INCREASED ACTIVITY OF ONCOLYTIC NEWCASTLE DISEASE VIRUS

Abstract

The invention relates to Newcastle Disease Vims (NDV), an avian paramyxovirus, which has been demonstrated to possess significant oncolytic activity against mammalian cancers. The invention provides the elucidation of the mechanisms of NDV-mediated oncolysis as well as the development of novel oncolytic viruses through the use of genetic engineering. The invention also provides a nucleic acid encoding a reverse genetically engineered (rg-)NDV having a mutation in the HN gene, said mutation allowing replication of said rgNDV in a cancer cell to a higher level than replication of an otherwise identical rgNDV not having said mutation in the HN gene.

Claims

1. A Newcastle Disease Virus (NDV) for use in ontological treatment of a subject considered in need thereof, wherein said NDV having a mutation in the HN gene providing it with an increased replication capability in a human cancer cell, allowing a replication of said oncolytic NDV in a human cancer cell in higher levels than the parent strain of said NDV not having said mutation.

2. An NDV according to claim 1, wherein said parent strain comprises or is strain MTH-68/H and/or wherein the mutation in the HN gene leads to a change in amino acid sequence of hemagglutinin-neuraminidase, preferably wherein an amino acid in position 277, particularly phenylalanine (F), is substituted, more preferably wherein the amino acid in position 277 is substituted to an amino acid with a hydrophobic side chain except phenylalanine, more particularly wherein the amino acid in position 277 is substituted to leucine (L) at position 277 of the HN gene.

3. An NDV according to claim 1, wherein said subject is a mammal, particularly a mammalian animal or a human, subject.

4. A nucleic acid encoding a NDV, particularly a rgNDV, having a mutation in the HN gene, said mutation allowing replication of said NDV in a cancer cell to a higher level than replication of an otherwise identical NDV not having said mutation in the HN gene, preferably wherein the nucleic acid comprises or consists of at least one of SEQ ID No. 1 to No. 4 or parts thereof, preferably having a sequence identity of at least 75%, particularly at least 90%, more particularly 95%, preferably wherein the nucleic acid is derived from a NDV according to any one of the preceding claims.

5. A nucleic acid according to claim 4 wherein said mutated HN gene encodes hemagglutinin-neuraminidase with an amino acid substitution at position 277 to an amino acid with a hydrophobic side chain other than phenylalanine, particularly a leucine (L), more particularly wherein the mutated HN gene encodes HN.sup.F277L.

6. A nucleic acid according to claim 4, additionally comprising a transgenic construct, wherein said transgenic construct provides for improved lysis of a cancer cell and/or increased replication capability in a human cancer cell, particularly improved lysis of a neoplastic tissue cell, preferably wherein said transgenic construct is selected from the group of nucleic acid constructs encoding one protein or a combination of two or more proteins and/or at least a part thereof selected from the group consisting of a protein that reduces or inhibits interferon expression, a protein with cytokine activity, a protein with antibody activity, a protein with apoptotic activity, a protein capable of blocking checkpoint inhibition, a green fluorescent protein (GFP), and/or a protein capable of enhanced binding (targeting) to a cancer cell.

7. A nucleic acid according to claim 4, comprising a or said transgenic construct, wherein the transgenic construct encodes a protein and/or a part thereof that reduces and/or inhibits interferon expression, such as an IFN-beta receptor, preferably viral protein B18R from vaccinia virus, particularly wherein the nucleic acid comprises or consists of the SEQ ID No. 3 or parts thereof, preferably having a sequence identity of at least 75%, particularly at least 90%, more particularly 95%.

8. A nucleic acid according to claim 4, comprising a or said transgenic construct, wherein the transgenic construct encodes a protein and/or a part thereof with apoptotic activity, such as viral protein-3 from chicken anemia virus, apoptin, particularly wherein the nucleic acid comprises or consists of the SEQ ID No. 2 or parts thereof, preferably having a sequence identity of at least 75%, particularly at least 90%, more particularly 95%.

9. A nucleic acid according to claim 4, comprising a or said transgenic construct, wherein the transgenic construct encodes an antibody and/or a part thereof capable of blocking checkpoint inhibition, such as an antibody directed against checkpoint inhibition protein PD-1, particularly wherein the nucleic acid comprises or consists of the SEQ ID No. 4 or parts thereof, preferably having a sequence identity of at least 75%, particularly at least 90%, more particularly 95%.

10. A nucleic acid according to claim 4, comprising a or said transgenic construct, wherein the transgenic construct encodes a protein and/or a part thereof capable of providing enhanced binding (targeting) of NDV to a cancer cell, particularly like one protein or a combination of two or more proteins and/or at least a part thereof selected from the group consisting of a modified HN protein that is fused to a single-chain antibody against a tumor-associated cell surface protein, a modified HN protein that is fused to a ligand that specifically binds to a tumor-associated cell-surface protein, and/or a bi-specific protein consisting of a single-chain antibody against the rgNDV HN protein fused to a single-chain antibody and/or a ligand that specifically binds to a tumor-associated cell-surface protein.

11. A nucleic acid, encoding a NDV, particularly a rgNDV, more particularly the nucleic acid according to claim 4, and/or having a mutation in the F gene, wherein said mutation is capable of improving oncolytic potential of said NDV, preferably wherein said mutated F gene encodes a fusion protein with an amino acid substitution at position 289 to an amino acid with a hydrophobic side chain other than leucine, particularly an alanine, more particularly wherein the mutated F gene encodes F.sup.L289A.

12. A nucleic acid according to claim 4 additionally having a mutation in the RNA-editing sequence of the P gene that abolishes and/or decreases the expression of the V protein and/or additionally having a deletion in the NP-gene and/or in the V-gene and/or in the HN-gene.

13. A method for preparing a rgNDV, having improved replication in a cancer cell over a parent NDV, said method comprising the steps: a. providing a nucleic acid construct encoding a HN gene with a mutation, wherein the mutation in the HN gene leads to a change in the expression of hemagglutinin-neuraminidase, wherein the amino acid, particularly phenylalanine (F), in position 277 is substituted, particularly wherein the amino acid in position 277 is substituted to an amino acid with a hydrophobic side chain, more particularly wherein the amino acid in position 277 is substituted to having a leucine (L) at position 277 of the HN gene, b. incorporating said nucleic acid construct with said mutation in a nucleic acid encoding a rgNDV, particularly to achieve a nucleic acid according to anyone of claims 4 to 12, c. using said nucleic acid encoding a rgNDV to produce infectious rgNDV, d. comparing the replication characteristics in cancer cells of said rgNDV with the replication characteristics of said parent NDV, e. selecting said rgNDV for further use when is shows improved replication characteristics over said parent NDV.

14. A method according to claim 13, wherein the nucleic acid encoding a rgNDV of step b further comprises a transgenic construct, preferably wherein said transgenic construct encodes a protein which leads to an improved lysis of a cancer cell, particularly improved lysis of a neoplastic tissue cell, more preferably wherein said transgenic construct is one or a combination of two or more selected from the group of nucleic acid constructs encoding a protein that reduces or inhibits interferon expression, encoding a protein with cytokine activity, encoding a protein with antibody activity, encoding a protein with apoptotic activity, encoding a protein capable of blocking checkpoint inhibition, encoding a green fluorescent protein (GFP), and/or encoding a protein capable of enhanced binding (targeting) to a cancer cell.

15. A method according to claim 13, wherein the nucleic acid encoding a rgNDV of step b carries a mutation in the F gene, particularly wherein said mutation is capable of improving oncolytic potential of said rgNDV, preferably wherein said mutation in the F gene comprises or is a mutation which encodes a fusion protein having an amino acid substitution in position 289, particularly a L289A substitution.

16. A method according to claim 13, wherein the nucleic acid encoding a rgNDV of step b further carries a mutation in the RNA-editing sequence of the P gene, particularly that abolishes and/or decreases the expression of the V protein.

17. A pharmaceutical formulation comprising particles of NDV according claim 1, preferably for use in oncological treatment of a subject considered in need thereof, in particular for the treatment of one or more indications selected from the group of brain tumors, like glioblastoma and/or astrocytoma, leukemia, lymphoma, bone tumors, like osteosarcoma and/or Ewing's sarcoma, soft tissue tumors, like rhabdomyosarcoma, gynecological tumors, like breast cancer, ovary cancer and/or cervix cancer, gastrointestinal tumors, like esophageal tumors, stomach tumors, colon tumors, pancreas tumors, prostate tumors, lung tumors, ear, nose & throat (ENT) tumors, tongue tumors, skin tumors, like melanoma, neuroblastoma, mesothelioma, renal cell carcinoma, fibrosarcoma, pheochromocytoma, head and/or neck carcinoma.

18. An NDV according claim 1, wherein it is used for the treatment of one or more indications selected from the group of brain tumors, like glioblastoma and/or astrocytoma, leukemia, lymphoma, bone tumors, like osteosarcoma and/or Ewing's sarcoma, soft tissue tumors, like rhabdomyosarcoma, gynecological tumors, like breast cancer, ovary cancer and/or cervix cancer, gastrointestinal tumors, like esophageal tumors, stomach tumors, colon tumors, pancreas tumors, prostate tumors, lung tumors, ear, nose & throat (ENT) tumors, tongue tumors, skin tumors, like melanoma, neuroblastoma, mesothelioma, renal cell carcinoma, fibrosarcoma, pheochromocytoma, head and/or neck carcinoma.

20. An NDV according to claim 1, wherein a replication of said oncolytic NDV in a human cancer cell in at least 2-fold higher levels than the parent strain of said NDV not having said mutation is achieved.

21. An NDV according to claim 1, which is encoded by and/or which comprises at least one of the nucleic acids according to SEQ ID No. 1 to 4 or parts thereof or having a sequence identity of at least 75%, particularly at least 90%, more particularly 95%.

22. An NDV according to claim 1, wherein said mutated HN gene encodes hemagglutinin-neuraminidase with an amino acid substitution at position 277 to an amino acid with a hydrophobic side chain other than phenylalanine, particularly a leucine (L), more particularly wherein the mutated HN gene encodes HNF277L.

Description

FIGURE LEGENDS

[0047] FIG. 1. NDV reverse genetics

[0048] Schematic presentation of the NDV reverse genetics system. The upper part shows the composition of the Full-length cDNA plasmid which contains the full-length NDV cDNA (encoding the NP, P, M, F, HN, and L proteins) cloned behind the bacteriophage T7 RNA Polymerase promoter (T7P; yellow triangle) and followed by a ribozyme sequence (Rz) and T7 transcription termination signal (T7T). A suitable host cell (shaded round-cornered box) is infected with a recombinant Fowlpox virus that expresses T7 DNA-dependent RNA Polymerase (Fowlpox-T7) and subsequently co-transfected with the full-length cDNA plasmid and three helper plasmids containing the genes encoding the NDV NP, P and L proteins, respectively. Transcription of the full-length cDNA results in the generation of the NDV antigenome RNA which is encapsidated by NP protein then transcribed and replicated by the RNA-dependent RNA Polymerase complex consisting of the L and P proteins, ultimately leading to the generation of infectious NDV.

[0049] FIG. 2. Assembly of full-length NDV cDNA

[0050] Schematic presentation showing the positions and sizes of the subgenomic cDNA fragments that were used to assemble the complete NDV cDNA in the transcription vector pOLTV5 (Peeters et al., 1999, J. Virol. 73:5001-5009). The dots indicate the positions of the G165W mutations in the M gene and the F277L mutation in the HN gene, respectively.

[0051] FIG. 3. Growth kinetics in HeLa cells

[0052] HeLa cells were infected at a multiplicity of infection (MOI) of 0.01 with the indicated viruses. At 0 h, 8 h, 24 h and 48 h after infection, the amount of infectious virus in the supernatant was determined by end-point titration on QM5 cells. MTH68: NDV strain MTH-68/H; MutHu: NDV strain MutHu; rgMTH68: NDV strain MTH-68/H derived by reverse genetics from cloned full-length cDNA; rgMutHu; NDV strain MutHu derived by reverse genetics from cloned full-length cDNA; rgMutHu(HNL277F); rgMutHu in which the amino acid mutation at position 277 in the HN gene was converted from L back to F; rgMutHu(MW165G): rgMutHu in which the amino acid mutation at position 165 in the M gene was converted from W back to G.

[0053] FIG. 4. Growth kinetics in HeLa cells

[0054] HeLa cells were infected at a MOI of 0.01 (left panel) or 1.0 (right panel) with the indicated viruses. At 0 h, 8 h, 24 h and 48 h after infection, the amount of infectious virus in the supernatant was determined by end-point titration on QM5 cells. MTH68: NDV strain MTH-68/H; MutHu: NDV strain MutHu; rgMutHu; NDV strain MutHu derived by reverse genetics from cloned full-length cDNA.

[0055] FIG. 5. Onset of cytopathogenic effect in NDV-infected HeLa cells

[0056] HeLa cells were infected at a MOI of 0.01 (left) or 1.0 (right) with the indicated viruses. At 24 h and 48 h after infection photographs were taken using a light microscope in order to examine the extent of the cytopathogenic effect caused by the different viruses. MTH68: NDV strain MTH-68/H; MutHu: NDV strain MutHu rgMutHu, NDV strain MutHu derived by reverse genetics from cloned full-length cDNA.

[0057] FIG. 6. Schematic presentation of the genomes of the rgMutHu strains.

[0058] The figure shows the position of the genes encoding Apoptin, B18R and Nivolumab which were inserted as extra transcription units into the NDV rgMutHu genome between the P and M genes.

[0059] FIG. 7. Expression of Apoptin by rgMutHu-Apoptin

[0060] Expression of Apoptin was verified by means of immunological staining using monoclonal antibody (MAb) CVI-CAV-111.3 against VP3 of chicken anemia virus (Danen-Van Oorschot, 1997, Proc Natl Acad Sci USA. 94: 5843-5847). Briefly, rgMutHu-Apoptin infected cell monolayers were fixed and incubated with horse-radish peroxidase (HRPO)-conjugated MAb CVI-CAV-111.3 for 1 h, and after washing the monolayers, binding of the MAb to Apoptin was detected by HPRO-assay using 3-amino-9-ethylcarbazole (AEC) as a substrate. (A) Non-infected QM5 cells, (B) QM5 cells infected with rgMutHu-Apoptin.

[0061] FIG. 8. Expression of Nivolumab by rgNDV-Nivolumab

[0062] Undiluted and diluted samples from the supernatant harvested after 48 h from rgMutHu-Nivolumab or rgMutHu infected HeLa cells were used to quantify the amount of Nivolumab using a commercial human IgG4 ELISA kit (ThermoFischer Scientific, catalog number: 88-50590-22). The values in the table represent the OD values and the corresponding standard curve is shown in the right panel. The expression level of Nivolumab amounted to approx. 2000 ng/m L.

[0063] FIG. 9. Real-time cell analysis (RTCA) profiles from HeLa cells infected with different NDV strains at an MOI of 0.01

[0064] The growth of uninfected or NDV-infected HeLa cells was examined by using a RTCA device (iCELLigence™; ACEA Biosciences Inc.) which measures differences in cellular impedance. The functional unit of a cellular impedance assay is a set of gold microelectrodes fused to the bottom surface of a cell culture plate well. When submersed in a current-conductive solution (such as buffer or standard tissue culture medium), the application of an electric potential across these electrodes causes electrons to exit the negative terminal, pass through bulk solution, and then deposit onto the positive terminal to complete the circuit. Because this phenomenon is dependent upon the electrodes interacting with bulk solution, the presence of adherent cells at the electrode-solution interface impedes electron flow. The magnitude of this impedance is dependent on the number of cells, the size and shape of the cells, and the cell-substrate attachment quality. Importantly, neither the gold microelectrode surfaces nor the applied electric potential has an effect on cell health or behavior (https://www.aceabio.com/products/icelligence/).

[0065] Cells were seeded in the wells of the analysis plate and 24 hr later, cells were infected with the indicated viruses at a MOI of 0.01 and further analyzed for 72 h. MTH68: NDV strain MTH-68/H; MutHu: NDV strain MutHu; rgMTH68: NDV strain MTH-68/H derived by reverse genetics from cloned full-length cDNA; rgMutHu; NDV strain MutHu derived by reverse genetics from cloned full-length cDNA; Apoptin: rgMutHu containing the Apoptin gene; Nivolumab; rgMutHu containing the Nivolumab gene; B18R: rgMutHu containing the B18R gene; HeLa: uninfected HeLa cells.

[0066] FIG. 10. RTCA profiles from HeLa cells infected with different NDV strains at an MOI of 0.01

[0067] The growth of uninfected or NDV-infected HeLa cells was examined by using a RTCA device. Cells were seeded in the wells of the analysis plate and 24 hr later the cells were infected with the indicated viruses at a MOI of 0.1 and further analyzed for 72 h. MTH68: NDV strain MTH-68/H; MutHu: NDV strain MutHu; rgMTH68: NDV strain MTH-68/H derived by reverse genetics from cloned full-length cDNA; rgMutHu; NDV strain MutHu derived by reverse genetics from cloned full-length cDNA; Apoptin: rgMutHu containing the Apoptin gene; Nivolumab; rgMutHu containing the Nivolumab gene; B18R: rgMutHu containing the B18R gene; HeLa: uninfected HeLa cells.

[0068] FIG. 11. Cell viability at different time points after infection (MOI=0.1)

[0069] The percentage of viable cells was examined at different time points after infection of HeLa cells with the indicated viruses at a MOI of 0.1. Cell viability was determined by means of the trypan-exclusion assay using a Countess II FL Automated Cell Counter (ThermoFischer).

[0070] FIG. 12. Virus titers at different time points after infection (MOI=0.1)

[0071] HeLa cells were infected with the indicated viruses at a MOI of 0.1 and infectious virus titers in the supernatant were determined at 0 h, 24 h, 48 h and 72 h after infection by end-point titration on QM5 cells. MTH68: NDV strain MTH-68/H; MutHu: NDV strain MutHu; rgMTH68: NDV strain MTH-68/H derived by reverse genetics from cloned full-length cDNA; rgMutHu; NDV strain MutHu derived by reverse genetics from cloned full-length cDNA; rgMutHu-Apoptin: rgMutHu containing the Apoptin gene; rgMutHu-Nivolumab; rgMutHu containing the Nivolumab gene; rgMutHu-B18R: rgMutHu containing the B18R gene.

[0072] FIG. 13. Appendix 2: alignment of 5′-terminal sequences

DETAILED DESCRIPTION

Example 1. Nucleotide Sequence Analysis of Mutant NDV-MutHu

[0073] Newcastle Disease Virus (NDV) is a non-segmented, negative-sense, single-stranded RNA virus belonging to the paramyxovirus family. The natural hosts of NDV are avian species, in particular water- and shorebirds. Some strains of NDV can cause severe and lethal disease in terrestrial poultry such as chickens and turkeys. Infection of humans is rare and is either asymptomatic or limited to a mild and transient conjunctivitis. NDV strains can be categorized into three different groups (pathotypes) based on their pathogenicity for day-old chickens: lentogenic (avirulent), mesogenic (intermediate virulent) and velogenic (virulent). These differences in pathogenicity can largely be explained by differences in the cleavage site in the fusion (F) protein. Lentogenic viruses have a monobasic cleavage site, which can only be cleaved by extra-cellular trypsin-like proteases found in the respiratory and digestive tracts of birds. Mesogenic and velogenic strains have a polybasic cleavage site, which can be cleaved by intra-cellular furin-like proteases, found more abundantly in most cell and organs, explaining why virulent strains can replicate systemically in birds. Several naturally occurring NDV strains have been shown to possess oncolytic anti-tumor properties. In humans, NDV selectively replicates in tumor cells and kills these cells while sparing normal cells. The ratio of killing of cancer cells to normal cells is the therapeutic index for a drug, and the higher it is, the better the efficacy of the drug while minimizing safety-related side effects. The selective replication of NDV in tumor cells is based on several mechanisms, including defects in activation of anti-viral signaling pathways, defects in type-I IFN-signaling pathways, defects in apoptotic pathways, and activation of Ras signaling and expression of Rac1 protein (for recent reviews, see: Schirrmacher, 2015, Expert Opin. Biol. Ther. 15:17 57-71; Zamarin & Palese, 2012, Future Microbiol. 7:347-367).

[0074] We identified a spontaneous mutant of an oncolytic NDV strain MTH-68/H (Csatary et al., 1999, Anticancer Res. 19:635-638.; further called MTH68). The replication capacity of the mutant strain (designated NDV-MutHu) in a variety of human neoplastic cell lines, as well as autologous primary tumors, is greatly enhanced as compared to the original MTH68 strain. We analyzed its nucleotide sequence and found that, compared to MTH68, NDV-MutHu has two nucleotide mutations, one leading to an amino acid substitution in the M protein (G165W) and the other in the HN protein (F277L).

Example 2. A Reverse Genetics System that Allows Genetic Modification of NDV-MutHu

[0075] 2.1 Reverse Genetics

[0076] In order to be able to genetically modify the genome of an RNA virus such as NDV, a manipulatable genetic system must be developed that uses a copy of the full viral RNA (vRNA) genome in the form of DNA. This full-length cDNA is amenable to genetic modification by using recombinant DNA techniques. The authentic or modified cDNA can be converted back into vRNA in cells, which in the presence of the viral replication proteins results in the production of a new modified infectious virus. Such ‘reverse genetics systems’ have been developed in the last few decades for different classes of RNA viruses. This system enables the rapid and facile introduction of mutations and deletions and the insertion of a transgene transcriptional unit, thereby enabling the changing of the biological properties of the virus.

[0077] Reverse genetics systems for several NDV strains, including lentogenic as well as velogenic strains, were developed by the Central Veterinary Institute (CVI), part of Wageningen University and Research, currently Wageningen Bioveterinary Research (WBVR) under the supervision of Dr. Ben Peeters (Peeters et al., 1999, J. Virol. 73:5001-9; de Leeuw et al., 2005, J. Gen. Virol. 86:1759-69; Dortmans et al., 2009, J. Gen. Virol. 90:2746-50). In order to generate a reverse genetics system for NDV-MutHu, a similar approach was used. Details of the procedure can be found in the above cited papers and in the paragraphs below. Briefly, the system consists of 4 components, i.e., a transcription plasmid containing the full-length (either authentic or genetically modified) cDNA of the virus, which is used to generate the vRNA, and 3 expression plasmids (‘helper plasmids’) containing the NP, P and L genes of NDV respectively, which are used to generate the vRNA-replication complex (consisting of NP, P and L proteins). Transcription of the cDNA (i.e. conversion of the cDNA into vRNA) and expression of the NP, P and L genes by the helper plasmids is driven by a T7 promoter. The corresponding T7 DNA-dependent RNA polymerase (T7-RNAPol) is provided by a helper-virus (Fowlpox-T7).

[0078] In order to rescue virus, the 4 plasmids are co-transfected into Fowlpox-T7 infected cells (FIG. 1). Three to five days after transfection, the supernatant is inoculated into specific-pathogen-free embryonated chicken eggs (ECE) and incubated for 3 days. Infectious virus that is produced by transfected cells will replicate in the ECE and progeny virus can be harvested from the allantois fluid.

[0079] In order to develop a reverse genetics system for NDV-MutHu the following steps were followed: [0080] Generation of sub-genomic NDV-MutHu cDNA's by RT-PCR [0081] Assembly of full-length cDNA in a transcription vector [0082] Cloning of each of the NP, P and L genes into an expression vector [0083] Verify nucleotide sequence of full-length cDNA and helper-plasmids [0084] Repair nucleotide differences resulting from the cloning procedure, if necessary [0085] Rescue of infectious virus from cDNA using co-transfection (FIG. 1)

[0086] 2.2 Construction of Full-Length NDV-MutHu cDNA and Helper Plasmids

[0087] NDV-MutHu (passage 28 HeLa cells) was used for the isolation of vRNA using standard procedures. The vRNA was used to generate first-strand cDNA by means of Reverse Transcriptase followed by PCR to generate 4 sub-genomic cDNA fragments (designated C1, C2, C3 and C8). The full-length cDNA of NDV-MutHu was assembled from these fragments and cloned in the transcription vector pOLTV5 (Peeters et al., 1999, J. Virol. 73:5001-5009) by a combination of In-Fusion® cloning and classical cloning using restriction enzymes. An overview of the procedure is shown in FIG. 2, and further details can be found in Appendix 1 of this reference. The resulting plasmid was designated pFL-NDV_MutHu. The NP, P and L-genes of NDV-MutHu were obtained by RT-PCR (Appendix 1) and cloned in the expression plasmid pCVI which was derived by deletion of a Clal restriction fragment from pCI-neo (Promega). The resulting helper plasmids were designated pCVI-NP.sup.MutHu, pCVI-P.sup.MutHu and pCVI-L.sup.MutHu.

[0088] 2.3 Nucleotide Sequence Analysis

[0089] Nucleotide sequence analysis was used to verify that the sequence of pFL-NDV MutHu was correct. A few nucleotides which differed from the Reference sequence were repaired (Table 1). These mutations may represent a minority species in the original virus stock or may be the result of the technical approach such as misincorporation of nucleotides during reverse-transcription and/or PCR-amplification. Two silent mutations (i.e., not leading to an amino acid change) were left unchanged (nt 1318 and 2339; see Table 1).

[0090] We noted a deletion of 1 nt in the Reference sequence compared to the rgMutHu sequence at position 11749. Since this deletion would result in a frameshift in the L-gene (and as a consequence a prematurely terminated L protein), we verified the nucleotide sequence of this region in the NDV-MutHu virus stock. The deletion was not present in the virus sequence and thus probably represents a sequencing error in the Reference sequence. A difference was also noted at position 13529 in the L gene sequence (T in Reference sequence; C in rgMutHu). This region was also verified several times using cDNA from 3 independent RT reactions. Each time the nucleotide at this position proved to be a C. Therefore, we assume that also this difference is due to a sequencing error in the Reference sequence. The change from T to C at this position results in an amino acid substitution from Tryptophan (Y) to Cysteine (C).”

TABLE-US-00001 TABLE 1 Differences in nucleotide sequence between rgMutHu and the MutHu reference sequence MutHu Position Gene Ref rgMutHu remark 1318 NP G A silent 2339 P A G silent; also, G in pCVI-P.sup.MutHu 5123 F G T > G repaired 8721-8727 L 5 × A insert repaired 10383 L C A > C repaired 10417 L G A > G repaired 11749 L del 1 nt A error in Ref seq 13529 L T C Y > C; also, C in pCVI-L.sup.MutHu

[0091] When comparing the nucleotide sequences of strains MutHu and MTH68 with those of other NDV strains, including strain Mukteswar (a mesogenic strain from which MTH68 is probably derived; Lancaster, 1964, Vet. Bull. 34:57-67), we noted a few differences in the last 20 nucleotides of the 5′-end of the viral genome (Appendix 2). These differences seem to be unique for MTH68/MutHu. Whether these differences are relevant for the oncolytic properties of these viruses is not clear.

[0092] 2.4 Rescue of Infectious Virus from pFL-NDV MutHu

[0093] In order to generate infectious virus, we used the co-transfection system described above (and illustrated in FIG. 1) to transfect QM5 cells (derived from Quail) using plasmid pFL-NDV_MutHu and the helper plasmids pCVI-NP.sup.MutHu, pCVI-P.sup.MutHu and pCVI-L.sup.MutHu. Rescue of infectious virus was successful as demonstrated by the presence of infectious virus in the allantoic fluid of ECE that were inoculated with the transfection supernatant (data not shown). The identity of the rescued virus was determined by RT-PCR followed by sequencing. The rescued virus was designated rgMutHu.

[0094] 2.5 Restoration of Amino Acid Substitutions in the HN and M Proteins and Rescue of Corresponding Viruses

[0095] The observation that NDV-MutHu replicates in HeLa cells to virus titers that are at least 10-fold higher than those of strain MTH68 suggests that either one or both of the amino acid differences between these two strains is responsible for this phenotype. In order to address this issue, plasmid pFL-NDV_MutHu was used to restore the two amino acid mutations either individually or simultaneously to the MTH68 sequence. Using In-Fusion® or classical restriction-enzyme based cloning procedures, three different plasmids were generated containing the desired alterations. These plasmids were designated pFL-NDV_MutHu(M.sup.W165G), pFL-NDV_MutHu(HN.sup.L277F) and pFL-NDV_MutHu(M.sup.W165G/HN.sup.L277F), respectively. Subsequently, virus was rescued from these plasmids using the above described procedure. All three viruses were rescued successfully (Table 3). It should be noted that the DNA sequence of plasmid pFL-NDV_MutHu(M.sup.W165G/HN.sup.L277F) is identical to that of strain MTH68 and therefore the rescued virus rgMutHu(M.sup.W165G/HN.sup.L277F) can be regarded as rgMTH68.

TABLE-US-00002 TABLE 2 rescued viruses Virus Remark rgMutHu 2 amino acid substitutions compared to MTH68 rgMutHu(M.sup.W165G) Amino acid 165 in M restored from W to G rgMutHu(HN.sup.L277F) Amino acid 277 in HN restored from L to F rgMutHu(M.sup.W165G/HN.sup.L277F) = Both amino acids restored to MTH68 rgMTH68 sequence W = Tryptophan; G = Glycine; L = Leucine; F = Phenylalanine

Example 3. Identify Whether One or Both of the Amino Acid Substitutions in NDV-MutHu are Responsible for the Difference in Growth Kinetics Between NDV-MutHu and the Parent Strain MTH68

[0096] 3.1 Growth Kinetics in HeLa Cells

[0097] The rescued rg-viruses (Table 2) as well as the original MutHu and MTH68 viruses were used to determine their growth-kinetics in HeLa cells. Briefly, 4×10.sup.6 HeLa cells were seeded in 25 cm.sup.2 cell culture flasks and grown overnight. The cells were infected using a MOI of 0.01 (i.e., 1 infectious virus particle per 100 cells), and at 8, 24 and 48 hours after infection the virus titer in the supernatant was determined by end-point titration on QM5 cells.

[0098] The data (FIG. 3) indicate that strains MutHu and rgMutHu yield at least 10-fold higher virus titers than MTH68. Furthermore, the data indicate that the mutation at amino acid position 277 in the HN gene is responsible for this effect. The M mutation does not seem to have an effect. This can be best seen when looking at the virus titers 24 h after infection, or even better when comparing the increase in virus titer between 8 h and 24 h (the exponential growth phase). The virus titer shows an increase of 3.5 (log 10) for MutHu, rgMutHu and rgMutHu(M.sup.W165G), whereas this is 2.5 for MTH68, 2.7 for rgMutHu(HN.sup.L277F) and 3.0 for rgMTH68 (Table 3).

TABLE-US-00003 TABLE 3 Virus titers (log10 TCID50/ml) Time after infection (h) Virus 0 8 24 48 MTH68 4.8 4.5 7.0 7.0 MutHu 5.0 4.3 7.8 8.3 rgMTH68 5.0 4.0 7.0 7.5 rgMutHu(HN.sup.L277F) 5.0 4.3 7.0 7.3 rgMutHu(M.sup.W165G) 4.8 4.3 7.8 7.5 rgMutHu 5.3 4.5 8.0 8.0

[0099] 3.2 Time of Induction of Cytopathogenic Effect (CPE)

[0100] In an independent earlier experiment, we compared the growth-kinetics of strains MTH68, MutHu, and rgMutHu in HeLa cells using the same conditions as described above, except that also an infection with an MOI=1 was used. Also in this case we noted that strains MutHu and rgMutHu yield at least 10-fold higher virus titers compared to MTH68 (FIG. 4).

[0101] During the course of this experiment we noted differences in the onset of cytopathogenic effect (CPE) caused by the different viruses. Notably, MTH68 induced CPE earlier than either MutHu or rgMutHu (FIG. 5).

[0102] 3.3 Conclusions [0103] A reverse genetics system was established for the oncolytic NDV strain NDV-MutHu [0104] Infectious virus, designated rgMutHu, was successfully rescued from cloned full-length NDV-MutHu cDNA [0105] NDV-MutHu and rgMutHu have similar growth kinetics in HeLa cells [0106] The HN.sup.277 mutation appears to be responsible for the improved growth kinetics of NDV-MutHu compared to MTH68 [0107] rgMutHu in which the HN and M mutations have been restored [rgMutHu(M.sup.W165G/HN.sup.L277F)] is identical to rgMTH68 [0108] In HeLa cells MTH68 appears to induce CPE earlier than NDV-MutHu and rgMutHu, but NDV-MutHu and rgMutHu reach ˜10-fold higher virus titers [0109] Genetic modification (including the insertion of therapeutic transgenes) of oncolytic NDV strains NDV-MutHu and MTH68 is now possible

Example 4. Generation of Recombinant NDV-MutHu Strains with Enhanced Oncolytic and Immune Stimulating Properties Due to the Expression of Different Therapeutic Proteins

[0110] To this end, three different rgMutHu strains were generated, expressing the genes for:

[0111] 1) Apoptin

[0112] 2) B18R

[0113] 3) Nivolumab

[0114] Apoptin (VP3 from chicken anemia virus) has been shown to selectively induce apoptosis in human tumor cells, but not in normal human cells.

[0115] B18R (from Vaccinia virus) is a homolog of the human IFN-β receptor. The secreted form of B18R acts as a decoy for IFN-β, thereby inhibiting IFN-mediated activation by cell signaling of the antiviral host response in naive cells.

[0116] Nivolumab is a human IgG4 anti-PD-1 monoclonal antibody (MAb) that is a checkpoint inhibitor, blocking a signal that prevents activated T cells from attacking the cancer, thus allowing the immune system to clear the cancer. Binding of Nivolumab to PD-1 on T-cells results in the elimination of downregulation of T-cell effector responses by cancer cells.

[0117] The properties of the recombinant viruses in comparison to the parent strain rgNDV-MutHu and strain MTH68 were examined by performing growth kinetics experiments and cytotoxicity assays in HeLa cells. In addition, we followed the fate of infected cells by using a RTCA that determines changes in attachment, size and morphology.

[0118] 4.1 Generation of Recombinant Viruses

[0119] Recombinant NDV-MutHu viruses (rgNDV-MutHu) expressing Apoptin, B18R or Nivolumab were generated by means of the previously established reverse genetics system described above. Synthetic genes containing the open reading frames encoding the different proteins were obtained from GenScript Inc. and cloned between the P and M genes of NDV-MutHu (FIG. 6). The genes were provided with the necessary NDV gene-start and gene-end sequences in order to allow transcription by the vRNA polymerase.

[0120] Nivulomab as a MAb consists of two proteins, i.e., IgG heavy (H) and light (L) chains. In order to allow expression of both proteins from one gene, we generated a fusion-construct that encodes H and L chains as a fusion protein separated by a furin cleavage site and the T2A peptide (Chng et al., 2015, mAbs 7:403-412). Due to a ribosomal stop-start event at the T2A peptide during translation, this results in two separate proteins (H chain and L chain) in equimolar amounts. Furthermore, we used the H7 and L2 signal sequences for the H and L chain, respectively, to allow secretion of the proteins (Haryadi et al., 2015, PLoS ONE 10(2): e0116878. doi: 10.1371/journal.pone.0116878). The secreted H and L chains assemble with each other to form the final IgG molecule.

[0121] Infectious virus was rescued for all three constructs, and virus stocks were prepared by two passages in HeLa cells. The nucleotide sequences of the inserted genes in the different recombinant viruses were verified by means of nucleotide sequence analysis and found to be correct. Faithfull expression of Apoptin by rgMutHu-apoptin was verified by means of immunological staining of rgMutHu-apoptin infected monolayers using a MAb against Apoptin (FIG. 7). Expression of Nivolumab was verified and quantified by means of a commercial human IgG4 ELISA. Expression levels of Nivolumab reached approximately 2 μg/mL (FIG. 8).

[0122] 4.2 Cytotoxicity Assays and Growth Kinetics

[0123] In order to examine the cytotoxic properties of the recombinant viruses and compare them to those of the parent virus rgMutHu as well as rgMTH68, we performed RTCA using a iCELLigence device which measures differences in cellular impedance. The functional unit of a cellular impedance assay is a set of gold microelectrodes fused to the bottom surface of a cell culture plate well. When submersed in an electrically conductive solution (such as buffer or standard tissue culture medium), the application of an electric potential across these electrodes causes electrons to exit the negative terminal, pass through bulk solution, and then deposit onto the positive terminal to complete the circuit. Because this phenomenon is dependent upon the electrodes interacting with bulk solution, the presence of adherent cells at the electrode-solution interface impedes electron flow. The magnitude of this impedance is dependent on the number of cells, the size and shape of the cells, and the cell-substrate attachment quality. Importantly, neither the gold microelectrode surfaces nor the applied electric potential has an effect on cell health or behavior (https://www.aceabio.com/product/icelligence/).

[0124] HeLa cell were grown in the wells of the device and after approx. 24 h the cells were infected with the different NDV strains (Table 4). The effect on cell proliferation, morphology change, and attachment was then monitored over a period of 4 or 5 days.

TABLE-US-00004 TABLE 4 NDV strains used. Strain Remark MTH68 Original MTH68 strain MutHu Original MutHu strain rgMTH68 MTH68 generated by reverse genetics rgMutHu MutHu generated by reverse genetics rgMutHu-Apoptin rgMutHu containing the Apoptin gene rgMutHu- rgMutHu containing the Nivolumab Nivolumab gene rgMutHu-B18R rgMutHu containing the B18R gene

[0125] FIGS. 9 and 10 show the results of the RTCA using HeLa cells infected with the different NDV strains at 24 h after seeding using a MOI of 0.01 and 0.1, respectively. The first noticeable observation is that the signal generated by all (MOI=0.01) or some (MOI=0.1) of the infected cultures increases above the value for non-infected HeLa cells. This increase does not correspond to cell proliferation (cell division) but is due to a change in morphology and size in the virus-infected cell cultures compared to non-infected cultures. This effect is reversed later in the infection cycle when cells start to die due to the cytotoxic effect of the viral infection. Thus, the rise and fall of the signal after virus infection is a combined effect of morphological changes and cell killing. The infection of HeLa cells induces cellular defense mechanisms (“danger signals”) resulting in the release of cytokines that stimulate the proliferation and/or morphology change of infected as well as non-infected cells. This seems to be in agreement with the observation that the effect is larger and longer-lasting at MOI of 0.01.

[0126] The difference in curves for the different viruses (best seen in FIG. 10; MOI=0.1) shows that the MTH68 strains are more cytotoxic than the MutHu strains. The cytotoxicity of the rgMutHu strains that carry an extra gene (Apoptin, B18R or Nivolumab) seems to be even further delayed.

[0127] We next studied the correlation between the RTCA results on the one hand and cell-killing & virus replication on the other. To this end, we determined the cell viability (percentage of living cells) and the virus titer at different time points after infection (MOI=0.1). Cell viability was determined by using the trypan-blue dye-exclusion assay, whereas infectious virus titers in the supernatant were determined by end point dilution on QM5 cells.

[0128] FIG. 11 shows that MTH68 and MutHu strains are more cytotoxic than the rgMutHu strains that carry an extra gene (Apoptin, Nivolumab or B18R). This appears to be in agreement with the RTCA results although the cytotoxicity seems to be underestimated in the RTCA compared to the viability assay, apparently due the above noted effect of virus infection on the morphology and size of the cells.

[0129] Analysis of the virus replication kinetics (FIG. 12) showed that final virus titers for MTH68 and rgMTH68 were approx. one log lower than those of MutHu and rgMutHu, confirming previous observations. Notably, strains rgMutHu-B18R and rgMutHu-Nivolumab reached virus titers at 72 h post infection that even exceeded those of the parent strain rgMutHu. This was not the case for rgMutHu-Apoptin. At 24 h post infection, however, the virus titers for rgMutHu-B18R and rgMutHu-Nivolumab (as well as rgNutHu-Apoptin) were significantly lower than those of rgMutHu, showing that replication was delayed, probably as a result of the larger genome size.

[0130] The insert-size of rgMutHu-Nivolumab is twice as large as that of rgMutHu-B18R and more than 4 times as large as that of rgMutHu-Apoptin. This difference in size seems to correlate with the cytotoxicity values at 72 h post infection. However, the RTCA signal for the rgMutHu-B18R is much lower compared to that of the other two strains (which are almost similar). This shows that other effects than the genome size are responsible for the observed difference in RTCA signal. These effects are most probably related to the biological functions of the therapeutic proteins.

[0131] In this example 4 we have generated three recombinant NDV-MutHu strains, each expressing a different therapeutic protein, i.e., Apoptin, B18R and Nivolumab. These proteins were chosen because expression of these proteins is expected to result in an enhancement of the oncolytic and/or immune-stimulating properties of NDV-MutHu. Our cytotoxicity assays suggest that the insertion of an extra gene results in a delay in the onset of cell killing. However, this does not necessarily result in lower virus titers. In fact, rgMutHu-B18R and rgMutHu-Nivolumab reached final virus titers which were higher than those of the parent strain rgMutHu (FIG. 12). It seems, therefore, that there is a balance between the onset and duration of cell-killing and the amount of progeny virus that is produced. In this respect, it is noteworthy that rgMutHu-Apoptin did not reach the same virus titers as the other two recombinant viruses. This suggests that expression of Apoptin by rgMutHu-Apoptin results in earlier cell-killing as would be expected from a pro-apoptotic protein. This seems to be confirmed by the cytotoxicity assays (FIG. 11).

[0132] Our data show that the results of the RTCA should be interpreted with some caution since the signal generated by the iCELLigence device underestimates the actual cytotoxic capacity of the recombinant MutHu strains. This is primarily caused by the effect on the RTCA signal of changes in cell morphology and cell size after infection. Thus, the RTCA signal shows a combined effect of morphological changes and cell killing.

[0133] The observation that the recombinant rgMutHu strains have a slower in vitro cytotoxicity (direct cell killing effect) in HeLa cells compared to the parent strain does not necessarily mean that they are inferior as oncolytic viruses for tumor treatment. It has been shown that the anti-cancer effects of replication-competent oncolytic viruses such as NDV are for a large part due to their immune-stimulating properties. Indeed, it has been shown that a non-pathogenic NDV is a potent inducer of type-I IFN and Dendritic Cell maturation, and that intra-tumoral injection of NDV results in distant tumor immune infiltration in the absence of distant virus spread (Zamarin et al., 2014, Sci. Transl. Med. 6(226 Whereas the presence of a transgene seems to have a negative effect on the rate of virus replication and cytotoxicity when compared to the parent strain, the ultimate virus titers of the transgene-expressing rgMutHu strains are comparable or even higher than those of the parent strain (FIG. 12). A slower replication rate in association with the production of a therapeutic protein will benefit the induction of immunological anti-tumor responses perhaps at a modest cost of cytotoxicity. However, compared to rgNDV strains that do not carry the F277L mutation, the intrinsic higher replication rate of rgMutHu strain will compensate for the loss of in vivo replication experienced by rgNDV strains. Therefore, the F277L mutation will enhance both the immune-stimulating as well as the cytotoxic effect.

[0134] An in-vitro effect was anticipated for rgMutHu-B18R since B18R is able to capture IFN-β thereby interfering with IFN-signaling. However, published data suggest that IFN-β expression by HeLa cells is poorly inducible, and that HeLa cells do not produce IFN-β after infection with NDV (Enoch et al., 1986, PLoS ONE 10(2): e0116878 Blach-Olszewska et al., 1977, Arch Immunol Ther Exp (Warsz) 25:683-91). This may explain why we did not observe a clear effect of B18R in rgMutHu-B18R infected HeLa cells. A biological effect is expected for rgMutHu-Nivolumab only in the context of in vivo application since the antibody exerts its function by binding to T-cells expressing PD-1.

Example 5: A Method for Preparing an rgNDV Having Improved Replication in a Cancer Cell Over a Parent NDV and the Resulting rgNDV

[0135] The observation that the F to L substitution at amino acid position 277 in the HN protein of NDV results in improved replication in cancer cells indicates that the HN protein fulfills an as-yet not understood but important function in determining the extent of virus replication in these cells. The substitution of F at position 277 by an amino acid other than L might increase replication to even higher levels. Furthermore, amino acid substitutions at positions other than 277 in the HN protein may have similar or improved effects on the level of virus replication in cancer cells. Also, the combination of two or more amino acid substitutions at different positions in HN, or the deletion of one or more amino acids at specific positions in HN, may result in increased replication levels of rgNDV in cancer cells. Therefore, a systematic survey of the effect of amino acid substitutions and/or deletions in HN of rgNDV on replication in cancer cells is provided herein.

[0136] An rgNDV having improved replication in cancer cells over its parent NDV is obtained by generating rgNDV containing a genetically modified HN gene. Having identified L277 as an important mutation that affects virus replication, it is now provided by such techniques to perform studies to evaluate the effect of substitutions with other amino acids at this position or at other positions in the neighborhood of 277 or at positions elsewhere in HN. Additional studies may also focus on the identification of potential differences in the cellular interaction partners of wt and mutant HN. Using methods known in the art, specific mutations (i.e., substitution of a specific nucleotide by a different nucleotide) or deletions are introduced in a nucleic acid construct containing (part of) the nucleotide sequence encoding the HN protein of NDV. Based on the position(s) and type(s) of the nucleotide substitution(s) or deletions this will result in (a) specific amino acid substitution(s) or deletions in the HN protein. The genetically modified nucleic acid is used to replace the corresponding nucleotides in the full-length NDV genome, which can subsequently be used to generate infectious virus. This collection of mutant rgNDV can be used to examine replication in cancer cells, thus allowing the identification rgNDV with improved replication properties over the parent NDV.

REFERENCES

[0137] Blach-Olszewska et al., (1977) Why HeLa cells do not produce interferon? Arch Immunol Ther Exp (Warsz) 25:683-91. [0138] Chng et al., (2015) Cleavage efficient 2A peptides for high level monoclonal antibody expression in CHO cells, mAbs, 7:2, 403-412; http://dx.doi.org/10.1080/19420862.2015.1008351. [0139] Enoch et al., (1986) Activation of the Human beta-Interferon Gene Requires an Interferon-Inducible Factor, Mol. Cell. Biol. 6:801-10. [0140] Haryadi et al., (2015) Optimization of Heavy Chain and Light Chain Signal Peptides for High Level Expression of Therapeutic Antibodies in CHO Cells. PLoS ONE 10(2): e0116878. doi:10.1371/journal.pone.0116878. [0141] Schirrmacher, (2015) Oncolytic Newcastle disease virus as a prospective anti-cancer therapy. A biologic agent with potential to break therapy resistance. Expert Opin. Biol. Ther. 15:17 57-71 [0142] Zamarin et al., (2014) Localized oncolytic virotherapy overcomes systemic tumor resistance to immune checkpoint blockade immunotherapy. Sci. Transl. Med. 6(226). [0143] Zamarin & Palese, (2017) Oncolytic Newcastle Disease Virus for cancer therapy: old challenges and new directions. Future Microbiol. 7: 347-67.

TABLE-US-00005 APPENDIX 1 primers used for the generation of cDNA fragments and helper-plasmids cDNA fragments Fragment Size Primer Sequence (5′-3′) C1 3.6 kb Noss-9F ACGACTCACTATAGGACCAAACAGAGAATCCGTGAG (SEQ ID No. 5) Noss- CCGGGAAGATCCAGGGCACTCTTCTTGCATGTTAC 121R (SEQ ID No. 6) C2 3.7 kb Noss-122F GGGCCTGCCTCACTATGGTGGTAACATGCAAGAAG (SEQ ID No. 7) Noss- TGCATGTTACCACCAATGTGTCATTGTATCGCTTG 123R (SEQ ID No. 8) C3 5.7 kb Noss-125F CAAGAAGGGAGATACGTAATATACAAGCGATACAATG (SEQ ID No. 9) Noss- TCGCTTGTATATTACTTGTTGTAGCAAAGAGCACC 126R (SEQ ID No. 10) C8 2.0 Noss-133 GGCCTGGATCTTCCCATTATGCTGTCTGTATACGGTGC (SEQ ID No. 11) Noss-10R ATGCCATGCCGACCCACCAAACAAAGACTTGGTGAATG (SEQ ID No. 12) RT-primer RT-21 ACCAAACAGAGAATCCGTG (C1, C2) (SEQ ID No. 13) RT-primer RT-45 AGTCTTCAGTCATGGACAGC (C3, C8) (SEQ ID No. 14) Helper-plasmids (generated by In-Fusion ® cloning in pCVI) Gene primer sequence NP Noss-22F CTCTAGAGTCGACCCTTCTGCCAACATGTCTTCCG (SEQ ID No. 15) Noss-23R GGGAAGCGGCCGCCCGTCGGTCAGTATCCCCAGTC (SEQ ID No. 16) P Noss-24F CTCTAGAGTCGACCCCAGAGTGAAGATGGCCACCTTC (SEQ ID No. 17) Noss- GGGAAGCGGCCGCCCAGTGATCAGCCATTCAGCGC 25R (SEQ ID No. 18) L Noss-26F CTCTAGAGTCGACCCGGGTAGGACATGGCGGGCTC (SEQ ID No. 19) Noss-27R GGGAAGCGGCCGCCCTGCCTTTAAGAGTCACAGTTAC (SEQ ID No. 20)

[0144] Sequences: [0145] SEQ ID No. 1: Nucleic acid (cDNA) sequence of Newcastle disease virus strain (NDV) MutHu genome; [0146] SEQ ID No. 2: Nucleic acid (cDNA) sequence of Newcastle disease virus strain rgMutHu-Apoptin genome created by reverse genetics as disclosed herein, wherein the nucleic acid additionally encodes the pro-apoptotic protein apoptin; [0147] SEQ ID No. 3: Nucleic acid (cDNA) sequence of Newcastle disease virus strain rgMutHu-B18 genome created by reverse genetics as disclosed herein, wherein the nucleic acid additionally encodes a homolog of the human IFN-β receptor; [0148] SEQ ID No. 4: Nucleic acid (cDNA) sequence of Newcastle disease virus strain rgMutHu-Nivolumab genome created by reverse genetics as disclosed herein, wherein the nucleic acid additionally encodes human IgG4 anti-PD-1 monoclonal antibody; [0149] SEQ ID No. 21: Nucleic acid (cDNA) sequence of Newcastle disease virus strain 5′-UTR Mukteswar EF201805 [0150] SEQ ID No. 22: Nucleic acid (cDNA) sequence of Newcastle disease virus strain 5′-UTR NDV MuHu (Noss) [0151] SEQ ID No. 23: Nucleic acid (cDNA) sequence of Newcastle disease virus strain 5′-end MTH68 (CVI) [0152] SEQ ID No. 24: Nucleic acid (cDNA) sequence of Newcastle disease virus strain 5′-end MuHu (CVI) [0153] SEQ ID No. 25: Consensus sequence 1 of SEQ ID No. 21 to 24