for 30 min at 0° C. The resulting solution was allowed to react for an additional 12 h at RT. The reaction was then quenched by the addition of 50 mL of water. Then the mixture was concentrated and extracted with 3×100 mL of ethyl acetate and the organic layers were combined and dried over anhydrous sodium sulfate and concentrated under vacuum. The residue was eluted from a silica gel column with ethyl acetate/petroleum ether (15/85). This resulted in 7.0 g (55.8%) of the title compound as yellow oil. MS-ESI: 194/196 (M+1).

    Step 3: 1-(4-Fluorothiophen-2-yl)-N,N-dimethylmethanamine

    [3856] Into a 250-mL round-bottom flask, was placed 2-(bromomethyl)-4-fluorothiophene (7.4 g, 37.9 mmol) in CHCl.sub.3 (50 mL). To the above solution was added butoxytributyl-14-azane sulfate (6.76 g, 19 mmol) and DMA (37 mL, 425 mmol) with stirring at RT. The resulting solution was stirred for 2 h at 60° C. The reaction was then quenched by the addition of 50 mL of water. Then the mixture was concentrated and extracted with 3×100 mL of ethyl acetate and the organic layers were combined and dried over anhydrous sodium sulfate and concentrated under vacuum. The residue was eluted from a silica gel column with ethyl acetate/petroleum ether (17/83). This resulted in 6.0 g (99.5%) of the title compound as a yellow solid. MS-ESI: 160 (M+1).

    Step 4: Lithium 5-((dimethylamino)methyl)-3-fluorothiophene-2-sulfinate

    [3857] Into a 500-mL 3-necked round-bottom flask purged with and maintained under nitrogen, was placed a solution of [(4-fluorothiophen-2-yl)methyl]dimethylamine (6.2 g, 38.9 mmol) in THF (60 mL). This was followed by the addition of n-BuLi/THF (18.7 mL, 2.5 M) dropwise with stirring at −78° C. in a liquid nitrogen/ethanol bath. The resulting solution was stirred for 30 min at −78° C. To the above SO.sub.2(g) was introduced into the reaction solution at −78° C. The resulting solution was allowed to react for an additional 2 h at RT. The resulting mixture was concentrated. This resulted in 10 g (crude) of the title compound as a yellow solid. MS-ESI: 222 (M−1).

    Step 5: 5-((Dimethylamino)methyl)-3-fluorothiophene-2-sulfonyl chloride

    [3858] Into a 500-mL round-bottom flask, was placed a solution of 5-[(dimethylamino)methyl]-3-fluorothiophene-2-sulfinic acid (10 g, 44.8 mmol) in THF (100 mL). To the above solution was added NCS (7.18 g, 53.8 mmol). The resulting solution was stirred for 30 min at 0° C. and then allowed to react for an additional 2 h at RT. This reaction was used for next step without purification.

    Step 6: 5-((Dimethylamino)methyl)-3-fluorothiophene-2-sulfonamide

    [3859] Into a 500-mL round-bottom flask, was placed a solution of 5-[(dimethylamino)methyl]-3-fluorothiophene-2-sulfonyl chloride (10 g, 38.8 mmol) in THF (100 mL). To the above NH.sub.3 (g) was introduced at RT. The resulting solution was stirred for 30 min at RT. The resulting mixture was concentrated. The residue was eluted from a silica gel column with ethyl acetate/petroleum ether (60/40). This resulted in 2.1 g (22.7%) of the title compound as yellow oil. MS-ESI: 239 (M+1).

    Step 7: N-(tert-butyldimethylsilyl)-5-((dimethylamino)methyl)-3-fluorothiophene-2-sulfonamide

    [3860] Into a 100-mL round-bottom flask, was placed a solution of 5-[(dimethylamino)methyl]-3-fluorothiophene-2-sulfonamide (1.8 g, 7.55 mmol) in THF (30 mL) under N.sub.2. To the above solution was added NaH (60% wt. oil dispersion, 640 mg, 15 mmol) with stirring at 0° C. The resulting solution was stirred for 5 min at 0° C. This was followed by the addition of TBSCl (1.37 g, 9.09 mmol) at 0° C. The resulting solution was allowed to react for an additional 15 h at RT. The reaction was then quenched by the addition of 20 mL of water. Then the mixture was concentrated and extracted with 3×100 mL of ethyl acetate and the organic layers were combined and dried over anhydrous sodium sulfate and concentrated under vacuum. The residue was eluted from a silica gel column with ethyl acetate/petroleum ether (1:1). This resulted in 2.0 g (75.2%) of the title compound as yellow oil. MS-ESI: 353 (M+1).

    Step 8: N-(tert-butyldimethylsilyl)-5-((dimethylamino)methyl)-3-fluorothiophene-2-sulfonimidoyl chloride

    [3861] Into a 500-mL round-bottom flask purged and maintained with an inert atmosphere of nitrogen was placed a solution of PPh.sub.3Cl.sub.2 (29.5 g, 88.7 mmol) in CHCl.sub.3 (50 mL). To the above solution was added DIEA (17.2 g, 133 mmol) dropwise in an ice/water bath. The solution was stirred at RT for 20 minutes. This was followed by the addition of N-(tert-butyldimethylsilyl)-5-[(dimethylamino)methyl]-3-fluorothiophene-2-sulfonamide (15.7 g, 44.4 mmol) in CHCl.sub.3 (30 mL) at 0° C. The resulting solution was allowed to react for an additional 30 min at 0° C. Then the reaction solution was used for next step without purification.

    Step 9: N′-(tert-butyldimethylsilyl)-5-((dimethylamino)methyl)-3-fluorothiophene-2-sulfonimidamide

    [3862] Into a 500-mL round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed [(tert-butyldimethylsilyl)imino](chloro)[5-[(dimethylamino)methyl]-3-fluorothiophen-2-yl]-λ.sup.6-sulfanone (16.5 g, 44.4 mmol) in CHCl.sub.3 (80 mL). To the above NH.sub.3(g) was introduced at 0° C. for 15 min. The resulting solution was stirred for 15 min at 0° C. and then allowed to react for an additional 15 h at RT. The resulting mixture was concentrated. The residue was eluted from a silica gel column with ethyl acetate/petroleum ether (60/40). This resulted in 5.8 g (37.2%) of the title compound as a yellow solid. MS-ESI: 352 (M+1).

    ##STR00954##

    ##STR00955##

    N′-(tert-butyldimethylsilyl)-2-(2-hydroxypropan-2-yl)thiazole-5-sulfonimidamide

    Step 1: 2-(2-Hydroxypropan-2-yl)thiazole-5-sulfonimidamide

    [3863] Into a 250-mL round-bottom flask, was placed a solution of tert-butyl 2-(2-hydroxypropan-2-yl)thiazole-5-sulfonimidoylcarbamate (3.21 g, 10 mmol) in HCl/dioxane (4 M, 50 mL). The resulting solution was stirred for 1 h at RT. The solution was concentrated to give the title compound (3.2 g, crude, yellow oil). MS-ESI: 222 (M+1).

    Step 2: N′-(tert-butyldimethylsilyl)-2-(2-hydroxypropan-2-yl)thiazole-5-sulfonimidamide

    [3864] Into a 250-mL round-bottom flask, was placed 2-(2-hydroxypropan-2-yl)thiazole-5-sulfonimidamide (3.2 g crude, 10 mmol) in THF (100 mL), DIEA (3.87 g, 30 mmol) was added in at RT. Then TBSCl (3.0 g, 20 mmol) was added to the solution in portions. The resulting solution was stirred for 16 h at RT. The solution was concentrated and the crude product was purified by silica gel column with ethyl acetate/petroleum ether (1:1) to give the title compound (2.3 g, yield 70%, yellow solid). MS-ESI: 336 (M+1).

    ##STR00956##

    ##STR00957##

    2-(2-Hydroxypropan-2-yl)-N-methylthiazole-5-sulfonimidamide

    Step 1: Tert-butyl (chloro(2-(2-hydroxypropan-2-yl)thiazol-5-yl)(oxo)-λ.SUP.6.-sulfaneylidene)carbamate

    [3865] Into a 1-L round-bottom flask, was placed tert-butyl N-[[2-(2-hydroxypropan-2-yl)-1,3-thiazol-5-yl]sulfinyl]carbamate (100 g, 326 mmol) in ACN (500 mL). To the stirred solution was added NCS (65.4 g, 49 mmol). The resulting solution was stirred for 2 h at RT. The resulted solution was concentrated. This resulted in 120 g crude title compound as yellow oil.

    Step 2: Tert-((2-(2-hydroxypropan-2-yl)thiazol-5-yl)(methylamino)(oxo)-λ.SUP.6.-sulfaneylidene)carbamate

    [3866] Into a 250-mL round-bottom flask, was placed tert-butyl N-[chloro[2-(2-hydroxypropan-2-yl)-1,3-thiazol-5-yl]oxo-λ.sup.6-sulfanylidene]carbamate (10 g, 29.3 mmol) in THF (100 mL). To the stirred solution was added CH.sub.3NH.sub.2 (1.82 g, 58.6 mmol). The resulting solution was stirred for 2 h at RT. The resulted solution was concentrated. The residue was eluted from silica gel with ethyl acetate/petroleum ether (1:1). This resulted in 6.1 g (62%) of the title compound as a yellow solid. MS-ESI: 336 (M+1).

    Step 3: 2-(2-Hydroxypropan-2-yl)-N′-methylthiazole-5-sulfonimidamide

    [3867] Into a 100-mL round-bottom flask, was placed tert-butyl((2-(2-hydroxypropan-2-yl)thiazol-5-yl) (methylamino)(oxo)-λ.sup.6-sulfaneylidene)carbamate (3.0 g, 8.94 mmol) in HCl (gas) in 1,4-dioxane (8.0 mL, 26.3 mmol) in one portion at RT. The resulting solution was stirred for 60 min at RT. The resulting mixture was concentrated under vacuum. This resulted in 2.10 g crude title compound as a yellow solid. MS-ESI: 236 (M+1).

    [3868] The schemes below illustrate the synthesis of Intermediates 89-96, 101-104, 114-117A, and 118″-126″, which are isocyanate and precursors thereof as well as other intermediates:

    ##STR00958##

    ##STR00959##

    7-Nitro-6-vinyl-1H-indazole

    Step 1: 7-Nitro-1H-indazol-6-ol

    [3869] Into a 25-mL round-bottom flask, was placed 1H-indazol-6-ol (500 mg, 3.73 mmol). This was followed by the addition of H.sub.2SO.sub.4 (5.0 mL) in several batches at 0° C. To this was added KNO3 (377 mg, 3.73 mmol) in portions at 0° C. The resulting solution was stirred for 30 min at 0° C. in a water/ice bath. The reaction was then quenched by the addition of 50 mL of water/ice. The solids were collected by filtration. This resulted in 350 mg (52.4%) of the title compound as a brown solid. MS-ESI: 180 (M+1).

    Step 2: 7-Nitro-1H-indazol-6-yl trifluoromethanesulfonate

    [3870] Into a 50-mL round-bottom flask, was placed 7-nitro-1H-indazol-6-ol (350 mg, 1.95 mmol) in DCM (10 mL), TEA (593 mg, 5.86 mmol), Tf.sub.2O (717 mg, 2.54 mmol). The resulting solution was stirred for 16 h at RT. The resulting solution was diluted with 20 mL of H.sub.2O. The resulting solution was extracted with 3×20 mL of ethyl acetate dried over anhydrous sodium sulfate and concentrated. The residue was eluted from a silica gel column with ethyl acetate/petroleum ether (1:3). This resulted in 80 mg (13.2%) of the title compound as a yellow solid. MS-ESI: 312 (M+1).

    Step 3: 7-Nitro-6-vinyl-1H-indazole

    [3871] Into a 50-mL round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed 7-nitro-1H-indazol-6-yl trifluoromethanesulfonate (100 mg, 0.32 mmol) in dioxane (10 mL) and H.sub.2O (2.0 mL), Cs.sub.2CO.sub.3 (209 mg, 0.64 mmol), 2-ethenyl-4,4,5,5-tetramethyl-1,3,2-dioxaborolane (59.4 mg, 0.39 mmol), Pd(dppf)C.sub.12 (23.5 mg, 0.030 mmol). The resulting solution was stirred for 16 h at 90° C. in an oil bath. Then the mixture was concentrated under vacuum. The residue was eluted from a silica gel column with ethyl acetate/petroleum ether (1:3). This resulted in 50 mg (82.6%) of the title compound as a yellow solid. MS-ESI: 190 (M+1).

    ##STR00960##

    6-Ethyl-1H-indazol-7-amine

    Step 4: 6-Ethyl-1H-indazol-7-amine

    [3872] Into a 50-mL round-bottom flask, was placed 6-ethenyl-7-nitro-1H-indazole (50 mg) in MeOH (10 mL), and Pd/C (10% wt., 5.0 mg). The flask was evacuated and flushed three times with hydrogen. The resulting solution was stirred for 12 h at RT under an atmosphere of hydrogen. The Pd/C catalysts were filtered out, the filtrate was concentrated under vacuum. This resulted in 44 mg of the title compound as a yellow solid. MS-ESI: 162 (M+1).

    ##STR00961##

    ##STR00962##

    6-Ethyl-2-methyl-2H-indazol-7-amine

    Step 1: 2-Methyl-7-nitro-6-vinyl-2H-indazole

    [3873] Into a 50-mL round-bottom flask, was placed 6-ethenyl-7-nitro-1H-indazole (380 mg, 2.01 mmol) in acetone (20 mL), KOH (225 mg, 4.02 mmol). This was followed by the addition of MeI (342 mg, 2.41 mmol) dropwise with stirring. The resulting solution was stirred for 1 h at 0° C. in a water/ice bath. The resulting solution was diluted with 20 mL of H.sub.2O. The resulting solution was extracted with 3×30 ml of ethyl acetate dried over anhydrous sodium sulfate and concentrated. The residue was eluted from a silica gel column with ethyl acetate/petroleum ether (1:1). This resulted in 210 mg (51.5%) of 254″ as a yellow solid and 180 mg (44%) of 255″ as a yellow solid. MS-ESI: 208 (M+1).

    Step 2: 6-Ethyl-2-methyl-2H-indazol-7-amine

    [3874] Into a 50-mL round-bottom flask purged and maintained with an inert atmosphere of N.sub.2, was placed 6-ethenyl-1-methyl-7-nitro-1H-indazole (210 mg, 1.03 mmol) in MeOH (15 mL) and Pd/C (10% wt., 50 mg). The flask was evacuated and flushed three times with hydrogen. The resulting solution was stirred for 12 h at RT under an atmosphere of hydrogen. The Pd/C catalysts were filtered out, and the filtrate was concentrated under vacuum. This resulted in 160 mg (88.4%) of the title compound as a yellow solid. MS-ESI:176 (M+1).

    TABLE-US-00021 TABLE 14 The Intermediates in the following Table were prepared using the similar procedures for converting compound 254″ to Intermediate 91 shown in Scheme 58 from 255″. Intermediate Exact Mass # Structure IUPAC Name [M + H].sup.+ Intermediate 92 [00963]embedded image 6-Ethyl-1-methyl-1H-indazol-7-amine 176

    ##STR00964##

    ##STR00965##

    2,4,5,6-Tetrahydro-1H-cyclobuta[f]inden-3-amine

    Step 1: Bicyclo[4.2.0]octa-1(6),2,4-triene-3-carbaldehyde

    [3875] Into a 500-mL round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed 3-bromobicyclo[4.2.0]octa-1(6),2,4-triene (70 g, 382 mmol) in THF (300 mL). This was followed by the addition of n-BuLi (184 mL, 459 mmol) dropwise with stirring at about −70° C. After addition, the reaction mixture was stirred at this temperature for 30 min. To this solution was added DMF (36.3 g, 497 mmol) dropwise with stirring at −70° C. The resulting solution was stirred for 30 min at −70° C. in a liquid nitrogen bath. The reaction was slowly warmed to RT and then quenched by the addition of 100 mL of water. The resulting solution was extracted with 3×200 ml of DCM. The organic layers combined and dried over anhydrous Na.sub.2SO.sub.4, and then the organic layers was concentrated. This resulted in 50 g (98.9%) of the title compound as light yellow oil. MS-ESI: 133 (M+1).

    Step 2: (Z)-3-(bicyclo[4.2.0]octa-1(6),2,4-trien-3-yl)acrylic acid

    [3876] Into a 250-mL round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed bicyclo[4.2.0]octa-1(6),2,4-triene-3-carbaldehyde (1.7 g, 12.9 mmol) in pyridine (20 mL), propanedioic acid (1.99 g, 19.2 mmol) and piperidine (110 mg, 1.29 mmol). The resulting solution was stirred for overnight at 90° C. in an oil bath. The resulting mixture was concentrated. This resulted in 2.1 g (93.7%) of the title compound as a solid. MS-ESI: 173 (M−1).

    Step 3: 3-(Bicyclo[4.2.0]octa-1(6),2,4-trien-3-yl)propanoic acid

    [3877] Into a 250-mL round-bottom flask, was placed 2-(Z or E)-3-[bicyclo[4.2.0]octa-1(6),2,4-trien-3-yl]prop-2-enoic acid (2.1 g, 12.1 mmol) and Pd/C (10% wt., 200 mg). The flask was evacuated and flushed three times with hydrogen. The resulting solution was stirred for 12 h at RT under an atmosphere of hydrogen. The Pd/C catalysts were filtered out, the filtrate was concentrated under vacuum. This resulted in 2.1 g (98.9%) of the title compound as a solid. MS-ESI: 175 (M−1).

    Step 4: 3-(Bicyclo[4.2.0]octa-1(6),2,4-trien-3-yl)propanoyl chloride

    [3878] Into a 250-mL round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed 3-[bicyclo[4.2.0]octa-1(6),2,4-trien-3-yl]propanoic acid (10 g, 56.8 mmol) in DCM (100 mL). This was followed by the addition of oxalyl chloride (7.2 g, 56.8 mmol) dropwise with stirring at 0° C. The resulting solution was stirred for 2 h at 0° C. in a water/ice bath. The resulting mixture was concentrated. This resulted in 10 g (90.5%) of the title compound as light yellow oil.

    Step 5: 1,2,5,6-Tetrahydro-4H-cyclobuta[f]inden-4-one

    [3879] Into a 100-mL round-bottom flask, was placed 3-[bicyclo[4.2.0]octa-1(6),2,4-trien-3-yl]propanoyl chloride (5.0 g, 25.7 mmol) in DCM (50 mL). This was followed by the addition of AlCl.sub.3 (3.4 g, 25.7 mmol) in portions at 0° C. for 10 min. The resulting solution was stirred for 1 h at 0° C. in a water/ice bath. The reaction was then quenched by the addition of 100 mL of water. The resulting solution was extracted with 2×50 mL of DCM. The organic layers combined and dried over anhydrous Na.sub.2SO.sub.4, then concentrated. The residue was eluted from a silica gel column with ethyl acetate/petroleum ether (1:20 to 1:15). This resulted in 3.5 g (86.1%) of the title compound as a white solid. .sup.1H NMR (300 MHz, CDCl.sub.3) δ 7.45 (s, 1H), 7.17 (s, 1H), 3.22 (m, 4H), 3.18-3.00 [3880] (m, 2H), 2.73-2.63 (m, 2H).

    Step 6: 2,4,5,6-Tetrahydro-1H-cyclobuta[f]indene

    [3881] Into a 500-mL round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed 1,2,5,6-tetrahydrocyclobuta[f]inden-4-one (20 g, 126 mmol) in THF (200 mL). This was followed by the addition of BH.sub.3-Me.sub.2S (25.3 mL, 253 mmol, 10 M) dropwise at 0° C. in an ice bath. The resulting solution was stirred for 14 h at 70° C. in an oil bath. The reaction was then quenched by the addition of 20 mL of MeOH. The resulting mixture was concentrated. The residue was eluted from a silica gel column with ethyl acetate/petroleum ether (1:100 to 1:50). This resulted in 15 g (82.3%) of the title compound as colorless oil. .sup.1H NMR (300 MHz, CDCl.sub.3) δ 6.95 (s, 2H), 3.10 (s, 4H), 2.88 (t, J=7.4 Hz, 4H), 2.03 (p, J=7.4 Hz, 2H).

    Step 7: 3-Iodo-2,4,5,6-tetrahydro-1H-cyclobuta[f]indene

    [3882] Into a 500-mL round-bottom flask, was placed acetic acid (100 mL), 2,4,5,6-tetrahydro-1H-cyclobuta[f]indene (15 g, 104 mmol) and NIS (35.1 g, 156 mmol). The resulting solution was stirred for 3 h at 50° C. in an oil bath. The resulting solution was diluted with 200 mL of water. The mixture was extracted with 3×100 mL of DCM. The organic layers combined and dried over anhydrous Na.sub.2SO.sub.4, then concentrated. The residue was eluted from a silica gel column with ethyl acetate/petroleum ether (1:100 to 1:80). This resulted in 5.0 g (17.8%) of the title compound as yellow oil.

    Step 8: Tert-butyl (2,4,5,6-tetrahydro-1H-cyclobuta[f]inden-3-yl)carbamate

    [3883] Into a 250-mL round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed 3-iodo-2,4,5,6-tetrahydro-1H-cyclobuta[f]indene (5.0 g, 18.5 mmol) in toluene (100 mL), tert-butyl carbamate (6.5 g, 55.5 mmol), X-phos (900 mg, 1.85 mmol), Pd.sub.2(dba).sub.3 (800 mg, 0.93 mmol), t-BuOK (6.2 g, 55.5 mmol). The resulting solution was stirred for 14 h at 100° C. in an oil bath. The resulting mixture was concentrated. The residue was eluted from a silica gel column with ethyl acetate/petroleum ether (1:50 to 1:20). This resulted in 3.0 g (83.3%) of the title compound as a white solid. MS-ESI: 260 (M+1).

    [3884] .sup.1H NMR (300 MHz, CDCl.sub.3) δ 6.72 (s, 1H), 6.13 (br, 1H), 3.26 (d, J=4.5 Hz, 2H), 3.01 (d, J=4.5 Hz, 2H), 2.90 (t, J=7.4 Hz, 2H), 2.75 (t, J=7.4 Hz, 2H), 2.06 (p, J=7.4 Hz, 2H), 1.52 (s, 9H).

    Step 9: 2,4,5,6-Tetrahydro-1H-cyclobuta[f]inden-3-amine

    [3885] Into a 100-mL round-bottom flask, was placed tert-butyl2,4,5,6-tetrahydro-1H-cyclobuta[f]inden-3-ylcarbamate (3.0 g, 11.6 mmol) in DCM (20 mL), 2,2,2-trifluoroacetic acid (5.0 mL). The resulting solution was stirred for 2 h at RT. The resulting solution was diluted with 50 mL of water. The pH value of the solution was adjusted to 10 with sat. aqueous Na.sub.2CO.sub.3. The resulting solution was extracted with 3×20 mL of DCM. The organic layers combined and dried over anhydrous Na.sub.2SO.sub.4, then concentrated. This resulted in 1.5 g (81.4%) of the title compound as a yellow solid. MS-ESI: 160 (M+1).

    ##STR00966##

    ##STR00967##

    3,5,6,7-tetrahydro-2H-indeno[5,6-b]furan-4-amine

    Step 1: 8-Nitro-2,3,5,6-tetrahydro-7H-indeno[5,6-b]furan-7-one

    [3886] Into a 100-mL round-bottom flask, was placed 2H,3H,5H,6H,7H-indeno[5,6-b]furan-7-one (4 g, 23 mmol,) in H.sub.2SO.sub.4 (20 mL). This was followed by the addition of HNO.sub.3 (2.13 g, 23 mmol, 68%) dropwise with stirring at 0° C. in an ice/ethanol bath. The resulting solution was stirred for 1 h at 0° C. The reaction was then quenched by the addition of 200 mL of water/ice. The solids were collected by filtration. This resulted in 4.0 g (79.5%) of the title compound as a light brown solid. MS-ESI: 220 (M+1).

    Step 2: 3,5,6,7-Tetrahydro-2H-indeno[5,6-b]furan-8-amine

    [3887] Into a 100-mL round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed 8-nitro-2H,3H,5H,6H,7H-indeno[5,6-b]furan-7-one (4.0 g, 18.3 mmol) in MeOH (50 mL), TsOH (1.0 mL), Pd(OH).sub.2/C (20% wt., 1 g). The flask was evacuated and flushed three times with hydrogen. The resulting solution was stirred for 16 h at RT under an atmosphere of hydrogen. The solids were filtered out. The resulting mixture was concentrated. The residue was dissolved in 50 mL of EA. The resulting mixture was washed with 2×50 ml of NaHCO.sub.3 and 3×40 ml of H.sub.2O. The mixture was dried over anhydrous sodium sulfate. The residue was eluted from a silica gel column with ethyl acetate/petroleum ether (1:9). This resulted in 1.1 g (34.4%) of the title compound as a yellow solid. MS-ESI: 176 (M+1).

    Step 3: 4-Bromo-3,5,6,7-tetrahydro-2H-indeno[5,6-b]furan-8-amine

    [3888] Into a 50-mL round-bottom flask, was placed 2H,3H,5H,6H,7H-indeno[5,6-b]furan-8-amine (1.1 g, 6.28 mmol) in ACN (30 mL) and NBS (1.34 g, 7.53 mmol). The resulting solution was stirred for 2 h at RT. The resulting mixture was concentrated. The residue was eluted from a silica gel column with ethyl acetate/petroleum ether (1:8). This resulted in 83 mg (52%) of the title compound as a yellow solid. MS-ESI: 254 (M+1).

    Step 4: 4-Bromo-3,5,6,7-tetrahydro-2H-indeno[5,6-b]furan

    [3889] Into a 50-mL round-bottom flask, was placed 4-bromo-2H,3H,5H,6H,7H-indeno[5,6-b]furan-8-amine (500 mg, 1.97 mmol) in ethanol (15 mL) and acetic acid (3.0 mL, 0.050 mmol). To the above solution was added NaNO.sub.2 (1.36 g, 19.7 mmol) in H.sub.2O (3 mL) dropwise at 0° C. The resulting solution was stirred for 2 h at RT. The resulting solution was diluted with 30 mL of H.sub.2O. The resulting solution was extracted with 3×30 ml of ethyl acetate dried over anhydrous sodium sulfate and concentrated. The residue was eluted from a silica gel column with ethyl acetate/petroleum ether (1:10). This resulted in 100 mg (21.3%) of the title compound as a yellow solid. MS-ESI: 239 (M+1).

    Step 5: Tert-butyl (3,5,6,7-tetrahydro-2H-indeno[5,6-b]furan-4-yl)carbamate

    [3890] Into a 50-mL round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed 4-bromo-2H,3H,5H,6H,7H-indeno[5,6-b]furan (120 mg, 0.50 mmol) in toluene (15 mL), t-BuOK (282 mg, 2.51 mmol), tert-butyl carbamate (588 mg, 5.02 mmol), Xphos (47.8 mg, 0.10 mmol), and Pd.sub.2(dba).sub.3CHCl.sub.3 (104 mg, 0.10 mmol). The resulting solution was stirred for 16 h at 100° C. in an oil bath. The resulting mixture was concentrated. The residue was eluted from a silica gel column with ethyl acetate/petroleum ether (1:5). This resulted in 80 mg (57.9%) of the title compound as a yellow solid. MS-ESI: 276 (M+1).

    Step 6: 3,5,6,7-Tetrahydro-2H-indeno[5,6-b]furan-4-amine

    [3891] Into a 50-mL round-bottom flask, was placed tert-butyl N-[2H,3H,5H,6H,7H-indeno[5,6-b]furan-4-yl]carbamate (80 mg, 0.29 mmol) in DCM (8 mL) and TFA (3.0 mL, 0.030 mmol). The resulting solution was stirred for 2 h at room temperature. The resulting mixture was concentrated. The residue was dissolved in 15 mL of DCM. The resulting mixture was washed with 2×15 ml of NaOH (aq.). The organic layer was dried with Na.sub.2SO.sub.4 and then concentrated. This resulted in 50 mg (98.2%) of the title compound as a yellow solid. MS-ESI: 176 (M+1).

    ##STR00968##

    ##STR00969##

    Tricyclo[6.2.0.0.SUP.3,6.]deca-1,3(6),7-trien-2-amine

    Step 1: 2,2′-(1,4-Phenylene)bis(ethan-1-ol)

    [3892] Into a 1.0-L round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed 2-[4-(carboxymethyl)phenyl]acetic acid (40 g, 200 mmol) in THF (500 mL). This was followed by the addition of BH.sub.3-Me.sub.2S (60 mL, 600 mmol, 10 M) dropwise with stirring at 0° C. The resulting solution was stirred for 24 h at RT. The reaction was then quenched by the addition of 200 mL of water. The resulting solution was extracted with 2×150 mL of ethyl acetate. The organic layers combined and dried over anhydrous Na.sub.2SO.sub.4, then concentrated. The residue was eluted from a silica gel column with ethyl acetate/petroleum ether (1:10 to 1:3). This resulted in 28 g (81.8%) of the title compound as brown oil. MS-ESI: 167 (M+1).

    Step 2: 1,4-Bis(2-bromoethyl)benzene

    [3893] Into a 50-mL round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed 2-[4-(2-hydroxyethyl)phenyl]ethan-1-ol (28 g, 168 mmol) in aq. HBr (300 mL, 40% wt.). The resulting solution was stirred for 5 h at 100° C. in an oil bath. The resulting solution was diluted with 500 mL of water. The resulting solution was extracted with 3×200 mL of DCM. The organic layers combined, then concentrated. This resulted in 40 g (81.4%) of the title compound as a white solid. MS-ESI: 291, 293, 295 (M+1).

    Step 3: 1,4-Dibromo-2,5-bis(2-bromoethyl)benzene

    [3894] Into a 500-mL round-bottom flask, was placed 1,4-bis(2-bromoethyl)benzene (30 g, 103 mmol) in trichloromethane (200 mL). To the above solution was added 12 (0.78 g, 3.08 mmol), iron powder (0.75 g, 13.4 mmol), Br.sub.2 (41 g, 257 mmol). The resulting solution was stirred for 24 h at RT. The reaction was then quenched by the addition of aqueous Na.sub.2SO.sub.3. The resulting solution was extracted with 3×200 mL DCM and the organic layers was combined and dried over anhydrous Na.sub.2SO.sub.4 then concentrated. This resulted in 40 g (86.6%) of the title compound as a white solid. MS-ESI: 449/451/453 (M+1).

    Step 4: Tricyclo[6.2.0.0.SUP.3,6.]deca-1,3(6),7-triene

    [3895] Into a 1000-mL round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed 1,4-dibromo-2,5-bis(2-bromoethyl)benzene (40 g, 88.9 mmol) in THF (400 mL). This was followed by the addition of n-BuLi (74.7 mL, 187 mmol, 2.5 M) dropwise with stirring at −78° C. in a liquid nitrogen bath. The resulting solution was stirred for 30 min at −78° C. The reaction was then quenched by the addition of aqueous NH.sub.4Cl (300 ml) and extracted with 2×200 mL of DCMDCM and the organic layers was combined and dried over anhydrous Na.sub.2SO.sub.4 then concentrated. This resulted in 8.0 g (69.1%) of the title compound as a light yellow solid.

    Step 5: 2-Iodotricyclo[6.2.0.0.SUP.3,6.]deca-1,3(6),7-triene

    [3896] Into a 250-mL round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed tricyclo[6.2.0.0.sup.3,6]deca-1,3(6),7-triene (8 g, 61.45 mmol) in acetic acid (50 mL) and NIS (20.7 g, 92.2 mmol). The resulting solution was stirred for 3 h at 50° C. in an oil bath. The resulting solution was diluted with 100 mL of water. The reaction was then quenched by the addition of aqueous Na.sub.2SO.sub.3. The resulting solution was extracted with 3×50 mL of DCM and the organic layers was combined and dried over anhydrous Na.sub.2SO.sub.4 then concentrated. The residue was eluted from a silica gel column with ethyl acetate/petroleum ether (1:100). This resulted in 2.5 g (18.2%) of the title compound as a white solid.

    Step 6: Tert-butyl tricyclo[6.2.0.0.SUP.3,6.]deca-1,3(6),7-trien-2-ylcarbamate

    [3897] Into a 250-mL round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed 2-iodotricyclo[6.2.0.0.sup.3,6]deca-1,3(6),7-triene (2.5 g, 9.76 mmol) in toluene (50 mL). To the stirred solution was added tert-butyl carbamate (3.43 g, 29.3 mmol), Pd.sub.2(dba).sub.3 (447 mg, 0.49 mmol), Xphos (466 mg, 0.98 mmol), and t-BuOK (3.29 g, 29.3 mmol). The resulting solution was stirred for 14 h at 100° C. in an oil bath. The resulting mixture was concentrated. The residue was eluted from a silica gel column with ethyl acetate/petroleum ether (1:50 to 1:30). This resulted in 1.5 g (62.6%) of the title compound as a light yellow solid. MS-ESI: 246 (M+1).

    Step 7: Tricyclo[6.2.0.0.SUP.3,6.]deca-1,3(6),7-trien-2-amine

    [3898] Into a 50-mL round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed tert-butyl N-[tricyclo[6.2.0.0.sup.3,6]deca-1,3(6),7-trien-2-yl]carbamate (1.5 g, 6.1 mmol) in DCM (20 mL) and 2,2,2-trifluoroacetic acid (4.0 mL). The resulting solution was stirred for 2 h at RT. The resulting mixture was concentrated. This resulted in 800 mg (90.1%) of the title compound as a brown solid. MS-ESI: 146 (M+1).

    ##STR00970##

    ##STR00971##

    3-Amino-2,4-diisopropylbenzonitrile

    Step 1: 3-Amino-2,4-dibromo-6-chlorobenzonitrile

    [3899] Into a 500-mL round-bottom flask, was placed 5-amino-2-chlorobenzonitrile (10 g, 65.8 mmol), ACN (200 mL) and NBS (17.6 g, 98.7 mmol). The resulting solution was stirred for 14 h at RT. The resulting mixture was concentrated. The residue was eluted from a silica gel column with ethyl acetate/petroleum ether (1:15 to 1:5). This resulted in 18 g of the title compound as a yellow solid. MS-ESI: 310, 312 (M+1).

    Step 2: 3-Amino-6-chloro-2,4-di(prop-1-en-2-yl)benzonitrile

    [3900] Into a 500-mL round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed 3-amino-2,4-dibromo-6-chlorobenzonitrile (15 g, 48 mmol) in dioxane (200 mL) and H.sub.2O (20 mL), 2-(tetramethyl-1,3,2-dioxaborolan-2-yl)prop-2-en-1-ylium (17.6 g, 106 mmol), Cs.sub.2CO.sub.3 (47 g, 144 mmol), and Pd(dppf)C.sub.12 (1.5 g, 4.8 mmol). The resulting solution was stirred for 14 h at 100° C. in an oil bath. The resulting mixture was concentrated. The residue was eluted from a silica gel column with ethyl acetate/petroleum ether (1:0 to 1:25). This resulted in 10 g of the title compound as brown oil. MS-ESI: 233 (M+1).

    Step 3: 3-Amino-2,4-diisopropylbenzonitrile

    [3901] Into a 500-mL round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed 3-amino-6-chloro-2,4-bis(prop-1-en-2-yl)benzonitrile (10 g, 43 mmol) in MeOH (50 mL). Then Pd/C (10% wt., 2.0 g) was added. The flask was evacuated and flushed three times with hydrogen. The resulting solution was stirred for 16 h at RT under an atmosphere of hydrogen. The solids were filtered out. The resulting filtrate was concentrated under vacuum. This resulted in 8.0 g of the title compound as brown oil. MS-ESI: 203 (M+1).

    ##STR00972##

    ##STR00973##

    8-Amino-1,2,3,5,6,7-hexahydro-s-indacen-1-ol

    Step 1: 8-Amino-3,5,6,7-tetrahydro-s-indacen-1(2H)-one

    [3902] Into a 250-mL round-bottom flask purged and maintained with an inert atmosphere of hydrogen, was placed a solution of 8-nitro-1,2,3,5,6,7-hexahydro-s-indacen-1-one (700 mg, 3.22 mmol) in MeOH (10 mL), and Pd/C (10% wt., 100 mg). The flask was evacuated and flushed three times with hydrogen. The resulting solution was stirred for 2 h at RT under an atmosphere of hydrogen. The Pd/C catalysts were filtered out, and the filtrate was concentrated under vacuum. This resulted in 550 mg (91.2%) of the title compound as a yellow oil. MS-ESI: 188 (M+1).

    Step 2: 8-Amino-1,2,3,5,6,7-hexahydro-s-indacen-1-ol

    [3903] Into a 100 mL round-bottom flask, was placed a solution of 8-amino-3,5,6,7-tetrahydro-s-indacen-1 (2H)-one (2.0 g, 10.7 mmol) in ethanol. To this solution was added NaBH.sub.4(1.9 g, 50 mmol) with stirring in portions at 0° C. in an ice bath. The resulting solution was stirred for 16 h at RT. The reaction was quenched by water (10 mL). The resulting solution was extracted with 3×50 mL of ethyl acetate and the organic layers combined and dried over anhydrous sodium sulfate, and then concentrated under vacuum. This resulted in 1.5 g of the title compound as a yellow solid. MS-ESI: 189 (M+1).

    ##STR00974##

    ##STR00975##

    4-Amino-1,2,3,5,6,7-hexahydro-s-indacen-1-ol

    Step 1: 4-Amino-3,5,6,7-tetrahydro-s-indacen-1(2H)-one

    [3904] Into a 250-mL round-bottom flask purged and maintained with an inert atmosphere of hydrogen, was placed a solution of 4-nitro-1,2,3,5,6,7-hexahydro-s-indacen-1-one (3.0 g, 13.8 mmol) in MeOH (30 mL), and Pd/C (10% wt., 500 mg). The flask was evacuated and flushed three times with hydrogen. The resulting solution was stirred for 4 h at RT under an atmosphere of hydrogen. The Pd/C catalysts were filtered out, the filtrate was concentrated under vacuum. The residue was eluted from a silica gel column with DCM/MeOH (10:1). This resulted in 2.2 g (85.1%) of the title compound as a white solid. MS-ESI: 187 (M+1).

    Step 2: 4-Amino-1,2,3,5,6,7-hexahydro-s-indacen-1-ol

    [3905] Into a 100-mL round-bottom flask, was placed a solution of 8-amino-3,5,6,7-tetrahydro-s-indacen-1(2H)-one (2.0 g, 10.7 mmol) in ethanol (20 mL) and NaBH.sub.4 (1.9 g, 50 mmol). The resulting solution was stirred for 16 h at RT. The reaction was quenched with water. The resulting solution was extracted with 3×50 mL of ethyl acetate and the organic layers combined and dried over anhydrous sodium sulfate. The mixture was concentrated under vacuum. This resulted in 1.36 g of the title compound as a yellow solid. MS-ESI: 190 (M+1).

    ##STR00976##

    ##STR00977##

    3-(3-(But-3-ynyl)-3H-diazirin-3-yl)propanoic acid

    Step 1: Methyl 3-oxohept-6-ynoate

    [3906] Into a 2000-mL 3-neck round-bottom flask purged with and maintained under nitrogen, was placed methyl 3-oxobutanoate (20 g, 172 mmol) in THF (200 mL). To the above solution was added LDA (200 mL, 400 mmol, 2 M) dropwise at −20° C. in a dry ice bath. Then reaction was allowed to react at −20° C. for 30 min. Then 3-bromoprop-1-yne (20.5 g, 172 mmol) was added to the reaction solution in portions at −20° C. The resulting solution was stirred for 3 h at −20° C. in a dry ice bath. The reaction was then quenched by the addition of 500 mL of NH.sub.4Cl solution. The pH value of the solution was adjusted to 3 with HCl (aq). The resulting solution was extracted with 3×200 ml of ethyl acetate and the organic layers was combined and dried over anhydrous Na.sub.2SO.sub.4, then concentrated. This resulted in the title compound (2.0 g, 7.53%) as white oil.

    Step 2: Methyl 2-(2-(but-3-ynyl)-1,3-dioxolan-2-yl)acetate

    [3907] Into a 500-mL round-bottom flask, was placed methyl 3-oxohept-6-ynoate (20 g, 130 mmol) in toluene (200 mL), ethane-1,2-diol (40.2 g, 649 mmol) and TsOH (2.23 g, 13 mmol). The resulting solution was stirred for 6 h at 120° C. in an oil bath. The resulting solution was diluted with 200 mL of Et.sub.2O. The resulting mixture was washed with 3×100 ml of NaHCO.sub.3 and 3×100 ml of saturated NaCl solution. The mixture was dried over anhydrous sodium sulfate and concentrated. This resulted in the title compound (20 g, 77.9%) as yellow oil.

    Step 3: 2-(2-(But-3-ynyl)-1,3-dioxolan-2-yl)ethanol

    [3908] Into a 1.0-L 3-necked round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed methyl 2-[2-(but-3-yn-1-yl)-1,3-dioxolan-2-yl]acetate (90 g, 454 mmol) in THF (300 mL). To this above solution was added LiAlH.sub.4 (17.9 g, 472 mmol) in portions with stirring at 0° C. in an ice/ethanol bath. The resulting solution was stirred for 6 h at RT. The reaction was then quenched by the addition of water/ice. The solids were filtered out. The resulting filtrate was concentrated under vacuum. This resulted in the title compound (80 g crude) and used in the next step directly. MS-ESI: 169 (M−1).

    Step 4: 1-Hydroxyhept-6-yn-3-one

    [3909] Into a 3.0-L 3-necked round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed 2-[2-(but-3-yn-1-yl)-1,3-dioxolan-2-yl]ethan-1-ol (80 g, 470 mmol) in THF (1.0 L) and HCl (500 mL). The resulting solution was stirred for 16 h at RT. The resulting solution was diluted with 1.0 L of water. The mixture was extracted with 3×1.0 L of ethyl acetate and the organic layer was combined and dried over anhydrous sodium sulfate. The solids were filtered out. The resulting filtrate was concentrated under vacuum. The residue was eluted from a silica gel column with DCM/petroleum ether (1:1). This resulted in 20 g of the title compound as a white solid. MS-ESI: 125 (M−1).

    Step 5: 2-(3-(But-3-ynyl)diaziridin-3-yl)ethanol

    [3910] Into a 500-mL round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed 1-hydroxyhept-6-yn-3-one (20 g, 159 mmol) in DCM (250 mL). To the above solution was introduced NH.sub.3 (g) for 15 min at −40° C. in a liquid nitrogen/ethanol bath. The resulting solution was stirred for 1 h at −40° C. and then allowed to react for 16 h at RT. The resulting mixture was concentrated. This resulted in 18 g (crude) of the title compound as a white solid. MS-ESI: 141 (M+1).

    Step 6: 2-(3-(But-3-ynyl)-3H-diazirin-3-yl)ethanol

    [3911] Into a 500-mL 3-necked round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed 2-[3-(but-3-yn-1-yl)diaziridin-3-yl]ethan-1-ol (14.4 g, 114 mmol) in DCM (200 mL), TEA (34.6 g, 342 mmol), 12 (58 g, 228 mmol). The resulting solution was stirred for 4 h at RT. The reaction was then quenched by the addition of Na.sub.2S.sub.2O.sub.3. The resulting mixture was quenched with 100 mL of water. The resulting solution was extracted with 3×300 mL of DCM and the organic layers combined and dried over anhydrous sodium sulfate. The solids were filtered out. The resulting mixture was concentrated. This resulted in 6.0 g (38%) of the title compound as a white solid. MS-ESI: 139 (M+1).

    Step 7: 3-(But-3-ynyl)-3-(2-iodoethyl)-3H-diazirine

    [3912] Into a 250-mL round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed 2-[3-(but-3-yn-1-yl)-3H-diazirin-3-yl]ethan-1-ol (5.0 g, 36.2 mmol) in THF (20 mL), imidazole (3.7 g, 54.3 mmol), 12 (9.18 g, 36.2 mmol), PPh.sub.3 (14.2 g, 54.3 mmol). The resulting solution was stirred for 16 h at RT. The reaction was then quenched by the addition of 20 mL of saturated Na.sub.2S.sub.2O.sub.3 solution. The resulting solution was extracted with 3×50 mL of DCM dried over anhydrous sodium sulfate. The solids were filtered out. The resulting mixture was concentrated. This resulted in 5.0 g (crude) of the title compound as a yellow solid. MS-ESI: 248 (M+1).

    Step 8: 3-(3-(But-3-ynyl)-3H-diazirin-3-yl)propanenitrile

    [3913] Into a 500-mL round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed 3-(but-3-yn-1-yl)-3-(2-iodoethyl)-3H-diazirine (5.0 g, 20.2 mmol) in DMF (250 mL), KCN (2.62 g, 40.3 mmol). The resulting solution was stirred for 16 h at 60° C. in an oil bath. The reaction was then quenched by the addition of 20 mL of FeSO.sub.4 solution. The resulting solution was extracted with 3×50 ml of ethyl acetate dried over anhydrous sodium sulfate. The solids were filtered out. The resulting mixture was concentrated. This resulted in 2.0 g (crude) of the title compound as a solid. MS-ESI: 148 (M+1).

    Step 9: 3-(3-(But-3-ynyl)-3H-diazirin-3-yl)propanoic acid

    [3914] Into a 100-mL round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed 3-[3-(but-3-yn-1-yl)-3H-diazirin-3-yl]propanenitrile (1.0 g, 3.40 mmol) in MeOH (40 mL), NaOH (272 mg, 6.79 mmol). The resulting solution was stirred for 16 h at 90° C. in an oil bath. The resulting solution was concentrated. The residue was eluted from a silica gel column with ethyl acetate/petroleum ether (1:1). This resulted in 400 mg crude (26.6%) of the title compound as yellow oil. MS-ESI: 167 (M+1).

    ##STR00978##

    ##STR00979##

    3,5-Diisopropyl-1-phenyl-1H-pyrazol-4-amine

    Step 1: 3,5-Diisopropyl-1-phenyl-1H-pyrazole

    [3915] Into a 100-mL round-bottom flask, was placed 2-propanol (50 mL), phenylhydrazine (3.81 g, 35.2 mmol) and 2,6-dimethylheptane-3,5-dione (5.0 g, 32.0 mmol). The resulting solution was stirred overnight at 85° C. in an oil bath. The resulting mixture was concentrated. The residue was dissolved in 100 mL of ethyl acetate. The resulting mixture was washed with 50 mL of H.sub.2O. The mixture was dried over anhydrous sodium sulfate and then concentrated. This resulted in 6.9 g (94%) of the title compound as a light yellow oil. MS-ESI: 229 (M+1).

    Step 2: 3,5-Diisopropyl-4-nitro-1-phenyl-1H-pyrazole

    [3916] Into a 100-mL round-bottom flask, was placed 1-phenyl-3,5-bis(propan-2-yl)-1H-pyrazole (6.9 g, 30 mmol) in AC.sub.2O (50 mL). This was followed by the addition of HNO.sub.3 (4.07 mL, 91 mmol) dropwise with stirring at 0° C. in 10 min. The resulting solution was stirred for overnight at RT. The residue was dissolved in 150 mL of ethyl acetate. The resulting mixture was washed with 2×100 mL of H.sub.2O. The mixture was dried over anhydrous sodium sulfate and then concentrated. This resulted in 3.7 g (44.8%) of the title compound as yellow oil. MS-ESI: 274 (M+1).

    Step 3: 3,5-Diisopropyl-1-phenyl-1H-pyrazol-4-amine

    [3917] Into a 250-mL round-bottom flask, was placed 4-nitro-1-phenyl-3,5-bis(propan-2-yl)-1H-pyrazole (3.7 g, 13.5 mmol) in MeOH (100 mL), to the stirred solution was added Pd/C (10% wt., 400 mg). The flask was evacuated and flushed three times with hydrogen. The resulting solution was stirred overnight at RT under an atmosphere of hydrogen. The Pd/C catalysts were filtered out, the filtrate was concentrated under vacuum. This resulted in 2.7 g (82%) of the title compound as a light yellow oil. MS-ESI: 244 (M+1).

    ##STR00980##

    ##STR00981##

    1,2,3,6,7,8-Hexahydro-as-indacen-4-amine

    Step 1: 4-Nitro-1,6,7,8-tetrahydro-as-indacen-3(2H)-one (308) and 5-nitro-1,6,7,8-tetrahydro-as-indacen-3(2H)-one (309″)

    [3918] Into a 250-mL round-bottom flask was placed a solution of 1,6,7,8-tetrahydro-as-indacen-3(2H)-one (Cpd 307″ was isolated from 113″ in Scheme 23 by chromatography) (9.8 g, 46.5 mmol) in H.sub.2SO.sub.4 (50 mL). Then HNO.sub.3 (5.85 g, 92.9 mmol) was added dropwise over 10 min at 0° C. The resulting solution was stirred for 1 h at 0° C. The reaction mixture was slowly added to a mixture of water/ice (100 mL) and DCM (50 mL) with ice bath cooling. The organic layer was collected, dried over Na.sub.2SO.sub.4 and concentrated under vacuum. This resulted in 11 g (89%) of a mixture of cpd 308″ and cpd 309″ as a yellow solid. The mixture was monitored by TLC (ethyl acetate/petroleum ether=1/10, R.sub.f=0.4),

    Step 2: 1,2,3,6,7,8-hexahydro-as-indacen-4-amine (116)

    [3919] Into a 100-mL round-bottom flask was placed a solution of the mixture of 4-nitro-1,6,7,8-tetrahydro-as-indacen-3(2H)-one and 5-nitro-1,6,7,8-tetrahydro-as-indacen-3 (2H)-one (2.17 g, 10 mmol) in MeOH (30 mL). To the solution was added MSA (1.15 g, 12 mmol). Then Pd(OH).sub.2/C (20% wt., 550 mg) was added. The flask was evacuated and filled three times with hydrogen. The resulting mixture was stirred for 16 h at RT under hydrogen (50 psi). The solids were filtered out and washed with MeOH. The MeOH filtrate and wash was diluted with water (50 mL) and the pH was adjusted to 10.6 with 2 N NaOH. The resulting mixture was filtered and the crude solids were recrystallized from MeOH/water (9:1) with heating. This resulted in 1.38 g (80%) of the title compound as an off-white solid. MS-ESI: 174 (M+1).

    ##STR00982## ##STR00983##

    Intermediate 117A Intermediate 117

    [3920] ##STR00984##

    1,2,3,5,6,7-Hexahydro-s-indacen-3,3,5,5-d.SUB.4.-4-amine

    Step 1: 5-Bromo-2,3-dihydro-1H-indene-1,1-d.SUB.2

    [3921] Into a 250-mL 3-necked round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed a solution of LiAlD.sub.4(1.57 g, 37 mmol) in Et.sub.2O (150 mL). This was followed by the addition of AlCl.sub.3 (10.1 g, 76 mmol) in portions at 0° C. in 5 min. To this was added 5-bromo-2,3-dihydro-1H-inden-1-one (4.0 g, 19 mmol) in portions at 0° C. in 5 min. The resulting solution was stirred for 4 h at RT. The reaction mixture was cooled to 0° C. with a water/ice bath. The reaction was then quenched by careful addition of 10 mL of water. The solids were filtered out. The resulting solution was extracted with 3×100 mL of ethyl acetate and concentrated under vacuum. This resulted in 3.5 g (93%) of the title compound as brown oil. MS-ESI: 199/201 (M+1).

    Step 2: Tert-butyl (E)-3-(2,3-dihydro-1H-inden-5-yl-1,1-d.SUB.2.)acrylate

    [3922] Into a 250-mL round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed a solution of 5-bromo-2,3-dihydro-1H-indene-1,1-d.sub.2 (7.0 g, 35 mmol) in DMF (80 mL), to the stirred solution was added tris(4-methylphenyl)phosphane (1.07 g, 3.52 mmol), tert-butyl prop-2-enoate (4.0 mL), triethylamine (5.0 mL) and Pd(OAc).sub.2 (395 mg, 1.76 mmol). The resulting solution was stirred overnight at 100° C. in an oil bath. The resulting mixture was concentrated under vacuum. The resulting solution was extracted with 3×50 mL of ethyl acetate and the organic layers combined and dried over anhydrous sodium sulfate. The residue was eluted from a silica gel column with DCM/petroleum ether (1:1). This resulted in 5.7 g (66%) of the title compound as light yellow oil. MS-ESI: 247 (M+1).

    Step 3: Tert-butyl 3-(2,3-dihydro-1H-inden-5-yl-1,1-d.SUB.2.)propanoate

    [3923] Into a 100-mL round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed a solution of tert-butyl (E)-3-(2,3-dihydro-1H-inden-5-yl-1,1-th)acrylate (5.8 g, 24 mmol) in MeOH (40 mL), to the stirred solution was added Pd/C (580 mg, 10% wt.). The flask was evacuated and flushed three times with hydrogen. The resulting solution was stirred for 1 h at RT under an atmosphere of hydrogen. The Pd/C catalysts were filtered out, the filtrate was concentrated under vacuum. This resulted in 5.7 g (98%) of the title compound as colorless oil. MS-ESI: 249 (M+1).

    Step 4: 3-(2,3-Dihydro-1H-inden-5-yl-1,1-d.SUB.2.)propanoic acid

    [3924] Into a 100-mL round-bottom flask, was placed a solution of tert-butyl 3-(2,3-dihydro-1H-inden-5-yl-1,1-d.sub.2)propanoate (4.3 g, 17.3 mmol) in DCM (50 mL), to the stirred solution was added CF.sub.3COOH (5.5 mL, 74 mmol). The resulting solution was stirred for overnight at RT. The resulting mixture was concentrated under vacuum. This resulted in 3.1 g (93%) of the title compound as an off-white solid. MS-ESI: 191 (M−1).

    Step 5: 3-(2,3-Dihydro-1H-inden-5-yl-1,1-d.SUB.2.)propanoyl chloride

    [3925] Into a 100-mL round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed a solution of 3-(2,3-dihydro-1H-inden-5-yl-1,1-th)propanoic acid (9.0 g, 41.7 mmol) in DCM (40 mL). This was followed by the addition of oxalic dichloride (8.0 mL) at 0° C. To this was added DMF (0.5 mL) at 0° C. The resulting solution was stirred for 3 h at RT. The resulting mixture was concentrated under vacuum. This resulted in 4.0 g (41%) of the title compound as brown oil.

    Step 6: 3,5,6,7-Tetrahydro-s-indacen-1(2H)-one-7,7-d.SUB.2

    [3926] Into a 100-mL round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed a solution of 3-(2,3-dihydro-1H-inden-5-yl-1,1-d.sub.2)propanoyl chloride (3.9 g, 18 mmol) in DCE (40 mL). This was followed by the addition of AlCl.sub.3 (3.3 g, 25 mmol) in portions at 0° C. in 2 min. The resulting solution was stirred for 1 h at RT. The reaction was then quenched by the addition of 200 mL of water/ice. The resulting solution was extracted with 3×50 mL of DCM and the organic layers combined and dried over anhydrous sodium sulfate. The residue was eluted from a silica gel column with ethyl acetate/petroleum ether (2:100). This resulted in 1.5 g (46%) of the title compound as an off-white solid. MS-ESI: 175 (M+1).

    Step 7: 8-Nitro-3,5,6,7-tetrahydro-s-indacen-1(2H)-one-7,7-d.SUB.2 .(Cpd 318″, major) and 4-Nitro-3,5,6,7-tetrahydro-s-indacen-1(2H)-one-7,7-d.SUB.2 .(Cpd 317″, minor)

    [3927] Into a 25-mL round-bottom flask, was placed 3,5,6,7-tetrahydro-s-indacen-1(2H)-one-7,7-d.sub.2 (120 g). This was followed by the addition of H.sub.2SO.sub.4 (8.0 mL) at 0° C. To this was added HNO.sub.3 (2.0 mL) at 0° C. in 2 min. To the mixture was added H.sub.2SO.sub.4 (2.0 mL) at 0° C. in 2 min. The resulting solution was stirred for 1 h at 0° C. The reaction was then quenched by the addition of water/ice. The resulting solution was extracted with 3×50 mL of ethyl acetate dried in an oven under reduced pressure. The residue was separated on silica gel eluted with ethyl acetate/petroleum ether (3:100). This resulted in 870 mg of cpd 318″ and 290 mg of cpd 317″, both as yellow solids. Cpd 317″: .sup.1H NMR (300 MHz, CDCl.sub.3) δ 7.83 (s, 1H), 3.55-3.45 (m, 2H), 3.42 (t, J=7.6 Hz, 2H), 2.84-2.74 (m, 2H), 2.22 (t, J=7.6 Hz, 2H). Cpd 318″: .sup.1H NMR (300 MHz, CDCl.sub.3) δ 7.46 (s, 1H), 3.20 3.00 (m, 4H), 2.83-2.73 (m, 2H), 2.20 (t, J=7.5 Hz, 2H).

    Step 8: 8-Amino-3,5,6,7-tetrahydro-s-indacen-1(2H)-one-7,7-d.SUB.2

    [3928] Into a 250-mL round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed a solution of 8-nitro-3,5,6,7-tetrahydro-s-indacen-1(2H)-one-7,7-d.sub.2 (870 mg) in MeOH (100 mL), to the stirred solution was added Pd/C (87 mg, 10% wt.). The flask was evacuated and flushed three times with hydrogen. The resulting solution was stirred for 1 h at RT under an atmosphere of hydrogen. The Pd/C catalysts were filtered out, the filtrate was concentrated under vacuum. This resulted in 700 mg of the title compound as a yellow solid. MS-ESI: 190 (M+1).

    Step 9: 1,2,3,5,6,7-Hexahydro-s-indacen-3,3,5,5-d.SUB.4.-4-amine

    [3929] Into a 250-mL round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed a solution of LiAlD.sub.4 (160 mg, 3.8 mmol) in Et.sub.2O (40 mL). This was followed by the addition of AlCl.sub.3 (634 mg, 4.8 mmol) in portions at 0° C. in 2 min. To this solution was added 8-amino-3,5,6,7-tetrahydro-s-indacen-1(2H)-one-7,7-d.sub.2 (600 mg, 3.17 mmol) at 0° C. The resulting solution was stirred for 4 h at RT. The reaction was then quenched by the addition of 10 mL of water. The resulting solution was diluted with 20 mL of EtOAc. The solids were filtered out. The resulting solution was extracted with 3×50 mL of ethyl acetate dried over anhydrous sodium sulfate and concentrated under vacuum. The residue was eluted from a silica gel column with ethyl acetate/petroleum ether (5:1). This resulted in 470 mg (78%) of the Intermediate 117 as a yellow solid. MS-ESI: 178 (M+1).

    ##STR00985##

    1,2,3,5,6,7-hexahydro-s-indacen-1,1,7,7-d.SUB.4.-4-amine

    [3930] Intermediate 117A was prepared starting from compound 317″ and using the same procedure as shown in scheme 73 above for converting compound 318″ to intermediate 117. MS-ESI: 178 (M+1).

    TABLE-US-00022 TABLE 15 The Intermediates in the following Table were prepared using similar procedure as shown in Scheme 30 above for converting compound 130″ to Intermediate 44. Intermediate # Structure IUPAC Name Intermediate 118″ [00986]embedded image 6-Ethyl-7-isocyanato- 1H-indazole Intermediate 119″ [00987]embedded image 6-Ethyl-7-isocyanato-1- methyl-1H-indazole Intermediate 120″ [00988]embedded image 3-Isocyanato-2,4,5,6- tetrahydro-1H- cyclobuta[f]indene Intermediate 121″ [00989]embedded image 4-Isocyanato-3,5,6,7- tetrahydro- 2H-indeno[5,6- b]furan Intermediate 122″ [00990]embedded image 2-Isocyanato- tricyclo[6.2.0.03,6]deca- 1,3(6),7-triene Intermediate 123″ [00991]embedded image 8-Isocyanato-2,3,6,7- tetrahydros-indacen- 1(5H)-one Intermediate 124″ [00992]embedded image 4-Isocyanato-2,3,6,7- tetrahydros-indacen- 1(5H)-one Intermediate 125″ [00993]embedded image 4-isocyanato- 1,2,3,5,6,7-hexahydro- s-indacene-3,3,5,5-d.sub.4 Intermediate 126″ [00994]embedded image 4-isocyanato- 1,2,3,5,6,7-hexahydro- s-indacene-1,1,7,7-d.sub.4

    [3931] Schemes below the synthesis of sulfonimidamide Intermediates 118-123.

    ##STR00995##

    ##STR00996##

    N-(tert-butyldimethylsilyl)-6-isopropylpyridine-3-sulfonimidamide

    [3932] Steps 1-4 used similar procedures for converting compound 245″ to Intermediate 88 shown in Scheme 56 to afford Intermediate 118 from compound 322″. MS-ESI: 314 (M+1).

    ##STR00997##

    ##STR00998##

    Step 1: 4-Amino-3-fluoro-N-methylbenzamide

    [3933] Into a 500 mL round-bottom flask were added 4-amino-3-fluorobenzoic acid (15 g, 97 mmol) and DMF (100 mL) at RT. To the stirred solution was added HATU (74 mg, 0.19 mmol) and DIEA (25 mg, 0.19 mmol) at 0° C. To the above mixture was added MeNH.sub.2/THF (2M, 97 mL, 194 mmol) in one portion at 0° C. The resulting mixture was stirred for additional 2 h at RT. The resulting mixture was extracted with EtOAc (3×100 mL). The combined organic layers were dried over anhydrous Na.sub.2SO.sub.4. After filtration, the filtrate was concentrated under reduced pressure. The residue was eluted from silica gel column with petroleum ether/EtOAc (1:1) to afford the title compound (16 g, 98%) as yellow oil. MS-ESI: 169 (M+1).

    [3934] Steps 2-3 used similar procedures for converting compound 27 to Intermediate 29 shown in Scheme 9 to afford compound 329″ from compound 327″. MS-ESI: 233 (M+1).

    Step 4: 2-Fluoro-4-((methylamino)methyl)benzenesulfonamide

    [3935] Into a 250-mL round-bottom flask were placed 3-fluoro-N-methyl-4-sulfamoylbenzamide (1.2 g) in THF (40 mL) at 0° C. To the stirred solution was added LiAlH.sub.4 (543 mg, 14 mmol) in portions at 0° C. under nitrogen atmosphere. The resulting mixture was stirred overnight at 70° C. The reaction was quenched with water (2 mL). The resulting mixture was filtered, the filter cake was washed with EtOAc (3×10 mL). The filtrate was concentrated under reduced pressure. The residue was purified by Prep-TLC (EtOAc/MeOH=25:1) to afford the title compound (800 mg, 77%) as a white solid. MS-ESI: 219 (M+1).

    Step 5: Tert-butyl (3-fluoro-4-sulfamoylbenzyl)(methyl)carbamate

    [3936] Into a 100-mL round-bottom flask were placed 2-fluoro-4-[(methylamino)methyl]benzene-1-sulfonamide (800 mg, 3.7 mmol) in THF (20 mL) at 0° C. To a stirred solution was added (Boc).sub.2O (1.5 g, 6.89 mmol) in portions at 0° C. The resulting mixture was stirred for 2 h at RT and concentrated under reduced pressure. The residue was purified by Prep-TLC (PE/EtOAc 1:1) to afford the title compound (900 mg, 77%) as a white solid. MS-ESI: 319 (M+1).

    [3937] Steps 6-7 used similar procedures for converting compound 248″ to Intermediate 88 shown in Scheme 56 to afford Intermediate 119 from compound 331″. MS-ESI: 432 (M+1).

    ##STR00999##

    ##STR01000##

    N′-(tert-butyldimethylsilyl)-4-((dimethylamino)methyl)-3-fluorobenzenesulfonimidamide

    Step 1: 1-(2-Fluoro-4-nitrophenyl)-N,N-dimethylmethanamine

    [3938] Into a 250-mL round-bottom flask, was placed a solution of 1-(bromomethyl)-2-fluoro-4-nitrobenzene (8.0 g, 34 mmol) in MeOH (50 mL). This was followed by the addition of dimethylamine (2 M, 21 mL) dropwise with stirring at 0° C. in 5 min. The resulting solution was stirred for 4 h at RT. The resulting mixture was concentrated under vacuum. This resulted in 7.0 g crude title compound as yellow oil. MS-ESI: 199 (M+1).

    Step 2: 4-((Dimethylamino)methyl)-3-fluoroaniline

    [3939] Into a 100-mL round-bottom flask, was placed the solution of [(2-fluoro-4-nitrophenyl)methyl]dimethylamine (7.0 g, 35 mmol) in AcOH (20 mL), to the stirred solution was added iron powder (10 g, 179 mmol). The resulting solution was stirred for 16 h at RT. The solids were filtered out. The resulting filtrate was concentrated under vacuum. The residue was eluted from a silica gel column with DCM/MeOH (9:1). This resulted in 6.5 g crude title compound as yellow oil. MS-ESI: 169 (M+1).

    [3940] Steps 3-4 used similar procedures for converting compound 145″ to compound 147″ shown in Scheme 36 to afford compound 337″ from compound 335″. MS-ESI: 233 (M+1).

    [3941] Steps 5-6 used similar procedures for converting compound 148″ to Intermediate 59 shown in Scheme 36 to afford Intermediate 120 from compound 337″. MS-ESI: 233 (M+1).

    ##STR01001##

    ##STR01002##

    N′-(tert-butyldimethylsilyl)-4-isopropylthiophene-2-sulfonimidamide

    [3942] Steps 1-2 used similar procedures for converting compound 158″ to intermediate 61 shown in Scheme 38 to afford compound 341″ from compound 339″. MS-ESI: 221 (M+1).

    [3943] Step 3 used similar procedures for converting compound 147″ to compound 148″ shown in Scheme 36 to afford compound 342″ from compound 341″. MS-ESI: 221 (M+1).

    Step 4: 4-Isopropylthiophene-2-sulfonamide

    [3944] Into a 250-mL round-bottom flask, was placed the solution of 4-(2-hydroxypropan-2-yl)thiophene-2-sulfonamide (1.5 g, 6.79 mmol) in DCM (20 mL). To the stirred solution was added TFA (3.9 g, 34 mmol) and Et.sub.3SiH (2.32 g, 20 mmol). The result solution was stirred overnight at RT. The mixture was concentrated under vacuum. The residue was eluted from silica gel column with a gradient of ethyl acetate/petroleum ether (1:5 to 1:3). This resulted in 1.1 g (79%) of the title compound as a light yellow solid. MS-ESI: 206 (M+1).

    [3945] Steps 5-6 used similar procedures for converting compound 148″ to Intermediate 59 shown in Scheme 36 to afford Intermediate 121 from compound 344″. MS-ESI: 319 (M+1).

    ##STR01003##

    ##STR01004##

    N-(tert-butyldimethylsilyl)-4-(1-methylpyrrolidin-2-yl)benzenesulfonimidamide

    Step 1: 2-(4-Bromophenyl)-1-methylpyrrolidine

    [3946] Into a 100-mL round-bottom flask, was placed 2-(4-bromophenyl)pyrrolidine (3.0 g, 13.3 mmol) in HCHO (3.23 g, 37% wt.), to the stirred solution was added NaBH.sub.3CN (2.5 g, 40 mmol). The resulting solution was stirred for 12 h at RT and concentrated under vacuum. The residue was eluted from a silica gel column with ethyl acetate/petroleum ether (1:1). This resulted in 2.8 g (88%) of the title compound as a light yellow solid. MS-ESI: 240/242 (M+1).

    [3947] Steps 2-6 used similar procedures for converting compound 245″ to Intermediate 88 shown in Scheme 56 to afford Intermediate 122″ from compound 347″. MS-ESI: 354 (M+1).

    ##STR01005##

    ##STR01006##

    N-(tert-butyldimethylsilyl)-2-(2-methyl-1,3-dioxolan-2-yl)thiazole-5-sulfonimidamide

    Step 1: 2-(2-Methyl-1,3-dioxolan-2-yl)thiazole

    [3948] Into a 50-mL round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed 1-(1,3-thiazol-2-yl)ethan-1-one (27 g, 212 mmol) in toluene (300 mL), to the stirred solution was added TsOH (2.0 g, 11.6 mmol) and ethane-1,2-diol (40 g, 644 mmol). The resulting solution was stirred for 14 h at 110° C. in an oil bath. The resulting mixture was concentrated under vacuum. The residue was eluted from a silica gel column with ethyl acetate/petroleum ether (1:20 to 1:10). This resulted in 36 g (99%) of the title compound as brown oil. MS-ESI: 172 (M+1).

    [3949] Steps 2-5 used similar procedures for converting compound 245″ to Intermediate 88 shown in Scheme 56 to afford Intermediate 123 from compound 353″. MS-ESI: 363 (M+1).

    Reagent 1

    Dichlorotriphenylphosphorane

    [3950] This reagent was either purchased or prepared using the following procedure:

    ##STR01007##

    [3951] An oven dried 40 mL vial equipped with a stir bar was capped with a rubber septum and flushed with nitrogen. At room temperature, a solution of PPh.sub.3 (0.85 g, 3.2 mmol) in anhydrous 1,2-dichloroethane (5 mL) was introduced via syringe. The reaction vessel was immersed in an ice/water bath and cooled for 5 min. A solution of hexachloroethane (0.76 g, 3.2 mmol) in anhydrous 1,2-dichloroethane (5 mL) was introduced dropwise via syringe. After the addition was complete the reaction mixture was stirred at the same temperature for an additional 5 min and then placed into a preheated block set at 80° C. Heating was continued for 4.5 h, at which time the reaction was assumed to be complete. The light golden clear solution was cooled to ambient temperature. The reagent thus prepared was transferred via syringe in subsequent reactions without any work up or purification. The total volume of the reaction mixture was 11 mL for the molar calculations for next steps. This solution containing PPh.sub.3Cl.sub.2 was stored under nitrogen at room temperature until used.

    Reagent 2

    Polymer-bound dichlorotriphenylphosphorane

    [3952] ##STR01008##

    [3953] Polystyrene bound PPh.sub.3 (0.32 g, 0.32 mmol) was suspended in anhydrous dichloroethane (6 mL) and shaked on a shaker for 5 mins. It was then filtered and the process was repeated again to swell the polymer. Filtered resin was suspended in anhydrous dichloroethane (6 mL) a third time and the whole suspension was transferred into an oven dried 40 mL vial with a stir bar via pipette. The vial was capped with a rubber septum and connected to a steady flow of nitrogen. The reaction vessel was immersed in an ice/water bath and cooled down for 10 min. A solution of hexachloroethane (0.076 g, 0.32 mmol) in anhydrous 1,2-dichloroethane (2 mL) was introduced drop wise via syringe. After the addition was complete the reaction mixture was placed in an already heated block set at 82° C. for 5 h. At this point the reaction is assumed to be completed. It was gradually brought to room temperature and used in the next step as is. This reagent was used at 1.5 equiv. with respect to sulfonamide in the next step.

    SYNTHETIC EXAMPLES

    Example 1

    [3954] ##STR01009##

    Example 1 (181): N′-(1,2,3,5,6,7-hexahydro-s-indacen-4-ylcarbamoyl)-4-(2-hydroxypropan-2-yl)-5-methylfuran-2-sulfonimidamide

    [3955] Example 1 was synthesized according to the general method shown in Scheme 1, as illustrated below.

    Examples 2 and 3

    [3956] ##STR01010##

    Examples 2 (181a) and 3 (181b): (S)- and (R)—N′-(1,2,3,5,6,7-hexahydro-s-indacen-4-ylcarbamoyl)-4-(2-hydroxypropan-2-yl)-5-methylfuran-2-sulfonimidamide

    [3957] Examples 2 and 3 were prepared through chiral separation of Example 1 as illustrated below.

    ##STR01011##

    Step 1: N′-(tert-butyldimethylsilyl)-N-(1,2,3,5,6,7-hexahydro-s-indacen-4-ylcarbamoyl)-4-(2-hydroxypropan-2-yl)-5-methylfuran-2-sulfonimidamide

    [3958] Into a 50-mL round-bottom flask was placed N′-(tert-butyldimethylsilyl)-4-(2-hydroxypropan-2-yl)-5-methylfuran-2-sulfonimidamide (200 mg, 0.6 mmol), THF (10 mL), NaH (60% wt, 48 mg, 1.2 mmol). This was followed by the addition of a solution of 4-isocyanato-1,2,3,5,6,7-hexahydro-s-indacene (120 mg, 0.6 mmol) in THF (1 mL) dropwise with stirring at RT. The resulting solution was stirred for 12 h at RT. The reaction was then quenched by the addition of 10 mL of NH.sub.4Cl (sat.). The resulting solution was extracted with 3×10 mL of DCM and the organic layers combined and concentrated under vacuum. The residue was applied onto a silica gel column and eluted with ethyl acetate/petroleum ether (1:10 to 1:3). This resulted in 140 mg (43.8%) of the title compound as brown oil. MS-ESI: 532.0 (M−1).

    Step 2: N′-(1,2,3,5,6,7-hexahydro-s-indacen-4-ylcarbamoyl)-4-(2-hydroxypropan-2-yl)-5-methylfuran-2-sulfonimidamide

    [3959] Into a 50-mL round-bottom flask was placed N′-(tert-butyldimethylsilyl)-N-(1,2,3,5,6,7-hexahydro-s-indacen-4-ylcarbamoyl)-4-(2-hydroxypropan-2-yl)-5-methylfuran-2-sulfonimidamide (130 g, 0.2 mmol), THF (10 mL), and TBAF (300 mg, 0.5 mmol). The resulting solution was stirred for 2 h at RT and then concentrated under vacuum. The crude product was purified by Prep-HPLC using method E eluted with a gradient of 30˜60% ACN. This resulted in 82 mg (80.3%) of Example 1 as a white solid.

    Example 1

    [3960] MS-ESI: 418.0 (M+1). .sup.1H NMR (400 MHz, DMSO-d.sub.6) δ 8.39 (s, 1H), 7.57 (s, 2H), 6.87 (s, 1H), 6.85 (s, 1H), 5.04 (s, 1H), 2.79 (t, J=7.4 Hz, 4H), 2.71-2.63 (m, 4H), 2.42 (s, 3H), 1.94 (tt, J=7.4 and 7.4 Hz, 4H), 1.40 (s, 6H).

    Step 3: Chiral Separation

    [3961] The product obtained as described in the previous step (70 mg) was resolved by Chiral-Prep-HPLC using the following conditions: Column, ChiralPak ID, 2*25 cm, 5 um; mobile phase, Hex and EtOH (hold 20% EtOH over 18 min); Flow rate, 20 mL/min; Detector, UV 254/220 nm. This resulted in 26.8 mg of Example 2 (front peak, 99% ee) as a white solid and 27.7 mg (second peak, 99.3% ee) of Example 3 as a white solid.

    Example 2

    [3962] MS-ESI: 418.0 (M+1). .sup.1H NMR (400 MHz, DMSO-d.sub.6) δ 8.36 (s, 1H), 7.57 (s, 2H), 6.87 (s, 1H), 6.85 (s, 1H), 5.03 (s, 1H), 2.78 (t, J=7.2 Hz, 4H), 2.73-2.60 (m, 4H), 2.41 (s, 3H), 1.93 (tt, J=7.2 and 7.2 Hz, 4H), 1.39 (s, 6H).

    Example 3

    [3963] MS-ESI: 418.0 (M+1). .sup.1H NMR (400 MHz, DMSO-d.sub.6) δ 8.39 (s, 1H), 7.58 (s, 2H), 6.87 (s, 1H), 6.85 (s, 1H), 5.03 (s, 1H), 2.78 (t, J=7.2 Hz, 4H), 2.73-2.60 (m, 4H), 2.41 (s, 3H), 1.93 (tt, J=7.2 and 7.2 Hz, 4H), 1.39 (s, 6H).

    [3964] Single crystal X-ray crystallographic analysis was performed on compound 181a. FIG. 1 shows ball and stick models of the asymmetrical unit containing two crystallographically independent molecules of compound 181a, with hydrogen atoms omitted for clarity. Table M below shows fractional atomic coordinates of compound 181a.

    TABLE-US-00023 TABLE M Fractional Atomic Coordinates (×10.sup.4) and Equivalent Isotropic Displacement Parameters (Å.sup.2 × 10.sup.3) for Example 2. U.sub.eq is defined as ⅓ of the trace of the orthogonalised U.sub.IJ tensor. Atom x y z U(eq) S1 722.5(7)  5368.3(5).sup.  6903.3(4).sup.  14.52(18) S2 4304.8(7).sup.  505.4(5)  3262.9(4).sup.  16.15(18) O1 2143(2) 6680.8(16)  8220.2(13)  16.1(4) O2 −195(2) 4624.4(17)  6478.0(14)  21.9(5) O5 2874(2) 1624.4(17)  1805.2(15)  22.8(5) O6 5238(2) −141.6(18)  3795.4(15)  25.6(5) O3 1492(3) 5769.7(18)  5397.8(14)  25.5(5) O7 2974(2) 2151.0(17)  3638.1(14)  24.6(5) N1  51(2) 7218.5(19)  8513.8(16)  14.6(5) N2  59(3) 5986.0(18)  7536.5(16)  15.3(5) O4 2422(3) 8513(2) 4297.8(17)  34.3(6) N4 4956(2) 2247(2) 1576.1(16)  16.9(5) O8 2771(3) 3430(2) 6070.3(18)  36.7(6) N5 4980(3) 1071.7(19)  2602.6(17)  16.6(5) N3 2120(3) 4817(2) 7347.5(17)  16.3(5) C13  854(3) 6633(2) 8105.0(18)  12.9(6) C1  605(3) 7947(2) 9133.7(19)  14.4(6) N6 2978(3) −121(2) 2801.8(19)  20.2(6) C22 4388(3) 2952(2)  936.5(19) 16.2(6) C24 5733(3) 2203(2) −207(2) 18.3(6) C34 4164(3) 1656(2) 1979(2) 16.6(6) C11 −695(3) 7200(2) 10304.5(19).sup.  17.2(6) C12  267(3) 7915(2) 9953.6(19)  14.2(6) C23 4754(3) 2918(2)  127(2) 17.0(6) C27 4221(3) 3614(2) −494(2) 18.1(6) C8  800(3) 8626(2) 10566(2)  17.0(6) C28 3315(3) 4357(2) −324(2) 18.6(6) C4 2436(4) 10034(2)  8218(2) 23.3(7) C7 1688(3) 9377(2) 10382(2)  16.9(6) C29 2969(3) 4399(2)  492(2) 18.0(6) C9  237(3) 8445(2) 11388(2)  20.4(6) C38 2557(3) 2633(3) 4320(2) 24.9(7) C2 1458(3) 8717(2) 8931.9(19)  15.1(6) C6 2005(3) 9409(2) 9557(2) 17.2(6) C26 4804(3) 3424(2) −1310(2)  21.8(7) C31 2476(4) 5023(2) 1822(2) 24.4(7) C5 2927(3) 10137(2)  9193(2) 19.6(6) C16 2044(3) 7389(3) 5427(2) 22.4(7) C25 5416(4) 2367(3) −1181(2)  24.1(7) C15 1514(3) 7144(2) 6188(2) 21.6(6) C33 3503(3) 3713(2) 1124(2) 16.9(6) C37 3005(3) 2117(3) 5067(2) 23.8(7) C30 2028(3) 5128(2)  844(2) 20.5(6) C10 −360(4) 7379(2) 11275(2)  23.9(7) C36 3748(3) 1285(3) 4821(2) 24.5(7) C17 2020(4) 6535(3) 4974(2) 28.3(7) C14 1181(3) 6178(2) 6137.8(19)  19.0(6) C35 3710(3) 1326(2) 3973(2) 23.7(7) C19 2583(3) 8401(3) 5214(2) 26.0(7) C3 1902(3) 8960(2) 8090(2) 19.0(6) C32 3002(3) 3944(2) 1954(2) 21.0(6) C40 2768(4) 2390(3) 5955(2) 33.7(8) C20 1804(4) 9231(3) 5566(3) 34.6(8) C39 1810(4) 3575(3) 4092(3) 35.7(8) C42 1313(4) 2062(3) 6087(3) 40.3(9) C21 4139(4) 8447(3) 5541(3) 40.0(9) C18 2406(5) 6256(3) 4130(3)  44.7(10) C41 3893(5) 1934(4) 6622(3)  54.3(12)

    [3965] Single crystal X-ray crystallographic analysis was performed on compound 181b. FIG. 2 shows ball and stick models of the asymmetrical unit containing two crystallographically independent molecules of compound 181b, with hydrogen atoms omitted for clarity. Table N below shows fractional atomic coordinates of compound 181b.

    TABLE-US-00024 TABLE N Fractional Atomic Coordinates (×10.sup.4) and Equivalent Isotropic Displacement Parameters (Å.sup.2 × 10.sup.3) for Example 3. U.sub.eq is defined as ⅓ of the trace of the orthogonalised U.sub.IJ tensor. Atom x y z U(eq) S1 9264.0(7).sup.  4621.3(5).sup.  3094.0(4).sup.  16.15(17) S2 5705.1(7).sup.  9485.8(5).sup.  6733.7(4).sup.  19.00(17) O1 7853(2) 3305.2(16)  1778.9(13)  18.6(4) O7 7027(2) 7842.4(18)  6357.2(15)  26.4(5) O2 10182(2)  5364.5(17)  3520.0(14)  23.6(5) O5 7131(2) 8368.0(19)  8192.5(15)  25.5(5) O3 8512(3) 4220.7(18)  4605.0(14)  26.6(5) O6 4770(2) 10133.7(19).sup.  6200.8(15)  28.4(5) O8 7211(3) 6563(2) 3921.7(19)  38.6(7) O4 7597(3) 1484(2) 5713.0(18)  37.3(6) N2 9933(3) 4006.4(19)  2465.8(16)  17.8(5) N1 9943(2) 2773(2) 1482.7(16)  16.3(5) N4 5051(3) 7745(2) 8421.8(17)  20.2(5) N3 7870(3) 5173(2) 2653.4(17)  18.4(5) N5 5031(3) 8923(2) 7390.2(17)  19.9(5) C14 9136(3) 3353(2) 1894.3(18)  15.8(6) C1 9391(3) 2043(2)  864.7(19) 17.4(6) N6 7031(3) 10109(2)  7191.6(19)  23.0(6) C30 5618(3) 7045(2) 9058(2) 19.3(6) C6 9205(3) 1370(2) −570(2) 20.1(6) C53 7446(4) 7363(3) 5675(2) 26.1(7) C32 4273(3) 7792(2) 10199(2)  20.6(6) C2 9731(3) 2078(2) .sup. 44.2(19) 16.8(6) C43 5846(3) 8333(2) 8016(2) 20.2(6) C3 10685(3)  2795(2) −304(2) 20.3(6) C37 7028(3) 5597(2) 9506(2) 21.2(6) C7 8316(3)  620(2) −386(2) 20.2(6) C35 5773(3) 6383(2) 10493(2)  20.7(6) C10 7573(4)  −36(3) 1780(2) 27.4(7) C36 6681(3) 5639(2) 10322(2)  21.2(6) C22 8481(3) 2845(3) 3816(2) 23.0(6) C8 8002(3)  584(2)  440(2) 20.3(6) C39 7525(4) 4977(3) 8177(2) 28.0(7) C31 5248(3) 7078(2) 9867(2) 19.6(6) C52 6981(3) 7875(3) 4927(2) 24.2(7) C12 8541(3) 1280(2) 1066.4(19)  18.0(6) C34 5191(4) 6574(3) 11302(2)  24.8(7) C51 6252(4) 8707(3) 5170(2) 26.7(7) C33 4585(4) 7630(3) 11175(2)  27.6(7) C24 7990(4) 3461(3) 5032(2) 30.5(8) C23 7962(3) 2603(3) 4580(2) 24.0(7) C50 6302(4) 8662(3) 6020(2) 25.4(7) C9 7077(3) −142(2)  804(2) 23.6(7) C38 7972(3) 4873(2) 9155(2) 23.5(7) C5 9763(4) 1551(3) −1391(2)  24.9(7) C41 6502(3) 6286(2) 8872(2) 20.5(6) C21 8811(3) 3816(2) 3866.6(19)  20.4(6) C4 10356(4)  2619(3) −1277(2)  28.3(7) C11 8099(3) 1036(2) 1909(2) 22.6(6) C40 7006(3) 6055(3) 8044(2) 24.5(6) C25 7419(4) 1599(3) 4793(2) 26.8(7) C58 8189(4) 6425(3) 5905(3) 37.6(9) C54 7221(4) 7601(3) 4036(2) 34.1(8) C27 8195(4)  774(3) 4438(3) 38.1(9) C29 7607(6) 3737(3) 5874(3)  46.7(10) C56 8674(4) 7924(3) 3907(3)  42.4(10) C28 5872(4) 1551(3) 4471(3)  44.2(10) C57 6101(6) 8060(4) 3369(3)  58.9(14)

    Example 4

    [3966] ##STR01012##

    Example 4 (101′): N′-(1,2,3,5,6,7-hexahydro-s-indacen-4-ylcarbamoyl)-2-(2-hydroxypropan-2-yl)thiazole-5-sulfonimidamide

    [3967] Example 4 (above) was synthesized according to the general methods in Schemes 2 and 3, as illustrated in Route 1 and Route 2 below.

    Examples 5 and 6

    [3968] ##STR01013##

    Examples 5 and 6 (Stereochemistry not Assigned)

    Examples 5 (101) and 6 (102): (S)- and (R)—N′-(1,2,3,5,6,7-hexahydro-s-indacen-4-ylcarbamoyl)-2-(2-hydroxypropan-2-yl)thiazole-5-sulfonimidamide

    [3969] Examples 5 and 6 (above) were synthesized according to general methods shown in Schemes 2 and 3, as illustrated in Route 1 and Route 2 below.

    Example 7

    [3970] ##STR01014##

    Example 7 (194): Tert-butyl N-(1,2,3,5,6,7-hexahydro-s-indacen-4-ylcarbamoyl)-2-(2-hydroxypropan-2-yl)thiazole-5-sulfonimidoylcarbamate

    [3971] Example 7 was synthesized according to general method shown in Scheme 3, as illustrated in Route 2 below.

    Route 1

    [3972] ##STR01015##

    Step 1: N-(tert-butyldimethylsilyl)-N′-(1,2,3,5,6,7-hexahydro-s-indacen-4-ylcarbamoyl)-2-(2-hydroxypropan-2-yl)thiazole-5-sulfonimidamide

    [3973] Into a 50-mL round-bottom flask was placed a solution of N′-(tert-butyldimethylsilyl)-2-(2-hydroxypropan-2-yl)thiazole-5-sulfonimidamide (336 mg, 1.0 mmol) in THF (10 mL). To this solution was added NaH (60% wt, 80 mg, 2.0 mmol) in portions at 0° C. The solution was stirred at 0° C. for 15 minutes, and this was followed by the addition of a solution of 4-isocyanato-1,2,3,5,6,7-hexahydro-s-indacene (209 mg, 1.1 mmol) in THF (5 mL) dropwise with stirring at RT. The resulting solution was stirred for 12 h at RT. The reaction was then quenched by the addition of 10 mL of NH.sub.4Cl (sat.). The resulting solution was extracted with 3×10 mL of DCM and the combined organic layers were concentrated under vacuum. This resulted in 535 mg (crude) of the title compound as a brown oil. MS-ESI: 535.0 (M+1).

    Step 2: N′-(1,2,3,5,6,7-hexahydro-s-indacen-4-ylcarbamoyl)-2-(2-hydroxypropan-2-yl)thiazole-5-sulfonimidamide

    [3974] Into a 50-mL round-bottom flask was placed a solution of N-(tert-butyldimethylsilyl)-N′-(1,2,3,5,6,7-hexahydro-s-indacen-4-ylcarbamoyl)-2-(2-hydroxypropan-2-yl)thiazole-5-sulfonimidamide (535 mg, crude, 1.0 mmol) in THF (10 mL). To this solution was added HF/Py (70% wt, 143 mg, 5.0 mmol) dropwise at 0° C. The solution was stirred at RT for 4 h. The reaction was then quenched by the addition of 10 mL of water. The resulting solution was extracted with 3×10 mL of ethyl acetate and the combined organic layers were concentrated under vacuum. The crude product was purified by Prep-HPLC using Method E with ACN/water (20% to 60% in 10 minutes). This resulted in 189 mg (45%, 2 steps) of Example 4 as a white solid.

    Example 4

    [3975] MS-ESI: 421.0 (M+1). .sup.1H NMR (400 MHz, DMSO-d.sub.6) δ 8.46 (br s, 1H), 8.04 (s, 1H), 7.80 (br s, 2H), 6.86 (s, 1H) 6.28 (s, 1H), 2.88-2.71 (m, 4H), 2.71-2.56 (m, 4H), 2.02-1.80 (m, 4H), 1.49 (s, 6H).

    Step 2: Chiral Separation

    [3976] The product obtained as described in the previous step (189 mg) was resolved by Chiral-Prep-HPLC using the following conditions: Column, CHIRAL Cellulose-SB, 2*25 cm, 5 um; mobile phase, Hex (0.1% DEA) and EtOH (hold 20% EtOH over 16 min); Flow rate, 20 mL/min; Detector, UV 254/220 nm. This resulted in 70 mg of Example 5 (front peak, 99% ee 101) as a white solid and 65 mg of Example 6 (second peak, 97.5% ee 102) as a white solid. Absolute stereochemistry of these two isomers has not been assigned.

    Example 5

    [3977] MS-ESI: 421.0 (M+1). .sup.1H NMR (400 MHz, DMSO-d.sub.6) δ 8.43 (br s, 1H), 8.05 (s, 1H), 7.83 (br s, 2H), 6.87 (s, 1H) 6.29 (s, 1H), 2.82-2.71 (m, 4H), 2.71-2.56 (m, 4H), 2.02-1.80 (m, 4H), 1.50 (s, 6H).

    Example 6

    [3978] MS-ESI: 421.0 (M+1). .sup.1H NMR (400 MHz, DMSO-d.sub.6) δ 8.41 (br s, 1H), 8.05 (s, 1H), 7.83 (s, 2H), 6.87 (s, 1H) 6.27 (s, 1H), 2.82-2.71 (m, 4H), 2.71-2.56 (m, 4H), 2.02-1.80 (m, 4H), 1.50 (s, 6H).

    Route 2:

    [3979] ##STR01016##

    Step 1: Tert-butyl N-(1,2,3,5,6,7-hexahydro-s-indacen-4-ylcarbamoyl)-2-(2-hydroxypropan-2-yl)thiazole-5-sulfonimidoylcarbamate

    [3980] Tert-butyl (amino(2-(2-hydroxypropan-2-yl)thiazol-5-yl)(oxo)-λ.sup.6-sulfaneylidene)carbamate (12 g, 37 mmol) was dissolved in dried THF (200 mL). To the solution was added NaH (17.7 g, 60%, 44 mmol) in portions at 0° C. under nitrogen atmosphere, and then the mixture was stirred at 0° C. for 0.5 h. Freshly prepared 4-isocyanato-1,2,3,5,6,7-hexahydro-s-indacene (7.4 g, 37 mmol) was dissolved in dried THF (50 mL) and the solution was added to the front mixture dropwise at 0° C. The mixture was stirred at RT for 1 h. The reaction was quenched with ice-water (100 mL), and the pH value of the resulting solution was adjusted to 6 with HCO.sub.2H. The solution was extracted with EtOAc (3×200 mL) and the combined organic layers were dried over anhydrous Na.sub.2SO.sub.4 and concentrated to give 17.5 g of Example 7 as a crude grey solid.

    Example 7

    [3981] MS-ESI: 521.0 (M+1). .sup.1H NMR (300 MHz, MeOD-d.sub.4) δ 8.14 (s, 1H), 6.89 (s, 1H), 3.00-2.60 (m, 8H), 2.20-1.90 (m, 4H), 1.51 (s, 6H), 1.37 (s, 9H).

    Step 2: N′-(1,2,3,5,6,7-hexahydro-s-indacen-4-ylcarbamoyl)-2-(2-hydroxypropan-2-yl)thiazole-5-sulfonimidamide

    [3982] The crude tert-butyl (N-((1,2,3,5,6,7-hexahydro-s-indacen-4-yl)carbamoyl)-2-(2-hydroxypropan-2-yl)-thiazole-5-sulfonimidoyl)carbamate (crude 17.5 g) was dissolved in THF (200 mL). To the solution was added HCl (200 mL, 4M in 1,4-dioxane) at RT. The mixture was stirred at RT overnight and concentrated. The residue was purified with SiO.sub.2-gel column and eluted with MeOH/DCM (5%) and further purified by reverse column with MeOH/water (50% to 80% in 50 minutes) to give 12 g of Example 4 (51%, 2 steps) as a white solid.

    Example 4

    [3983] MS-ESI: 421.0 (M+1). .sup.1H NMR (400 MHz, DMSO-d.sub.6) δ 8.46 (br s, 1H), 8.04 (s, 1H), 7.80 (br s, 2H), 6.86 (s, 1H) 6.28 (s, 1H), 2.88-2.71 (m, 4H), 2.71-2.56 (m, 4H), 2.02-1.80 (m, 4H), 1.49 (s, 6H).

    Step 3: Chiral Separation

    [3984] The product obtained as described in the previous step (12 g) was resolved by Chiral-Prep-SFC using the following conditions: Column, CHIRALPAK IF, 2*25 cm, 5 um; Mobile Phase A: CO.sub.2: 60, Mobile Phase B: MeOH (2 mM NH.sub.3-MeOH): 40; Flow rate: 40 mL/min; Detector, UV 220 nm. This resulted in 3.8 g of Example 6 (front peak, 99% ee 102) as a white solid and 4.6 g of Example 5 (second peak, 97.5% ee 101) as a white solid. Absolute stereochemistry of these two isomers has not been assigned.

    Example 5

    [3985] MS-ESI: 421.0 (M+1). .sup.1H NMR (400 MHz, DMSO-d.sub.6) δ 8.43 (br s, 1H), 8.05 (s, 1H), 7.83 (br s, 2H), 6.87 (s, 1H) 6.29 (s, 1H), 2.82-2.71 (m, 4H), 2.71-2.56 (m, 4H), 2.02-1.80 (m, 4H), 1.50 (s, 6H).

    Example 6

    [3986] MS-ESI: 421.0 (M+1). .sup.1H NMR (400 MHz, DMSO-d.sub.6) δ 8.41 (br s, 1H), 8.05 (s, 1H), 7.83 (s, 2H), 6.87 (s, 1H) 6.27 (s, 1H), 2.82-2.71 (m, 4H), 2.71-2.56 (m, 4H), 2.02-1.80 (m, 4H), 1.50 (s, 6H).

    Example 8

    [3987] ##STR01017##

    Example 8 (270): N′-(8-fluoro-1,2,3,5,6,7-hexahydro-s-indacen-4-ylcarbamoyl)-4-(2-hydroxypropan-2-yl)-N-methylthiophene-2-sulfonimidamide (Scheme 4)

    [3988] Example 8 was synthesized according to the general method shown in Scheme 4.

    [3989] Into a 50-mL round-bottom flask purged with and maintained under nitrogen was placed a solution of 4-fluoro-8-isocyanato-1,2,3,5,6,7-hexahydro-s-indacene (110 mg, 0.51 mmol) in DCM (5 mL). To the solution were added TEA (153 mg, 1.51 mmol) and 4-(2-hydroxypropan-2-yl)-N′-methylthiophene-2-sulfonimidamide (120 mg, 0.51 mmol). The resulting solution was stirred for 14 h at RT and then was concentrated under vacuum. The crude product was purified by Prep-HPLC using method E eluted with a gradient of 30˜74% ACN. This resulted in 80 mg (35%) of Example 8 as a white solid.

    Example 8

    [3990] MS-ESI: 450.1 (M−1). .sup.1H NMR (400 MHz, DMSO-d.sub.6) δ 8.50 (br s, 1H), 7.64 (s, 1H), 7.59-7.50 (m, 2H), 5.23 (s, 1H), 2.84-2.69 (m, 8H), 2.50 (s, 3H), 1.99 (t, J=7.2 Hz, 4H), 1.42 (d, J=2.8 Hz, 6H)

    Example 9 (204)

    [3991] ##STR01018##

    N′-((2,6-dimethylpyridin-4-yl)carbamoyl)-4-methyl-5-(2-hydroxypropan-2-yl)thiophene-2-sulfonimidamide (Scheme 5)

    [3992] ##STR01019##

    Step 1: 4-Azido-2,6-dimethylpyridine

    [3993] To the solution of 2,6-dimethylpyridine-4-carboxylic acid (151 mg, 1.0 mmol) in dried toluene (15 mL). To the solution was added DPPA (825 mg, 3.0 mmol) and TEA (303 mg, 3.0 mmol). The mixture was stirred at 60° C. for 4 h. The solution was concentrated under vacuum. This gave 900 mg (crude) of the title compound as yellow oil.

    Step 2 & 3: N-(tert-butyldimethylsilyl)-N′-((2,6-dimethylpyridin-4-yl)carbamoyl)-5-(2-hydroxypropan-2-yl)-3-methylthiophene-2-sulfonimidamide

    [3994] The 4-azido-2,6-dimethylpyridine (900 mg, crude) was dissolved in THF (20 mL). To the solution was added N′-(tert-butyldimethyl silyl)-5-(2-hydroxy propan-2-yl)-3-methylthiophene-2-sulfonimidamide (349 mg, 1.0 mmol) and NaOH (120 mg, 3.0 mmol). The mixture was stirred at 50° C. for 12 h. The solution was diluted with water 20 mL, then the resulting solution was extracted with 3×20 mL of ethyl acetate. The organic layers were combined, dried over anhydrous Na.sub.2SO.sub.4, then concentrated under vacuum. This gave 500 mg (crude) of the title compound as a yellow solid. MS-ESI: 497.0 (M+1).

    Step 4: N′-((2,6-dimethylpyridin-4-yl)carbamoyl)-4-methyl-5-(2-hydroxypropan-2-yl)thiophene-2-sulfonimidamide

    [3995] Into a 50-mL round-bottom flask was placed a solution of N-(tert-butyldimethylsilyl)-N′-((2,6-dimethylpyridin-4-yl)carbamoyl)-4-methyl-5-(2-hydroxypropan-2-yl)thiophene-2-sulfonimidamide (500 mg, crude) in THF (10 mL), to this solution was added HF/Py (70% wt, 143 mg, 5.0 mmol) dropwise at 0° C. The solution was stirred at RT for 4 h. The reaction was then quenched by the addition of 10 mL of water. The resulting solution was extracted with 3×10 mL of ethyl acetate and the combined organic layers were concentrated under vacuum. The crude product was purified by Prep-HPLC using method E eluted with a gradient of ACN/water (10% to 30% in 10 minutes). This resulted in 15 mg (4%, 4 steps) of Example 9 as a white solid. MS-ESI: 383.0 (M+1). .sup.1H NMR (300 MHz, DMSO-d.sub.6) δ 9.31 (s, 1H), 7.53 (br s, 2H), 7.31 (s, 1H), 7.14 (s, 2H), 5.81 (s, 1H), 2.28 (s, 6H), 2.23 (s, 3H), 1.50 (s, 6H).

    TABLE-US-00025 TABLE 16 Examples in the following table were prepared using similar conditions as described in Example 1 and Scheme 1 from appropriate starting materials. Example Final Target Exact Mass # Number Structure IUPAC Name [M + H].sup.+ 10 180 [01020]embedded image N′-(4-fluoro-2,6- diisopropylphenylcarbamoyl)-4-(2- hydroxypropan-2-yl)-5-methylfuran- 2-sulfonimidamide 440.2 11 190 [01021]embedded image N′-(4-fluoro-2,6- diisopropylphenylcarbamoyl)-4-(2- hydroxypropan-2- yl)benzenesulfonimidamide 436.2 12 182 [01022]embedded image N′-(1,2,3,5,6,7-hexahydro-s-indacen- 4-ylcarbamoyl)-4-(2-hydroxypropan- 2-yl)-5-methylthiophene-2- sulfonimidamide 434.1 13 191 [01023]embedded image 2-fluoro-N′-(1,2,3,5,6,7-hexahydro- s-indacen-4-ylcarbamoyl)-4-(2- hydroxypropan-2- yl)benzenesulfonimidamide 432.2 14 177 [01024]embedded image N′-(8-chloro-1,2,3,5,6,7-hexahydro- s-indacen-4-ylcarbamoyl)-4-(2- hydroxypropan-2-yl)thiophene-2- sulfonimidamide 452.0 (M − 1) 15 185 [01025]embedded image N′-(4-cyano-3-fluoro-2,6- diisopropylphenylcarbamoyl)-2-(2- hydroxypropan-2-yl)thiazole-5- sulfonimidamide 468.2 16 186 [01026]embedded image N′-(1,2,3,5,6,7-hexahydro-5-indacen- 4-ylcarbamoyl)-1-isopropyl-1H- pyrazole-3-sulfonimidamide 388.1 17 187 [01027]embedded image N′-(4-(difluoromethoxy)-2,6- diisopropylphenylcarbamoyl)-3- fluoro-5-(2-hydroxypropan-2- yl)thiophene-2-sulfonimidamide 508.2 18 188 [01028]embedded image N′-(4-(difluoromethoxy)-2-ethyl-6- isopropylphenylcarbamoyl)-2-(2- hydroxypropan-2-yl)thiazole-5- sulfonimidamide 477.1 19 192 [01029]embedded image N′-(1,2,3,5,6,7-hexahydro-s-indacen- 4-ylcarbamoyl)-4-(2-hydroxypropan- 2-yl)-2- methylbenzenesulfonimidamide 426.2 (M − 1) 20 189 [01030]embedded image N′-(2-cyclopropyl-4- (difluoromethoxy)-6- isopropylphenylcarbamoyl)-2-(2- hydroxypropan-2-yl)thiazole-5- sulfonimidamide 487.1 (M − 1) 21 178 [01031]embedded image N′-(4-fluoro-2,6- diisopropylphenylcarbamoyl)-2-(2- hydroxypropan-2-yl)thiazole-5- sulfonimidamide 441.1 (M − 1) 22 193 [01032]embedded image N′-(4-fluoro-2,6- diisopropylphenylcarbamoyl)-3-(2- hydroxypropan-2- yl)benzenesulfonimidamide 436.1 23 170 [01033]embedded image N′-(4-cyano-6-cyclopropyl-3-fluoro- 2-isopropylphenylcarbamoyl)-2-(2- hydroxypropan-2-yl)thiazole-5- sulfonimidamide 466.1 24 168 [01034]embedded image N′-(4-(difluoromethoxy)-2,6- diisopropylphenylcarbamoyl)-5-(2- hydroxypropan-2-yl)-3- methylthiophene-2-sulfonimidamide 504.3 25 171 [01035]embedded image N′-(4-(difluoromethoxy)-2,6- diisopropylphenylcarbamoyl)-2-(2- hydroxypropan-2-yl)thiazole-5- sulfonimidamide 491.1 26 122 [01036]embedded image N′-(8-cyano-1,2,3,5,6,7-hexahydro-s- indacen-4-ylcarbamoyl)-4-(2- hydroxypropan-2-yl)thiophene-2- sulfonimidamide 443.1 (M − 1) 27 120 [01037]embedded image N′-(8-(difluoromethoxy)-1,2,3,5,6,7- hexahydro-s-indacen-4- ylcarbamoyl)-2-(2-hydroxypropan-2- yl)thiazole-5-sulfonimidamide 487.1 28 125 [01038]embedded image 4-((dimethylamino)methyl)-N′- (1,2,3,5,6,7-hexahydro-s-indacen-4- ylcarbamoyl)benzenesulfonimidamide 413.3 29 129 [01039]embedded image N′-(2-cyclopropyl-4- (difluoromethoxy)-6- isopropylphenylcarbamoyl)-4-(2- hydroxypropan-2-yl)-2- methylbenzenesulfonimidamide 496.2 30 213 [01040]embedded image 3-fluoro-N′-(8-fluoro-1,2,3,5,6,7- hexahydro-s-indacen-4- ylcarbamoyl)-5-(2-hydroxypropan-2- yl)thiophene-2-sulfonimidamide 456.1 31 207 [01041]embedded image 4-(2-hydroxypropan-2-yl)-5-methyl- N′-((3-methyl-1,2,3,5,6,7-hexahydro- s-indacen-4-yl)carbamoyl)furan-2- sulfonimidamide 432.2 32 195 [01042]embedded image 4-(2-hydroxypropan-2-yl)-5-methyl- N′-((1-methyl-1,2,3,5,6,7-hexahydro- s-indacen-4-yl)carbamoyl)furan-2- sulfonimidamide 432.2

    TABLE-US-00026 TABLE 17 Examples in the following table were prepared using similar conditions as described in Example 4 - route 1 and Scheme 2 from appropriate starting materials. Example Final Target Exact Mass # Number Structure IUPAC Name [M + H].sup.+ 33 179 [01043]embedded image N′-(4-cyano-3-fluoro-2,6- diisopropylphenylcarbamoyl)-4- (2-hydroxypropan-2-yl)-5- methylfuran-2-sulfonimidamide 465.2 34 105 [01044]embedded image N′-(8-fluoro-1,2,3,5,6,7- hexahydro-s-indacen-4- ylcarbamoyl)-3-(2- hydroxypropan-2- yl)benzenesulfonimidamide 432.2 35 121 [01045]embedded image N′-(4-cyano-2,6- diisopropylphenylcarbamoyl)-5- (2-hydroxypropan-2-yl)thiazole- 2-sulfonimidamide 448.1 (M − 1) 36 145 [01046]embedded image 4-((dimethylamino)methyl)-N′- (4-fluoro-2,6- diisopropylphenylcarbamoyl) benzenesulfonimidamide 435.2 37 131 [01047]embedded image N′-(2-cyclopropyl-4- (difluoromethoxy)-6- isopropylphenylcarbamoyl)-4- ((dimethylamino)methyl)benzene- sulfonimidamide 481.3 38 132 [01048]embedded image N′-(4-(difluoromethoxy)-2,6- diisopropylphenylcarbamoyl)-5- (2-hydroxypropan-2-yl)thiazole- 2-sulfonimidamide 489.1 (M − 1) 39 144 [01049]embedded image N′-(4-fluoro-2,6- diisopropylphenylcarbamoyl)-5- (2-hydroxypropan-2-yl)thiazole- 2-sulfonimidamide 441.1 (M − 1) 40 149 [01050]embedded image N′-(4-fluoro-2,6- diisopropylphenylcarbamoyl)-4- (2-hydroxypropan-2- yl)thiophene-2-sulfonimidamide 440.1 (M − 1) 41 152 [01051]embedded image N′-(8-chloro-1,2,3,5,6,7- hexahydro-s-indacen-4- ylcarbamoyl)-2-fluoro-4-(2- hydroxypropan-2- yl)benzenesulfonimidamide 466.2 42 150 [01052]embedded image N′-(4-fluoro-2,6- diisopropylphenylcarbamoyl)-4- (methylsulfonyl)benzene- sulfonimidamide 454.1 (M − 1) 43 167 [01053]embedded image N′-(8-cyano-1,2,3,5,6,7- hexahydro-s-indacen-4- ylcarbamoyl)-2-(2- hydroxypropan-2-yl)thiazole-5- sulfonimidamide 444.2 (M − 1) 44 106 [01054]embedded image N′-(8-fluoro-1,2,3,5,6,7- hexahydro-s-indacen-4- ylcarbamoyl)-2-(2- hydroxypropan-2-yl)thiazole-5- sulfonimidamide 437.1 (M − 1) 45 107 [01055]embedded image N′-(8-fluoro-1,2,3,5,6,7- hexahydro-s-indacen-4- ylcarbamoyl)-4-(2- hydroxypropan-2-yl)-5- methylfuran-2-sulfonimidamide 436.2 46 110 [01056]embedded image N′-(1,2,3,5,6,7-hexahydro-s- indacen-4-ylcarbamoyl)-3-(2- hydroxypropan-2- yl)benzenesulfonimidamide 414.2 47 151 [01057]embedded image 2-fluoro-N′-(8-fluoro-1,2,3,5,6,7- hexahydro-s-indacen-4- ylcarbamoyl)-4-(2- hydroxypropan-2- yl)benzenesulfonimidamide 448.1 (M − 1) 48 154 [01058]embedded image 4-((dimethylamino)methyl)-2- fluoro-N′-(1,2,3,5,6,7-hexahydro- s-indacen-4- ylcarbamoyl)benzene- sulfonimidamide 431.2 49 148 [01059]embedded image N′-(4-fluoro-2,6- diisopropylphenylcarbamoyl)-5- (2-hydroxypropan-2- yl)thiophene-2-sulfonimidamide 442.2 50 153 [01060]embedded image 2-chloro-N′-(8-fluoro-1,2,3,5,6,7- hexahydro-s-indacen-4- ylcarbamoyl)-4-(2- hydroxypropan-2- yl)benzenesulfonimidamide 464.1 (M − 1) 51 109 [01061]embedded image 3-((dimethylamino)methyl)-N′- (1,2,3,5,6,7-hexahydro-s- indacen-4- ylcarbamoyl)benzene- sulfonimidamide 411.1 (M − 1) 52 135 [01062]embedded image N′-((1,2,3,5,6,7-hexahydro-s- indacen-4-yl)carbamoyl)-4-(2- hydroxypropan-2-yl)-3- methylbenzenesulfonimidamide 428.2 53 134 [01063]embedded image N′-((1,2,3,5,6,7-hexahydro-s- indacen-4-yl)carbamoyl)-2-(2- hydroxypropan-2-yl)-4- methylthiazole-5- sulfonimidamide 435.1 54 130 [01064]embedded image N′-((2-cyclopropyl-4- (difluoromethoxy)-6- isopropylphenyl)carbamoyl)-2- fluoro-4-(2-hydroxypropan-2- yl)benzenesulfonimidamide 500.2 55 212 [01065]embedded image 2-fluoro-N′-((8-fluoro- 1,2,3,5,6,7-hexahydro-s-indacen- 4-yl)carbamoyl)-5-(2- hydroxypropan-2- yl)benzenesulfonimidamide 450.2 56 205 [01066]embedded image 3-fluoro-N′-((8-fluoro- 1,2,3,5,6,7-hexahydro-s-indacen- 4-yl)carbamoyl)-5-(2- hydroxypropan-2- yl)benzenesulfonimidamide 450.2 57 143 [01067]embedded image N′-((4-(difluoromethoxy)-2,6- diisopropylphenyl)carbamoyl)-5- (2-hydroxypropan-2-yl)-4- methylthiophene-2- sulfonimidamide 504.2 58 206 [01068]embedded image 4-fluoro-N′-((8-fluoro- 1,2,3,5,6,7-hexahydro-s-indacen- 4-yl)carbamoyl)-3-(2- hydroxypropan-2- yl)benzenesulfonimidamide 450.2 59 108 [01069]embedded image N′-((8-fluoro-1,2,3,5,6,7- hexahydro-s-indacen-4- yl)carbamoyl)-2-(2- hydroxypropan-2-yl)-4- methylthiazole-5- sulfonimidamide 453.1 60 202 [01070]embedded image 3-fluoro-N′-((1,2,3,5,6,7- hexahydro-s-indacen-4- yl)carbamoyl)-4-(2- hydroxypropan-2- yl)benzenesulfonimidamide 432.2 61 208 [01071]embedded image N′-((8-fluoro-1,2,3,5,6,7- hexahydro-s-indacen-4- yl)carbamoyl)-4-(2- hydroxypropan-2-yl)thiazole-2- sulfonimidamide 439.1 62 197 [01072]embedded image N′-((3-fluoro-2,6- diisopropylphenyl)carbamoyl)-2- (2-hydroxypropan-2-yl)thiazole- 5-sulfonimidamide 443.2 63 196 [01073]embedded image N′-((4-fluoro-2,6- diisopropylphenyl)carbamoyl)-3- (methylsulfonyl)benzene- sulfonimidamide 456.1 64 124 [01074]embedded image N′-((1,2,3,5,6,7-hexahydro-s- indacen-4-yl)carbamoyl)-5-(2- hydroxypropan-2-yl)thiazole-2- sulfonimidamide 421.1 65 173 [01075]embedded image N′-((4-cyano-2,6- diisopropylphenyl)carbamoyl)-3- fluoro-5-(2-hydroxypropan-2- yl)thiophene-2-sulfonimidamide 467.2 66 172 [01076]embedded image N′-((4-cyano-2,6- diisopropylphenyl)carbamoyl)- 3,5-bis(2-hydroxypropan-2- yl)benzenesulfonimidamide 501.2 67 174 [01077]embedded image 3-cyano-N′-((4-cyano-2,6- diisopropylphenyl)carbamoyl)-5- (2-hydroxypropan-2- yl)benzenesulfonimidamide 468.2 68 158 [01078]embedded image N′-((4-cyano-2,6- diisopropylphenyl)carbamoyl)-3- (hydroxymethyl)-4-(2- hydroxypropan-2- yl)benzenesulfonimidamide 473.2 69 220 [01079]embedded image N′-((8-cyano-1,2,3,5,6,7- hexahydro-s-indacen-4- yl)carbamoyl)-4- (hydroxymethyl)-2-(2- hydroxypropan-2-yl)thiazole-5- sulfonimidamide 476.1 70 157 [01080]embedded image N-((4-cyano-2,6- diisopropylphenyl)carbamoyl)-4- (hydroxymethyl)-2-(2- hydroxypropan-2-yl)thiazole-5- sulfonimidamide 480.2 71 161 [01081]embedded image N-((4-cyano-3-fluoro-2,6- diisopropylphenyl)carbamoyl)-4- (hydroxymethyl)-2-(2- hydroxypropan-2-yl)thiazole-5- sulfonimidamide 498.2 72 159 [01082]embedded image N′-((4-cyano-3-fluoro-2,6- diisopropylphenyl)carbamoyl)-2- (1,2-dihydroxypropan-2- yl)thiazole-5-sulfonimidamide 484.1 73 165 [01083]embedded image N′-((4-cyano-2,6- diisopropylphenyl)carbamoyl)-4- (methylsulfonyl)benzene- sulfonimidamide 463.1 74 183 [01084]embedded image N′-(1,2,3,5,6,7-hexahydro-s- indacen-4-ylcarbamoyl)-4-(2- hydroxypropan-2-yl)thiophene-2- sulfonimidamide 418.1 (M − 1) 75 176 [01085]embedded image N′-(8-fluoro-1,2,3,5,6,7- hexahydro-s-indacen-4- ylcarbamoyl)-4-(2- hydroxypropan-2-yl)thiophene-2- sulfonimidamide 438.0 76 136 [01086]embedded image N′-(1,2,3,5,6,7-hexahydro-s- indacen-4-ylcarbamoyl)-4-(2- hydroxypropan-2-yl)furan-2- sulfonimidamide 404.2 77 209 [01087]embedded image N′-(1,2,3,5,6,7-hexahydro-s- indacen-4-ylcarbamoyl)-4-(2- hydroxypropan-2-yl)thiazole-2- sulfonimidamide 421.1

    TABLE-US-00027 TABLE 18 Examples in the following table were prepared using similar conditions as described in Example 9 and Scheme 5 from appropriate materials. Example Final Target Exact Mass # Number Structure IUPAC Name [M + H].sup.+ 78 203 [01088]embedded image N-((2,6-dimethylpyridin- 4-yl)carbamoyl)-5-(2- hydroxypropan-2- yl)thiophene-2- sulfonimidamide 369.1

    TABLE-US-00028 TABLE 19 Examples in the following table were obtained from chiral HPLC resolutions of racemic examples described above. The chiral column and eluents are listed in the table. As a convention, the faster-eluting enantiomer is always listed first in the table followed by the slower-eluting enantiomer of the pair. The symbol * at a chiral center denotes that this chiral center has been resolved and the absolute stereochemistry at that center has not been determined. Final LC-MS Ex. Target [M + # Number Structure IUPAC Name Column Eluents H].sup.+  79 180a or 180b [01089]embedded image (S)-or (R)- N′-(4-fluoro-2,6- diisopropylphenylcarbamoyl)-4-(2- hydroxypropan-2-yl)-5-methylfuran- 2-sulfonimidamide ChiralPak ID, 2*25 cm, 5 um 20% EtOH in Hex 440.3  80 180b or 180a [01090]embedded image (R)-or (S)- N′-(4-fluoro-2,6- diisopropylphenylcarbamoyl)-4-(2- hydroxypropan-2-yl)-5-methylfuran- 2-sulfonimidamide ChiralPak ID, 2*25 cm, 5 um 20% EtOH in Hex 440.3  81 179a or 179b [01091]embedded image (S)-or (R)- N′-(4-cyano-3-fluoro-2,6- diisopropylphenylcarbamoyl)-4-(2- hydroxypropan-2-yl)-5-methylfuran- 2-sulfonimidamide ChiralPak ID, 2*25 cm, 5 um 23% EtOH in Hex 465.3  82 179b or 179a [01092]embedded image (R)-or (S)- N′-(4-cyano-3-fluoro-2,6- diisopropylphenylcarbamoyl)-4-(2- hydroxypropan-2-yl)-5- methylfuran-2-sulfonimidamide ChiralPak ID, 2*25 cm, 5 um 23% EtOH in Hex 465.3  83 190a or 190b [01093]embedded image (S)-or (R)- N′-(4-fluoro-2,6- diisopropylphenylcarbamoyl)-4- (2-hydroxypropan-2- yl)benzenesulfonimidamide ChiralPak ID, 2*25 cm, 5 um 20% EtOH in Hex 436.2  84 190b or 190a [01094]embedded image (R)-or (S)- N′-(4-fluoro-2,6- diisopropylphenylcarbamoyl)- 4-(2-hydroxypropan-2- yl)benzenesulfonimidamide ChiralPak ID, 2*25 cm, 5 um 20% EtOH in Hex 436.2  85 182a or 182b [01095]embedded image (S)-or (R)- N′-(1,2,3,5,6,7-hexahydro-s- indacen-4-ylcarbamoyl)-4-(2- hydroxypropan-2-yl)-5- methylthiophene-2-sulfonimidamide ChiralPak IC, 2*25 cm, 5 um 20% EtOH in Hex 434.1  86 182b or 182a [01096]embedded image (R)-or (S)- N′-(1,2,3,5,6,7-hexahydro-s- indacen-4-ylcarbamoyl)-4-(2- hydroxypropan-2-yl)-5- methylthiophene-2-sulfonimidamide ChiralPak IC, 2*25 cm, 5 um 20% EtOH in Hex 434.1  87 191a or 191b [01097]embedded image (S)-or (R)- 2-fluoro-N′-(1,2,3,5,6,7-hexahydro- s-indacen-4-ylcarbamoyl)-4-(2- hydroxypropan-2- yl)benzenesulfonimidamide ChiralPak IG, 2*25 cm, 5 um 30% IPA in Hex (0.1% DEA) 430.1 (M − 1)  88 191b or 191a [01098]embedded image (R)-or (S)- 2-fluoro-N′-(1,2,3,5,6,7-hexahydro- s-indacen-4-ylcarbamoyl)-4-(2- hydroxypropan-2- yl)benzenesulfonimidamide ChiralPak IG, 2*25 cm, 5 um 30% IPA in Hex (0.1% DEA) 430.1 (M − 1)  89 177a or 177b [01099]embedded image (S)-or (R)- N′-(8-chloro-1,2,3,5,6,7-hexahydro- s-indacen-4-ylcarbamoyl)-4-(2- hydroxypropan-2-yl)thiophene-2- sulfonimidamide ChiralPak ID, 2*25 cm, 5 um 20% EtOH in Hex (0.1% DEA) 452.0 (M − 1)  90 177b or 177a [01100]embedded image (R)-or (S)- N′-(8-chloro-1,2,3,5,6,7-hexahydro- s-indacen-4-ylcarbamoyl)-4-(2- hydroxypropan-2-yl)thiophene-2- sulfonimidamide ChiralPak ID, 2*25 cm, 5 um 20% EtOH in Hex (0.1% DEA) 452.0 (M − 1)  91 185a or 185b [01101]embedded image (S)-or (R)- N′-(4-cyano-3-fluoro-2,6- diisopropylphenylcarbamoyl)-2-(2- hydroxypropan-2-yl)thiazole-5- sulfonimidamide ChiralPak ID, 2*25 cm, 5 um 30% EtOH in Hex (0.1% DEA) 466.1 (M − 1)  92 185b or 185a [01102]embedded image (R)-or (S)- N′-(4-cyano-3-fluoro-2,6- diisopropylphenylcarbamoyl)-2-(2- hydroxypropan-2-yl)thiazole-5- sulfonimidamide ChiralPak ID, 2*25 cm, 5 um 30% EtOH in Hex (0.1% DEA) 466.1 (M − 1)  93 186a or 186b [01103]embedded image (S)-or (R)- N′-(1,2,3,5,6,7-hexahydro-s- indacen-4-ylcarbamoyl)-1- isopropyl-1H-pyrazole-3- sulfonimidamide ChiralPak IG, 2*25 cm, 5 um 30% EtOH in Hex (0.1% DEA) 388.1  94 186b or 186a [01104]embedded image (R)-or (S)- N′-(1,2,3,5,6,7-hexahydro-s- indacen-4-ylcarbamoyl)-1- isopropyl-1H-pyrazole-3- sulfonimidamide ChiralPak IG, 2*25 cm, 5 um 30% EtOH in Hex (0.1% DEA) 388.1  95 187a or 187b [01105]embedded image (S)-or (R)- N′-(4-(difluoromethoxy)-2,6- diisopropylphenylcarbamoyl)-3- fluoro-5-(2-hydroxypropan-2- yl)thiophene-2-sulfonimidamide ChiralPak ID, 2*25 cm, 5 um 20% EtOH in Hex (0.1% DEA) 508.2  96 187b or 187a [01106]embedded image (R)-or (S)- N′-(4-(difluoromethoxy)-2,6- diisopropylphenylcarbamoyl)-3- fluoro-5-(2-hydroxypropan-2- yl)thiophene-2-sulfonimidamide ChiralPak ID, 2*25 cm, 5 um 20% EtOH in Hex (0.1% DEA) 508.2  97 188a or 188b [01107]embedded image (S)-or (R)- N′-(4-(difluoromethoxy)-2-ethyl-6- isopropylphenylcarbamoyl)-2-(2- hydroxypropan-2-yl)thiazole-5- sulfonimidamide ChiralPak ID, 2*25 cm, 5 um 30% IPA in Hex (0.1% DEA) 477.2  98 188b or 188a [01108]embedded image (R)-or (S)- N′-(4-(difluoromethoxy)-2-ethyl-6- isopropylphenylcarbamoyl)-2-(2- hydroxypropan-2-yl)thiazole-5- sulfonimidamide ChiralPak ID, 2*25 cm, 5 um 30% IPA in Hex (0.1% DEA) 477.2  99 192a or 192b [01109]embedded image (S)-or (R)- N′-(1,2,3,5,6,7-hexahydro-s- indacen-4-ylcarbamoyl)-4-(2- hydroxypropan-2-yl)-2- methylbenzenesulfonimidamide ChiralPak ID, 2*25 cm, 5 um 30% EtOH in Hex (0.1% DEA) 428.2 100 192b or 192a [01110]embedded image (R)-or (S)- N′-(1,2,3,5,6,7-hexahydro-s- indacen-4-ylcarbamoyl)-4-(2- hydroxypropan-2-yl)-2- methylbenzenesulfonimidamide ChiralPak ID, 2*25 cm, 5 um 30% EtOH in Hex (0.1% DEA) 428.2 101 189a or 189b [01111]embedded image (S)-or (R)- N′-(2-cyclopropyl-4- (difluoromethoxy)-6- isopropylphenylcarbamoyl)-2-(2- hydroxypropan-2-yl)thiazole-5- sulfonimidamide ChiralPak ID, 2*25 cm, 5 um 50% IPA in Hex (0.1% DEA) 489.3 102 189b or 189a [01112]embedded image (R)-or (S)- N′-(2-cyclopropyl-4- (difluoromethoxy)-6- isopropylphenylcarbamoyl)-2-(2- hydroxypropan-2-yl)thiazole-5- sulfonimidamide ChiralPak ID, 2*25 cm, 5 um 50% IPA in Hex (0.1% DEA) 489.2 103 178a or 178b [01113]embedded image (S)-or (R)- N′-(4-fluoro-2,6- diisopropylphenylcarbamoyl)-2-(2- hydroxypropan-2-yl)thiazole-5- sulfonimidamide ChiralPak ID, 2*25 cm, 5 um 30% IPA (0.1% DEA) in Hex:DCM = 3:1 443.2 104 178b or 178a [01114]embedded image (R)-or (S)- N′-(4-fluoro-2,6- diisopropylphenylcarbamoyl)-2-(2- hydroxypropan-2-yl)thiazole-5- sulfonimidamide ChiralPak ID, 2*25 cm, 5 um 30% IPA (0.1% DEA) in Hex:DCM = 3:1 443.1 105 193a or 193b [01115]embedded image (S)-or (R)- N′-(4-fluoro-2,6- diisopropylphenylcarbamoyl)-3-(2- hydroxypropan-2- yl)benzenesulfonimidamide ChiralPak IG, 2*25 cm, 5 um 20% IPA in Hex (0.1% DEA) 436.2 106 193b or 193a [01116]embedded image (R)-or (S)- N′-(4-fluoro-2,6- diisopropylphenylcarbamoyl)-3-(2- hydroxypropan-2- yl)benzenesulfonimidamide ChiralPak IG, 2*25 cm, 5 um 20% IPA in Hex (0.1% DEA) 436.2 107 170a or 170b [01117]embedded image (S)-or (R)- N′-(4-cyano-6-cyclopropyl-3-fluoro- 2-isopropylphenylcarbamoyl)-2-(2- hydroxypropan-2-yl)thiazole-5- sulfonimidamide ChiralPak IG, 2*25 cm, 5 um 15% EtOH in Hex (0.1% DEA) 466.1 108 170b or 170a [01118]embedded image (R)-or (S)- N′-(4-cyano-6-cyclopropyl-3-fluoro- 2-isopropylphenylcarbamoyl)-2-(2- hydroxypropan-2-yl)thiazole-5- sulfonimidamide ChiralPak IG, 2*25 cm, 5 um 15% EtOH in Hex (0.1% DEA) 466.1 109 168a or 168b [01119]embedded image (S)-or (R)- N′-(4-(difluoromethoxy)-2,6- diisopropylphenylcarbamoyl)-5-(2- hydroxypropan-2-yl)-3- methylthiophene-2-sulfonimidamide ChiralPak ID, 2*25 cm, 5 um 30% IPA in Hex (0.1% DEA) 504.2 110 168b or 168a [01120]embedded image (R)-or (S)- N′-(4-(difluoromethoxy)-2,6- diisopropylphenylcarbamoyl)-5-(2- hydroxypropan-2-yl)-3- methylthiophene-2-sulfonimidamide ChiralPak ID, 2*25 cm, 5 um 30% IPA in Hex (0.1% DEA) 504.2 111 171a or 171b [01121]embedded image (S)-or (R)- N′-(4-(difluoromethoxy)-2,6- diisopropylphenylcarbamoyl)-2-(2- hydroxypropan-2-yl)thiazole-5- sulfonimidamide ChiralPak ID, 2*25 cm, 5 um 50% IPA in Hex:DCM = 1:1 489.1 (M − 1) 112 171b or 171a [01122]embedded image (R)-or (S)- N′-(4-(difluoromethoxy)-2,6- diisopropylphenylcarbamoyl)-2-(2- hydroxypropan-2-yl)thiazole-5- sulfonimidamide ChiralPak ID, 2*25 cm, 5 um 50% IPA in Hex:DCM = 1:1 489.1 (M − 1) 113 122a or 122b [01123]embedded image (S)-or (R)- N′-(8-cyano-1,2,3,5,6,7-hexahydro- s-indacen-4-ylcarbamoyl)-4-(2- hydroxypropan-2-yl)thiophene-2- sulfonimidamide ChiralPak ID, 2*25 cm, 5 um 30% IPA in Hex 443.1 (M − 1) 114 122b or 122a [01124]embedded image (R)-or (S)- N′-(8-cyano-1,2,3,5,6,7-hexahydro- s-indacen-4-ylcarbamoyl)-4-(2- hydroxypropan-2-yl)thiophene-2- sulfonimidamide ChiralPak ID, 2*25 cm, 5 um 30% IPA in Hex 443.1 (M − 1) 115 120a or 120b [01125]embedded image (S)-or (R)- N′-(8-(difluoromethoxy)-1,2,3,5,6,7- hexahydro-s-indacen-4- ylcarbamoyl)-2-(2-hydroxypropan- 2-yl)thiazole-5-sulfonimidamide Chiral ART Cellulose- SB 2*25 cm, 5 um 20% EtOH in Hex (0.1% DEA) 485.1 (M − 1) 116 120b or 120a [01126]embedded image (R)-or (S)- N′-(8-(difluoromethoxy)-1,2,3,5,6,7- hexahydro-s-indacen-4- ylcarbamoyl)-2-(2-hydroxypropan- 2-yl)thiazole-5-sulfonimidamide Chiral ART Cellulose- SB 2*25 cm, 5 um 20% EtOH in Hex (0.1% DEA) 485.1 (M − 1) 117 125a or 125b [01127]embedded image (S)-or (R)- 4-((dimethylamino)methyl)-N′- (1,2,3,5,6,7-hexahydro-s-indacen- 4-ylcarbamoyl)benzene- sulfonimidamide ChiralPak ID, 2*25 cm, 5 um 50% IPA in Hex:DCM = 3:1 413.2 118 125b or 125a [01128]embedded image (R)-or (S)- 4-((dimethylamino)methyl)-N′- (1,2,3,5,6,7-hexahydro-s-indacen-4- ylcarbamoyl)benzene- sulfonimidamide ChiralPak ID, 2*25 cm, 5 um 50% IPA in Hex:DCM = 3:1 413.2 119 129a or 129b [01129]embedded image (S)-or (R)- N′-(2-cyclopropyl-4- (difluoromethoxy)-6- isopropylphenylcarbamoyl)-4-(2- hydroxypropan-2-yl)-2- methylbenzenesulfonimidamide ChiralPak ID, 2*25 cm, 5 um 50% IPA in Hex:DCM = 3:1 496.2 120 129b or 129a [01130]embedded image (R)-or (S)- N′-(2-cyclopropyl-4- (difluoromethoxy)-6- isopropylphenylcarbamoyl)-4-(2- hydroxypropan-2-yl)-2- methylbenzenesulfonimidamide ChiralPak ID, 2*25 cm, 5 um 50% IPA in Hex:DCM = 3:1 496.2 121 112a or 112b [01131]embedded image (S)-or (R)- 3-fluoro-N′-(8-fluoro-1,2,3,5,6,7- hexahydro-s-indacen-4- ylcarbamoyl)-5-(2-hydroxypropan- 2-yl)thiophene-2-sulfonimidamide ChiralPak IG, 2*25 cm, 5 um 15% EtOH in Hex (0.1% DEA) 456.1 122 112b or 112a [01132]embedded image (R)-or (S)- 3-fluoro-N′-(8-fluoro-1,2,3,5,6,7- hexahydro-s-indacen-4- ylcarbamoyl)-5-(2-hydroxypropan-2- yl)thiophene-2-sulfonimidamide ChiralPak IG, 2*25 cm, 5 um 15% EtOH in Hex (0.1% DEA) 456.1 128 105a or 105b [01133]embedded image (S)-or (R)- N′-(8-fluoro-1,2,3,5,6,7-hexahydro- s-indacen-4-ylcarbamoyl)-3-(2- hydroxypropan-2- yl)benzenesulfonimidamide ChiralPak ID, 2*25 cm, 5 um 40% EtOH in Hex 432.1 129 105b or 105a [01134]embedded image (R)-or (S)- N′-(8-fluoro-1,2,3,5,6,7-hexahydro- s-indacen-4-ylcarbamoyl)-3-(2- hydroxypropan-2- yl)benzenesulfonimidamide ChiralPak ID, 2*25 cm, 5 um 40% EtOH in Hex 432.1 130 121a or 121b [01135]embedded image (S)-or (R)- N′-(4-cyano-2,6- diisopropylphenylcarbamoyl)-5-(2- hydroxypropan-2-yl)thiazole-2- sulfonimidamide ChiralPak ID, 2*25 cm, 5 um 40% EtOH in Hex 448.1 (M − 1) 131 121b or 121a [01136]embedded image (R)-or (S)- N′-(4-cyano-2,6- diisopropylphenylcarbamoyl)-5-(2- hydroxypropan-2-yl)thiazole-2- sulfonimidamide ChiralPak ID, 2*25 cm, 5 um 40% EtOH in Hex 448.1 (M − 1) 132 145a or 145b [01137]embedded image (S)-or (R)- 4-((dimethylamino)methyl)-N′-(4- fluoro-2,6-diisopropyl- phenylcarbamoyl)benzene- sulfonimidamide ChiralPak IG, 2*25 cm, 5 um 30% EtOH in Hex 435.2 133 145b or 145a [01138]embedded image (R)-or (S)- 4-((dimethylamino)methyl)-N′-(4- fluoro-2,6-diisopropyl- phenylcarbamoyl)benzene- sulfonimidamide ChiralPak IG, 2*25 cm, 5 um 30% EtOH in Hex 435.2 134 131a or 131b [01139]embedded image (S)-or (R)- N′-(2-cyclopropyl-4- (difluoromethoxy)-6- isopropylphenylcarbamoyl)-4- ((dimethylamino)methyl)benzene- sulfonimidamide ChiralPak IG, 2*25 cm, 5 um 50% EtOH in Hex 481.2 135 131b or 131a [01140]embedded image (R)-or (S)- N′-(2-cyclopropyl-4- (difluoromethoxy)-6- isopropylphenylcarbamoyl)-4- ((dimethylamino)methyl)benzene- sulfonimidamide ChiralPak IG, 2*25 cm, 5 um 50% EtOH in Hex 481.2 136 225a or 225b [01141]embedded image (S)-or (R)- N′-(4-(difluoromethoxy)-2,6- diisopropylphenylcarbamoyl)-5-(2- hydroxypropan-2-yl)thiazole-2- sulfonimidamide ChiralPak IF, 2*25 cm, 5 um 20% MeOH (0.1% TFA) in CO.sub.2 489.1 (M − 1) 137 225b or 225a [01142]embedded image (R)-or (S)- N′-(4-(difluoromethoxy)-2,6- diisopropylphenylcarbamoyl)-5-(2- hydroxypropan-2-yl)thiazole-2- sulfonimidamide ChiralPak IF, 2*25 cm, 5 um 20% MeOH (0.1% TFA) in CO.sub.2 489.1 (M − 1) 138 144a or 144b [01143]embedded image (S)-or (R)- N′-(4-fluoro-2,6- diisopropylphenylcarbamoyl)-5-(2- hydroxypropan-2-yl)thiazole-2- sulfonimidamide ChiralPak IF, 2*25 cm, 5 um 20% MeOH (0.1% TFA) in CO.sub.2 443.2 139 144b or 144a [01144]embedded image (R)-or (S)- N′-(4-fluoro-2,6- diisopropylphenylcarbamoyl)-5-(2- hydroxypropan-2-yl)thiazole-2- sulfonimidamide ChiralPak IF, 2*25 cm, 5 um 20% MeOH (0.1% TFA) in CO.sub.2 443.1 140 149a or 149b [01145]embedded image (S)-or (R)- N′-(4-fluoro-2,6- diisopropylphenylcarbamoyl)-4-(2- hydroxypropan-2-yl)thiophene-2- sulfonimidamide ChiralPak ID, 2*25 cm, 5 um 30% EtOH in Hex 440.1 (M − 1) 141 149b or 149a [01146]embedded image (R)-or (S)- N′-(4-fluoro-2,6- diisopropylphenylcarbamoyl)-4-(2- hydroxypropan-2-yl)thiophene-2- sulfonimidamide ChiralPak ID, 2*25 cm, 5 um 30% EtOH in Hex 440.1 (M − 1) 142 152a or 152b [01147]embedded image (S)-or (R)- N′-(4-fluoro-2,6- diisopropylphenylcarbamoyl)-4-(2- hydroxypropan-2-yl)thiophene-2- sulfonimidamide ChiralPak IG, 2*25 cm, 5 um 30% IPA in Hex 466.2 143 152b or 152a [01148]embedded image (R)-or (S)- N′-(4-fluoro-2,6- diisopropylphenylcarbamoyl)-4-(2- hydroxypropan-2-yl)thiophene-2- sulfonimidamide ChiralPak IG, 2*25 cm, 5 um 30% IPA in Hex 466.2 144 151a′ or 151b′ [01149]embedded image (S)-or (R)- N′-(4-fluoro-2,6- diisopropylphenylcarbamoyl)-4- (methylsulfonyl)benzene- sulfonimidamide Lux 5u Cellulose- 4, AXIA Packed, 2.12*25 cm, 5 um 35% MeOH (2 mM NH.sub.3) in CO.sub.2 454.1 (M − 1) 145 151b′ or 151a′ [01150]embedded image (R)-or (S)- N′-(4-fluoro-2,6- diisopropylphenylcarbamoyl)-4- (methylsulfonyl)benzene- sulfonimidamide Lux 5u Cellulose- 4, AXIA Packed, 2.12*25 cm, 5 um 35% MeOH (2 mM NH.sub.3) in CO.sub.2 454.1 (M − 1) 146 167a or 167b [01151]embedded image (S)-or (R)- N′-(8-cyano-1,2,3,5,6,7-hexahydro- s-indacen-4-ylcarbamoyl)-2-(2- hydroxypropan-2-yl)thiazole-5- sulfonimidamide ChiralPak IC, 2*25 cm, 5 um 30% EtOH in Hex (0.1% DEA) 444.1 (M − 1) 147 167b or 167a [01152]embedded image (R)-or (S)- N′-(8-cyano-1,2,3,5,6,7-hexahydro- s-indacen-4-ylcarbamoyl)-2-(2- hydroxypropan-2-yl)thiazole-5- sulfonimidamide ChiralPak IC, 2*25 cm, 5 um 30% EtOH in Hex (0.1% DEA) 444.1 (M − 1) 148 107a or 107b [01153]embedded image (S)-or (R)- N′-(8-fluoro-1,2,3,5,6,7-hexahydro- s-indacen-4-ylcarbamoyl)-4-(2- hydroxypropan-2-yl)-5-methylfuran- 2-sulfonimidamide ChiralPak ID, 2*25 cm, 5 um 50% IPA in Hex 434.1 (M − 1) 149 107b or 107a [01154]embedded image (R)-or (S)- N′-(8-fluoro-1,2,3,5,6,7-hexahydro- s-indacen-4-ylcarbamoyl)-4-(2- hydroxypropan-2-yl)-5-methylfuran- 2-sulfonimidamide ChiralPak ID, 2*25 cm, 5 um 50% IPA in Hex 434.1 (M − 1) 150 110a or 110b [01155]embedded image (S)-or (R)- N′-(1,2,3,5,6,7-hexahydro-s-indacen- 4-ylcarbamoyl)-3-(2-hydroxypropan- 2-yl)benzenesulfonimidamide ChiralPak IF, 2*25 cm, 5 um 30% EtOH in Hex 412.1 (M − 1) 151 110b or 110a [01156]embedded image (R)-or (S)- N′-(1,2,3,5,6,7-hexahydro-s-indacen- 4-ylcarbamoyl)-3-(2-hydroxypropan- 2-yl)benzenesulfonimidamide ChiralPak IF, 2*25 cm, 5 um 30% EtOH in Hex 412.1 (M − 1) 152 151a or 151b [01157]embedded image (S)-or (R)- 2-fluoro-N′-(8-fluoro-1,2,3,5,6,7- hexahydro-s-indacen-4- ylcarbamoyl)-4-(2-hydroxypropan- 2-yl)benzenesulfonimidamide ChiralPak IG, 2*25 cm, 5 um 30% IPA in Hex 448.1 (M − 1) 153 151b or 151a [01158]embedded image (R)-or (S)- 2-fluoro-N′-(8-fluoro-1,2,3,5,6,7- hexahydro-s-indacen-4- ylcarbamoyl)-4-(2-hydroxypropan- 2-yl)benzenesulfonimidamide ChiralPak IG, 2*25 cm, 5 um 30% IPA in Hex 448.1 (M − 1) 154 154a or 154b [01159]embedded image (S)-or (R)- 4-((dimethylamino)methyl)-2- fluoro-N′-(1,2,3,5,6,7-hexahydro-s- indacen-4-ylcarbamoyl)benzene- sulfonimidamide ChiralPak IG, 2*25 cm, 5 um 30% EtOH in Hex 431.2 155 154b or 154a [01160]embedded image (R)-or (S)- 4-((dimethylamino)methyl)-2-fluoro- N′-(1,2,3,5,6,7-hexahydro-s-indacen- 4-ylcarbamoyl)benzene- sulfonimidamide ChiralPak IG, 2*25 cm, 5 um 30% EtOH in Hex 431.2 156 148a or 148b [01161]embedded image (S)-or (R)- N′-(4-fluoro-2,6- diisopropylphenylcarbamoyl)-5-(2- hydroxypropan-2-yl)thiophene-2- sulfonimidamide ChiralPak ID, 2*25 cm, 5 um 30% EtOH in Hex 442.1 157 148b or 148a [01162]embedded image (R)-or (S)- N′-(4-fluoro-2,6- diisopropylphenylcarbamoyl)-5-(2- hydroxypropan-2-yl)thiophene-2- sulfonimidamide ChiralPak ID, 2*25 cm, 5 um 30% EtOH in Hex 442.1 158 153a or 153b [01163]embedded image (S)-or (R)- 2-chloro-N′-(8-fluoro-1,2,3,5,6,7- hexahydro-s-indacen-4- ylcarbamoyl)-4-(2-hydroxypropan- 2-yl)benzenesulfonimidamide ChiralPak IF, 2*25 cm, 5 um 30% EtOH in Hex 464.1 (M − 1) 159 153a or 153b [01164]embedded image (R)-or (S)- 2-chloro-N′-(8-fluoro-1,2,3,5,6,7- hexahydro-s-indacen-4- ylcarbamoyl)-4-(2-hydroxypropan- 2-yl)benzenesulfonimidamide ChiralPak IF, 2*25 cm, 5 um 30% EtOH in Hex 464.1 (M − 1) 160 109a or 109b [01165]embedded image (S)-or (R)- 3-((dimethylamino)methyl)-N′- (1,2,3,5,6,7-hexahydro-s-indacen- 4-ylcarbamoyl)benzene- sulfonimidamide ChiralPak ID, 2*25 cm, 5 um 50% EtOH in Hex (0.1% DEA) 413.1 161 109b or 109a [01166]embedded image (R)-or (S)- 3-((dimethylamino)methyl)-N′- (1,2,3,5,6,7-hexahydro-s-indacen- 4-ylcarbamoyl)benzene- sulfonimidamide ChiralPak ID, 2*25 cm, 5 um 50% EtOH in Hex (0.1% DEA) 413.1 162 135a or 135b [01167]embedded image (S)-or (R)- N′-((1,2,3,5,6,7-hexahydro-s- indacen-4-yl)carbamoyl)-4-(2- hydroxypropan-2-yl)-3- methylbenzenesulfonimidamide ChiralPak ID, 2*25 cm, 5 um 30% IPA in Hex 428.2 163 135b or 135a [01168]embedded image (R)-or (S)- N′-((1,2,3,5,6,7-hexahydro-s- indacen-4-yl)carbamoyl)-4-(2- hydroxypropan-2-yl)-3- methylbenzenesulfonimidamide ChiralPak ID, 2*25 cm, 5 um 30% IPA in Hex 428.2 164 134a or 134b [01169]embedded image (S)-or (R)- N′-((1,2,3,5,6,7-hexahydro-s- indacen-4-yl)carbamoyl)-2-(2- hydroxypropan-2-yl)-4- methylthiazole-5-sulfonimidamide ChiralPak ID, 2*25 cm, 5 um 30% IPA in Hex 435.1 165 134b or 134a [01170]embedded image (R)-or (S)- N′-((1,2,3,5,6,7-hexahydro-s- indacen-4-yl)carbamoyl)-2-(2- hydroxypropan-2-yl)-4- methylthiazole-5-sulfonimidamide ChiralPak ID, 2*25 cm, 5 um 30% IPA in Hex 435.1 166 130a or 130b [01171]embedded image (S)-or (R)- N′-((2-cyclopropyl-4- (difluoromethoxy)-6- isopropylphenyl)carbamoyl)-2- fluoro-4-(2-hydroxypropan-2- yl)benzenesulfonimidamide ChiralPak ID, 2*25 cm, 5 um 40% IPA in Hex 500.2 167 130b or 130a [01172]embedded image (R)-or (S)- N′-((2-cyclopropyl-4- (difluoromethoxy)-6- isopropylphenyl)carbamoyl)-2- fluoro-4-(2-hydroxypropan-2- yl)benzenesulfonimidamide ChiralPak ID, 2*25 cm, 5 um 40% IPA in Hex 500.2 168 212a or 212b [01173]embedded image (S)-or (R)- 2-fluoro-N′-((8-fluoro-1,2,3,5,6,7- hexahydro-s-indacen-4- yl)carbamoyl)-5-(2- hydroxypropan-2- yl)benzenesulfonimidamide ChiralPak ID, 2*25 cm, 5 um 40% EtOH in Hex 450.2 169 212b or 212a [01174]embedded image (S)-or (R)- 2-fluoro-N′-((8-fluoro-1,2,3,5,6,7- hexahydro-s-indacen-4- yl)carbamoyl)-5-(2- hydroxypropan-2- yl)benzenesulfonimidamide ChiralPak ID, 2*25 cm, 5 um 40% EtOH in Hex 450.2 170 205a or 205b [01175]embedded image (R)-or (S)- 3-fluoro-N′-((8-fluoro-1,2,3,5,6,7- hexahydro-s-indacen-4- yl)carbamoyl)-5-(2- hydroxypropan-2- yl)benzenesulfonimidamide Chiral ART Cellulose- SB, 2*25 cm, 5 um 30% EtOH in Hex 450.2 171 205a or 205b [01176]embedded image (S)-or (R)- 3-fluoro-N′-((8-fluoro-1,2,3,5,6,7- hexahydro-s-indacen-4- yl)carbamoyl)-5-(2- hydroxypropan-2- yl)benzenesulfonimidamide Chiral ART Cellulose- SB, 2*25 cm, 5 um 40% EtOH in Hex 450.2 172 143a or 143b [01177]embedded image (S)-or (R)- N′-((4-(difluoromethoxy)-2,6- diisopropylphenyl)carbamoyl)- 5-(2-hydroxypropan-2-yl)-4- methylthiophene-2- sulfonimidamide ChiralPak ID, 2*25 cm, 5 um 30% EtOH in Hex 504.2 173 143b or 143a [01178]embedded image (R)-or (S)- N′-((4-(difluoromethoxy)-2,6- diisopropylphenyl)carbamoyl)-5- (2-hydroxypropan-2-yl)-4- methylthiophene-2- sulfonimidamide ChiralPak ID, 2*25 cm, 5 um 30% EtOH in Hex 504.2 174 206a or 206b [01179]embedded image (S)-or (R)- 4-fluoro-N′-((8-fluoro-1,2,3,5,6,7- hexahydro-s-indacen-4- yl)carbamoyl)-3-(2-hydroxypropan- 2-yl)benzenesulfonimidamide ChiralPak ID, 2*25 cm, 5 um 30% EtOH in Hex (8 mM NH.sub.3•MeOH) 450.2 175 206b or 206a [01180]embedded image (R)-or (S)- 4-fluoro-N′-((8-fluoro-1,2,3,5,6,7- hexahydro-s-indacen-4- yl)carbamoyl)-3-(2-hydroxypropan- 2-yl)benzenesulfonimidamide ChiralPak ID, 2*25 cm, 5 um 30% EtOH in Hex (8 mM NH.sub.3•MeOH) 450.2 176 108a or 108b [01181]embedded image (S)-or (R)- N′-((8-fluoro-1,2,3,5,6,7-hexahydro- s-indacen-4-yl)carbamoyl)-2-(2- hydroxypropan-2-yl)-4- methylthiazole-5-sulfonimidamide ChiralPak IG, 2*25 cm, 5 um 30% IPA in Hex 453.1 177 108b or 108a [01182]embedded image (R)-or (S)- N′-((8-fluoro-1,2,3,5,6,7-hexahydro- s-indacen-4-yl)carbamoyl)-2-(2- hydroxypropan-2-yl)-4- methylthiazole-5-sulfonimidamide ChiralPak IG, 2*25 cm, 5 um 40% IPA in Hex 453.1 178 202a or 202b [01183]embedded image (S)-or (R)- 3-fluoro-N′-((1,2,3,5,6,7-hexahydro- s-indacen-4-yl)carbamoyl)-4-(2- hydroxypropan-2- yl)benzenesulfonimidamide Chiral ART Cellulose- SB, 2*25 cm, 5 um 50% EtOH in Hex (8 mM NH.sub.3•MeOH) 432.2 179 202b or 202a [01184]embedded image (R)-or (S)- 3-fluoro-N′-((1,2,3,5,6,7-hexahydro- s-indacen-4-yl)carbamoyl)-4-(2- hydroxypropan-2- yl)benzenesulfonimidamide Chiral ART Cellulose- SB, 2*25 cm, 5 um 50% EtOH in Hex (8 mM NH.sub.3•MeOH) 432.2 180 116a or 116b [01185]embedded image (S)-or (R)- N′-((8-fluoro-1,2,3,5,6,7-hexahydro- s-indacen-4-yl)carbamoyl)-4-(2- hydroxypropan-2-yl)-N- methylthiophene-2-sulfonimidamide ChiralPak IG, 2*25 cm, 5 um 30% EtOH in Hex 452.1 181 116b or 116a [01186]embedded image (R)-or (S)- N′-((8-fluoro-1,2,3,5,6,7-hexahydro- s-indacen-4-yl)carbamoyl)-4-(2- hydroxypropan-2-yl)-N- methylthiophene-2-sulfonimidamide ChiralPak IG, 2*25 cm, 5 um 30% EtOH in Hex 452.1 182 173a or 173b [01187]embedded image (S)-or (R)- N′-((4-cyano-2,6- diisopropylphenyl)carbamoyl)-3- fluoro-5-(2-hydroxypropan-2- yl)thiophene-2-sulfonimidamide ChiralPak ID, 2*25 cm, 5 um 15% EtOH in Hex (0.1% DEA) 467.2 183 173b or 173a [01188]embedded image (R)-or (S)- N′-((4-cyano-2,6- diisopropylphenyl)carbamoyl)-3- fluoro-5-(2-hydroxypropan-2- yl)thiophene-2-sulfonimidamide ChiralPak ID, 2*25 cm, 5 um 15% EtOH in Hex (0.1% DEA) 467.2 184 174a or 174b [01189]embedded image (S)-or (R)- 3-cyano-N′-((4-cyano-2,6- diisopropylphenyl)carbamoyl)-5-(2- hydroxypropan-2- yl)benzenesulfonimidamide ChiralPak IG, 2*25 cm, 5 um 15% EtOH in Hex (0.1% DEA) 468.2 185 174b or 174a [01190]embedded image (R)-or (S)- 3-cyano-N′-((4-cyano-2,6- diisopropylphenyl)carbamoyl)-5-(2- hydroxypropan-2- yl)benzenesulfonimidamide ChiralPak IG, 2*25 cm, 5 um 15% EtOH in Hex (0.1% DEA) 468.2 186 223a or 223b [01191]embedded image (S)-or (R)- N′-((4-cyano-2,6- diisopropylphenyl)carbamoyl)-5-(2- hydroxypropan-2-yl)thiophene-2- sulfonimidamide ChiralPak ID, 2*25 cm, 5 um 30% EtOH in Hex (0.1% DEA) 449.2 187 223b or 223a [01192]embedded image (R)-or (S)- N′-((4-cyano-2,6- diisopropylphenyl)carbamoyl)-5-(2- hydroxypropan-2-yl)thiophene-2- sulfonimidamide ChiralPak ID, 2*25 cm, 5 um 30% EtOH in Hex (0.1% DEA) 449.2 188 158a or 158b [01193]embedded image (S)-or (R)- N′-((4-cyano-2,6- diisopropylphenyl)carbamoyl)-3- (hydroxymethyl)-4-(2- hydroxypropan-2- yl)benzenesulfonimidamide ChiralPak ID, 2*25 cm, 5 um 30% EtOH in Hex (0.1% DEA) 473.2 189 158b or 158a [01194]embedded image (R)-or (S)- N′-((4-cyano-2,6- diisopropylphenyl)carbamoyl)-3- (hydroxymethyl)-4-(2- hydroxypropan-2- yl)benzenesulfonimidamide ChiralPak ID, 2*25 cm, 5 um 30% EtOH in Hex (0.1% DEA) 473.2 190 220a or 220b [01195]embedded image (S)-or (R)- N′-((8-cyano-1,2,3,5,6,7-hexahydro- s-indacen-4-yl)carbamoyl)-4- (hydroxymethyl)-2-(2- hydroxypropan-2-yl)thiazole-5- sulfonimidamide ChiralPak IF, 2*25 cm, 5 um MeOH (0.1% DEA) 476.1 191 220b or 220a [01196]embedded image (R)-or (S)- N′-((8-cyano-1,2,3,5,6,7-hexahydro- s-indacen-4-yl)carbamoyl)-4- (hydroxymethyl)-2-(2- hydroxypropan-2-yl)thiazole-5- sulfonimidamide ChiralPak IF, 2*25 cm, 5 um MeOH (0.1% DEA) 476.1 192 157a or 157b [01197]embedded image (S)-or (R)- N′-((4-cyano-2,6- diisopropylphenyl)carbamoyl)-4- (hydroxymethyl)-2-(2- hydroxypropan-2-yl)thiazole-5- sulfonimidamide ChiralPak IC, 2*25 cm, 5 um 15% EtOH in Hex 480.2 193 157b or 157a [01198]embedded image (R)-or (S)- N′-((4-cyano-2,6- diisopropylphenyl)carbamoyl)-4- (hydroxymethyl)-2-(2- hydroxypropan-2-yl)thiazole-5- sulfonimidamide ChiralPak IC, 2*25 cm, 5 um 15% EtOH in Hex 480.2 194 161a or 161b [01199]embedded image (S)-or (R)- N′-((4-cyano-3-fluoro-2,6- diisopropylphenyl)carbamoyl)-4- (hydroxymethyl)-2-(2- hydroxypropan-2-yl)thiazole-5- sulfonimidamide ChiralPak IC, 2*25 cm, 5 um 15% EtOH in Hex 498.2 195 161b or 161a [01200]embedded image (R)-or (S)- N′-((4-cyano-3-fluoro-2,6- diisopropylphenyl)carbamoyl)-4- (hydroxymethyl)-2-(2- hydroxypropan-2-yl)thiazole-5- sulfonimidamide ChiralPak IC, 2*25 cm, 5 um 15% EtOH in Hex 498.2 196 165a or 165b [01201]embedded image (S)-or (R)- N′-((4-cyano-2,6- diisopropylphenyl)carbamoyl)-4- (methylsulfonyl)benzene- sulfonimidamide ChiralPak IG, 2*25 cm, 5 um 30% EtOH in Hex (0.1% DEA) 463.1 197 165b or 165a [01202]embedded image (R)-or (S)- N′-((4-cyano-2,6- diisopropylphenyl)carbamoyl)-4- (methylsulfonyl)benzene- sulfonimidamide ChiralPak IG, 2*25 cm, 5 um 30% EtOH in Hex (0.1% DEA) 463.1 198 172a or 172b [01203]embedded image N′-((4-cyano-2,6- diisopropylphenyl)carbamoyl)-3,5- bis(2-hydroxypropan-2- yl)benzenesulfonimidamide ChiralPak IC, 2*25 cm, 5 um 15% EtOH in Hex (0.1% DEA) 501.2 199 172b or 172a [01204]embedded image N′-((4-cyano-2,6- diisopropylphenyl)carbamoyl)-3,5- bis(2-hydroxypropan-2- yl)benzenesulfonimidamide ChiralPak IC, 2*25 cm, 5 um 15% EtOH in Hex (0.1% DEA) 501.2 200 106a or 106b [01205]embedded image (R)-or (S)- N′-(8-fluoro-1,2,3,5,6,7-hexahydro- s-indacen-4-ylcarbamoyl)-2-(2- hydroxypropan-2-yl)thiazole-5- sulfonimidamide ChiralPak AD-H, 2*25 cm, 5 um 25% EtOH in CO2 439.2 201 106b or 106a [01206]embedded image (S)-or (R)- N′-(8-fluoro-1,2,3,5,6,7-hexahydro- s-indacen-4-ylcarbamoyl)-2-(2- hydroxypropan-2-yl)thiazole-5- sulfonimidamide ChiralPak AD-H, 2*25 cm, 5 um 25% EtOH in CO.sub.2 439.2 202 136a or 136b [01207]embedded image (S)-or (R)- N′-(1,2,3,5,6,7-hexahydro-s-indacen- 4-ylcarbamoyl)-4-(2-hydroxypropan- 2-yl)furan-2-sulfonimidamide Chiral ART Cellulose- SB, 2*25 cm, 5 um 20% EtOH in Hex (0.2% DEA) 404.2 203 136b or 136a [01208]embedded image (R)-or (S)- N′-(1,2,3,5,6,7-hexahydro-s-indacen- 4-ylcarbamoyl)-4-(2-hydroxypropan- 2-yl)furan-2-sulfonimidamide Chiral ART Cellulose- SB, 2*25 cm, 5 um 20% EtOH in Hex (0.2% DEA) 404.2 204 183a or 183b [01209]embedded image (R)-or (S)- N′-(1,2,3,5,6,7-hexahydro-s-indacen- 4-ylcarbamoyl)-4-(2-hydroxypropan- 2-yl)thiophene-2-sulfonimidamide ChiralPak ID, 2*25 cm, 5 um 20% EtOH in Hex (0.1% DEA) 418.1 (M − 1) 205 183a or 183b [01210]embedded image (S)-or (R)- N'-(1,2,3,5,6,7-hexahydro-s-indacen- 4-ylcarbamoyl)-4-(2-hydroxypropan- 2-yl)thiophene-2-sulfonimidamide ChiralPak ID, 2*25 cm, 5 um 20% EtOH in Hex (0.1% DEA) 418.1 (M − 1) 206 176a or 176b [01211]embedded image (S)-or (R)- N′-(8-fluoro-1,2,3,5,6,7-hexahydro- s-indacen-4-ylcarbamoyl)-4-(2- hydroxypropan-2-yl)thiophene-2- sulfonimidamide ChiralPak IG, 2*25 cm, 5 um 30% EtOH in Hex 438.2 207 176b or 176a [01212]embedded image (R)-or (S)- N′-(8-fluoro-1,2,3,5,6,7-hexahydro- s-indacen-4-ylcarbamoyl)-4-(2- hydroxypropan-2-yl)thiophene-2- sulfonimidamide ChiralPak IG, 2*25 cm, 5 um 30% EtOH in Hex 438.2

    Example 77

    [3996] MS-ESI: 421.1 (M+1). .sup.1H NMR (400 MHz, DMSO-d.sub.6) δ 8.41 (br s, 1H), 7.74 (br s, 2H), 7.68 (s, 1H), 6.87 (s, 1H), 5.36 (s, 1H), 3.02-2.50 (m, 8H), 2.10-1.80 (m, 4H), 1.48 (s, 6H).

    Example 200

    [3997] MS-ESI: 439.2 (M+1). 1H NMR (400 MHz, DMSO-d.sub.6) δ 8.38 (br, 1H), 8.02 (s, 1H), 7.75 (br, 1H), 6.27 (s, 1H), 2.81 (t, J=7.6 Hz, 4H), 2.70 (t, J=6.8 Hz, 4H), 2.02-1.95 (m, 4H), 1.50 (s, 6H).

    Example 203

    [3998] MS-ESI: 404.2 (M+1). .sup.1H NMR (300 MHz, DMSO-d.sub.6) δ 8.42 (br s, 1H), 7.76 (s, 1H), 7.72 (s, 2H), 7.01 (s, 1H), 6.88 (s, 1H), 5.11 (s, 1H), 2.90-2.72 (m, 4H), 2.72-2.60 (m, 4H), 2.10-1.80 (m, 4H), 1.46 (s, 6H).

    Example 205

    [3999] MS-ESI: 418.1 (M−1). .sup.1H NMR (400 MHz, DMSO-d.sub.6) δ 8.39 (br s, 1H), 7.68 (s, 2H), 7.63 (s, 1H), 7.59 (s, 1H), 6.88 (s, 1H), 5.23 (s, 1H), 2.95-2.75 (m, 4H), 2.75-2.60 (m, 4H), 2.05-1.80 (m, 4H), 1.43 (s, 6H).

    Example 206

    [4000] MS-ESI: 438.2 (M+1). .sup.1H NMR (300 MHz, DMSO-d.sub.6) δ 8.41 (br s, 1H), 7.65 (s, 2H), 7.59 (s, 1H), 7.55 (s, 1H), 5.20 (s, 1H), 2.90-2.60 (m, 8H), 2.10-1.80 (m, 4H), 1.39 (s, 6H).

    Example 208 (Compound 221)

    [4001] ##STR01213##

    4,5-Dichloro-N′-((4-fluoro-2,6-diisopropylphenyl)carbamoyl)thiophene-2-sulfonimidamide

    [4002] ##STR01214##

    Step 1: N-(tert-butyldimethylsilyl)-4,5-dichlorothiophene-2-sulfonamide

    [4003] 4,5-Dichlorothiophene-2-sulfonamide (50 mg, 0.22 mmol) was dissolved in anhydrous CH.sub.2C.sub.12 (2 mL). Triethylamine (0.090 mL, 0.65 mmol) and TBSCl (38 mg, 0.25 mmol) were added and the resulting mixture was stirred overnight at room temperature, or until the reaction was complete as indicated by LCMS (Method F: m/Z=424.1 [M+DMSO+H].sup.+, retention time=3.70 min). The reaction mixture was used in the next step as is.

    Step 2: N-(tert-butyldimethylsilyl)-4,5-dichlorothiophene-2-sulfonimidamide

    [4004] In an oven-dried vial under nitrogen, a solution of PPh.sub.3Cl.sub.2 (143 mg, 0.44 mmol) was prepared in dichloroethane (1.5 mL). Triethylamine (0.120 mL, 0.86 mmol) was introduced in a steady stream via syringe at 0° C. The reaction mixture was stirred at room temperature for 10 min. The reaction mixture was then cooled in an ice/water bath for 2 min and the reaction mixture of TBS protected sulfonamide (prepared in 2 mL DCM) from step 1 was introduced via syringe rapidly drop by drop (addition time <30 seconds). The resulting mixture was stirred at 0° C. for 30 min, at which time anhydrous ammonia was bubbled into the reaction mixture for 45 seconds. The suspension thus formed was stirred in an ice/water bath for 30 min and then warmed to room temperature and centrifuged to remove solids. The supernatant was concentrated in vacuo and dried under high vacuum for 30 min.

    Step 3: 4,5-Dichloro-N′-((4-fluoro-2,6-diisopropylphenyl)carbamoyl)thiophene-2-sulfonimidamide and N-(tert-butyldimethylsilyl)-4,5-dichloro-N′-((4-fluoro-2,6-diisopropyl phenyl)carbamoyl)thiophene-2-sulfonimidamide

    [4005] To the crude reaction mixture from step 2 was added anhydrous THF (1.5 mL) and the resulting solution was stirred in an ice/water bath for 5 min, at which time NaH (17 mg, 0.44 mmol) was added. After 2 min stirring, a solution of 5-fluoro-2-isocyanato-1,3-diisopropylbenzene (36.5 mg, 0.165 mmol) in THF (3 ml) was added dropwise at 0° C. The resulting mixture was brought to room temperature and stirred for 30 min to give a mixture of crude products. LC-MS (Method F): m/Z=451.8 [M+H].sup.+, retention time=6.18 min; for TBS-protected product, 566.4 [M+H].sup.+, retention time=9.25 min.

    Step 4: 4,5-Dichloro-N′-((4-fluoro-2,6-diisopropylphenyl)carbamoyl)thiophene-2-sulfonimidamide

    [4006] To the reaction mixture from step 3 was carefully added 4N HCl in dioxane (0.3 mL) and the resulting mixture was stirred at room temperature for approximately 30 min until the completion of reaction, as determined by LCMS analysis (Method F: 451.8 [M+H].sup.+, retention time=6.18 min). The reaction mixture was then concentrated in vacuo. DMSO (0.5 mL) was added to the residue and the resulting solution was purified on a prep-HPLC to afford the title compound. LC-MS: 451 [M+H].sup.+.

    TABLE-US-00029 TABLE 20 Examples in the following table were prepared using similar procedures as described in Example 208 above starting from appropriate sulfonamides. Example Final Target Exact Mass # Number Structure IUPAC Name [M + H].sup.+ 209 219 [01215]embedded image N′-((4-fluoro-2,6- diisopropylphenyl)carbamoyl)- 1,3-dimethyl-1H-pyrazole-4- sulfonimidamide 396.05 210 217 [01216]embedded image N′-((4-fluoro-2,6- diisopropylphenyl)carbamoyl) naphthalene-2-sulfonimidamide 428.17 211 216 [01217]embedded image N′-((4-fluoro-2,6- diisopropylphenyl)carbamoyl)- 2,3-dihydrobenzofuran-5- sulfonimidamide 420.07 212 215 [01218]embedded image N′-((4-fluoro-2,6- diisopropylphenyl)carbamoyl)- [1,1′-biphenyl]-2-sulfonimidamide 454.28 213 218 [01219]embedded image N′-((4-fluoro-2,6- diisopropylphenyl)carbamoyl)- 2-(methoxymethyl) benzenesulfonimidamide 422.17 214 214 [01220]embedded image 2,5-dichloro-N′-((4-fluoro-2,6- diisopropylphenyl) carbamoyl)thiophene-3- sulfonimidamide 452.18 215 211 [01221]embedded image N′-((4-fluoro-2,6- diisopropylphenyl) carbamoyl)pyridine-3- sulfonimidamide 379.24 216 210 [01222]embedded image N′-((4-fluoro-2,6- diisopropylphenyl)carbamoyl) benzo[d][1,3]dioxole-5- sulfonimidamide 422.17 217 201 [01223]embedded image N′-((4-fluoro-2,6- diisopropylphenyl) carbamoyl)-2,5-dimethylfuran-3- sulfonimidamide 396.40 218 200 [01224]embedded image N′-((4-fluoro-2,6- diisopropylphenyl) carbamoyl)quinoline-3- sulfonimidamide 429.40 219 199 [01225]embedded image N′-((4-fluoro-2,6- diisopropylphenyl)carbamoyl)- 6,7-dihydro-5H-pyrrolo[1,2- a]imidazole-3-sulfonimidamide 408.40 220 198 [01226]embedded image N′-((4-fluoro-2,6- diisopropylphenyl)carbamoyl)- 5-methylpyridine-2- sulfonimidamide 393.40

    Example 221 (Compound 141)

    [4007] ##STR01227##

    N′-((1,2,3,5,6,7-hexahydrodicyclopenta[b,e]pyridin-8-yl)carbamoyl)-4-(2-hydroxypropan-2-yl)-5-methylfuran-2-sulfonimidamide (Scheme 31)

    [4008] ##STR01228##

    Step 1: Phenyl (1,2,3,5,6,7-hexahydrodicyclopenta[b,e]pyridin-8-yl)carbamate

    [4009] Into a 50-mL 3-necked round-bottom flask purged and maintained with nitrogen, was placed 1,2,3,5,6,7-hexahydrodicyclopenta[b,e]pyridin-8-amine (50 mg, 0.29 mmol) in THF (10 mL), to this was added NaH (60% wt. oil dispersion, 22.8 mg, 0.57 mmol) at 0° C.; and then phenyl chloroformate (67.4 mg, 0.43 mmol,) in THF (2.0 mL) was added dropwise at 0° C. The resulting solution was stirred for 2 h at RT. This reaction solution was used for next step directly without any purification.

    Step 2: N-(tert-butyldimethylsilyl)-N′-((1,2,3,5,6,7-hexahydrodicyclopenta[b,e]pyridin-8-yl)carbamoyl)-4-(2-hydroxypropan-2-yl)-5-methylfuran-2-sulfonimidamide

    [4010] Into a 50-mL 3-necked round-bottom flask purged and maintained with nitrogen, was placed N-(tert-butyldimethylsilyl)-4-(2-hydroxypropan-2-yl)-5-methylfuran-2-sulfonoimidamide (96 mg, 0.29 mmol) in THF (10 mL). To this was added NaH (60% wt. oil dispersion, 23.2 mg, 0.58 mmol) at 0° C., followed by phenyl (1,2,3,5,6,7-hexahydrodicyclopenta[b,e]pyridin-8-yl)carbamate (127 mg, 0.43 mmol) crude in THF from via syringe rapidly drop by drop. The resulting mixture was stirred for 16 h at RT. The reaction was then quenched by the addition of 5.0 mL of water. The resulting solution was extracted with 4×10 ml of ethyl acetate. The combined organic layers were dried over anhydrous sodium sulfate and concentrated under vacuum. The residue was eluted from a silica gel column with ethyl acetate/petroleum ether (1;1). This resulted in 50 mg (38.4%) of the title compound as an off-white solid. MS-ESI: 533 (M+1).

    Step 3: N′-((1,2,3,5,6,7-hexahydrodicyclopenta[b,e]pyridin-8-yl)carbamoyl)-4-(2-hydroxypropan-2-yl)-5-methylfuran-2-sulfonimidamide

    [4011] Into a 50-mL round-bottom flask, was placed N-(tert-butyldimethylsilyl)-N′-((1,2,3,5,6,7-hexahydrodicyclopenta[b,e]pyridin-8-yl)carbamoyl)-4-(2-hydroxypropan-2-yl)-5-methylfuran-2-sulfonimidamide (58 mg, 0.11 mmol) in THF (10 mL), to this was added TBAF (28.8 mg, 0.11 mmol). The resulting solution was stirred for 1 h at RT. The resulting mixture was concentrated under vacuum. The residue was eluted from a silica gel column with DCM/MeOH (10:1). The crude product was further purified by Prep-HPLC with the following conditions: Column: XBridge Prep OBD C18 Column 19*250 mm, 5 um; Mobile Phase A: water (10 mM NH.sub.4HCO.sub.3), Mobile Phase B: ACN; Flow rate: 25 mL/min; Gradient: 11% B to 40% B in 7 min; UV 254/210 nm; Rt: 6 min. This resulted in 25 mg (54.87%) of Example 221 as a white solid. MS-ESI: 419 (M+1). .sup.1H NMR (400 MHz, DMSO-d.sub.6, ppm) δ: 8.82 (s, 1H), 7.65 (s, 2H), 6.90 (s, 1H), 5.03 (s, 1H), 2.82-2.78 (m, 4H), 2.76-2.67 (m, 4H), 2.41 (s, 3H), 2.00-1.92 (m, 4H), 1.39 (s, 6H).

    TABLE-US-00030 TABLE 21 Examples in the following table were prepared using similar conditions as described in Example 221 and Scheme 31 from appropriate starting materials. Exact Example Final Target Mass # Number Structure IUPAC Name [M + H].sup.+ 222 140 [01229]embedded image N′-((3,5-diisopropylpyridin-4- yl)carbamoyl)-4-(2- hydroxypropan-2-yl)-5- methylfuran-2-sulfonimidamide 423

    Example 223 (Compound 321)

    [4012] ##STR01230##

    2-(2-Hydroxypropan-2-yl)-N′-((2,4,5,6-tetrahydro-1H-cyclobuta[f]inden-3-yl)carbamoyl)thiazole-5-sulfonimidamide (Scheme 3A)

    Examples 224 and 225 (Compound 321b and 321a)

    [4013] ##STR01231##

    (R)- and (S)-2-(2-hydroxypropan-2-yl)-N′-((2,4,5,6-tetrahydro-1H-cyclobuta[f]inden-3-yl)carbamoyl)thiazole-5-sulfonimidamide

    Route 1:

    [4014] ##STR01232##

    Step 1: Tert-butyl(2-(2-hydroxypropan-2-yl)-N-((2,4,5,6-tetrahydro-1H-cyclobuta[f]inden-3-yl) carbamoyl)thiazole-5-sulfonimidoyl)carbamate

    [4015] Into a 100-mL round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed tert-butyl N-[amino[2-(2-hydroxypropan-2-yl)-1,3-thiazol-5-yl]oxo-λ.sup.6-sulfanylidene]carbamate (1.39 g, 4.32 mmol) in THF (50 mL). To this solution was added NaH (60% wt. oil dispersion, 518 mg, 13 mmol) at 0° C., followed by the addition of 3-isocyanato-2,4,5,6-tetrahydro-1H-cyclobuta[f]indene (800 mg, 4.32 mmol) in THF (5.0 mL) dropwise at 0° C. The resulting solution was stirred for 14 h at RT. The reaction was then quenched by the addition of 100 mL of water. The resulting solution was extracted with 3×50 mL of DCM. The organic layers combined and dried over anhydrous Na.sub.2SO.sub.4, then concentrated. The residue was eluted from a silica gel column with ethyl acetate/petroleum ether (1:5 to 1:1). This resulted in 2.0 g (91%) of title compound as a light yellow solid. MS-ESI: 507 (M+1).

    Step 2: 2-(2-Hydroxypropan-2-yl)-N′-((2,4,5,6-tetrahydro-1H-cyclobuta[f]inden-3-yl)carbamoyl) thiazole-5-sulfonimidamide

    [4016] Into a 100-mL round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed tert-butyl(2-(2-hydroxypropan-2-yl)-N-((2,4,5,6-tetrahydro-1H-cyclobuta[f]inden-3-yl)carbamoyl) thiazole-5-sulfonimidoyl)carbamate (2.2 g, 4.34 mmol) in dioxane (40 mL). To this was added conc. HCl (8 mL, 12 M) dropwise at 0° C. The resulting solution was stirred for 14 h at RT. The resulting solution was diluted with 100 mL of water. The resulting solution was extracted with 3×50 mL of DCM. The organic layers combined and dried over anhydrous Na.sub.2SO.sub.4, then concentrated. The crude product was purified by HP-Flash with the following conditions: Column, C18 silica gel; mobile phase, ACN:H.sub.2O=25:75 increasing to ACN:H.sub.2O=55:45 within 25; Detector, UV 254 nm. This resulted in 1.5 g (85%) of Example 223. MS-ESI: 407 (M+1). .sup.1H NMR (300 MHz, DMSO-d.sub.6) δ 8.35 (s, 1H), 8.05 (s, 1H), 7.74 (s, 2H), 6.66 (s, 1H), 6.25 (s, 1H), 3.06-2.94 (m, 2H), 2.93-2.84 (m, 2H), 2.82-2.60 (m, 4H), 2.03-1.79 (m, 2H), 1.50 (s, 6H).

    Step 3: Chiral Resolution

    [4017] Example 223 (1.5 g) was separated with the followed condition: Column: CHIRALPAK IG, 20*250 mm, 5 um; Mobile Phase A: CO.sub.2: 60, Mobile Phase B: MeOH—Preparative: 40; Flow rate: 50 mL/min; 220 nm. The resulting solution was stirred for 20 min at 10° C. This resulted in 546 mg (99% ee, 36.4%) of Example 224 (RT.sub.1: 3.47 min) as a white solid and 595 mg (99% ee, 39.6%) of Example 225 (RT.sub.2: 5.35 min) as a white solid. The absolute stereochemistry was tentatively assigned.

    Example 224

    [4018] MS-ESI: 407.1 (M+1). .sup.1H NMR (300 MHz, DMSO-d.sub.6) δ 8.35 (s, 1H), 8.05 (s, 1H), 7.74 (s, 2H), 6.66 (s, 1H), 6.25 (s, 1H), 3.06-2.94 (m, 2H), 2.93-2.84 (m, 2H), 2.82-2.60 (m, 4H), 2.03-1.79 (m, 2H), 1.50 (s, 6H).

    Example 225

    [4019] MS-ESI: 407.1 (M+1). .sup.1H NMR (300 MHz, DMSO-d.sub.6) δ 8.35 (s, 1H), 8.05 (s, 1H), 7.74 (s, 2H), 6.66 (s, 1H), 6.25 (s, 1H), 3.06-2.94 (m, 2H), 2.93-2.84 (m, 2H), 2.82-2.60 (m, 4H), 2.03-1.79 (m, 2H), 1.50 (s, 6H).

    Route 2:

    [4020] ##STR01233##

    Step 1: Chiral resolution (R) and (S)-tert-butyl(amino(2-(2-hydroxypropan-2-yl)thiazol-5-yl)(oxo)-λ.SUP.6.-sulfaneylidene)carbamate

    [4021] The product 10 g of Intermediate 28 was separated with the followed condition: Column: CHIRALPAK IC, 5*25 cm, 5 um; Mobile Phase A:CO.sub.2:55, Mobile Phase B: EtOH:HeX=1:1:45; Flow rate: 150 mL/min; UV 220 nm; 5.13 (Intermediate 28A); Rte: 5.65 (Intermediate 28B). This resulted in 3 g (99.5% ee, 60%) of 28A, and 3 g (99.0% ee, 60%) of 28B.

    Step 2: Tert-butyl (R)-(2-(2-hydroxypropan-2-yl)-N-((2,4,5,6-tetrahydro-1H-cyclobuta[f]inden-3-yl) carbamoyl)thiazole-5-sulfonimidoyl)carbamate

    [4022] Into a 100-mL round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed intermediate 28A (>99% ee, 1.67 g, 5.20 mmol) in THF (50 mL), NaH (60% wt. oil dispersion, 624 mg, 15.6 mmol) was added at 0° C., this was followed by the addition of 3-isocyanato-2,4,5,6-tetrahydro-1H-cyclobuta[f]indene (850 mg, crude) in THF (5 mL) dropwise at 0° C. The resulting solution was stirred for 14 h at RT. The reaction was then quenched by the addition of 100 mL of water. The resulting solution was extracted with 3×100 mL of DCM. The organic layers combined and dried over anhydrous Na.sub.2SO.sub.4, then concentrated. This resulted in 2.2 g (83.5%) of title compound as a light yellow solid. MS-ESI: 507 (M+1).

    Step 3: (R)-2-(2-hydroxypropan-2-yl)-N′-((2,4,5,6-tetrahydro-1H-cyclobuta[f]inden-3-yl)carbamoyl) thiazole-5-sulfonimidamide

    [4023] Into a 100-mL round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed tert-butyl (S)-(2-(2-hydroxypropan-2-yl)-N-((2,4,5,6-tetrahydro-1H-cyclobuta[f]inden-3-yl)carbamoyl) thiazole-5-sulfonimidoyl)carbamate (2.2 g, 4.34 mmol) in dioxane (40 mL), to this was added conc. HCl (8 mL, 12M) dropwise at 0° C. The resulting solution was stirred for 8 h below 10° C. The resulting solution was diluted with 100 mL of water. The resulting solution was extracted with 3×100 mL of DCM. The organic layers combined and dried over anhydrous Na.sub.2SO.sub.4, then concentrated. The crude product was purified by HP-Flash with the following conditions: Column, C18 silica gel; mobile phase, MeCN:water=25:75 increasing to MeCN:water=55:45 within 30 min; Detector, UV 210 nm. This resulted in 1.37 g (77.3%) of Example 224 (99.4% ee) as a white solid. MS-ESI: 407 (M+1).

    [4024] .sup.1H NMR (300 MHz, DMSO-d.sub.6) δ 8.43 (s, 1H), 8.09 (s, 1H), 7.90 (s, 2H), 6.67 (s, 1H), 6.29 (s, 1H), 2.92 (d, J=3.9 Hz, 2H), 2.89 (d, J=3.9 Hz, 2H), 2.90-2.55 (m, 4H), 2.00-1.75 (m, 6H), 1.50 (s, 6H).

    TABLE-US-00031 TABLE 22 Examples in the following table were prepared using similar conditions as described in Example 223-Route 1 and Scheme 3A from appropriate starting materials. Final Exact Example Target Mass # # Structure IUPAC Name [M + H].sup.+ 226 329 [01234]embedded image 2-(2-Hydroxypropan-2-yl)-N′- (tricyclo[6.2.0.03,6]deca-1,3(6),7- trien-2-ylcarbamoyl)thiazole-5- sulfonimidamide 393 227 375 [01235]embedded image N′-((1,2,3,5,6,7-hexahydro-s- indacen-4-yl-3,3,5,5- d.sub.4)carbamoyl)-2-(2- hydroxypropan-2-yl)thiazole-5- sulfonimidamide 425 228 376 [01236]embedded image N′-((1,2,3,5,6,7-hexahydro-s- indacen-4-yl-1,1,7,7- d.sub.4)carbamoyl)-2-(2- hydroxypropan-2-yl)thiazole-5- sulfonimidamide 425

    Example 229 (Compound 307)

    [4025] ##STR01237##

    2-Fluoro-N′-((8-fluoro-1,2,3,5,6,7-hexahydro-s-indacen-4-yl)carbamoyl)-4-hydroxybenzenesulfonimidamide (Scheme 3B)

    [4026] ##STR01238##

    Step 1: N-(tert-butyldimethylsilyl)-2-fluoro-N′-(8-fluoro-1,2,3,5,6,7-hexahydro-s-indacen-4-ylcarbamoyl)-4-methoxybenzenesulfonimidamide

    [4027] Into a 50-mL round-bottom flask, was placed a solution of N-(tert-butyldimethylsilyl)-2-fluoro-4-methoxybenzene-1-sulfonoimidamide (139 mg, 0.44 mmol) in THF (5.0 mL). To this solution was added NaH (60% wt. oil dispersion, 35.2 mg, 0.44 mmol) at 0° C. This was followed by the addition of 4-fluoro-8-isocyanato-1,2,3,5,6,7-hexahydro-s-indacene (95 mg, 0.44 mmol) in THF (5 mL) dropwise at RT. The resulting solution was stirred for 1 h at RT. The reaction was then quenched by the addition of 100 mL of water. The resulting solution was extracted with 3×50 mL of ethyl acetate. The organic layers combined and dried over anhydrous Na.sub.2SO.sub.4, and then concentrated. The residue was eluted from a silica gel column with ethyl acetate/petroleum ether (1:5 to 1:1). This resulted in 120 mg (51.2%) of the title compound as yellow oil. MS-ESI: 536 (M+1).

    Step 2: 2-Fluoro-N′-(8-fluoro-1,2,3,5,6,7-hexahydro-s-indacen-4-ylcarbamoyl)-4-hydroxybenzenesulfonimidamide

    [4028] Into a 50-mL round-bottom flask, was placed a solution of 1-[[(tert-butyldimethylsilyl)imino](2-fluoro-4-methoxybenzene)sulfinyl]-3-(8-fluoro-1,2,3,5,6,7-hexahydro-s-indacen-4-yl)urea (120 mg, 0.22 mmol) in ACN (5.0 mL), to this solution was added BBr.sub.3 (561 mg, 2.24 mmol) dropwise at 0° C. The resulting solution was stirred for 2 h at RT. The reaction was then quenched by the addition of 5 mL of MeOH. The resulting mixture was concentrated. The crude product (100 mg) was purified by Prep-HPLC under the following conditions: Column, XBridge Prep OBD C18, 19*250 mm, 5 um; mobile phase: water (10 mM NH.sub.4HCO.sub.3) and ACN (25% to 43% ACN gradient in 7 min); Detector, UV. This resulted in 17.7 mg (19.4%) of Example 229 as a white solid. MS-ESI: 408 (M+1).

    Example 230 (Compound 323)

    [4029] ##STR01239##

    N′((1-hydroxy-1,2,3,5,6,7-hexahydro-s-indacen-4-yl)carbamoyl)-2-(2-hydroxypropan-2-yl)thiazole-5-sulfonimidamide (Scheme 32)

    [4030] ##STR01240##

    [4031] Into a 50-mL round-bottom flask, was placed 2-(2-hydroxypropan-2-yl)-N′-((1-oxo-1,2,3,5,6,7-hexahydro-s-indacen-4-yl)carbamoyl)thiazole-5-sulfonimidamide (100 mg, 0.23 mmol) in ethanol (10 mL). To this solution was added NaBH.sub.4 (17.4 mg, 0.46 mmol) in portions at 0° C. The resulting solution was stirred for 2 h at RT. The crude product (5 mL) was purified by Flash-Prep-HPLC with the following conditions: Column: XBridge Prep OBD C18 Column 30×150 mm 5 um; Mobile Phase A: water (10 mM NH.sub.4HCO.sub.3), Mobile Phase B: ACN; Flow rate: 60 mL/min; Gradient: 10% to 28% B in 7 min; 210/254 nm; Rt: 6.00 min. This resulted in 180 mg of the title compound (Example 230) as a solid. MS-ESI: 437.1 (M+1).

    [4032] .sup.1H NMR (400 MHz, DMSO-d.sub.6) δ 8.51 (br s, 1H), 8.04 (s, 1H), 7.82 (br s, 2H), 6.97 (s, 1H), 6.28 (s, 1H), 5.07 (d, J=5.6 Hz, 1H), 5.05-4.85 (m, 1H), 2.95-2.75 (m, 2H), 2.75-50 (m, 4H), 2.35-2.15 (m, 1H), 2.00-1.80 (m, 2H), 1.80-1.60 (m, 1H), 1.51 (s, 6H).

    Example 231 (Compound 338)

    [4033] ##STR01241##

    N′-((1,2,3,5,6,7-hexahydro-s-indacen-4-yl)carbamoyl)-4-((3-methoxyazetidin-1-yl)methyl)benzenesulfonimidamide (Scheme 33A)

    [4034] ##STR01242##

    [4035] Into a 50-mL round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed 1-[amino[4-(bromomethyl)phenyl]oxo-λ.sup.6-sulfanylidene]-3-(1,2,3,5,6,7-hexahydro-s-indacen-4-yl)urea (50 mg, 0.11 mmol) in THF (5 mL). To this solution was added DIEA (28.4 mg, 0.22 mmol) and 3-methoxyazetidine (10.5 mg, 0.12 mmol) at RT. The resulting solution was stirred for 1 h at 65° C. The resulting mixture was concentrated. The crude product was purified by Prep-HPLC with the following conditions: Column: XBridge Prep C18 OBD Column 19×100 mm 5 um 13 nm; Mobile Phase A: water (10 mM NH.sub.4HCO.sub.3 mM+0.1% NH.sub.3.H.sub.2O), Mobile Phase B: ACN; Flow rate: 25 mL/min; Gradient: 30% to 37% B in 9.5 min; 254/210 nm; Rt: 9.62 min. This resulted in 5 mg of Example 231 as a white solid. MS-ESI: 455 (M+1). .sup.1H NMR (300 MHz, DMSO-d.sub.6) δ: 8.27 (br s, 1H), 7.81 (d, J=8.4 Hz, 2H), 7.45 (d, J=8.4 Hz, 2H), 7.34 (s, 2H), 6.85 (s, 1H), 4.02-3.94 (m, 1H), 3.67 (s, 2H), 3.51-3.46 (m, 2H), 3.14 (s, 3H), 2.95-2.80 (m, 2H), 2.78-2.73 (m, 4H), 2.69-2.63 (m, 4H), 1.96-1.88 (m, 4H).

    TABLE-US-00032 TABLE 23 Examples in the following table were prepared using similar conditions as described in Example 231 and Scheme 33A from appropriate starting materials. Final Exact Example Target Mass # # Structure IUPAC Name [M + H].sup.+ 232 341 [01243]embedded image N′-(1,2,3,5,6,7-hexahydro-A- indacen-4-ylcarbamoyl)-4-(((2- methoxyethyl)(methyl)amino) methyl)benzenesulfonimidamide 457 233 342 [01244]embedded image N′-(1,2,3,5,6,7-hexahydro-s- indacen-4-ylcarbamoyl)-4- (hydroxymethyl)benzene- sulfonimidamide 386 234 345 [01245]embedded image N′-(1,2,3,5,6,7-hexahydro-s- indacen-4-ylcarbamoyl)-4- (morpholinomethyl)benzene- sulfonimidamide 455 235 346 [01246]embedded image 4-((3,3-Difluoropyrrolidin-1- yl)methyl)-N′-(1,2,3,5,6,7- hexahydro-s-indacen-4- ylcarbamoyl)benzene- sulfonimidamide 475 236 347 [01247]embedded image N′-(1,2,3,5,6,7-hexahydro-s- indacen-4-ylcarbamoyl)-4- (pyrrolidin-1-ylmethyl) benzenesulfonimidamide 439 237 348 [01248]embedded image 4-(Azetidin-1-ylmethyl)-N′- (1,2,3,5,6,7-hexahydro-s-indacen- 4-ylcarbamoyl)benzene- sulfonimidamide 425 238 403 [01249]embedded image 4-((Allyl(methyl)amino)methyl)- N′-(1,2,3,5,6,7-hexahydro-s- indacen-4-ylcarbamoyl)benzene- sulfonimidamide 439 239 402 [01250]embedded image N′-(1,2,3,5,6,7-hexahydro-s- indacen-4-ylcarbamoyl)-4- ((methyl(prop-2-ynyl)amino) methyl)benzenesulfonimidamide 437 240 350 [01251]embedded image 4- (((Cyclopropylmethyl)(methyl) amino)methyl)-N′-(1,2,3,5,6,7- hexahydro-s-indacen-4- ylcarbamoyl)benzene- sulfonimidamide 453 241 322 [01252]embedded image 4-(((2,2- Difluoroethyl)(methyl)amino) methyl)-N′-(1,2,3,5,6,7-hexahydro- s-indacen-4-ylcarbamoyl) benzenesulfonimidamide 463 242 351 [01253]embedded image N′-(1,2,3,5,6,7-hexahydro-s- indacen-4-ylcarbamoyl)-4- (methoxymethyl)benzene- sulfonimidamide 400 243 358 [01254]embedded image 4-(Aminomethyl)-N′-(1,2,3,5,6,7- hexahydro-s-indacen-4- ylcarbamoyl)benzene- sulfonimidamide 385

    Example 244 (Compound 401)

    [4036] ##STR01255##

    N′-((1,2,3,5,6,7-hexahydro-s-indacen-4-yl)carbamoyl)-4-((2-oxopyrrolidin-1-yl)methyl)benzenesulfonimidamide (Scheme 33B)

    [4037] ##STR01256##

    [4038] Into a 40-mL sealed tube purged and maintained with an inert atmosphere of nitrogen, was placed 1-[amino[4-(bromomethyl)phenyl]oxo-λ.sup.6-sulfanylidene]-3-(1,2,3,5,6,7-hexahydro-s-indacen-4-yl)urea (200 mg, 0.45 mmol) in THF (10 mL), to this stirred solution was added DIEA (173 mg, 1.34 mmol) and pyrrolidin-2-one (114 mg, 1.34 mmol) at RT. The resulting solution was stirred for 3 h at 60° C. The resulting mixture was concentrated. The crude product was purified by Prep-HPLC with the following conditions: Column, XBridge Prep OBD C18, 30×150 mm 5 um; mobile phase, water (10 mM NH.sub.4HCO.sub.3) and ACN (25% to 44% ACN gradient in 7 min); Detector, UV. This resulted in 10 mg (4.95%) of Example 244 as a white solid. MS-ESI: 453 (M+1).

    [4039] .sup.1H NMR (400 MHz, DMSO-d.sub.6) δ: 8.26 (br s, 1H), 7.83 (d, J=8.0 Hz, 2H), 7.40 (d, J=8.0 Hz, 2H), 7.27 (br s, 2H), 6.85 (s, 1H), 4.43 (s, 2H), 3.26-3.22 (m, 2H), 2.78-2.74 (m, 4H), 2.65-2.61 (m, 4H), 2.30 (t, J=8.20 Hz, 2H), 1.98-1.89 (m, 6H).

    Example 245 (Compound 404)

    [4040] ##STR01257##

    N′-((1,2,3,5,6,7-hexahydro-s-indacen-4-yl)carbamoyl)-4-(2-hydroxypropan-2-yl)-N,N-dimethylthiophene-2-sulfonimidamide (Scheme 4A)

    [4041] ##STR01258##

    [4042] Into a 50-mL 3-necked round-bottom flask, was placed a solution of 4-(2-hydroxypropan-2-yl)-N,N-dimethylthiophene-2-sulfonoimidamide (125 mg, 0.50 mmol) in THF (2.0 mL). To this was added NaH (60% wt. oil dispersion, 30.2 mg, 0.75 mmol) in several batches at 0° C. in an ice/water bath. To the mixture was added 4-isocyanato-1,2,3,5,6,7-hexahydro-s-indacene (110 mg, 0.55 mmol) at 0° C. in an ice/water bath. The resulting solution was stirred for 30 min at 0° C. in a water/ice bath. The reaction was then quenched by the addition of NH.sub.4Cl (aq.). The resulting solution was extracted with ethyl acetate and the organic layers combined, the organic layer was dried over anhydrous sodium sulfate and concentrated under vacuum. The crude product was purified by Prep-HPLC with the following conditions: X Bridge Prep C.sub.18 OBD, 19*150 mm 5 um; mobile phase, water (10 mM NH.sub.4HCO.sub.3) and ACN (10% to 80% in 6 min); Detector, UV 254 nm. This resulted in 90 mg (39.9%) of Example 245 as a white powder. MS-ESI: 448.2 (M+1). .sup.1H NMR (DMSO-d.sub.6, 300 MHz): δ 8.60 (br s, 1H), 7.71 (s, 1H), 7.58 (br s, 1H), 6.88 (s, 1H), 5.21 (s, 1H), 2.86-2.70 (m, 8H), 2.70 (s, 6H), 1.98-1.90 (m, 4H), 1.3 (s, 6H).

    Example 246 (Compound 331)

    [4043] ##STR01259##

    N′-((1,2,3,5,6,7-hexahydro-s-indacen-4-yl)carbamoyl)-4-(2-hydroxypropan-2-yl)-N-methylthiophene-2-sulfonimidamide (Scheme 4)

    [4044] ##STR01260##

    [4045] Into a 50-mL 3-necked round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed 4-(2-hydroxypropan-2-yl)-N-methylthiophene-2-sulfonoimidamide (106 mg, 0.45 mmol) in THF (4.0 mL). This was followed by the addition of NaH (60% wt. oil dispersion, 23.5 mg, 0.59 mmol) in several batches at 0° C. in a water/ice bath. To this was added a solution of 4-isocyanato-1,2,3,5,6,7-hexahydro-s-indacene (99.1 mg, 0.50 mmol) in THF (2.0 mL) dropwise with stirring at 0° C. The resulting solution was stirred for 30 min at 0° C. in a water/ice bath. The reaction was then quenched by the addition of water/ice. The resulting solution was extracted with ethyl acetate and the organic layers combined, the organic layer was dried over anhydrous sodium sulfate and concentrated under vacuum. The crude product was purified by Prep-HPLC with the following conditions: Column, X Bridge Shield RP18 OBD, 19×250 mm, 10 um; mobile phase, water (10 mM NH.sub.4HCO.sub.3+0.1% NH.sub.3.H.sub.2O) and ACN (43% to 67% ACN gradient in 6 min); Detector, UV 254 nm. This resulted in 80 mg (40.79%) of Example 246 as a white solid. MS-ESI: 434.15 (M+1). .sup.1H NMR (DMSO-d.sub.6, 300 MHz): δ 8.55 (br s, 1H) 7.65 (s, 1H), 7.59 (s, 1H), 7.53 (s, 1H), 6.89 (s, 1H), 5.22 (s, 1H) 2.63-2.85 (m, 8H) 2.49 (s, 3H) 2.00-1.80 (m, 4H) 1.31 (s, 6H).

    TABLE-US-00033 TABLE 24 Examples in the following table were prepared using similar conditions as described in Example 246 and Scheme 4 from appropriate starting materials. Final Exact Example Target Mass # Number Structure IUPAC Name [M + H].sup.+ 247 339 [01261]embedded image N′-((1,2,3,5,6,7-hexahydro-s- indacen-4-yl)carbamoyl)-2-(2- hydroxypropan-2-yl)-N- methylthiazole-5-sulfonimidamide 435

    Example 248 (Compound 405)

    [4046] ##STR01262##

    N′-((1,2,3,5,6,7-hexahydro-s-indacen-4-yl)(methyl)carbamoyl)-2-(2-hydroxypropan-2-yl)thiazole-5-sulfonimidamide (Scheme 34)

    [4047] ##STR01263##

    Step 1: Tert-butyl(N-((1,2,3,5,6,7-hexahydro-s-indacen-4-yl)(methyl)carbamoyl)-2-(2-hydroxypropan-2-yl)thiazole-5-sulfonimidoyl)carbamate

    [4048] Into a 50-mL round-bottom flask, was placed tert-butyl N-([[(1,2,3,5,6,7-hexahydro-s-indacen-4-yl) carbamoyl]imino][2-(2-hydroxypropan-2-yl)-1,3-thiazol-5-yl]oxo-λ.sup.6-sulfanyl)carbamate (200 mg, 0.38 mmol) in THF (10 mL), to this stirred solution was added CH.sub.3I (60 mg, 0.42 mmol) dropwise at 0° C. The resulting solution was stirred for 1 d at RT. The resulting mixture was concentrated. This resulted in 100 mg (49%) of the title compound as a solid. MS-ESI: 535 (M+1).

    Step 2: N′-((1,2,3,5,6,7-hexahydro-s-indacen-4-yl)(methyl)carbamoyl)-2-(2-hydroxypropan-2-yl) thiazole-5-sulfonimidamide

    [4049] Into a 25-mL round-bottom flask, was placed tert-butyl N-([[(1,2,3,5,6,7-hexahydro-s-indacen-4-yl) (methyl)carbamoyl]imino][2-(2-hydroxypropan-2-yl)-1,3-thiazol-5-yl]oxo-λ.sup.6-sulfanyl)carbamate (100 mg) in HCl (4M, 10 mL). The resulting solution was stirred for 5 h at RT. The crude product was purified by Prep-HPLC with the following conditions: Column, XBridge Prep C18 OBD, 5 um, 19*150 mm; mobile phase, water (10 mM NH.sub.4HCO.sub.3 mM) and ACN (22% to 53% ACN gradient in 7 min); Detector, UV. This resulted in 15.7 mg of Example 248 as a solid. MS-ESI: 435 (M+1).

    TABLE-US-00034 TABLE 25 Example 249 was isolated as a side product from the preparation of Example 248. Example Final Target Exact Mass # Number Structure IUPAC Name [M + H].sup.+ 249 406 [01264]embedded image N′-((1,2,3,5,6,7-hexahydro- s-indacen-4- yl)(methyl)carbamoyl)-2- (2-hydroxypropan-2-yl)-N- methylthiazole-5- sulfonimidamide 449

    Example 250 (Compound 324)

    [4050] ##STR01265##

    N—(N-((1,2,3,5,6,7-hexahydro-s-indacen-4-yl)carbamoyl)-2-(2-hydroxypropan-2-yl)thiazole-5-sulfonimidoyl)acetamide (Scheme 35A)

    [4051] ##STR01266##

    [4052] Into a 50-mL round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed a mixture of N-((1,2,3,5,6,7-hexahydro-s-indacen-4-yl)carbamoyl)-2-(2-hydroxypropan-2-yl)thiazole-5-sulfonimidamide (200 mg, 0.48 mmol) and TEA (96 mg, 0.96 mmol) in DCM (20 mL). To the stirred solution, AC.sub.2O (74 mg, 0.72 mmol) was added dropwise at 0° C. The resulting solution was stirred overnight. Then 80 mg of the product was obtained by Prep-HPLC with the following conditions: Column: XBridge Prep C18 OBD Column 19×150 mm 5 um; Mobile Phase A: water (10 mM NH.sub.4HCO.sub.3), Mobile Phase B: ACN; Flow rate: 25 mL/min; Gradient: 18% B to 41% B in 7 min; 254/210 nm; Rt: 5.05 min, this resulted in 100 mg of the Example 250 as a white solid. MS-ESI: 462.14 (M+1). .sup.1H NMR (300 MHz, CD.sub.3OD-d.sub.4) δ: 8.11 (s, 1H), 6.89 (s, 1H), 2.92-2.69 (m, 8H), 2.09-2.01 (m, 4H), 1.99 (s, 3H), 1.60 (d, J=2.3 Hz, 6H).

    Example 251 (Compound 407)

    [4053] ##STR01267##

    methyl 4-((4-(N′-((1,2,3,5,6,7-hexahydro-s-indacen-4-yl)carbamoyl)sulfamidimidoyl)benzyl)(methyl)amino)-4-oxobutanoate (Scheme 35)

    [4054] ##STR01268##

    [4055] Into a 8-mL round-bottom flask, was placed a solution of 1-[amino([4-[(methylamino)methyl]-phenyl])oxo-λ.sup.6-sulfanylidene]-3-(1,2,3,5,6,7-hexahydro-s-indacen-4-yl)urea (100 mg, 0.25 mmol), methyl 4-chloro-4-oxobutanoate (37.8 mg, 0.25 mmol) in DMF (10 mL), to this stirred solution was added HATU (191 mg, 0.50 mmol) and DIEA (64.9 mg, 0.50 mmol). The resulting solution was stirred for 20 min at RT. The crude product was purified by Prep-HPLC with the following conditions: Column, XBridge Shield RP18 OBD, 19*250 mm, 10 um; mobile phase, water (10 mM NH.sub.4HCO.sub.3) and ACN (15% to 75% ACN gradient in 7 min); Detector, UV 250 nm. This resulted in 4.2 mg (3.27%) of Example 251 as a white solid. MS-ESI: 513 (M+1). .sup.1H NMR (300 MHz, CD.sub.3OD-d.sub.4) δ: 8.02-7.94 (m, 2H), 7.49-7.41 (m, 2H), 6.89 (s, 1H), 4.68 (s, 2H), 3.68 (s, 3H), 3.04 (s, 3H), 2.85-2.80 (m, 4H), 2.75-2.60 (m, 8H), 2.03-1.97 (m, 4H).

    Example 252 (Compound 410)

    [4056] ##STR01269##

    4-((4-(N′-(1,2,3,5,6,7-hexahydro-s-indacen-4-ylcarbamoyl)sulfamimidoyl)benzyl)(methyl)amino)-4-oxobutanoic acid

    [4057] ##STR01270##

    [4058] Into a 50-mL round-bottom flask, was placed a solution of methyl 3-[([4-[amino([[(1,2,3,5,6,7-hexahydro-s-indacen-4-yl)carbamoyl]imino])oxo-λ.sup.6-sulfanyl]phenyl]methyl)(methyl)-carbamoyl]propanoate (80 mg, 0.16 mmol) in THF (3.0 mL) and H.sub.2O (3.0 mL), to the stirred solution was added KOH (17.5 mg, 0.31 mmol). The resulting solution was stirred for 120 min at RT. The crude product was purified by Prep-HPLC with the following conditions: Column, XBridge Shield RP18 OBD, 19*250 mm, 10 um; mobile phase, water (10 mM NH.sub.4HCO.sub.3) and ACN (15% to 75% gradient in 7 min); Detector, UV250 nm. This resulted in 39 mg (50%) of Example 252 as a white solid. MS-ESI: 499 (M+1). .sup.1H-NMR (300 MHz, CD.sub.3OD-d.sub.4) δ: 8.10-7.80 (m, 2H), 7.55-7.30 (m, 2H), 6.89 (s, 1H), 4.68 (s, 2H), 3.04 (s, 3H), 2.90-2.60 (m, 12H), 2.10-1.80 (m, 4H).

    Example 253 (Compound 408)

    [4059] ##STR01271##

    (E)-N-(4-(N′-((1,2,3,5,6,7-hexahydro-s-indacen-4-yl)carbamoyl)sulfamidimidoyl)benzyl)-N-methyloct-4-en-7-ynamide (Scheme 35)

    [4060] ##STR01272##

    [4061] Example 253 was prepared using similar conditions as described in Example 251 and Scheme 35 from 3-(3-(but-3-ynyl)-3H-diazirin-3-yl)propanoic acid and Intermediate 67. MS-ESI: 519 (M+1)

    TABLE-US-00035 TABLE 26 Examples in the following table were prepared using similar conditions as described in Example 4-route 1 and Scheme 2 from appropriate starting materials. Final Exact Example Target Mass # Number Structure IUPAC Name [M + H].sup.+ 254 308 [01273]embedded image N′-((3-cyano-2,6- diisopropylphenyl)carbamoyl)- 5-(2-hydroxypropan-2-yl) thiophene-2-sulfonimidamide 449 255 311 [01274]embedded image N′-((6-ethyl-1-methyl-1H- indazol-7-yl)carbamoyl)-5-(2- hydroxypropan-2-yl)thiazole- 2-sulfonimidamide 423 256 312 [01275]embedded image N′-((6-ethyl-2-methyl-2H- indazol-7-yl)carbamoyl)-5-(2- hydroxypropan-2-yl)thiazole- 2-sulfonimidamide 423 257 327 [01276]embedded image 5-(2-hydroxypropan-2-yl)- N′-((3,5,6,7-tetrahydro-2H- indeno[5,6-b]furan-4-yl) carbamoyl)thiazole-2- sulfonimidamide 423 258 326 [01277]embedded image 5-(2-Hydroxypropan-2-yl)- N′-((3,5,6,7-tetrahydro-2H- indeno[5,6-b]furan-8-yl) carbamoyl)thiazole-2- sulfonimidamide 423 259 139 [01278]embedded image N′-((1,2,3,5,6,7-hexahydro- s-indacen-4-yl)carbamoyl)-5- (2-hydroxypropan-2-yl)-1- phenyl-1H-pyrazole-3- sulfonimidamide 480 260 137 [01279]embedded image N′-((1,2,3,5,6,7-hexahydro- s-indacen-4-yl)carbamoyl)-6- (2-hydroxypropan-2-yl) pyridine-3-sulfonimidamide 415 261 409 [01280]embedded image N-(4-(N′-((1,2,3,5,6,7- hexahydro-s-indacen-4- yl)carbamoyl)sulfamidi- midoyl)benzyl)-N- methylpent-4-ynamide 479 262 303 [01281]embedded image 4-(2-Hydroxypropan-2-yl)- N′-((2,4,5,6-tetrahydro-1H- cyclobuta[f]inden-3-yl) carbamoyl)thiazole-2- sulfonimidamide 407 263 325 [01282]embedded image 4-(2-Hydroxypropan-2-yl)- N′-((3,5,6,7-tetrahydro-2H- indeno[5,6-b]furan-8-yl) carbamoyl)thiazole-2- sulfonimidamide 423 264 138 [01283]embedded image N′-((1,2,3,5,6,7-hexahydro- s-indacen-4-yl)carbamoyl)- 6-(2-hydroxypropan-2-yl)- 2-methylpyridine-3- sulfonimidamide 429 265 332 [01284]embedded image N′-(1,2,3,5,6,7-hexahydro- s-indacen-4-ylcarbamoyl)- 4-(2-hydroxypropan-2-yl)- 5-methylthiazole-2- sulfonimidamide 435 266 334 [01285]embedded image 4-(1-(Dimethylamino)ethyl)- N′-(1,2,3,5,6,7-hexahydro-s- indacen-4-ylcarbamoyl) benzenesulfonimidamide 427 267 335 [01286]embedded image 4-(2-(Dimethylamino)propan- 2-yl)-N′-(1,2,3,5,6,7- hexahydro-s-indacen-4-yl- carbamoyl)benzene- sulfonimidamide 441 268 337 [01287]embedded image N-(4-(N′-(1,2,3,5,6,7- hexahydro-s-indacen-4- ylcarbamoyl)sulfamimidoyl) benzyl)-N-methylacetamide 441 269 113 [01288]embedded image 3-Fluoro-N′-(1,2,3,5,6,7- hexahydro-s-indacen-4- ylcarbamoyl)-5-(2- hydroxypropan-2-yl) thiophene-2- sulfonimidamide 438 270 343 [01289]embedded image N′-((1,2,3,5,6,7-hexahydro- s-indacen-4-yl)carbamoyl)- 2-methyl-1,2,3,4- tetrahydroisoquinoline-6- sulfonimidamide 425 271 349 [01290]embedded image N-(1,2,3,5,6,7-hexahydro-s- indacen-4-ylcarbamoyl)-2- methyl-1,2,3,4- tetrahydroisoquinoline-7- sulfonimidamide 425 272 344 [01291]embedded image 4-((Dimethylamino)methyl)- N′-((1,2,3,5,6,7-hexahydro- s-indacen-4-yl)carbamoyl)- 2-methoxybenzene- sulfonimidamide 443 273 359 [01292]embedded image N′-(1,2,3,5,6,7-hexahydro- s-indacen-4-ylcarbamoyl)- 1-methyl-1H-indazole-5- sulfonimidamide 410 274 352 [01293]embedded image N′-(1,2,3,5,6,7-hexahydro- s-indacen-4-ylcarbamoyl)- 4-(2-methoxypropan-2-yl) benzenesulfonimidamide 428 275 354 [01294]embedded image N′-(1,2,3,5,6,7-hexahydro- s-indacen-4-ylcarbamoyl)- 6-isobutylpyridine-3- sulfonimidamide 413 276 355 [01295]embedded image 6-((Dimethylamino)methyl)- N′-(1,2,3,5,6,7-hexahydro-5- indacen-4-ylcarbamoyl) pyridine-3-sulfonimidamide 414 277 356 [01296]embedded image N′-(1,2,3,5,6,7-hexahydro-s- indacen-4-ylcarbamoyl)-4- isobutylbenzene- sulfonimidamide 412 278 357 [01297]embedded image 5-((Dimethylamino)methyl)- N′-(1,2,3,5,6,7-hexahydro- s-indacen-4-ylcarbamoyl) pyridine-2-sulfonimidamide 414 279 340 [01298]embedded image 5-((Dimethylamino)methyl)- 3-fluoro-N′-(1,2,3,5,6,7- hexahydro-s-indacen-4- ylcarbamoyl)thiophene-2- sulfonimidamide 437 280 377 [01299]embedded image 4-((dimethylmino)methyl)- 3-fluoro-N′- ((1,2,3,5,6,7-hexahydro-s- indacen-4-yl)carbamoyl) benzenesulfonimidamide 431 281 378 [01300]embedded image 3-fluoro-5-(2-hydroxy- propan-2-yl)-N′- ((2,4,5,6-tetrahydro-1H- cyclobuta[f]inden-3-yl) carbamoyl)thiophene-2- sulfonimidamide 424 282 379 [01301]embedded image N′-((1,2,3,5,6,7-hexahydro- s-indacen-4-yl)carbamoyl)- 4-isopropylthiophene-2- sulfonimidamide 404 283 380 [01302]embedded image N-((1,2,3,5,6,7-hexahydro- s-indacen-4-yl)carbamoyl)- 4-(1-methylpyrrolidin-2- yl)benzenesulfonimidamide 439 284 353 [01303]embedded image N′-((3,5-diisopropyl-1- phenyl-1H-pyrazol-4-yl) carbamoyl)-4-(2-hydroxy- propan-2-yl)thiophene-2- sulfonimidamide 490 285 333 [01304]embedded image N′-((1,2,3,6,7,8-hexahydro- as-indacen-4-yl)carbamoyl)- 2-(2-hydroxypropan-2-yl) thiazole-5-sulfonimidamide 421 287 382 [01305]embedded image 2-fluoro-N′-((1,2,3,5,6,7- hexahydro-s-indacen-4-yl) carbamoyl)-4-((methylamino) methyl) benzenesulfonimidamide 417 288 383 [01306]embedded image N′-((1,2,3,5,6,7-hexahydro- s-indacen-4-yl)carbamoyl)- 6-isopropylpyridine-3- sulfonimidamide 399

    TABLE-US-00036 TABLE 27 Examples in the following table were prepared using similar conditions as described in Example 4-route 2 and Scheme 3 from appropriate starting materials. Final Exact Example Target Mass # Number Structure IUPAC Name [M + H].sup.+ 289 315 [01307]embedded image 2-(2-Hydroxypropan-2-yl)-N′- ((3,5,6,7-tetrahydro-2H- indeno[5,6-b]furan-8- yl)carbamoyl)thiazole-5- sulfonimidamide 423 290 316 [01308]embedded image N′-((6-ethyl-1H-indazol-7- yl)carbamoyl)-2-(2- hydroxypropan-2-yl)thiazole- 5-sulfonimidamide 409 291 317 [01309]embedded image 2-(2-Hydroxypropan-2-yl)- N′-((1-methyl-1,2,3,5,6,7- hexahydro-s-indacen-4- yl)carbamoyl)thiazole-5- sulfonimidamide 435 292 319 [01310]embedded image 2-(2-Hydroxypropan-2-yl)- N′-((3-methyl-1,2,3,5,6,7- hexahydro-s-indacen-4- yl)carbamoyl)thiazole-5- sulfonimidamide 435 293 320 [01311]embedded image 2-(2-Hydroxypropan-2-yl)- N′-((1-oxo-1,2,3,5,6,7- hexahydro-s-indacen-4- yl)carbamoyl)thiazole-5- sulfonimidamide 435 294 336 [01312]embedded image 2-(2-Hydroxypropan-2-yl)- N′-((3-oxo-1,2,3,5,6,7- hexahydro-s-indacen-4- yl)carbamoyl)thiazole-5- sulfonimidamide 435 295 330 [01313]embedded image N′-((1,2,3,5,6,7-hexahydro- s-indacen-4-yl)carbamoyl)- 2-(2-methoxypropan-2-yl) thiazole-5-sulfonimidamide 435

    TABLE-US-00037 TABLE 28 Examples in the following table were obtained from chiral HPLC resolutions of racemic examples described above. The chiral column and eluents are listed in the table. As a convention, the faster-eluting enantiomer is always listed first in the table followed by the slower-eluting enantiomer of the pair. The symbol * at a chiral center denotes that this chiral center has been resolved and the absolute stereochemistry at that center has not been determined. For mixtures contained two chiral centers and if two columns are used for separating the four diastereomers, the individual isomers are listed in the order of faster column 1/faster column 2; faster column 1/slower column 2; slower column 1/faster column 2; followed by slower column 1/slower column 2. Final Tar- LC- get MS Ex. Num- [M + # ber Structure IUPAC Name Column Eluents H].sup.+ 296 364a [01314]embedded image (R) or (S)-N′- ((1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl)-5- (2-hydroxy- propan-2-yl) thiazole-2- sulfonimi- damide CHIRAL- PAK IG 2*25 cm (5 um) 50% MeOH (8 mM NH.sub.3- MeOH) in CO.sub.2.sup.# 421 297 364b [01315]embedded image (S) or (R)-N′- ((1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl)-5- (2-hydroxy- propan-2-yl) thiazole-2- sulfonimi- damide CHIRAL- PAK IG 2*25 cm (5 um) 50% MeOH (8 mM NH.sub.3• MeOH) in CO.sub.2 421 298 365a [01316]embedded image (R) or (S)-N′- ((3-fluoro-2,6- diisopropyl- phenyl)carba- moyl)-2-(2- hydroxy- propan-2-yl) thiazole-5- sulfonimi- damide Chiralpak ID, 2*25 cm, 5 um IPA in Hex: DCM = 5:1 443 299 365b [01317]embedded image (S) or (R)-N′- ((3-fluoro-2,6- diisopropyl- phenyl)carba- moyl)-2-(2- hydroxy- propan-2-yl) thiazole-5- sulfonimi- damide Chiralpak ID, 2*25 cm, 5 um IPA in Hex: DCM= 5:1 443 300 308a [01318]embedded image (R) or (S)-N′- ((3-cyano-2,6- diisopropyl- phenyl)carba- moyl)-5-(2- hydroxy- propan-2-yl) thiophene-2- sulfonimi- damide CHIRAL- PAK IG, 20*250 mm, 5 um 30% EtOH in Hex (0.1% DEA) 449 301 308b [01319]embedded image (S) or (R)-N′- ((3-fluoro-2,6- diisopropyl- phenyl)carba- moyl)-2-(2- hydroxy- propan-2-yl) thiazole-5- sulfonimi- damide CHIRAL- PAK IG, 20*250 mm, 5 um 30% EtOH in Hex (0.1% DEA) 449 126 195a [01320]embedded image Two isomers of (S,S)-and (S,R)-or (R,S)-and (R,R) 4-(2- hydroxy- propan-2-yl)- 5-methyl- N′-((3-methyl- 1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl) furan-2- CHIRAL- ART Cellulose- SB, 2*25 cm, 5 um MeOH (0.1% DEA); 1.sup.st and 2.sup.nd peaks 432 sulfonimi- damide 127 195e [01321]embedded image Two isomers of (R,S)-and (R,R)-or (S,S)-and (S,R) 4-(2- hydroxy- propan-2-yl)- 5-methyl-N′- ((3-methyl- 1,2,3,5,6,7- hexahydro- s-indacen-4- yl)carbamoyl) furan-2-sul- MeOH (0.1% DEA); 3.sup.rd peak 432 fonimidamide 302 195ba [01322]embedded image (R,R) or (R,S) or (S,S) or (S,R)-4-(2- hydroxy- propan-2-yl)- 5-methyl-N′- ((3-methyl- 1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl) furan-2- sulfonimi- Pheno- mene x Lux 5u Cellu- lose-4, AXIA Packed 2.12*25 cm, 5 um 40% MeOH in CO.sub.2 432 damide re- solved from example 127 303 195bb [01323]embedded image (R,S) or (R,R) or (S,R) or (S,S)-4-(2- hydroxy- propan-2-yl)- 5-methyl-N′- ((3-methyl- 1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl) furan-2- sulfonimi- Pheno- mene x Lux 5u Cellu- lose-4, AXIA Packed 2.12*25 cm, 5 um 40% MeOH in CO.sub.2 432 damide re- solved from example 127 123 207c [01324]embedded image Two isomers of (R,S)- and (R,R) 4-(2- hydroxy- propan-2-yl)- 5-methyl-N′- (1-methyl- 1,2,3,5,6,7- hexahydros- indacen-4-yl- carbamoyl) Chiral- Pak IC, 2*25 cm, 5 um 50% EtOH in MTBE; 1.sup.st and 2.sup.nd peaks 432.2 furan-2- sulfonimi- damide 124 207aa [01325]embedded image (S,S)-or (S,R)-4-(2- hydroxy- propan-2-yl)- 5-methyl-N′- (1-methyl- 1,2,3,5,6,7- hexahydros- indacen-4-yl- carbamoyl) furan-2- sulfonimi- 50% EtOH in MTBE; 3.sup.rd peak 432.2 damide 125 207b [01326]embedded image (S,R)-or (S,S)-4-(2- hydroxy- propan-2-yl)- 5-methyl-N′- (1-methyl- 1,2,3,5,6,7- hexahydros- indacen-4-yl- carbamoyl) furan-2- sulfonimi- 50% EtOH in MTBE; 4.sup.th peak 432.2 damide 304 207a [01327]embedded image (R,R) or (R,S)-4-(2- hydroxy- propan-2-yl)- 5-methyl-N′- ((3-methyl- 1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl) furan-2- sulfonimi- CHIRAL- PAK IG, 20*250 mm, 5 um EtOH in Hex (0.1% FA) 432 damide; resolved from example 123 305 207bb [01328]embedded image (R,S) or (R,R)-4-(2- hydroxy- propan-2-yl)- 5-methyl-N′- ((3-methyl- 1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl) furan-2- sulfonimi- CHIRAL- PAK IG, 20*250 mm, 5 um EtOH in Hex (0.1% FA) 432 damide; resolved from example 123 306 366a [01329]embedded image (R) or (S)-N′- ((1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl)- 4-(2-hydroxy- propan-2-yl) thiazole-2- sulfonimi- damide CHIRAL- PAK AS-H, 2*25 cm (5 um) 35% IPA (2 mM NH.sub.3- MeOH) in CO.sub.2 421 307 366b [01330]embedded image (S) or (R)-N′- ((1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl)- 4-(2-hydroxy- propan-2-yl) thiazole-2- sulfonimi- damide CHIRAL- PAK AS-H, 2*25 cm (5 um) 35% IPA (2 mM NH.sub.3- MeOH) in CO.sub.2 421 308 139a [01331]embedded image (S) or (R)-N′- ((1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl)- 5-(2-hydroxy- propan-2-yl)- 1-phenyl-1H- pyrazole-3- sulfonimi- damide CHIRAL- PAK AS-H, 2*25 cm (5 um) EtOH in Hex (0.1% DEA) 480 309 139b [01332]embedded image (R) or (S)-N′- ((1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl)- 5-(2-hydroxy- propan-2-yl)- 1-phenyl-1H- pyrazole-3- sulfonimi- damide CHIRAL- PAK AS-H, 2*25 cm (5 um) EtOH in Hex (0.1% DEA) 480 310 367a [01333]embedded image (R) or (S)-N′- ((8-fluoro- 1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl)- 4-(2-hydroxy- propan-2-yl) thiazole-2- sulfonimi- damide Chiral- pak AS-H 2*25 cm (5 um) 35% IPA in CO.sub.2 439 311 367b [01334]embedded image (S) or (R)-N′- ((8-fluoro- 1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl)- 4-(2-hydroxy- propan-2-yl) thiazole-2- sulfonimi- damide Chiral- pak AS-H 2*25 cm (5 um) 35% IPA in CO.sub.2 439 312 409b [01335]embedded image (S) or (R)-N- (4-(N′- ((1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl) sulfamidi- midoyl) benzyl)-N- CHIRAL ART Cellu- lose- SB, 2*25 cm, 5 um EtOH in Hex (8 mM NH.sub.3- MeOH) 479 methylpent- 4-ynamide 313 409a [01336]embedded image (R) or (S)-N- (4-(N′- ((1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl) sulfamidi- midoyl) benzyl)-N- CHIRAL ART Cellu- lose- SB, 2*25 cm, 5 um EtOH in Hex (8 mM NH.sub.3• MeOH) 479 methylpent- 4-ynamide 314 369a [01337]embedded image (S) or (R)-N′- ((1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl)- 4-((methyl- amino)methyl) benzene- sulfonimi- damide Chiral- pak ID-2, 2*25 cm, 5 um EtOH in Hex (8 mM NH.sub.3• MeOH) 399 315 369b [01338]embedded image (R) or (S)-N′- ((1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl)- 4-((methyl- amino)methyl) benzene- sulfonimi- damide Chiral- pak ID-2, 2*25 cm, 5 um EtOH in Hex (8 mM NH.sub.3• MeOH) 399 316 159a [01339]embedded image Two isomers of (R,R) or (R,S) or (S,S) or (S,R)-N′- ((4-cyano-3- fluoro-2,6- diisopropyl- phenyl) carbamoyl)- 2-(1,2-di- hydroxy- propan-2-yl) thiazole-5- CHIRAL ART Cellu- lose- SB, 2*25 cm, 5 um EtOH in Hex (0.1% FA) 1.sup.st and 2.sup.nd peak 484 sulfonimi- damide 317 159ab [01340]embedded image (R,R) or (R,S) or (S,S) or (S,R)-N- ((4-cyano-3- fluoro-2,6- diisopropyl- phenyl) carbamoyl)- 2-(1,2-di- hydroxy- CHIRAL ART Cellu- lose- SB, 2*25 cm, 5 um EtOH in Hex (0.1% FA) 3.sup.rd peak 484 propan-2-yl) thiazole-5- sulfonimi- damide 318 159ba [01341]embedded image (S,S) or (S,R) or (R,R) or (R,S)-N- ((4-cyano-3- fluoro-2,6- diisopropyl- phenyl) carbamoyl)- 2-(1,2-di- hydroxy- CHIRAL ART Cellu- lose- SB, 2*25 cm, 5 um EtOH in Hex (0.1% FA) 4.sup.th peak 484 propan-2-yl) thiazole-5- sulfonimi- damide 319 137a [01342]embedded image (S) or (R)-N′- ((1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl)- 6-(2-hydroxy- propan-2-yl) pyridine-3- sulfonimi- damide CHIRAL ART Cellu- lose- SB, 2*25 cm, 5 um EtOH in Hex (0.1% FA) 415 320 137b [01343]embedded image (R) or (S)-N′- ((1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl)- 6-(2-hydroxy- propan-2-yl) pyridine-3- sulfonimi- damide CHIRAL ART Cellu- lose- SB, 2*25 cm, 5 um EtOH in Hex (0.1% FA) 415 321 317ab [01344]embedded image (S,S) or (S,R)-2-(2- hydroxy- propan-2-yl)- N′-((1- methyl- 1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl) thiazole-5- sulfonimi- 1.sup.st and 2.sup.nd peak (two isomers) Faster-eluting on column 1: CHIRAL ART Cellulose-SB, 2*25 cm, 5 um, IPA in Hex (0.1% FA). Separated further on column 2: 435 damide CHIRALPAK (from Exam- IE, EtOH in ple 291) MTBE (0.1% FA) to obtain single isomers. 322 317aa [01345]embedded image (S,R) or (S,S)-2-(2- hydroxy- propan-2-yl)- N′-((1- methyl- 1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl) thiazole-5- sulfonimi- 435 damide (from Exam- ple 291) 323 317bb [01346]embedded image (R,R) or (R,S)-2-(2- hydroxy- propan-2-yl)- N′-((1- methyl- 1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl) thiazole-5- sulfonimi- CHIRAL ART Cellu- lose- SB, 2*25 cm, 5 um IPA in Hex (0.1% FA) 3.sup.rd peak 435 damide (from Exam- ple 291) 324 317ba [01347]embedded image (R,S) or (R,R)-2-(2- hydroxy- propan-2-yl)- N′-((1- methyl- 1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl) thiazole-5- sulfonimi- IPA in Hex (0.1% FA) 4.sup.th peak 435 damide (from Exam- ple 291) 325 316a [01348]embedded image (S) or (R)-N′- ((6-ethyl-1H- indazol-7-yl) carbamoyl)- 2-(2-hydroxy- propan-2-yl) thiazole-5- sulfonimi- damide Chiral- pak ID, 2*25 cm, 5 um EtOH in Hex (0.1% FA) 409 326 316b [01349]embedded image (R) or (S)-N′- ((6-ethyl-1H- indazol-7-yl) carbamoyl)- 2-(2-hydroxy- propan-2-yl) thiazole-5- sulfonimi- damide Chiral- pak ID, 2*25 cm, 5 um EtOH in Hex (0.1% FA) 409 327 373a [01350]embedded image (S) or (R)-N′- ((6-ethyl-1- methyl-1H- indazol-7-yl) carbamoyl)- 5-(2-hydroxy- propan-2-yl) thiazole-2- sulfonimi- damide CHIRAL- PAK IG, 20*250 mm, 5 um EtOH in Hex (0.1% FA) 423 328 373b [01351]embedded image (R) or (S)-N′- ((6-ethyl-1- methyl-1H- indazol-7-yl) carbamoyl)- 5-(2-hydroxy- propan-2-yl) thiazole-2- sulfonimi- damide CHIRAL- PAK IG, 20*250 mm, 5 um EtOH in Hex (0.1% FA) 423 329 374a [01352]embedded image (S) or (R)-N′- ((6-ethyl-2- methyl-2H- indazol-7-yl) carbamoyl)- 5-(2-hydroxy- propan-2-yl) thiazole-2- sulfonimi- damide CHIRAL ART Cellu- lose-SB S-5 um, 250*20 mm EtOH in Hex (0.1% FA) 423 330 374b [01353]embedded image (R) or (S)-N′- ((6-ethyl-2- methyl-2H- indazol-7-yl) carbamoyl)- 5-(2-hydroxy- propan-2-yl) thiazole-2- sulfonimi- damide CHIRAL ART Cellu- lose-SB S-5 um, 250*20 mm EtOH in Hex (0.1% FA) 423 331 319ab [01354]embedded image (S,S) or (S,R)-2-(2- hydroxy- propan-2-yl)- N′-((3- methyl- 1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl) thiazole-5- sulfonimi- 1.sup.st peak CHIRAL ART Cellu- lose- SB, 2*25 cm, 5 um EtOH in Hex (0.1% FA) 435 damide 332 319aa [01355]embedded image (R,R) or (R,S)-2-(2- hydroxy- propan-2-yl)- N′-((3- methyl- 1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl) thiazole-5- sulfonimi- 2.sup.nd peak CHIRAL ART Cellu- lose- SB, 2*25 cm, 5 um EtOH in Hex (0.1% FA) 435 damide 333 319bb [01356]embedded image (S,R) or (S,S)-2-(2- hydroxy- propan-2-yl)- N′-((3- methyl- 1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl) thiazole-5- sulfonimi- 3.sup.rd peak CHIRAL ART Cellu- lose- SB, 2*25 cm, 5 um EtOH in Hex (0.1% FA) 435 damide 334 319ba [01357]embedded image (R,S) or (R,R)-2-(2- hydroxy- propan-2-yl)- N′-((3- methyl- 1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl) thiazole-5- sulfonimi- 4.sup.th peak CHIRAL ART Cellu- lose- SB, 2*25 cm, 5 um EtOH in Hex (0.1% FA) 435 damide 335 320a [01358]embedded image (S) or (R)-2-(2- Hydroxy- propan-2-yl)- N′-((1-oxo- 1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl) thiazole-5- sulfonimi- damide from Chiral- pak IA, 2*25 cm, 5 um EtOH in Hex (0.1% FA) 435 Example 293 336 320b [01359]embedded image (R) or (S)-2-(2- Hydroxy- propan-2-yl)- N′-((1-oxo- 1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl) thiazole-5- sulfonimi- damide from Chiral- pak IA, 2*25 cm, 5 um EtOH in Hex (0.1% FA) 435 Example 293 337 323ab [01360]embedded image (R,R) or (R,S)-N′- ((1-hydroxy- 1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl)- 2-(2-hydroxy- propan-2-yl) thiazole-5- sulfonimi- damide (from example 336) CHIRAL- PAK AD, 2*25 cm, 5 um EtOH (0.1% DEA) in CO.sub.2, 1.sup.st peak 437 338 323bb [01361]embedded image (R,S) or (R,R)-N′- ((1-hydroxy- 1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl)- 2-(2-hydroxy- propan-2-yl) thiazole-5- sulfonimi- damide (from example 336) EtOH (0.1% DEA) in CO.sub.2, 2.sup.nd peak 437 339 323aa [01362]embedded image (S,S) or (S,R)-N′- ((1-hydroxy- 1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl)- 2-(2-hydroxy- propan-2-yl) thiazole-5- sulfonimi- damide (from example 335) CHIRAL- PAK AD, 2*25 cm, 5 um EtOH (0.1% DEA) in CO.sub.2, 1.sup.st peak 437 340 323ba [01363]embedded image (S,R) or (S,S)-N′- ((1-hydroxy- 1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl)- 2-(2-hydroxy- propan-2-yl) thiazole-5- sulfonimi- damide (from example 335) EtOH (0.1% DEA) in CO.sub.2, 2.sup.nd peak 437 341 303a [01364]embedded image (R) or (S)- 4-(2-hydroxy- propan-2-yl)- N′-((2,4,5,6- tetrahydro- 1H-cyclobuta [f]inden-3-yl) carbamoyl) thiazole-2- sulfonimi- damide Chiral- pak ID, 2*25 cm, 5 um EtOH in Hex (0.1% FA) 407 342 303b [01365]embedded image (R) or (S)- 4-(2-hydroxy- propan-2-yl)- N′-((2,4,5,6- tetrahydro- 1H-cyclobuta [f]inden-3-yl) carbamoyl) thiazole-2- sulfonimi- damide Chiral- pak ID, 2*25 cm, 5 um EtOH in Hex (0.1% FA) 407 343 315a [01366]embedded image (R) or (S)- 2-(2-hydroxy- propan-2-yl)- N′-((3,5,6,7- tetrahydro- 2H-indeno [5,6-b]furan- 8-yl) carbamoyl) thiazole-5- sulfonimi- damide Chiral- pak ID, 2*25 cm, 5 um EtOH in Hex (0.1% FA) 423 344 315b [01367]embedded image (R) or (S)- 2-(2-hydroxy- propan-2-yl)- N′-((3,5,6,7- tetrahydro- 2H-indeno [5,6-b]furan- 8-yl) carbamoyl) thiazole-5- sulfonimi- damide Chiral- pak ID, 2*25 cm, 5 um EtOH in Hex (0.1% FA) 423 345 138a [01368]embedded image (R) or (S)- N′- ((1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl)- 6-(2-hydroxy- propan-2-yl)- 2-methyl- pyridine-3- sulfonimi- damide CHIRAL- PAK IF, 2*25 cm, 5 um EtOH in Hex (8 mM NH.sub.3- MeOH) 429 346 138b [01369]embedded image (R) or (S)- N′- ((1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl)- 6-(2-hydroxy- propan-2-yl)- 2-methyl- pyridine-3- sulfonimi- damide CHIRAL- PAK IF, 2*25 cm, 5 um EtOH in Hex (8 mM NH.sub.3• MeOH) 429 347 328a [01370]embedded image (R) or (S)- 5-(2-hydroxy- propan-2-yl)- N′-((3,5,6,7- tetrahydro- 2H-indeno [5,6-b] furan-4-yl) carbamoyl) thiazole-2- sulfonimi- damide CHIRAL- PAK IC, 2*25 cm, 5 um EtOH in Hex (0.1% FA) 423 348 328b [01371]embedded image (S) or (R)- 5-(2-hydroxy- propan-2-yl)- N′-((3,5,6,7- tetrahydro- 2H-indeno [5,6-b] furan-4-yl) carbamoyl) thiazole-2- sulfonimi- damide CHIRAL- PAK IC, 2*25 cm, 5 um EtOH in Hex (0.1% FA) 423 349 326b [01372]embedded image (S) or (R)- 5-(2-hydroxy- propan-2-yl)- N′-((3,5,6,7- tetrahydro- 2H-indeno [5,6-b] furan-8-yl) carbamoyl) thiazole-2- sulfonimi- damide CHIRAL- PAK IG, 20*250 mm, 5 um IPA in Hex: DCM = 5:1 (0.1% FA) 423 350 326a [01373]embedded image (R) or (S)- 5-(2-hydroxy- propan-2-yl)- N′-((3,5,6,7- tetrahydro- 2H-indeno [5,6-b] furan-8-yl) carbamoyl) thiazole-2- sulfonimi- damide CHIRAL- PAK IG, 20*250 mm, 5 um 423 351 318a [01374]embedded image (S) or (R)- N′-((8- bromo- 1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl)- 5-(2-hydroxy- propan-2-yl) thiazole-2- sulfonimi- damide CHIRAL ART Cellu- lose- SB S- 5 um, 2*25 cm, 5 um EtOH in Hex (8 mM NH.sub.3• MeOH) 499 352 318b [01375]embedded image (R) or (S)- N′-((8- bromo- 1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl)- 5-(2-hydroxy- propan-2-yl) thiazole-2- sulfonimi- damide CHIRAL ART Cellu- lose- SB S- 5 um, 2*25 cm, 5 um EtOH in Hex (8 mM NH.sub.3• MeOH) 499 353 325a [01376]embedded image (S) or (R)- 4-(2-hydroxy- propan-2-yl)- N′-((3,5,6,7- tetrahydro- 2H-indeno [5,6-b] furan-8-yl) carbamoyl) thiazole-2- sulfonimi- damide CHIRAL ART Cellu- lose- SB, 2*25 cm, 5 um EtOH in Hex (0.1% FA) 423 354 325b [01377]embedded image (R) or (S)- 4-(2-hydroxy- propan-2-yl)- N′-((3,5,6,7- tetrahydro- 2H-indeno [5,6-b] furan-8-yl) carbamoyl) thiazole-2- sulfonimi- damide CHIRAL ART Cellu- lose- SB, 2*25 cm, 5 um EtOH in Hex (0.1% FA) 423 355 329a [01378]embedded image (R) or (S)- 2-(2-hydroxy- propan-2-yl)- N′-(tricyclo [6.2.0.03,6] deca-1,3(6),7- trien-2-yl- carbamoyl) thiazole-5- sulfonimi- damide Chiral- pak ID, 2*25 cm, 5 um IPA in Hex (0.1% FA) 393 356 329b [01379]embedded image (S) or (R)- 2-(2-hydroxy- propan-2-yl)- N′-(tricyclo [6.2.0.03,6] deca-1,3(6),7- trien-2-yl- carbamoyl) thiazole-5- sulfonimi- damide Chiral- pak ID, 2*25 cm, 5 um IPA in Hex (0.1% FA) 393 357 404b [01380]embedded image (R) or (S)-N′- ((1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl)- 4-(2-hydroxy- propan-2-yl)- N,N- dimethyl- thiophene-2- sulfonimi- damide CHIRAL- PAK IG, 20*250 mm, 5 um IPA in Hex: DCM = 3:1 (10 mM NH.sub.3- MeOH) 448 358 404a [01381]embedded image (S) or (R)-N′- ((1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl)- 4-(2-hydroxy- propan-2-yl)- N,N- dimethyl- thiophene-2- sulfonimi- damide CHIRAL- PAK IG, 20*250 mm, 5 um IPA in Hex: DCM = 3:1 (10 mM NH.sub.3- MeOH) 448 359 332a [01382]embedded image (R) or (S)-N′- ((1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl)- 4-(2-hydroxy- propan-2-yl)- 5-methyl- thiazole-2- sulfonimi- damide Chiral- pak ID, 2*25 cm, 5 um IPA in Hex (0.1% FA) 435 360 332b [01383]embedded image (S) or (R)-N′- ((1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl)- 4-(2-hydroxy- propan-2-yl)- 5-methyl- thiazole-2- sulfonimi- damide Chiral- pak ID, 2*25 cm, 5 um IPA in Hex (0.1% FA) 435 361 335a [01384]embedded image (R) or (S)-4-(2- (dimethyl- amino) propan-2- yl)-N′- ((1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl) benzene- sulfonimi- CHIRAL- PAK IG, 2.0*25 cm (5 um) IPA in Hex (8 mM NH.sub.3- MeOH) 441 damide 362 335b [01385]embedded image (S) or (R)-4-(2- (dimethyl- amino) propan-2- yl)-N′- ((1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl) benzene- sulfonimi- CHIRAL- PAK IG, 2.0*25 cm (5 um) IPA in Hex (8 mM NH.sub.3- MeOH) 441 damide 363 336a [01386]embedded image (S) or (R)-2-(2- Hydroxy- propan-2-yl)- N′-((3-oxo- 1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl) thiazole-5- sulfonimi- damide CHIRAL ART Cellu- lose- SB, 2*25 cm, 5 um EtOH in MTBE (10 mM NH.sub.3- MeOH) 435 364 336b [01387]embedded image (R) or (S)-2-(2- Hydroxy- propan-2-yl)- N′-((3-oxo- 1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl) thiazole-5- sulfonimi- damide CHIRAL ART Cellu- lose- SB, 2*25 cm, 5 um EtOH in MTBE (10 mM NH.sub.3- MeOH) 435 365 337a [01388]embedded image (S) or (R)-N- (4-(N′- ((1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl) sulfamidimi- doyl)benzyl)- N-methyl- acetamide CHIRAL ART Cellu- lose- SB, 2*25 cm, 5 um EtOH in Hex (8 mM NH.sub.3- MeOH) 441 366 337b [01389]embedded image (R) or (S)-N- (4-(N′- ((1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl) sulfamidimi- doyl)benzyl)- N-methyl- acetamide CHIRAL ART Cellu- lose- SB, 2*25 cm, 5 um EtOH in Hex (8 mM NH.sub.3- MeOH) 441 367 371a [01390]embedded image (S) or (R)-N- (3-(N′- ((1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl) sulfamidimi- doyl)benzyl)- N-methyl- acetamide CHIRAL ART Cellu- lose- SB, 2*25 cm, 5 um EtOH in Hex (8 mM NH.sub.3- MeOH) 441 368 371b [01391]embedded image (R) or (S)-N- (3-(N′- ((1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl) sulfamidimi- doyl)benzyl)- N-methyl- acetamide CHIRAL ART Cellu- lose- SB, 2*25 cm, 5 um EtOH in Hex (8 mM NH.sub.3- MeOH) 441 369 372a [01392]embedded image (S,R/S) or (R,R/S)-N′- ((3-hydroxy- 1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl)- 2-(2-hydroxy- propan-2-yl) thiazole-5- sulfonimi- damide Obtained from Example 363 N/A 435 (M − 1) 370 372b [01393]embedded image (R,R/S) or (S,R/S)-N′- ((3-hydroxy- 1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl)- 2-(2-hydroxy- propan-2-yl) thiazole-5- sulfonimi- damide Obtained from Example 364 N/A 435 (M − 1) 371 334a [01394]embedded image (S) or (R)-4-(1- (dimethyl- amino) ethyl)-N′- ((1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl) benzene- sulfonimi- damide CHIRAL ART Cellu- lose- SB, 2*25 cm, 5 um IPA in Hex (8 mM NH.sub.3- MeOH) 427 372 334b [01395]embedded image (R) or (S)-4-(1- (dimethyl- amino) ethyl)-N′- ((1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl) benzene- sulfonimi- damide CHIRAL ART Cellu- lose- SB, 2*25 cm, 5 um IPA in Hex (8 mM NH.sub.3- MeOH) 427 373 339a [01396]embedded image (R) or (S)-N′- ((1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl)- 2-(2-hydroxy- propan-2-yl)- N-methyl- thiazole-5- sulfonimi- damide CHIRAL- PAK IE, 2*25 cm, 5 um IPA in Hex (8 mM NH.sub.3- MeOH) 435 374 339b [01397]embedded image (S) or (R)-N′- ((1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl)- 2-(2-hydroxy- propan-2-yl)- N-methyl- thiazole-5- sulfonimi- damide CHIRAL- PAK IE, 2*25 cm, 5 um IPA in Hex (8 mM NH.sub.3- MeOH) 435 375 334ab [01398]embedded image (S,R) or (S,S) or (R,S) or (R,R)-4- (1-(dimethyl- amino) ethyl)-N′- ((1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl) benzene- CHIRAL- PAK IG, 20*250 mm, 5 um EtOH in Hex (8 mM NH.sub.3- MeOH) 427 sulfonimi- damide 376 334aa [01399]embedded image (S,S) or (S,R) or (R,R) or (R,S)-4- (1-(dimethyl- amino) ethyl)-N′- ((1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl) benzene- CHIRAL- PAK IG, 20*250 mm, 5 um EtOH in Hex (8 mM NH.sub.3- MeOH) 427 sulfonimi- damide 377 334bb [01400]embedded image (R,R) or (R,S) or (S,S) or (S,R)-4- (1-(dimethyl- amino) ethyl)-N′- ((1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl) benzene- CHIRAL- PAK IG, 20*250 mm, 5 um EtOH in Hex (8 mM NH.sub.3- MeOH) 427 sulfonimi- damide 378 334ba [01401]embedded image (R,S) or (R,R) or (S,R) or (S,S)-4- (1-(dimethyl- amino) ethyl)-N′- ((1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl) benzene- CHIRAL- PAK IG, 20*250 mm, 5 um EtOH in Hex (8 mM NH.sub.3- MeOH) 427 sulfonimi- damide 379 338a [01402]embedded image (R) or (S)-N′- ((1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl)- 4-((3- methoxy- azetidin-1-yl) methyl) benzene- sulfonimi- CHIRAL- PAK IF, 2*25 cm, 5 um EtOH in Hex (8 mM NH.sub.3- MeOH) 455 damide 380 338b [01403]embedded image (S) or (R)-N′- ((1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl)- 4-((3- methoxy- azetidin-1-yl) methyl) benzene- sulfonimi- CHIRAL- PAK IF, 2*25 cm, 5 um EtOH in Hex (8 mM NH.sub.3- MeOH) 455 damide 381 340a [01404]embedded image (R) or (S)-5- ((dimethyl- amino) methyl)-3- fluoro-N′- ((1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl) thiophene-2- sulfonimi- damide CHIRAL- PAK IG, 20*250 mm, 5 um Hex (0.1% DEA): EtOH = 50:50 437 382 340b [01405]embedded image (S) or (R)-5- ((dimethyl- amino) methyl)-3- fluoro-N′- ((1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl) thiophene-2- sulfonimi- damide CHIRAL- PAK IG, 20*250 mm, 5 um Hex (0.1% DEA): EtOH = 50:50 437 383 361b [01406]embedded image (R) or (S)-4- ((dimethyl- amino) methyl)-N′- ((1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl)- N-methyl- benzene- sulfonimi- damide CHIRAL- PAK IE, 2*25 cm, 5 um EtOH in Hex (8 mM NH.sub.3- MeOH) 427 384 361a [01407]embedded image (S) or (R)-4- ((dimethyl- amino) methyl)-N′- ((1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl)- N-methyl- benzene- sulfonimi- damide CHIRAL- PAK IE, 2*25 cm, 5 um EtOH in Hex (8 mM NH.sub.3- MeOH) 427 385 113a [01408]embedded image (R) or (S)-3- fluoro-N′- ((1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl)- 5-(2-hydroxy- propan-2-yl) thiophene-2- sulfonimi- damide CHIRAL- PAK IG, 20*250 mm, 5 um IPA in Hex (8 mM NH.sub.3- MeOH) 438 386 113b [01409]embedded image (S) or (R)-3- fluoro-N′- ((1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl)- 5-(2-hydroxy- propan-2-yl) thiophene-2- sulfonimi- damide CHIRAL- PAK IG, 20*250 mm, 5 um IPA in Hex (8 mM NH.sub.3- MeOH) 438 387 330a [01410]embedded image (S) or (R)-N′- ((1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl)- 2-(2- methoxy- propan-2-yl) thiazole-5- sulfonimi- damide CHIRAL ART Cellu- lose- SB, 2*25 cm, 5 um EtOH in Hex (8 mM NH.sub.3- MeOH) 435 388 330b [01411]embedded image (R) or (S)-N′- ((1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl)- 2-(2- methoxy- propan-2-yl) thiazole-5- sulfonimi- damide CHIRAL ART Cellu- lose- SB, 2*25 cm, 5 um EtOH in Hex (8 mM NH.sub.3- MeOH) 435 389 341a [01412]embedded image (S) or (R)-N′- ((1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl)- 4-(((2- methoxy- ethyl) (methyl) amino) methyl) CHIRAL- Cellu- lose-SB 4.6*100 mm 3 um Hex (0.1% DEA): EtOH = 70:30 457 benzene- sulfonimi- damide 390 341b [01413]embedded image (R) or (S)-N′- ((1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl)- 4-(((2- methoxy- ethyl) (methyl) amino) methyl) CHIRAL- Cellu- lose-SB 4.6*100 mm 3 um Hex (0.1% DEA): EtOH = 70:30 457 benzene- sulfonimi- damide 391 360ba [01414]embedded image (R,R) or (R,S) or (S,S) or (S,R)-N′- ((3-hydroxy- 1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl)- 2-(2-hydroxy- propan-2-yl) thiazole-5- sulfonimi- damide (from CHIRAL- PAK IG, 20*250 mm, 5 um EtOH in MTBE (10 mM NH.sub.3- MeOH) 437 Example 370) 392 360bb [01415]embedded image (R,S) or (R,R) or (S,R) or (S,S)-N′- ((3-hydroxy- 1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl)- 2-(2-hydroxy- propan-2-yl) thiazole-5- sulfonimi- damide (from CHIRAL- PAK IG, 20*250 mm, 5 um EtOH in MTBE (10 mM NH.sub.3- MeOH) 437 Example 370) 393 363b [01416]embedded image (R)-N′- ((1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl)- 2-(2-hydroxy- propan-2-yl- 1,1,1,3,3,3- d.sub.6)thiazole- 5-sulfonimi- damide CHIRAL- PAK IF, 2*25 cm, 5 um 40% MeOH in CO.sub.2 427 394 363a [01417]embedded image (S)-N′- ((1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl)- 2-(2-hydroxy- propan-2-yl- 1,1,1,3,3,3- d.sub.6)thiazole- 5-sulfonimi- damide CHIRAL- PAK IF, 2*25 cm, 5 um 40% MeOH in CO.sub.2 427 395 343a [01418]embedded image (R) or (S)-N′- ((1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl)- 2-methyl- 1,2,3,4- tetrahydro- isoquinoline- 6-sulfonimi- damide CHIRAL- PAK IG, 20*250 mm, 5 um EtOH in Hex (8 mM NH.sub.3- MeOH 425 396 343b [01419]embedded image (S) or (R)-N′- ((1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl)- 2-methyl- 1,2,3,4- tetrahydro- isoquinoline- 6-sulfonimi- damide CHIRAL- PAK IG, 20*250 mm, 5 um EtOH in Hex (8 mM NH.sub.3- MeOH 425 397 359a [01420]embedded image (R) or (S)-N′- ((1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl)- 1-methyl- 1H- indazole-5- sulfonimi- damide Chiral- pakID, 2*25 cm, 5 um IPA in Hex: DCM = 3:1 (10 mM NH.sub.2- MeOH) 410 398 359b [01421]embedded image (S) or (R)-N′- ((1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl)- 1-methyl- 1H- indazole-5- sulfonimi- damide Chiral- pakID, 2*25 cm, 5 um IPA in Hex: DCM = 3:1 (10 mM NH.sub.2- MeOH) 410 399 352a [01422]embedded image (R) or (S)-N′- ((1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl)- 4-(2- methoxy- propan-2-yl) benzene- sulfonimi- CHIRAL- PAK IG, 2.0*25 cm (5 um) Hex (0.1% DEA): IPA = 70:30 428 damide 400 352b [01423]embedded image (S) or (R)-N′- ((1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl)- 4-(2- methoxy- propan-2-yl) benzene- sulfonimi- CHIRAL- PAK IG, 2.0*25 cm (5 um) Hex (0.1% DEA): IPA = 70:30 428 damide 401 383a [01424]embedded image (R) or (S)-N′- ((1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl)- 6-isopropyl- pyridine-3- sulfonimi- damide CHIRAL- PAK IG, 2*25 cm, 5 um EtOH in Hex (8 mM NH.sub.3- MeOH) 399 402 383b [01425]embedded image (S) or (R)-N′- ((1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl)- 6-isopropyl- pyridine-3- sulfonimi- damide CHIRAL- PAK IG, 2*25 cm, 5 um EtOH in Hex (8 mM NH.sub.3- MeOH) 399 403 382a [01426]embedded image (R) or (S)-2- fluoro-N′- ((1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl)- 4-((methyl- amino) methyl) benzene- sulfonimi- CHIRAL- PAK IG, 2*25 cm, 5 um EtOH in Hex (8 mM NH.sub.3- MeOH) 417 damide 404 382b [01427]embedded image (S) or (R)-2- fluoro-N′- ((1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl)- 4-((methyl- amino) methyl) benzene- sulfonimi- CHIRAL- PAK IG, 2*25 cm, 5 um EtOH in Hex (8 mM NH.sub.3• MeOH) 417 damide 405 379a [01428]embedded image (R) or (S)-N′- ((1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl)- 4-isopropyl- thiophene-2- sulfonimi- damide CHIRAL- PAK IG, 2.0*25 cm (5 um) EtOH in Hex (8 mM NH.sub.3- MeOH) 404 406 379b [01429]embedded image (S) or (R)-N′- ((1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl)- 4-isopropyl- thiophene-2- sulfonimi- damide CHIRAL- PAK IG, 2.0*25 cm (5 um) EtOH in Hex (8 mM NH.sub.3- MeOH) 404 407 380a [01430]embedded image (R,R) or (R,S) or (S,S) or (S,R)-N- ((1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl)- 4-(1-methyl- pyrrolidin-2- yl)benzene- CHIRAL- PAK IG, 20*250 mm, 5 um IPA in Hex: DCM = 5:1 (10 mM NH.sub.3- MeOH) 439 sulfonimi- damide 408 380b [01431]embedded image (S,R) or (S,S) or (R,S) or (R,R)-N- ((1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl)- 4-(1-methyl- pyrrolidin-2- yl)benzene- CHIRAL- PAK IG, 20*250 mm, 5 um IPA in Hex: DCM = 5:1 (10 mM NH.sub.3- MeOH) 439 sulfonimi- damide 409 380c [01432]embedded image (R,S) or (S,R) or (S,R) or (R,R)-N- ((1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl)- 4-(1-methyl- pyrrolidin-2- yl)benzene- CHIRAL- PAK IG, 20*250 mm, 5 um IPA in Hex: DCM = 5:1 (10 mM NH.sub.3- MeOH) 439 sulfonimi- damide 410 380d [01433]embedded image (R,S) or (S,R) or (R,S or (S,S)-N- ((1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl)- 4-(1-methyl- pyrrolidin-2- yl)benzene- CHIRAL- PAK IG, 20*250 mm, 5 um IPA in Hex: DCM = 5:1 (10 mM NH.sub.3- MeOH) 439 sulfonimi- damide 411 384a [01434]embedded image (R) or (S)-4- (amino- methyl)-N′- ((1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl) benzene- sulfonimi- damide CHIRAL- PAK IG, 2*25 cm, 5 um EtOH in Hex (8 mM NH.sub.3- MeOH) 385 412 384b [01435]embedded image (S) or (R)-4- (amino- methyl)-N′- ((1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl) benzene- sulfonimi- damide CHIRAL- PAK IG, 2*25 cm, 5 um EtOH in Hex (8 mM NH.sub.3- MeOH) 385 413 357a [01436]embedded image (R) or (S)-5- ((dimethyl- amino) methyl)-N′- ((1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl) pyridine-2- sulfonimi- CHIRAL- PAK AD-H, 2.0.*25 cm EtOH in Hex (8 mM NH.sub.3- MeOH) 414 damide 414 357b [01437]embedded image (S) or (R)-5- ((dimethyl- amino) methyl)-N′- ((1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl) pyridine-2- sulfonimi- CHIRAL- PAK AD-H, 2.0.*25 cm EtOH in Hex (8 mM NH.sub.3- MeOH) 414 damide 415 354a [01438]embedded image (R) or (S)-N′- ((1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl)- 6-isobutyl- pyridine-3- sulfonimi- damide CHIRAL ART Cellu- lose- SB, 2*25 cm, 5 um EtOH in Hex (0.1% DEA) 413 416 354b [01439]embedded image (S) or (R)-N′- ((1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl)- 6-isobutyl- pyridine-3- sulfonimi- damide CHIRAL ART Cellu- lose- SB, 2*25 cm, 5 um EtOH in Hex (0.1% DEA) 413 417 387a [01440]embedded image (R) or (S)-2- acetyl-N′- ((1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl) thiazole-5- sulfonimi- damide CHIRAL ART Cellu- lose- SB, 2*25 cm, 5 um IPA in CO.sub.2 405 418 387b [01441]embedded image (S) or (R)-2- acetyl-N′- ((1,2,3,5,6,7- hexahydro-s- indacen-4-yl) carbamoyl) thiazole-5- sulfonimi- damide CHIRAL ART Cellu- lose- SB, 2*25 cm, 5 um IPA in CO.sub.2 405 419 333a [01442]embedded image (R) or (S)-N′- ((1,2,3,6,7,8- hexahydro-as- indacen-4-yl) carbamoyl)- 2-(2-hydroxy- propan-2-yl) thiazole-5- sulfonimi- damide CHIRAL- PAK IF, 5*25 cm, 5 um EtOH in Hex (8 mM NH.sub.3- MeOH) 421 420 333b [01443]embedded image (S) or (R)-N′- ((1,2,3,6,7,8- hexahydro-as- indacen-4-yl) carbamoyl)- 2-(2-hydroxy- propan-2-yl) thiazole-5- sulfonimi- damide CHIRAL- PAK IF, 5*25 cm, 5 um EtOH in Hex (8 mM NH.sub.3- MeOH) 421 421 375a [01444]embedded image (R) or (S)-N′- ((1,2,3,5,6,7- hexahydro-s- indacen-4-yl- 3,3,5,5-d.sub.4) carbamoyl)- 2-(2-hydroxy- propan-2-yl) thiazole-5- sulfonimi- damide CHIRAL- PAK IF, 2*25 cm, 5 um MeOH (2 mM NH.sub.3- MeOH) in CO.sub.2 425 422 375b [01445]embedded image (S) or (R)-N′- ((1,2,3,5,6,7- hexahydro-s- indacen-4-yl- 3,3,5,5-d.sub.4) carbamoyl)- 2-(2-hydroxy- propan-2-yl) thiazole-5- sulfonimi- damide CHIRAL- PAK IF, 2*25 cm, 5 um MeOH (2 mM NH.sub.3- MeOH) in CO.sub.2 425 423 376a [01446]embedded image (R) or (S)-N′- ((1,2,3,5,6,7- hexahydro-s- indacen-4-yl- 1,1,7,7-d.sub.4) carbamoyl)- 2-(2-hydroxy- propan-2-yl) thiazole-5- sulfonimi- damide CHIRAL- PAK ID, 2*25 cm (5 um) MeOH (2 mM NH.sub.3- MeOH) in CO.sub.2 425 424 376b [01447]embedded image (S) or (R)-N′- ((1,2,3,5,6,7- hexahydro-s- indacen-4-yl- 1,1,7,7-d.sub.4) carbamoyl)- 2-(2-hydroxy- propan-2-yl) thiazole-5- sulfonimi- damide CHIRAL- PAK ID, 2*25 cm (5 um) MeOH (2 mM NH.sub.3- MeOH) in CO.sub.2 425 .sup.#The amount of NH.sub.3 in this chiral chromatographic solvent and similar solvents were adjusted by adding 2M NH.sub.3 in methanol to the desired NH.sub.3 concentration. In this case, the resulting concentration of NH.sub.3 in methanol is 8 mM.

    Example 425 (Compound 318)

    1-{Amino[5-(2-hydroxypropan-2-yl)-1,3-thiazol-2-yl]oxo-λ.SUP.6.-sulfanylidene}-3-(8-bromo-1,2,3,5,6,7-hexahydro-s-indacen-4-yl)urea

    [4062] ##STR01448##

    Step 1: 4-Bromo-1,2,3,5,6,7-hexahydro-8-isocyanato-s-indacene

    [4063] To a solution of 8-bromo-1,2,3,5,6,7-hexahydros-indacen-4-amine (1.5 g, 5.94 mmol) in anhydrous THF (50 mL) was added triethylamine (1.07 mL, 7.73 mmol) and triphosgene (882 mg, 2.97 mmol) at room temperature. The resulting mixture was then stirred at 60° C. for 4 h. Reaction mixture was then brought to room temperature and used directly in the next step.

    Step 2: 1-{Amino[5-(2-hydroxypropan-2-yl)-1,3-thiazol-2-yl]oxo-λ.SUP.6.-sulfanylidene}-3-(8-bromo-1,2,3,5,6,7-hexahydro-s-indacen-4-yl)urea

    [4064] To a solution of N-(tert-butyldimethylsilyl)-5-(2-hydroxypropan-2-yl)-1,3-thiazole-2-sulfonoimidamide (400 mg, 1.2 mmol) in anhydrous THF (10 mL) was added NaH (60% wt. oil dispersioin, 96 mg, 2.4 mmol) at room temperature. After 5 min, a solution of 4-bromo-1,2,3,5,6,7-hexahydro-8-isocyanato-s-indacene (2 mL, 2 mmol, from Step 1) was added drop wise. The resulting mixture was stirred at room temperature for 20 min before quenching carefully with 4 M HCl solution in dioxane (3 mL). Saturated aqueous ammonium chloride was added and the mixture was extracted with dichloromethane (15 mL×3). The combined organic layers were washed with brine, dried over MgSO.sub.4, filtered, and concentrated in vacuo. The crude product was purified by prep-HPLC to obtain the titled compound (280 mg, 47%). LCMS: [M+H].sup.+=499.3.

    Example 426 (Compound 313)

    1-{Amino[5-(2-hydroxypropan-2-yl)-1,3-thiazol-2-yl]oxo-λ.SUP.6.-sulfanylidene}-3-[7-(3,4-dimethylphenyl)-2,3-dihydro-1H-inden-4-yl]urea

    [4065] ##STR01449## ##STR01450##

    Step 1: N-(2,3-dihydro-1H-inden-4-yl)acetamide

    [4066] To a solution of 2,3-dihydro-1H-inden-4-amine (3.4 g, 26 mmol) in ethanol (45 mL) was added a solution of acetic anhydride (4.9 mL, 52 mmol) in ethanol (15 mL) dropwise at 0° C. The resulting mixture was gradually warmed up to RT and stirred for 15 h. Solvent was removed under reduced pressure and the residue was triturated with diethyl ether to afford titled compound as off white solid (3 g, 66%). LCMS [M+H].sup.+=176.3.

    Step 2: N-(4-bromo-2,3-dihydro-1H-inden-7-yl)acetamide

    [4067] Into a 250-mL round-bottom flask was added N-(2,3-dihydro-1H-inden-4-yl)acetamide (3 g, 17.1 mmol) and acetic acid (45 mL). The resulting solution was cooled to 0° C. and then a solution of bromine (5.4 g, 34.2 mmol) in acetic acid (12 mL) was added dropwise with stirring over 10 min. The cooling bath was removed and the reaction mixture was stirred at RT for 1 h. Water was added and the resulting precipitates of product were collected by filtration and dried under vacuum to afford titled compound as off white solid (3.9 g, 90%). LCMS [M+H].sup.+=254.4.

    Step 3: N-(2,3-dihydro-4-(3,4-dimethylphenyl)-1H-inden-7-yl)acetamide

    [4068] A mixture of N-(4-bromo-2,3-dihydro-1H-inden-7-yl)acetamide (1 g, 3.9 mmol), 3,4-dimethylphenylboronic acid (700 mg, 4.68 mmol), Pd(dppf)Cl.sub.2.DCM (160 mg, 0.19 mmol), sodium carbonate (900 mg, 8.58 mmol as 2 M aqueous solution) in dioxane (12 mL) was stirred at 100° C. in an oil bath for 72 h. The reaction mixture was brought to RT, water (20 mL) was added and extracted with EtOAc (15 mL×3). The combined organic layers were washed with brine, dried over MgSO.sub.4, filtered, and concentrated in vacuo. The crude product was purified by silica gel flash chromatography using 0-30% gradient of EtOAc in hexanes to afford titled compound (880 mg, 81%). LCMS [M+H].sup.+=280.6.

    Step 4: 2,3-Dihydro-7-(3,4-dimethylphenyl)-1H-inden-4-amine

    [4069] A solution of N-(2,3-dihydro-4-(3,4-dimethylphenyl)-1H-inden-7-yl)acetamide (880 mg, 3.15 mmol) in 6 N HCl (20 mL) was stirred at 100° C. for 40 h. After consumption of the starting material, the reaction mixture was cooled to 0° C. and adjusted to pH=8 with 10 M aqueous sodium hydroxide solution. The precipitates formed were collected, washed with water and dried under vacuum to afford the titled compound (81 mg, 67%) as tan colored powder. LCMS [M+H].sup.+=238.3.

    Step 5: 1-{Amino[5-(2-hydroxypropan-2-yl)-1,3-thiazol-2-yl]oxo-λ.SUP.6.-sulfanylidene}-3-[7-(3,4-dimethylphenyl)-2,3-dihydro-1H-inden-4-yl]urea

    [4070] To a solution of N-(tert-butyldimethyl silyl)-5-(2-hydroxypropan-2-yl)-1,3-thiazole-2-sulfonoimidamide (42 mg, 0.13 mmol) in DMF (1 mL) was added Et.sub.3N (35 uL, 0.25 mmol) and the resulting mixture was stirred at room temperature for 10 min, followed by the addition of CDI (41 mg, 0.25 mmol). The reaction mixture was further stirred at RT for 1 h, and then 2,3-dihydro-7-(3,4-dimethylphenyl)-1H-inden-4-amine (30 mg, 0.13 mmol) was added. The resulting reaction mixture was stirred overnight at room temperature. The presence of desired product was then confirmed by LC-MS. The reaction mixture was quenched with 4 M HCl in dioxane (1 mL) and stirred for 30 min to de-protect the TBS group which indicated the formation of desired product on LCMS. The crude product was purified by preparative HPLC to provide titled compound (16.4 mg, 27%). LCMS [M+H].sup.+=485.49.

    Example 427 (Compound 314)

    1-{Amino[5-(2-hydroxypropan-2-yl)-1,3-thiazol-2-yl]oxo-λ.SUP.6.-sulfanylidene}-3-[8-(3,4-dimethylphenyl)-1,2,3,5,6,7-hexahydro-s-indacen-4-yl]urea

    [4071] ##STR01451##

    Step 1: 1,2,3,5,6,7-Hexahydro-8-(3,4-dimethylphenyl)-s-indacen-4-amine

    [4072] 8-Bromo-1,2,3,5,6,7-hexahydro-s-indacen-4-amine (105 mg, 0.42 mmol), 3,4-dimethylphenyl-boronic acid (187 mg, 1.25 mmol), Pd(dppf)C.sub.12 (30.4 mg, 0.04 mmol) and dioxane (1.5 mL) were added to a reaction vial. Cesium carbonate (1.24 mL, 1 M in H.sub.2O) was then added and the reaction mixture was stirred at 80° C. for 16 h. Reaction mixture was brought to RT and filtered through a small bed of Celite and rinsed with dioxane (5 mL). Water (5 mL) was added to the filtrates and extracted with diethyl ether (5 mL×3). The combined organic layers were washed with brine, dried over anhydrous MgSO.sub.4, filtered, and concentrated in vacuo to provide titled compound which was used in the next step without any purification. LCMS [M+H].sup.+=278.4.

    Step 2: 1-{Amino[5-(2-hydroxypropan-2-yl)-1,3-thiazol-2-yl]oxo-λ.SUP.6.-sulfanylidene}-3-[8-(3,4-dimethylphenyl)-1,2,3,5,6,7-hexahydro-s-indacen-4-yl]urea

    [4073] ##STR01452##

    [4074] The title product was obtained using similar procedure as in Step 5 Example 426. LCMS: [M+H].sup.+=525.42.

    Example 428 (Compound 309)

    3-[Amino(dimethyl-1,3-thiazol-5-yl)oxo-λ.SUP.6.-sulfanylidene]-1-[4-fluoro-2,6-bis(propan-2-yl)phenyl]urea

    [4075] ##STR01453##

    Step 1: N-(tert-butyldimethylsilyl)-2,4-dimethyl-1,3-thiazole-5-sulfonamide

    [4076] Dimethyl-1,3-thiazole-5-sulfonamide (41.4 mg, 0.22 mmol) was dissolved in anhydrous CH.sub.2C.sub.12 (2 mL). Triethylamine (0.090 mL, 0.65 mmol) and TBSCl (38 mg, 0.25 mol) were added and the resulting mixture was stirred at 50° C. for 18 h. Reaction mixture was brought to RT and used directly in the next step. LCMS: [M+H].sup.+=307.2.

    Step 2: N-(tert-butyldimethylsilyl)-2,4-dimethyl-1,3-thiazole-5-sulfonoimidamide

    [4077] Polymer bound dichlorotriphenylphosphorane reaction mixture (described for Reagent 2) was cooled in an ice/water bath under nitrogen. Triethylamine (0.1 mL, 0.72 mmol, 2.25 equiv.) was added slowly via syringe. Resulting mixture was stirred at 0° C. for 10 min and then the reaction mixture from Step 1 above was added dropwise via syringe. This reaction mixture was further stirred at 0° C. for 30 min and then a steady stream of anhydrous ammonia was bubbled into the reaction mixture for 3 min. Reaction vial was screw capped and stirred in ice/water bath for 2 h. Reaction mixture was warmed up to room temperature, carefully opened and filtered to remove resin. The cloudy filtrate was centrifuged to remove any solids. Supernatant was concentrated in vacuo and dried under high vacuum for 1 h and used directly in the next step. LCMS: [M+H].sup.+=306.8.

    Step 3: 3-{[(Tert-butyldimethylsilyl)amino](dimethyl-1,3-thiazol-5-yl)oxo-λ.SUP.6.-sulfanylidene}-1-[4-fluoro-2,6-bis(propan-2-yl)phenyl]urea

    [4078] To the crude reaction mixture from Step 2 was added anhydrous THF (1.5 mL) and the resulting mixture was stirred in an ice/water bath for 5 min. NaH (17 mg, 0.44 mmol) was added and after 2 min of stirring a solution of isocyanate (0.165 mmol) in THF (3 ml) was added dropwise at 0° C. The resulting mixture was brought to RT and stirred for 15 min to give a mixture of crude products. LCMS: [M+H].sup.+=527.5; for de-protected product, [M+H].sup.+=413.5.

    Step 4: 3-[amino(dimethyl-1,3-thiazol-5-yl)oxo-λ.SUP.6.-sulfanylidene]-1-[4-fluoro-2,6-bis(propan-2-yl)phenyl]urea

    [4079] To the reaction from Step 3 was carefully added 4N HCl in dioxane (0.3 mL) and the resulting mixture was stirred at RT for 30 min or till the completion of reaction as determined by the LCMS analysis ([M+H].sup.+=413.5). Reaction mix was then concentrated in vacuo. DMSO (0.8 mL) was added to the residue and purified by prep-HPLC to afford titled compound (10 mg).

    [4080] Examples in the following table were prepared using similar procedures described in Example 428.

    TABLE-US-00038 TABLE 29 Example Final LCMS: # Target # IUPAC Name Structure [M + H].sup.+ 428 309 3-[amino(dimethy1-1,3- thiazol-5-yl)oxo-λ.sup.6- sulfanylidene]-1-[4-fluoro- 2,6-bis(propan-2- yl)phenyl]urea [01454]embedded image 413.16 430 310 3-[amino({1-methy1-1H- pyrazolo[3,4-b]pyridin-5- yl})oxo-λ.sup.6-sulfanylidene]- 1-[4-fluoro-2,6-bis(propan- 2-yl)phenyl]urea [01455]embedded image 433.27 431 306 1-{amino[5- (dimethylamino)naphthalen- 1-yl]oxo-λ.sup.6 sulfanylidene}-3-[4-fluoro- 2,6-bis(propan-2- yl)phenyl]urea [01456]embedded image 471.70

    [4081] The following protocol is suitable for testing the activity of the compounds disclosed herein.

    Procedure 1: IL-1β Production in PMA-Differentiated THP-1 Cells Stimulated with Gramicidin.

    [4082] THP-1 cells were purchased from the American Type Culture Collection and sub-cultured according to instructions from the supplier. Cells were cultured in complete RPMI 1640 (containing 10% heat inactivated FBS, penicillin (100 units/ml) and streptomycin (100 μg/ml)), and maintained in log phase prior to experimental setup. Prior to the experiment, compounds were dissolved in dimethyl sulfoxide (DMSO) to generate a 30 mM stock. The compound stock was first pre-diluted in DMSO to 3, 0.34, 0.042 and 0.0083 mM intermediate concentrations and subsequently spotted using Echo550 liquid handler into an empty 384-well assay plate to achieve desired final concentration (e.g. 100, 33, 11, 3.7, 1.2, 0.41, 0.14, 0.046, 0.015, 0.0051, 0.0017 μM). DMSO was backfilled in the plate to achieve a final DMSO assay concentration of 0.37%. The plate was then sealed and stored at room temperature until required.

    [4083] THP-1 cells were treated with PMA (Phorbol 12-myristate 13-acetate) (20 ng/ml) for 16-18 hours. On the day of the experiment the media was removed and adherent cells were detached with trypsin for 5 minutes. Cells were then harvested, washed with complete RPMI 1640, spun down, and resuspended in RPMI 1640 (containing 2% heat inactivated FBS, penicillin (100 units/ml) and streptomycin (100 μg/ml). The cells were plated in the 384-well assay plate containing the spotted compounds at a density of 50,000 cells/well (final assay volume 50 μl). Cells were incubated with compounds for 1 hour and then stimulated with gramicidin (5 μM) (Enzo) for 2 hours. Plates were then centrifuged at 340 g for 5 min. Cell free supernatant (40 μL) was collected using a 96-channel PlateMaster (Gilson) and the production of IL-1(3 was evaluated by HTRF (cisbio). The plates were incubated for 18 h at 4° C. and read using the preset HTRF program (donor emission at 620 nm, acceptor emission at 668 nm) of the SpectraMax i3× spectrophotometer (Molecular Devices, software SoftMax 6). A vehicle only control and a dose titration of CRID3 (100-0.0017 μM) were run concurrently with each experiment. Data was normalized to vehicle-treated samples (equivalent to 0% inhibition) and CRID3 at 100 μM (equivalent to 100% inhibition). Compounds exhibited a concentration-dependent inhibition of IL-1(3 production in PMA-differentiated THP-1 cells.

    Procedure 2: IL-1β Production in PMA-Differentiated THP-1 Cells Stimulated with Gramicidin.

    [4084] THP-1 cells were purchased from the American Type Culture Collection and sub-cultured according to instructions from the supplier. Prior to experiments, cells were cultured in complete RPMI 1640 (containing 10% heat inactivated FBS, penicillin (100 units/ml) and streptomycin (100 μg/ml)), and maintained in log phase prior to experimental setup. Prior to the experiment THP-1 were treated with PMA (Phorbol 12-myristate 13-acetate) (20 ng/ml) for 16-18 hours. Compounds were dissolved in dimethyl sulfoxide (DMSO) to generate a 30 mM stock. On the day of the experiment the media was removed and adherent cells were detached with trypsin for 5 minutes. Cells were then harvested, washed with complete RPMI 1640, spun down, resuspended in RPMI 1640 (containing 2% heat inactivated FBS, penicillin (100 units/ml) and streptomycin (100 μg/ml). The cells were plated in a 384-well plate at a density of 50,000 cells/well (final assay volume 50 μl). Compounds were first dissolved in assay medium to obtain a 5× top concentration of 500 μM. 10 step dilutions (1:3) were then undertaken in assay medium containing 1.67% DMSO. 5× compound solutions were added to the culture medium to achieve desired final concentration (e.g. 100, 33, 11, 3.7, 1.2, 0.41, 0.14, 0.046, 0.015, 0.0051, 0.0017 μM). Final DMSO concentration was at 0.37%. Cells were incubated with compounds for 1 hour and then stimulated with gramicidin (5 μM) (Enzo) for 2 hours. Plates were then centrifuged at 340 g for 5 min. Cell free supernatant (40 μL) was collected using a 96-channel PlateMaster (Gilson) and the production of IL-1β was evaluated by HTRF (cisbio). A vehicle only control and a dose titration of CRID3 (100-0.0017 μM) were run concurrently with each experiment. Data was normalized to vehicle-treated samples (equivalent to 0% inhibition) and CRID3 at 100 μM (equivalent to 100% inhibition). Compounds exhibited a concentration-dependent inhibition of IL-1β production in PMA-differentiated THP-1 cells.

    Procedure 3

    1. Experimental Procedure

    [4085] 1.1 Cell Culture [4086] 1) Culture THP-1 cells in the complete RPMI-1640 medium with 10% FBS at 37° C., 5% CO.sub.2. [4087] 2) Passage the cells every 3 days by inoculating 3×10.sup.5 cells per ml.

    [4088] 1.2 Compound Preparation [4089] Prepare the 3-fold serial dilution of the compounds with DMSO in a 384-well LDV Microplate using TECAN EVO system to generate the compound source plate with 10 concentrations. Top concentration is 30 mM. FIG. 3 depicts the layout of the microplate.

    [4090] 1.3 Cell Preparation [4091] 1) Centrifuge THP-1 cells at 350 g for 5 min. [4092] 2) Re-suspend cells with complete RMPI-1640 medium, and count cells. [4093] 3) Seed cells in T225 flask, about 2.5×10.sup.7 per flask, treat cells with 20 ng/ml PMA (final DMSO concentration<1%). [4094] 4) Incubate overnight.

    [4095] 1.4 THP-1 Stimulation [4096] 1) Wash adherent THP-1 cells with PBS, and detach cells with 4 ml trypsin for T225 flask. [4097] 2) Centrifuge cells at 350 g for 5 min, re-suspend cells with RPMI-1640 containing 2% FBS and count cells with trypan blue. [4098] 3) Transfer 50 nl/well the serial dilution of test compound to 384-well plate by Echo; For the high control and first point of CRID3 (MCC950), transfer 165 nl, then backfill to make the DMSO concentration is consistent in all wells, the plate layout is as below. [4099] 4) Seed 50 k cells in 40 ul RPMI-1640 with 2% FBS per well in 384-well plate. [4100] 5) Incubate for 1 h at 37° C., 5% CO.sub.2. [4101] 6) Prepare 5× gramicidin, add 10 μl per well, the final concentration is 5 μM, incubate for 2 hrs at 37° C., 5% CO.sub.2. [4102] 7) Centrifuge at 350 g for 1 min. [4103] 8) Pipet 16 μl supernatant by apricot, and transfer into white 384 proxiplate. FIG. 3 depicts the layout of the plates: HC: 100 μM CRID3 (MCC950)+5 μM gramicidin LC: 5 μM Gramicidin.

    [4104] 1.5 IL-1β Detection [4105] 1) Homogenize the 5× diluent #5 with a vortex and add 1 volume of stock solution in 4 volumes of distilled water. [4106] 2) Thaw 20× stock solution of anti-IL1β-Cryptate-antibody and anti-IL1β XL-antibody. Dilute these two antibodies to 1× with detection buffer #3. [4107] 3) Pre-mix the two ready-to-use antibody solutions just prior to use. 4) Dispense 4 ul of pre-mixed Anti-IL1β antibodies working solution into all wells. [4108] 5) Seal the plate and incubate overnight at 4° C. [4109] 6) Read the cell plate using EnVison and plot Readout vs. the test compound concentration to calculate the IC.sub.50.

    2. Data Analysis

    [4110] 1. IC.sub.50 of compounds can be calculated using the following formulas


    % inhibition=100−100×[HC.sub.ave−Readout/(HC.sub.ave−LC.sub.ave)]  Formula for IC.sub.50 [4111] 2. Fit the normalized data in a dose-response manner using XLfit, and calculate the compound concentration.
    Table 30 shows the biological activity of compounds in hTHP-1 assay containing 2% fetal bovine serum: <0.008 μM=“++++++”; ≥0.008 and <0.04 μM=“+++++”; ≥0.04 and <0.2 μM=“++++”; ≥0.2 and <1 μM=“+++”; ≥1 and <5 μM=“++”; ≥5 and <30 μM=“+”.

    TABLE-US-00039 TABLE 30 Average IC.sub.50 of compounds in hTHP-1 assay Example # Compound Number hTHP-1 IC.sub.50 1 181 +++++ 2  181a +++++ 3  181b +++ 4 .sup. 101′ ++++ 5 101 or 102 +++ 6 102 or 101 +++++ 7 194 +++ 8 270 + 9 204 >30 μM 10 180 ++++ 11 190 + 12 182 ++++ 13 191 ++++ 14 177 +++++ 15 185 ++++ 16 186 ++++ 17 187 +++++ 18 188 +++ 19 192 ++ 20 189 ++++ 21 178 ++++ 22 193 ++ 23 170 ++++ 24 168 ++ 25 171 ++++ 26 122 ++++ 27 120 +++ 28 125 ++++ 29 129 + 30 213 +++++ 31 207 ++++ 32 195 +++++ 33 179 ++++ 34 105 ++ 35 121 +++ 36 145 ++ 37 131 ++ 38 132 ++++ 39 144 +++ 40 149 ++++ 41 152 ++++ 42 150 + 43 167 ++++ 44 106 +++++ 45 107 ++++++ 46 110 ++ 47 151 +++ 48 154 ++++ 49 148 +++ 50 153 ++ 51 109 ++ 52 135 +++ 53 134 +++++ 54 130 ++ 55 212 +++ 56 205 +++ 57 143 +++ 58 206 ++ 59 108 +++++ 60 202 ++ 61 208 +++++ 62 197 ++++ 63 196 ++ 64 124 ++++ 65 173 ++++ 66 172 + 67 174 +++ 68 158 ++ 69 220 ++ 70 157 ++ 71 161 ++ 72 159 +++ 73 165 ++ 74 183 +++++ 75 176 +++++ 76 136 +++++ 77 209 ++++ 78 203 >30 μM 79 180b or 180a +++++ 80 180a or 180b +++ 81  179b +++++ 82  179a +++ 83 190a or 190b ++ 84 190b or 190a >30 μM 85 182a or 182b +++++ 86 182b or 182a +++ 87 191b or 191a ++++ 88 191a or 191b ++ 89 177b or 177a +++++ 90 177a or 177b +++ 91 185b or 185a ++++ 92 185a or 185b ++ 93 186a or 186b ++++ 94 186b or 186a ++ 95 187a or 187b ++++++ 96 187b or 187a +++ 97 188b or 188a ++++ 98 188a or 188b + 99 192b or 192a +++ 100 192a or 192b + 101 189b or 189a ++++ 102 189a or 189b ++ 103 178b or 178a ++++ 104 178a or 178b ++ 105 193b or 193a +++ 106 193a or 193b + 107 170b or 170a + 108 170a or 170b ++++ 109 168b or 168a +++ 110 168a or 168b >30 μM 111 171b or 171a ++++ 112 171a or 171b + 113 122b or 122a +++++ 114 122a or 122b ++ 115 120b or 120a ++ 116 120a or 120b ++++ 117 125b or 125a ++++ 118 125a or 125b ++ 119 129b or 129a + 120 129a or 129b >30 μM 121 112b or 112a +++++ 122 112a or 112b +++ 123  207c ++++ 124  207aa ++ 125  207b ++++ 126 195a or 195e ++ 127 195e or 195a ++++ 128 105b or 105a +++ 129 105a or 105b + 130 121b or 121a ++++ 131 121a or 121b ++ 132 145b or 145a ++ 133 145a or 145b >30 μM 134 131b or 131a >30 μM 135 131a or 131b ++ 136 225b or 225a ++ 137 225a or 225b ++++ 138 144b or 144a ++ 139 144a or 144b ++++ 140 149b or 149a +++++ 141 149a or 149b ++ 142 152b or 152a ++++ 143 152a or 152b + 144 151b′ or 151a′ >30 μM 145 151a′ or 151b′ + 146 167b or 167a ++ 147 167a or 167b +++ 148 107b or 107a ++++++ 149 107a or 107b +++ 150 110b or 110a + 151 110a or 110b +++ 152 151b or 151a ++++ 153 151a or 151b ++ 154 154b or 154a ++++ 155 154a or 154b ++ 156 148b or 148a +++ 157 148a or 148b + 158 153b or 153a ++ 159 153a or 153b + 160 109b or 109a +++ 161 109a or 109b + 162 135b or 135a +++ 163 135a or 135b + 164 134b or 134a +++++ 165 134a or 134b ++ 166 130b or 130a +++ 167 130a or 130b >11.2150 168 212b or 212a +++ 169 212a or 212b  >5.5915 170 205b or 205a ++ 171 205a or 205b +++ 172 143b or 143a +++ 173 143a or 143b ++ 174 206b or 206a +++ 175 206a or 206b ++ 176 108b or 108a +++++ 177 108a or 108b ++ 178 202b or 202a + 179 202a or 202b ++ 180 116b or 116a ++ 181 116a or 116b + 182 173a or 173b +++++ 183 173b or 173a +++ 184 174b or 174a +++ 185 174a or 174b + 186 223b or 223a ++++ 187 223a or 223b + 188 158b or 158a ++ 189 158a or 158b >30 μM 190 220b or 220a +++ 191 220a or 220b + 192 157a or 157b +++ 193 157b or 157a >30 μM 194 161b or 161a ++ 195 161a or 161b + 196 165b or 165a + 197 165a or 165b >30 μM 198 172b or 172a + 199 172a or 172b >30 μM 200 106a or 106b +++++ 201 106b or 106a +++ 202 136b or 136a ++ 203 136a or 136b ++++++ 204 183a or 183b +++ 205 183b or 183a +++++ 206 176b or 176a +++++ 207 176a or 176b +++ 208 221 + 209 219 >30 μM 210 217 >30 μM 211 216 + 212 215 >30 μM 213 218 >30 μM 214 214 >30 μM 215 211 + 216 210 >30 μM 217 201 + 218 200 ++ 219 199 >30 μM 220 198 + 221 141 ++++ 222 140 +++ 223 321 +++++ 224 321b or 321a +++++ 225 321a or 321b ++ 226 329 +++++ 227 375 ++++ 228 376 ++++ 229 307 ++ 230 323 ++ 231 338 ++ 232 341 ++ 233 342 ++ 234 345 ++ 235 346 ++ 236 347 ++ 237 348 ++ 238 403 ++ 239 402 ++ 240 350 ++ 241 322 ++ 242 351 ++ 243 358 ++ 244 401 + 245 404 + 246 331 + 247 339 + 248 405 + 249 406 >30 μM 250 324 + 251 407 ++ 252 410 >30 μM 253 408 254 308 ++ 255 311 + 256 312 >30 μM 257 327 ++++ 258 326 ++++ 259 139 +++ 260 137 +++ 261 409 ++ 262 303 +++++ 263 325 +++++ 264 138 ++ 265 332 ++++ 266 334 ++++ 267 335 ++++ 268 337 ++ 269 113 +++++ 270 343 ++ 271 349 ++ 272 344 +++ 273 359 + 274 352 +++ 275 354 ++ 276 355 +++ 277 356 >30 μM 278 357 +++ 279 340 +++++ 280 377 +++ 281 378 +++++ 282 379 +++ 283 380 +++ 284 353 + 285 333 ++++ 287 382 ++ 288 383 ++ 289 315 ++++ 290 316 ++ 291 317 ++++ 292 319 ++++ 293 320 +++ 294 336 ++++ 295 330 ++++ 296  364a ++++++ 297  364b +++ 298  365a ++++ 299  365b ++ 300  308a +++ 301  308b + 302 195ba or 195bb +++ 303 195bb or 195ba +++++ 304  207a or 207bb ++++ 305 207bb or 207a  +++++ 306  366a ++++++ 307  366b ++++ 308  139a ++ 309  139b ++++ 310  367a +++++ 311  367b +++ 312  409b ++ 313  409a ++ 314  369a +++ 315  369b + 316  159a +++ 317  159ab ++ 318  159ba +++ 319  137a ++ 320  137b ++++ 321  317ab ++ 322  317aa +++ 323  317bb ++++ 324  317ba +++++ 325  316a >28.4352 326  316b + 327  373a >30 μM 328  373b ++ 329  374a >30 μM 330  374b >30 μM 331  319ab + 332  319aa +++ 333  319bb ++ 334  319ba +++++ 335  320a ++ 336  320b +++ 337  323ab ++ 338  323bb ++ 339  323aa ++ 340  323ba ++ 341  303a ++++++ 342  303b +++ 343  315a ++++ 344  315b ++ 345  138a +++ 346  138b + 347  328a +++++ 348  328b ++ 349  326b ++ 350  326a ++++ 351  318a +++ 352  318b ++++ 353  325a ++ 354  325b +++++ 355  329a ++++++ 356  329b +++ 357  404b + 358  404a >30 μM 359  332a +++++ 360  332b +++ 361  335a ++++ 362  335b ++ 363  336a ++ 364  336b ++++ 365  337a >30 μM 366  337b ++ 367  371a >30 μM 368  371b ++ 369  372a >30 μM 370  372b +++ 371  334a + 372  334b ++++ 373  339a + 374  339b +++++ 375  334ab + 376  334aa + 377  334bb ++++ 378  334ba +++ 379  338a ++ 380  338b >30 μM 381  340a +++++ 382  340b ++ 383  361b >30 μM 384  361a >30 μM 385  113a +++++ 386  113b +++ 387  330a ++ 388  330b ++++ 389  341a >30 μM 390  341b ++ 391  360ba +++ 392  360bb +++ 393  363b +++++ 394  363a +++ 395  343a ++ 396  343b >30 μM 397  359a ++ 398  359b >30 μM 399  352a +++ 400  352b + 401  383a >30 μM 402  383b ++ 403  382a +++ 404  382b + 405  379a 406  379b >30 μM 407  380a + 408  380b ++ 409  380c +++ 410  380d ++++ 411  384a ++ 412  384b >30 μM 413  357a +++ 414  357b + 415  354a >30 μM 416  354b +++ 417  387a ++ 418  387b ++++ 419  333a ++++ 420  333b ++ 421  375a +++++ 422  375b 423  376a +++++ 424  376b 425 318 +++ 426 313 + 427 314 + 428 309 + 430 310 + 431 306 +

    [4112] A number of embodiments of the invention have been described. Nevertheless, it will be understood that various modifications may be made without departing from the spirit and scope of the invention. Accordingly, other embodiments are within the scope of the following claims.