COMPOSITION FOR PREVENTION OR TREATMENT OF INTRACTABLE EPILEPSY COMPRISING mTOR INHIBITOR

20210186980 · 2021-06-24

    Inventors

    Cpc classification

    International classification

    Abstract

    Provided is a use of the prophylaxis, amelioration or therapy of intractable epilepsy, for example, Focal Cortical Dysplasia (FCD).

    Claims

    1.-24. (canceled)

    25. A method for preventing or treating Focal Cortical Dysplasia (FCD) type II in a subject, comprising administering to the subject an effective amount of an mTOR inhibitor.

    26. The method of claim 25, wherein the subject has a brain somatic mutation in a gene of the mTOR pathway.

    27. The method of claim 25, wherein the subject has a brain somatic mutation in mTOR, TSC1, TSC2, AKT3, or PIK3CA.

    28. The method of claim 25, wherein the FCD type II is characterized by mTOR hyperactivation, spontaneous seizures, behavioral seizures, electrographic seizures or generation of abnormal neurons in the subject.

    29. The method of claim 28, wherein the mTOR inhibitor decreases the onset frequency of spontaneous seizures, behavioral seizures, or electrographic seizures.

    30. The method of claim 25, wherein the mTOR inhibitor decreases the number or soma size of abnormal neurons in the cerebral cortex.

    31. The method of claim 25, wherein the mTOR inhibitor is administered intracerebroventricularly.

    32. The method of claim 25, wherein the mTOR inhibitor is Rapamycin, [5-[2,4-bis[(3S)-3-methylmorpholin-4-yl]pyrido[2,3d]pyrimidin-7-yl]-2-methoxyphenyl]methanol (AZD8055), 3-[2,4-bis[(3S)-3methylmorpholin-4-yl]pyrido[2,3-d]pyrimidin-7-yl]-N-methylbenzamide (AZD2014), 2methyl-2-[4-(3-methyl-2-oxo-8-quinolin-3-ylimidazo[4,5-c]quinolin-1yl)phenyl]propanenitrile (BEZ235), (Z)-but-2-enedioic acid; 8-(6-methoxypyridin-3-yl)-3methyl-1-[4-piperazin-1-yl-3-(trifluoromethyl)phenyl]imidazo[4,5-c]quinolin-2-one (BGT226), Everolimus, 5-ethyl-3-[2-methyl-6-(1H-1,2,4-triazol-5-yl)pyridin-3yl]-7,8-dihydropyrazino[2,3-b]pyrazin-6-one (CC-115), 3-[6-(2-hydroxypropan-2 yl)pyridin-3-yl]-5-(4-methoxycyclohexyl)-7,8-dihydropyrazino[2,3-b]pyrazin-6-one (CC223), 8-[5-(2-hydroxypropan-2-yl)pyridin-3-yl]-1-[(2S)-2-methoxypropyl]-3methylimidazo[4,5-c]quinolin-2-one (LY3023414), P7170, 1-{(2R)-4-[2-(2Aminopyrimidin-5-yl)-6-(morpholin-4-yl)-9-(2,2,2-trifluoroethyl)-9H-purin-8-yl]-2 methylpiperazin-1-yl}ethan-1-one (DS-7423), (4-[(5Z)-4-amino-5-(7-methoxyindol-2 ylidene)-1H-imidazo[5,1-f][1,2,4]triazin-7-yl]cyclohexane-1-carboxylic acid) (OSI-027), 2-amino-8-[4-(2-hydroxyethoxy)cyclohexyl]-6-(6-methoxypyridin-3-yl)-4methylpyrido[2,3-d]pyrimidin-7-one (PF-04691502), 1-[4-[4-(dimethylamino)piperidine-1carbonyl]phenyl]-3-[4-(4,6-dimorpholin-4-yl-1,3,5-triazin-2-yl)phenyl]urea (PF-05212384), Temsirolimus, 5-(4-amino-1-propan-2-ylpyrazolo[3,4-d]pyrimidin-3-yl)-1,3-benzoxazol-2amine (INK128), [6-(2-amino-1,3-benzoxazol-5-yl)imidazo[1,2-a]pyridin-3-yl]morpholin-4-ylmethanone (MLN1117), Ridaforolimus, Metformin, N-[4-[[3-(3,5dimethoxyanilino)quinoxalin-2-yl]sulfamoyl]phenyl]-3-methoxy-4-methylbenzamide (XL765), 2-amino-8-ethyl-4-methyl-6-(1H-pyrazol-5-yl)pyrido[2,3-d]pyrimidin-7-one (SAR245409), (3S)-4-[[(1S)-1-carboxy-2-hydroxyethyl]amino]-3-[[2-[[(2S)-5(diaminomethylideneamino)-2-[[4-oxo-4-[[4-(4-oxo-8-phenylchromen-2-yl)morpholin-4 ium-4-yl]methoxy]butanoyl]amino]pentanoyl]amino]acetyl]amino]-4-oxobutanoate (SF 1126), 5-(8-methyl-2-morpholin-4-yl-9-propan-2-ylpurin-6-yl)pyrimidin-2-amine (VS5584), (2S)-1-[4-[[2-(2-aminopyrimidin-5-yl)-7-methyl-4-morpholin-4-ylthieno[3,2d]pyrimidin-6-yl]methyl]piperazin-1-yl]-2-hydroxypropan-1-one (GDC0980), (2,4difluoro-N-[2-methoxy-5-(4-pyridazin-4-ylquinolin-6-yl)pyridin-3-yl]benzenesulfonamide) (GSK2126458), a compound of any of chemical formulae 1 to 5: ##STR00001## ##STR00002## or a pharmaceutically-acceptable salt thereof.

    33. The method of claim 26, wherein the brain somatic mutation comprises a mutation in a gene encoding SEQ ID NO: 2, 4, 6, 8, or 10 that results in at least one of: substitution of R at position 206 to C, R at position 624 to H, Y at position 1450 to D, C at position 1483 to R, R at position 1709 to H, T at position 1977 to K, R at position 2193 to C, S at position 2215 to F, L at position 2427 to P, or L at position 2427 to Q, in the amino acid sequence of SEQ ID NO: 2; substitution of R at position 22 to W, R at position 204 to C, or R at position 811 to L in the amino acid sequence of SEQ ID NO: 4; substitution of valine (V) at position 1547 to isoleucine (I) in the amino acid sequence of SEQ ID NO: 6; substitution of arginine (R) at position 247 to histidine (H) in the amino acid sequence of SEQ ID NO: 8; or substitution of aspartic acid (D) at position 1018 to asparagine (N) in an amino acid of SEQ ID NO: 10.

    34. The method of claim 26, wherein the brain somatic mutation includes at least one of: substitution of Cytosine (C) at position 616 to Thymine (T), Guanine (G) at position 1871 to Adenine (A), Thymine (T) at position 4348 to Guanine (G), Thymine (T) at position 4447 to Cytosine (C), Guanine (G) at position 5126 to Adenine (A), Cytosine (C) at position 5930 to Adenine (A), Cytosine (C) at position 6577 to Thymine (T), Cytosine (C) at position 6644 to Thymine (T), Thymine (T) at position 7280 to Cytosine (C), or Thymine (T) at position 7280 to Adenine (A) in the amino acid sequence of SEQ ID NO: 1; substitution of Cytosine (C) at position 64 to Thymine (T), Cytosine (C) at position 610 to Thymine (T), or Guanine (G) at position 2432 to Thymine (T) in the amino acid sequence of SEQ ID NO: 3; substitution of Guanine (G) at position 4639 to Adenine (A) in the nucleotide sequence of SEQ ID NO: 5; substitution of Guanine (G) at position 740 to Adenine (A) in the nucleotide sequence of SEQ ID NO: 7; or substitution of Guanine (G) at position 3052 to Adenine (A) in the nucleotide sequence of SEQ ID NO: 9.

    35. The method of claim 25, wherein the mTOR inhibitor is in a composition that further comprises a pharmaceutically acceptable diluent, excipient, stabilizing agent, surfactant, gelling agent, pH adjusting agent, anti-oxidant, or preservative.

    36. The method of claim 27, wherein the subject has mTOR hyperactivation, spontaneous seizures, behavioral seizures, electrographic seizures or generation of abnormal neurons in the subject.

    Description

    DESCRIPTION OF DRAWINGS

    [0135] FIG. 1a shows post-operative brain MRI images of patients carrying mTOR mutations (FCD4, FCD6), and H&E staining of pathological samples from the patients. The arrowheads (white) indicate resected brain regions and the arrows (black) indicate cytomegalic neurons (Scale bar=50 um).

    [0136] FIG. 1b shows sites of mTOR-associated somatic mutations as found in FCD patients through deep sequencing.

    [0137] FIG. 1c shows evolutionarily conserved amino acid residues responsible for the mTOR-associated somatic mutations on the mTOR sequences.

    [0138] FIG. 2a shows the results of Western blot analysis of S6 phosphorylation in mTOR mutation-expressing HEK293T cells. “P-56” stands for phosphorylated S6 proteins, “S6” for S6 proteins, and “Flag” for flag proteins. “20% serum” represents a positive control with mTOR activity after exposure to 20% serum for 1 hr.

    [0139] FIG. 2b shows the results of an in-vitro kinase assay for mTOR proteins in HEK293 cells expressing the mTOR mutations of the present disclosure.

    [0140] FIG. 2c shows the results of an immunohistochemical assay for S6 phosphorylation level and soma size in pathological samples from patients with FCD-caused intractable epilepsy.

    [0141] FIG. 2d shows the mean numbers of phosphorylated S6 proteins in representative cortical regions of patients with FCD-caused intractable epilepsy (number of counted cells=197-1182 per case).

    [0142] FIG. 2e shows the mean soma sizes of neurons in representative cortical regions of patients with FCD-caused intractable epilepsy.

    [0143] FIG. 3a shows schematic views of a procedure for electroporating embryos in utero at embryonic day 14 (E14) with a plasmid carrying mTOR mutations, followed by screening only mice exhibiting fluorescence with a flashlight (Electron Microscopy Science, USA) after birth, monitoring the mice for seizures through video-electroencephalography (video-EEG), and examining the effect of rapamycin after the onset of seizures. The “in-utero electroporation (E14)” schematically shows the electroporation of a plasmid carrying mTOR mutations at embryonic day 14, the “GFP screening at birth (P0)” schematically shows monitoring only of fluorescence-exhibiting mice with a flashlight (Electron Microscopy Science, USA) after the electroporated embryos are delivered, and the “Video-EEG monitoring (>3 weeks)” schematically shows recording video-EEG with implanted electrodes after video monitoring of seizure onset from the time of weaning (>3 weeks).

    [0144] FIG. 3b shows the presence of spontaneous seizures in mice carrying mTOR mutations of the present disclosure, based on video-EEG recording. The “No. of GFP+pups” represents the number of mice that expressed GFP as a result of the introduction of mTOR mutations thereinto, and the “No. of mice with seizure” represents the number of mice that underwent seizures as a result of the introduction of mTOR mutations thereinto.

    [0145] FIG. 3c shows frequencies of spontaneous seizures in mice carrying mTOR mutations of the present disclosure before and after rapamycin treatment. *p<0.05 and **p<0.01 (n=7-17 for each group, one-way ANOVA with Bonferroni's post test).

    [0146] FIG. 3d shows changes in the soma size of GFP-positive neurons in mice carrying mTOR mutations of the present disclosure before and after rapamycin treatment.

    [0147] FIG. 4 is a schematic view of the experimental design of the present disclosure, showing deep sequencing analysis in tissues from FCD patients, and in-vitro and in-vivo functional analysis.

    [0148] FIG. 5a shows algorithms used to exploit brain-specific mutations using both Virmid (Genome Biology, 14(8), R90 (2013)) and MuTect software (Nature Biotechnology, 31, 213 (2013)) with regard to the deep sequencing results.

    [0149] FIG. 5b shows sequencing counts of reference (Ref) and mutant (Mut) alleles, and percentages of mutated alleles from deep whole exome sequencing and amplicon sequencing of FCD patient samples.

    [0150] FIG. 6 shows somatic mutations of FCD, found by deep whole exome sequencing, as colored bars in the collapsed mode of an Integrative Genomic Viewer (IGV).

    [0151] FIG. 7 shows brain MRI images from FCD patients. Arrows highlight the affected cortical regions.

    [0152] FIG. 8 shows domain organizations and 3-D structures of the mTOR kinase prepared using PyMol1 (the PyMOL Molecular Graphics System, Schrodinger, LLC). “FAT” stands for FRAP, ATM, and TRRAP domains of mTOR, “FRB” for FKBP12-rapamycin binding domain, and “KD” for N and C lobes of the kinase domain. The activation and catalytic loops are indicated in red and blue, respectively. ATPrS and Mg.sup.2+ are shown as sticks and spheres, respectively. Identified mutation sites in FCD patients are labeled in red.

    [0153] FIG. 9a shows the effects of rapamycin on HEK293K cells expressing mTOR mutations.

    [0154] FIG. 9b shows the effects of rapamycin on HEK293K cells expressing mTOR mutations. “P-56K” represents phosphorylated S6 proteins and “S6K” represents S6 proteins.

    [0155] FIG. 9c shows the effects of the compounds of Chemical Formulas 1 to 4 and everolimus on HEK293K cells expressing mTOR mutations. “P-S6K” represents phosphorylated S6 proteins and “S6K” represents S6 proteins.

    [0156] FIG. 10 shows the enrichment of the mTOR mutant allele of the present disclosure, as analyzed by Sanger sequencing after cytomegalic neurons with increased S6 phosphorylation, obtained from pathological tissues of patients with FCD-caused intractable epilepsy, are micro-dissected. NeuN-positive cytomegalic neurons with increased S6 phosphorylation are labeled with yellow dots. “LCM” represents cytomegalic cells microdissected through laser capture microdissection. For a control, bulk genomic DNA, extracted from brain samples without enrichment, was used. Scale bar, 100

    [0157] FIG. 11a is a schematic view of the procedure for in-utero electroporation with a plasmid carrying mTOR mutations of the present disclosure at E14, followed by the analysis of brain coronal sections at E18.

    [0158] FIG. 11b shows images of coronal sections of mouse brains electroporated with mTOR mutants of the present disclosure, representing the disruption of neuronal migrations and mTOR activity. “CP” stands for cortical plate, “IZ” for intermediate zone, “SVZ” for subventricular zone, “VZ” for ventricular zone, “Wild type” for the insertion of a wild-type mTOR plasmid, and “Relative intensity value” for the relative intensity of a GFP (green fluorescent protein) in each case.

    [0159] FIG. 11c shows mTOR activity in the developing mouse neocortex after the introduction of the mTOR mutations of the present disclosure (Scale bars, 20 μm, Error bars, s.e.m.).

    [0160] FIG. 12a shows video-EEG records of spontaneous seizures in mice expressing the mTOR mutations of the present disclosure. “LF” stands for left frontal, “RF” for right frontal, “LT” for left temporal, and “RT” for right temporal.

    [0161] FIG. 12b shows interictal spikes and nonconvulsive electrographic seizures in mice expressing the mTOR mutations of the present disclosure.

    [0162] FIG. 12c shows a change in the frequency of interictal spikes in mice expressing the mTOR mutations of the present disclosure before and after rapamycin treatment.

    [0163] FIG. 12d shows a change in the frequency of nonconvulsive electrographic seizures in mice expressing the mTOR mutations of the present disclosure before and after rapamycin treatment.

    [0164] FIG. 12e shows the time of seizure onset in mice carrying a wild-type mTOR gene or a mTOR mutant of the present disclosure. (n=8-20 for each group). Error bars, s.e.m.

    [0165] FIGS. 13 and 14 show the results of the treatment of HEK293T cells, expressing the mTOR mutations of the disclosure, with various mTOR inhibitors. “P-S6K” stands for phosphorylated S6 kinase, and “S6K” for S6 kinase.

    [0166] FIG. 15 shows the results of Western blot analysis of HEK293T cells carrying wild-type or mutant TSC-1. (−) and (+) indicate a control and rapamycin treatment (200 nM), respectively. “P-S6K” stands for phosphorylated S6 kinase and “S6K” for S6 kinase.

    [0167] FIG. 16 shows the results of Western blot analysis of HEK293T cells carrying wild-type or mutant TSC-2. (−) and (+) indicate a control and rapamycin treatment (200 nM), respectively. “P-S6K” stands for phosphorylated S6 kinase and “S6K” for S6 kinase.

    [0168] FIG. 17 shows the results of Western blot analysis of HEK293T cells carrying wild-type or mutant AKT3. (−) and (+) indicate a control and rapamycin treatment (200 nM), respectively. “P-S6K” stands for phosphorylated S6K kinase and “S6K” for S6K kinase.

    [0169] FIG. 18 shows the association of p.Arg22Trp and p.Arg204Cys mutations of TSC-1 with mTOR hyperactivation, as analyzed in Example 9. Immunoprecipitation assay results are given to identify the mechanism of TSC1 mutant-induced mTOR hyperactivation. “Empty” indicates non-treated cells.

    [0170] FIG. 19 shows the results of the GTP-agarose pull down assay according to Example 9. The activity level of the TSC complex was analyzed by measuring the level of GTP-bound Rheb, a substrate of the TSC complex.

    [0171] FIG. 20 shows results of the treatment of mutant mTOR-expressing HEK293T cells with rapamycin. **p<0.01 and ***p<0.001 (comparison with wild-type, n=3-5 for each group, one-way ANOVA with Bonferroni's post test)

    [0172] FIG. 21 shows the results of the treatment of mutant mTOR-expressing HEK293T cells with rapamycin. “P-S6K” stands for phosphorylated S6 kinase, and “56K” for S6 kinase.

    [0173] FIG. 22 shows the results of the treatment of mutant mTOR-expressing HEK293T cells with the compounds of Chemical Formulas 1 to 4, and everolimus. “P-56” stands for phosphorylated S6, and “S6” for S6 protein.

    [0174] FIGS. 23a and 23b show the results of Western blot analysis of wild-type or mutant mTOR-expressing HEK293T cells before and after treatment with 6 different drugs according to Example 10. (−) and (+) indicate a control and rapamycin treatment (200 nM), respectively. “P-S6K” stands for phosphorylated S6 kinase, and “S6K” for S6 kinase.

    [0175] FIGS. 24a and 24b show the results of Western blot analysis of wild-type or mutant TSC1-expressing HEK293T cells before and after treatment with 6 different drugs. (−) and (+) indicate a control and rapamycin treatment (200 nM), respectively. “P-S6K” stands for phosphorylated S6 kinase, and “S6K” for S6 kinase.

    [0176] FIGS. 25a and 25b show the results of Western blot analysis of wild-type or mutant TSC1-expressing HEK293T cells before and after treatment with 6 different drugs. (−) and (+) indicate a control and rapamycin treatment (200 nM), respectively. “P-S6K” stands for phosphorylated S6 kinase, and “S6K” for S6 kinase.

    [0177] FIGS. 26a and 26c show pathological samples from all FCD patients identified as carrying TSC1 and TSC2 mutations. “Non-FCD” stands for samples with normal brains, “P-56” for phosphorylated S6 proteins, “NeuN” for a neuronal marker, and “Merge” for merged images of P-S6 and NeuN.

    [0178] FIGS. 26b and 26d show percentages of cells expressing phosphorylated S6 in 4-5 cortical regions.

    [0179] FIGS. 26e and 26f show the soma sizes of neuronal marker (NeuN)-positive neurons. *p<0.05, **P<0.001, ***P<0.0001 [relative to Non-FCD samples, one-way ANOVA with Bonferroni posttest]. Error bars, s.e.m. Scale bars, 50 um.

    [0180] FIG. 27a shows the disruption of neuronal migration in TSC mouse models, resulting in malformations of cortical developments. “Control” indicates the absence of sgRNA, and red letters indicate percentages of cells expressing the plasmids. Scale bars, 250 um. FIG. 27b shows the distribution of electroporated cells in the cortex. *p<0.05, ***P<0.0001 [Two-way ANOVA with Bonferroni posttest]. Error bars, s.e.m.

    [0181] FIG. 28 shows electrographic seizures measured in TSC mouse models with spontaneous seizures after administration with rapamycin. *p<0.05 and **p<0.01 (n=7-17 for each group, one-way ANOVA with Bonferroni's post test)

    MODE FOR INVENTION

    [0182] A better understanding of the present invention may be obtained through the following examples which are set forth to illustrate, but are not to be construed as limiting the present invention.

    Example 1: Identification of Gene by Whole Exome Sequencing, and Confirmation

    Example 1-1: Identification of 3 Candidate mTOR Mutations from 4 Patients Through Whole Exome Sequencing

    [0183] Deep whole exome sequencing (read depth 412-668×) was performed on brain tissue samples from four FCDII patients (designated FCD3, FCD4, FCD6, and FCD23, respectively). Selection was made of three candidate genetic mutations that were found simultaneously using the two algorithms Virmid and Mutect.

    [0184] To obtain data of the whole exome sequencinge, libraries of sequences were prepared using the Agilent library preparation protocols (Agilent Human All Exon 50 Mb kit) according to the manufacturer's instructions. The libraries were subjected to sequencing on Hiseq2000 (Illumina). For more accurate analysis, sequencing was carried out with a read depth of about 500×, five-times higher than the general sequencing depth. The sequencing data was prepared into a file that can be analyzed using the Best Practices Pipeline suggested by Broad Institute (https://www.broadinstitute.org/gatk/).

    Example 1-2: Confirmation of 3 Gene Mutant Candidates by Site-Specific Amplicon Sequencing and Identification of One Genetic Mutation (L2427P)

    [0185] Site-specific amplicon was performed for the candidate mutations-(read depth, 100-347, 499×). The samples were obtained from the same brain tissue block through biological replication, thereby minimizing any unexpected sequencing artifacts or erroneous calls that can mimic low-frequency somatic mutations. For the site-specific amplicon sequencing, the samples were determined to have a mutation when the percentage of mutated reads exceeded 1%.

    [0186] Site-Specific Amplicon Sequencing

    [0187] Two pairs of primers carrying two target regions of mTOR target gene codon sites (amino acids Cys1483 and Leu2427) were designed (Table 2).

    TABLE-US-00002 TABLE 2 Target region primer SEQ ID NO Chrl:11174301~Chr1:11174513 Forward 5′-TAGGTTACAGGCCTGGATGG-3′ 11 Reverse 5′-CTTGGCCTCCCAAAATGTTA-3′ 12 Chrl:11217133~Chrl:11217344 Forward 5′-TCCAGGCTACCTGGTATGAGA-3′ 13 reverse 5′-GCCTTCCTTTCAAATCCAAA-3′ 14

    [0188] Each primer had a patient-specific index, and only a single index was assigned to the sample from one patient so as to indicate patient origins of the base sequences upon the analysis of genetic mutations. PCR was performed on the target regions using the primers to amplify the nucleotide sequences of the two target regions. Subsequently, a DNA library was constructed using a Truseq DNA kit (Illumina) and libraries of the target genes were sequenced again on a Miseq sequencer (Illumina) (median read depth 135,424×). Using Bowtie2 (http://bowtie-bio.sourceforge.net/bowtie2/index.shtml), the sequences were aligned to a reference genome to generate analyzable files (bam files).

    Example 1-3: Sequencing Analysis Results

    [0189] The use of two different sequencing platforms in biological replicates, as shown in FIG. 5a, revealed recurrent mTOR c.7280T>C encoding p.Leu2427Pro in two patients. The allelic frequencies in the affected brains, as shown in FIG. 5b, ranged from 9.6 to 12.6% in FCD4 and from 6.9 to 7.3% in FCD6.

    [0190] In addition, the mutation was negative in blood samples, as shown in FIGS. 5b and 6.

    Example 2: Search of mTOR-Specific Gene Mutation in Large Cohort

    [0191] Based on the data of mTOR-specific genetic mutations obtained from 4 patients in Example 1, deep sequencing of the mTOR gene was performed for a large FCDII cohort including 73 patients.

    Example 2-1: Collection of Patient Samples and Extraction of Genomic DNA

    [0192] From 73 focal cortical dysplasia (FCD)-caused intractable epilepsy patients undergoing epilepsy surgery, surgical brain tissues (1-2 g), saliva (1-2 ml), blood (about 5 ml), and formalin-fixed, paraffin-embedded brain samples were obtained with the consent thereof (Neurosurgery Dept. and Neurology Dept. of Severance Children's Hospital, Seoul, Korea). Genomic DNA was extracted from the freshly frozen brain, blood, saliva, and formalin-fixed, paraffin-embedded brain tissues using the following kits according to the instructions of the manufacturers:

    [0193] Brain tissue: Qiamp mini DNA kit (Qiagen, USA), blood: Flexigene DNA kit (Qiagen, USA), saliva: prepIT2P purification kit (DNA Genotek, USA), formalin-fixed, paraffin-embedded brain tissue: Qiamp mini FFPE DNA kit (Qiagen, USA).

    Example 2-2: Sequencing

    [0194] Hybrid capture sequencing of brain tissue samples from 73 FCDII patients were performed (read depth, 100-17,700×). PCR-based amplicon sequencing was carried out through site-specific amplicon sequencing (read depth, 100-347,499×, 73 patients) and mTOR amplicon sequencing (read depth, 100-20,210×, 59 patients).

    [0195] For hybrid capture sequencing, an mTOR-specific probe was designed using SureDesign online tools (Agilent Technologies). Sequencing libraries were prepared using Agilent library preparation protocols according to the manufacturer's instructions. Sequencing was conducted using Hiseq2500 (Illumina) (median read depth 515×). The data obtained from the sequencing was prepared into analyzable files (bam files) using the Broad Institute best practice pipeline (https://www.broadinstitute.org/gatk/).

    [0196] For mTOR amplicon sequencing, extracted genomic DNA was sequenced using customized MTOR amplicon (Truseq custom amplicon kit, Illumina) designed with illumine design studio (http://designstudio.illumina.com). DNA library preparation was performed according to the manufacturer's instructions. The libraries were sequenced on a Miseq sequencer (Illumina) (median read depth 1,647×). Analyzable barn files were generated using the BWA-MEM algorithm (http://bio-bwasourceforge.net).

    Example 2-3: Sequencing Result

    [0197] In order to find brain-specific, de novosomatic mutations, blood-brain paired whole exome sequencing data sets were analyzed using both Virmid (http://sourceforge.net/projects/virmid/) and Mutect (http://www.broadinstitute.org/cancer/cga/mutect). Only the somatic mutations that were commonly found in the two analytic approaches were used in subsequent experiments.

    [0198] Of the mutations commonly found in the hybrid capture sequencing and the PCR-based amplicon sequencing, only those meeting selection standards (depth 100 or greater, and 3 or more mutated calls (mapping quality 30 or higher) were selected as disease-related candidates.

    [0199] For all 2508 CRAM files (compressed files) downloaded from the 1000 Genomes Project FTP, 9 somatic mutation positions were found (chr1:11298590 for c.1871G>A, chr1:11217330 for c.4348T>G, chr1:11217231 for c.4447T>C, chr1:11199365 for c.5126G>A, chr1:11188164 for c.5930C>A, chr1:11184640 for c.6577C>T, chr1:11184573 for c.6644C>T, chr1:11174395 for c.7280T>C and c.7280T>A). All of the 9 genomic positions were negative for the somatic mutations meeting the selection standards. Accordingly, the gene mutations identified in the present disclosure were found to be disease-specific.

    Example 2-4: Sequencing Result

    [0200] Overlapping mutations in both hybrid capture sequencing (73 patients) and mTOR amplicon sequencing (59 patients) were detected in order to obtain a total of 9 true candidate variants (inclusive of mutations found in Example 1).

    [0201] To rigorously exclude any potential sequence artifacts and erroneous calls, variants were considered as true only when identified variants (>1% mutated reads) were reproducible in both hybrid capture and amplicon sequencing as well as in multi-samples.

    [0202] This analysis, as shown in FIG. 1b, revealed another 10 FCDII patients carrying 8 different somatic mutations in MTOR: mTOR c.1871G>A (p.Arg624His), c. 4348T>G (p.Tyr1450Asp), c.4447T>C (p.Cys1483Arg), c.5126G>A (p.Arg1709His), c.5930C>A (p.Thr1977Lys), c.6577C>T (p.Arg2193Cys), c.6644C>T (p.Ser2215Phe), and c.7280T>A (p.Leu2427G1n). In total, 15.6% of the participants (12/77) were positive for 9 different brain somatic mutations in mTOR (Table 3).

    TABLE-US-00003 TABLE 3 Age upon mTOR gene mTOR protein Patient Surgery Sex Pathology mutation mutation FCD 4 5 years 2 months F Consistent with FCDIIa (Cortical c.7280T > C p.Leu2427Pro dyslamination/Dysmorphic neurons) FCD 6  5 years F Consistent with FCDIIa (Cortical c.7280T > C p.Leu2427Pro dyslamination/Dysmorphic neurons) FCD 91 7 years 1 month F Consistent with FCDIIa (Cortical c.6577C > T p.Arg2193Cys dyslamination/Dysmorphic neurons) FCD 104 1 year 2 months M Consistent with FCDIIa (Cortical c.1871G > A p.Arg624His dyslamination/Dysmorphic neurons) FCD 105 3 years 7 months M Consistent with FCDIIa (Cortical c.5126G > A p.Arg1709His dyslamination/Dysmorphic neurons) FCD 107 7 years 3 months F Consistent with FCDIIb (Cortical c.6644C > T p.Ser2215Phe dyslamination/Dysmorphic neurons/ balloon cells) FCD 113 10 years F Consistent with FCDIIb (Cortical c.7280T > A p.Leu2427Gln dyslamination/Dysmorphic neurons/ balloon cells) FCD 116 7 years 9 months M Consistent with FCDIIb (Cortical c.5930C > A p.Thr1977Lys dyslamination/Dysmorphic neurons/ balloon cells) FCD 121 11 months M Consistent with FCDIIb (Cortical c.4348T > G p.Tyr1450Asp dyslamination/Dysmorphic neurons/ balloon cells) FCD 128 4 years 4 months F Consistent with FCDIIb (Cortical c.4447T > C p.Cys1483Arg dyslamination/Dysmorphic neurons/ balloon cells) FCD 143 2 years 10 months F Consistent with FCDIIb (Cortical c.6644C > T p.Ser2215Phe dyslamination/Dysmorphic neurons/ balloon cells) FCD 145 4 years 1 month F Consistent with FCDIIb (Cortical c.5930C > A p.Thr1977Lys dyslamination/Dysmorphic neurons/ balloon cells)

    [0203] All identified mutations were negative for all available saliva and blood samples from mutation-positive patients. 100% of the exomes from the 1000 Genomes database were mutation-negative. Among the mutations, p.Thr1977Lys, p.Ser2215Phe, and p.Leu2427Pro were recurrently found in two patients. All mutation-positive patients were found to have a single mTOR mutation. The allelic frequencies of identified mutations range from 1.26% to 12.6%. As can be seen in FIG. 1c, the affected amino acids are evolutionarily conserved.

    Example 3: Identification of mTOR Mutation-Induced mTOR Hyperactivation

    [0204] To determine whether mTOR p.Tyr1450Asp, p.Cys1483Arg, p.Leu2427G1n, and p.Leu2427Pro lead to mTOR hyperactivation, HEK293T cells were transfected with wild-type or mutant mTOR vectors, and S6 phosphorylation, a well-known biomarker of mTOR activation along with S6K phosphorylation, was subjected to Western blot analysis.

    Example 3-1: Mutagenesis and mTOR Mutant Construct

    [0205] A pcDNA3.1 flag-tagged wild-type mTOR construct was provided from Dr. Kun-Liang Guan at University of California, San Diego. This construct was used to generate mTOR mutant vectors (Y1450D, C1483R, L2427Q and L2427P) with a QuikChange II site-directed mutagenesis kit (200523, Stratagene, USA).

    [0206] To construct pCIG-mTOR mutant-IRES-EGFP vectors, an annealing primer set [forward primer 5′-AATTCCAATTGCCCGGGCTTAAGATCGATACGCGTA-3′ (SEQ ID NO. 15) and reverse primer 5′-ccggtacgcgtatcgatcttaagcccgggcaattgg-3′ (SEQ ID NO. 16)] were inserted into pCIG2 (CAG promoter-MCS-IRES-EGFP) to generate pCIG-C1 having new restriction enzyme sites MfeI and MluI. Using the primers [hmTOR-MfeI-flag-F; gATcACAATTGTGGCCACCATGGACTACAAGGACGACGATGACAAGatgc (SEQ ID NO. 17) and hmTOR-MluI-R; tgatcaACGCGTttaccagaaagggcaccagccaatatagc (SEQ ID NO. 18)], PCR fragments corresponding to wild-type and mutated mTOR genes were subcloned into the MfeI and MluI sites of pCIG-C1 to construct pCIG-mTOR wild type-IRES-EGFP and pCIG-mTOR mutant-IRES-EGFP vectors, respectively. Primers for mutagenesis are listed in Table 4, below.

    TABLE-US-00004 TABLE 4 Name Primer SEQ ID NO Y1450D Forward 5′-TCGTGCAGTTTCTCATCCCAGGTAGCCTGGATC-3′ 19 Reverse 5′-GATCCAGGCTACCTGGGATGAGAAACTGCACGA-3′ 20 C1483R Forward 5′-GGCCTCGAGGCGGCGCATGCGGC-3′ 21 Reverse 5′-GCCGCATGCGCCGCCTCGAGGCC-3′ 22 L2427Q Forward 5′-GTCTATGACCCCITGCAGAACTGGAGGCTGATG-3′ 23 Reverse 5′-CATCAGCCTCCAGTTCTGCAAGGGGTCATAGAC-3′ 24 L2427P Forward GTCTATGACCCCTTGCCGAACTGGAGGCTGATG 25 Reverse CATCAGCCTCCAGTTCGGCAAGGGGTCATAGAC 26

    Example 3-2. Transfection with Wild-Type and Mutant mTOR Vectors and Western Blot

    [0207] HEK293T cells (Thermo Scientific) was cultured in DMEM (Dulbecco's Modified Eagle's Medium) containing 10% FBS at 37° C. and 5% CO.sub.2. The cells were transfected with empty flag-tagged vector, flag-tagged mTOR wild type, and flag-tagged mTOR mutants using jetPRIME transfection reagent (Polyplus, France). The cells were serum-starved with DMEM containing 0.1% FBS for 24 hours after transfection and then incubated at 37° C. and 5% CO.sub.2 in PBS containing 1 mM MgCl.sub.2 and CaCl.sub.2 for 1 hour. The cells were lysed with PBS containing 1% Triton X-100 and Halt protease and phosphatase inhibitor cocktail (78440, Thermo Scientific, USA).

    [0208] Proteins were resolved by SDS-PAGE and transferred to PVDF membranes (Millipore, USA). The membranes were blocked with 3% BSA in TBS containing 0.1% Tween 20 (TBST). They were washed 4 times with TBST. The membranes were each incubated overnight at 4° C. with primary antibodies including a 1/1000 dilution of anti-phospho-S6 ribosomal protein (5364, Cell Signaling Technology, USA), anti-56 ribosomal protein (2217, Cell Signaling Technology, USA), and anti-flag M2 (8164, Cell Signaling Technology, USA) in TBST. After incubation, the membranes were washed 4 times with TBST. They were incubated with a 1/5000 dilution of HRP-linked anti-rabbit or anti-mouse secondary antibodies (7074, Cell Signaling Technology, USA) for 2 hours at room temperature. After washing with TBST, immunodetection was performed using ECL reaction reagents.

    Example 3-3. Monitoring of S6 Phosphorylation Level in Mutant mTOR-Expression Cell

    [0209] An in vitro mTOR kinase assay was performed. To this end, the kinase activity of mTOR was assayed using a K-LISA mTOR activity kit (CBA055, Calbiochem, USA) according to the manufacturer's protocol. The transfected cells (HEK293T cells) were lysed with TBS containing 1% Tween 20, Halt protease, and phosphatase inhibitor cocktail. One mg of total lysates was pre-cleared by adding 15 μl of protein G-beads (10004D, Life technologies, USA), and incubated at 4° C. for 15 min. Anti-flag antibodies were added to the pre-cleared lysates and incubated overnight at 4° C. Then, 50 μl of 20% slurry protein G-beads was added and incubated at 4° C. for 90 min. The supernatant was carefully discarded. The pelleted beads were washed 4 times with 500 μl of lysis buffer and once with the 1× kinase buffer of the K-LISA mTOR activity kit (K-LISA mTOR activity kit). The pelleted beads were resuspended in 50 μl of 2× kinase buffer and 50 μl of mTOR substrate (p70S6K-GST fusion protein), followed by incubation at 30° C. for 30 min. The reaction mixture was incubated in a glutathione-coated 96-well plate and incubated at 30° C. for 30 min. The phosphorylated substrate was detected using an anti-p70S6K-pT389 antibody, an HRP antibody-conjugate and a TMB substrate. Relative activities were measured by reading the absorbance at 450 nm.

    [0210] As is understood from the data of FIGS. 2a and 9b, S6 phosphorylation was robustly increased in mutant mTOR-expressing cells.

    [0211] Wild-type and mutant mTOR proteins were pulled down from MTOR wild-type and mutant-expressing HEK293T cells, respectively, and assayed in vitro for mTOR kinase activity. As shown in FIG. 2b, pCys1483Arg, p.Leu2427G1n, and p.Leu2427Pro mTOR proteins had constitutively increased kinase activity.

    Example 3-4. Change in S6K Phosphorylation after Drug Treatment

    [0212] After treatment with drugs (rapamycin, everolimus, compounds of Chemical Formulas 1 to 4), the mutant mTOR-expressing cells were analyzed for S6K phosphorylation.

    [0213] Transfection of mTOR mutants into HEK293T cells was carried out in the same manner as in Example 3-2. Then, the cells were serum-starved with DMEM containing 0.1% FBS for 24 hours and incubated at 37° C. and 5% CO.sub.2 in PBS containing 1 mM MgCl.sub.2 and CaCl.sub.2 for 1 hour, followed by treatment with rapamycin, everolimus, or compounds of Chemical Formulas 1 to 4 (Torinl, INK128, AZD8055, GSK2126458); Torin was purchased from TOCRIS, INK128, AZD8055, and GSK2126458 were provided from Selleckchem, and everolimus was purchased from LC laboratory. Subsequently, Western blotting was performed in the same manner as in Example 9.

    [0214] As can be seen in FIGS. 9a and 9b, the phosphorylation of S6K in mutant mTOR-expressing cells was inhibited by rapamycin treatment.

    [0215] In addition, the mutant mTOR-expressing cells were monitored for S6K phosphorylation after treatment with everolimus or the compounds of Chemical Formulas 1 to 4.

    [0216] Likewise, everolimus or the compounds of Chemical Formulas 1 to 4 inhibited the phosphorylation of S6K in the mutant mTOR-expressing cells, as shown in FIG. 9c.

    Example 3-5. Change of S6K Phosphorylation with Various mTOR Inhibitors

    [0217] Cells expressing various mTOR mutations were treated in the same manner as in Example 3-2 with rapamycin, everolimus, or the compounds of Chemical Formulas 1 to 4 and monitored for S6K phosphorylation. The mTOR mutations were R624H, Y1450D, C1483R, R1709H, Y1977K, S2215F, L2427P, and L2427Q.

    [0218] Briefly, the mutant mTOR-expressing cells were monitored for S6K phosphorylation level after treatment with everolimus or the compounds of Chemical Formulas 1 to 4. The results are depicted in FIGS. 13 and 14. As shown, the phosphorylation of S6K in all the mutant mTOR-expressing cells was inhibited by everolimus or the compounds of Chemical Formulas 1 to 4.

    Example 4: mTOR Hyperactivation Induced by mTOR Mutation

    Example 4-1: Immunostaining of Brain Tissue Section of FCD Patient

    [0219] To determine whether the affected brains of FCDII patients carrying mutations are associated with mTOR hyperactivation, immunostaining was performed for S6 phosphorylation and NeuN (a neuronal marker) in brain tissue sections obtained from FCDII patients carrying the p.Leu2427Pro mutation.

    [0220] Brain specimens that did not exhibit any malformations in cortical development (non-MCD) were collected in the operating room from the tumor-free margin of individual patients with glioblastoma as part of a planned resection, and were pathologically conformed to be normal brains without tumors. Surgical tissue blocks were fixed overnight in freshly prepared phosphate-buffered (PB) 4% paraformaldehyde, ciyoprotected overnight in 20% buffered sucrose, and prepared into gelatin-embedded tissues blocks (7.5% gelatin in 10% sucrose/PB) before storage at −80° C. Cryostat-cut sections (10 um thick) were collected, placed on glass slides, and blocked in PBS-GT (0.2% gelatin and 0.2% Triton X-100 in PBS) at room temperature for 1 hr before staining with the following antibodies: rabbit antibody to phosphorylated S6 ribosomal protein (Ser240/Ser244) (1:100 dilution; 5364, Cell signaling Technology), and mouse antibody to NeuN (1:100 dilution; MAB377, Millipore). Subsequently, samples were washed in PBS and stained with the following secondary antibodies: Alexa Fluor 555-conjugated goat antibody to mouse (1:200 dilution; A21422, Invitrogen) and Alexa Fluor 488-conjugated goat antibody to rabbit (1:200 dilution; A11008, Invitrogen). DAPI included in a mounting solution (P36931, Life technology) was used for nuclear staining. Images were acquired using a Leica DMI3000 B inverted microscope. Cells positive for NeuN were counted using a 10× objective lens; 4-5 fields were acquired per subject within neuron-rich regions, and 100 or more cells were scored per region. The number of DAPI-positive cells represents total cell counts. Neuronal cell sizes were measured in NeuN-positive cells using the automated counting protocol of ImageJ software (http://rsbweb.nih.gov/ij/).

    [0221] As seen in FIG. 2c, the results showed a marked increase in the number of neuronal cells positive for phosphorylated S6 in FCDII patients (FCD4 and FCD6) carrying p.Leu2427Pro mutation, but not in non-FCD brains, as shown in FIG. 2d. In addition, the cell sizes of phosphorylated S6-positive neurons were measured, and a robust increase in the soma size in pathological samples was observed, as shown in FIG. 2e.

    Example 4-2: Microdissection of S6 Phosphorylation-Increased, Cytomegalic Neurons in Brain Tissue of FCD Patient and Subsequent Sanger Sequencing

    [0222] Surgical tissue blocks were fixed overnight in freshly prepared phosphate-buffered (PB) 4% paraformaldehyde, cryoprotected overnight in 20% buffered sucrose, and prepared into gelatin-embedded tissue blocks (7.5% gelatin in 10% sucrose/PB) before storage at −80° C. Cryostat-cut sections (10 urn thick) were collected, placed on glass slides, and blocked in PBS-GT (0.2% gelatin and 0.2% Triton X-100 in PBS) at room temperature for 1 hr before staining with the following antibodies: rabbit antibody to phosphorylated S6 ribosomal protein (Ser240/Ser244) (1:100 dilution; 5364, Cell signaling Technology) and mouse antibody to NeuN (1:100 dilution; MAB377, Millipore). Subsequently, samples were washed in PBS and stained with the following secondary antibodies: Alexa Fluor 555-conjugated goat antibody to mouse (1:200 dilution; A21422, Invitrogen) and Alexa Fluor 488-conjugated goat antibody to rabbit (1:200 dilution; A11008, Invitrogen).

    [0223] DAPI, included in a mounting solution (P36931, Life technology), was used for nuclear staining. After immunofluorescence staining, phosphorylated S6 immunoreactive neurons (n=about 20 per case) were microdissected with a PALM Laser capture system (Carl Zeiss, Germany) and collected in an adhesive cap (Carl Zeiss, Germany).

    [0224] Thereafter, genomic DNA was extracted from the collected neurons using a QiAamp microkit (Qiagen, USA), and mutation regions (mTOR c.7280T>C) were amplified by PCR using the primers: sense 5′-CCCAGGCACTTGATGATACTC-3′ (SEQ ID NO. 27) and antisense, 5′-CTTGCTTTGGGTGGAGAGTT-3′ (SEQ ID NO. 28).

    [0225] The PCR products thus obtained were purified with a MEGAquick spin total fragment purification kit (Intron, Korea), followed by Sanger sequencing with the aid of the BioDye Terminator and an automatic sequencer system (Applied Biosystems).

    [0226] As shown in FIG. 10, moreover, the microdissection of cytomegalic neurons positive for phosphorylated S6 in the same pathological tissues showed the enrichment of the p.Leu2427Pro mutant allele in Sanger sequencing. These results suggest that the identified mTOR mutations are strongly associated with both the aberrant mTOR activation and the dysregulation of neuronal growth.

    Example 5: Effect of mTOR Hyperactivation on Cerebral Development in Animal Model

    [0227] The recurrent mutation p.Leu2427Pro was selected for in vivo functional analysis. in utero electroporation of mTOR mutant constructs was performed to analyze the effect ofthe mTOR mutations on cortical radial neuronal migration and S6 phosphorylation in mice.

    Example 5-1: Construction of Animal Model

    [0228] Timed pregnant mice (E14) (Damul Science) were anesthetized with isoflurane (0.4 L/min of oxygen and isoflurane vaporizer gauge 3 during surgery).

    [0229] The uterine horns were exposed, and a lateral ventricle of each embryo was injected using pulled glass capillaries with 2 μg/ml of Fast Green (F7252, Sigma, USA) combined with 2-3 μg of mTOR mutant plasmids, constructed in Example 3-1, carrying mTOR C1483Y, mTOR E2419K, and mTOR L2427P mutants. Plasmids were electroporated on the head of the embryo by discharging 50 V with the ECM830 eletroporator (BTX-Harvard apparatus) in five electric pulses of 100 ms at 900-ms intervals.

    Example 5-2: Image Analysis of Mouse Model

    [0230] Embryonic mice were electroporated at embryonic day 14 (E14). Then, their brains were harvested after 4 days of development (E18) and fixed overnight in freshly prepared phosphate-buffered (PB) 4% paraformaldehyde, ciyoprotected overnight in 30% buffered sucrose, and prepared into gelatin-embedded tissue blocks (7.5% gelatin in 10% sucrose/PB) before storage at −80° C.

    [0231] Cryostat-cut sections (30 um thick) were collected and placed on glass slides. DAPI, included in a mounting solution (P36931, Life Technology) was used for nuclear staining. Images were acquired using a Leica DMI3000 B inverted microscope or a Zeiss LSM510 confocal microscope. Fluorescence intensities reflecting the distribution of electroporated cells within the cortex were converted into gray values and measured from the ventricular zone (VZ) to the cortical plate (CP, using ImageJ software (http://rsbweb.nih.gov/ij/). Mander's co-localization analysis was carried out using Fiji software (http://fiji.sc/wiki/index.php/Colocalization Analysis).

    Example 5-3: Experiment Result

    [0232] As shown in FIG. 11a, mTOR wild-type or p.Leu2427Pro constructs containing an IRES-GFP reporter were electroporated into the developing mouse cortex at embryonic day (E) 14, and measured for cortical radial migration and the S6 phosphorylation of GFP-positive neurons at E18.

    [0233] It was observed, as shown in FIG. 11b, that brain sections expressing the mTOR mutant construct showed a significant decrease in GFP-positive cells in the cortical plate (CP) and an increase in GFP-positive cells in the intermediate zone (IZ), the subventricular zone (SVZ), and the ventricular zone (VZ), thereby indicating the disruption of cortical radial neuronal migration.

    [0234] In addition, as shown in FIG. 11c, mTOR mutant expressing GFP-positive cells were observed to coexist with cells having an elevated level of S6 phosphorylation in brain sections. These findings suggest that the identified mTOR mutations cause the aberrant activation of mTOR kinase protein and the disruption of proper cortical development in vivo.

    Example 6: Identification of mTOR Hyperactivation-Induced Disease Phenotype in Animal Model

    Example 6-1. Identification of Spontaneous Seizure and Abnormal Neurons in Animal Model

    [0235] A determination was made to see whether the focal cortical expression of mTOR induces spontaneous seizures in mice after in utero electroporation. Subsequent to in utero electroporation at E14, properly delivered mice pups at birth that showed GFP signals on the electroporated cortical region were selected, as shown in FIG. 3a.

    [0236] Thereafter, continuous video-electroencephalographic monitoring of the mice was performed starting 3 weeks after birth. After weaning, the mice were monitored by video-recoding for 12 hrs per day until tonic-clonic seizures were observed. Then, mice with seizures were monitored using video-electroencephalography for 6 hrs per day over two days to characterize the spontaneous seizures with epileptic discharge.

    [0237] Briefly, after weaning (>3 weeks), seizures were observed only through video monitoring. Thereafter, electrodes for recoding electroencephalograms were surgically implanted. A total of five electrodes were located in the epidural layer: based on the bregma, two electrodes on the frontal lobes (AP+2.8 mm, ML±1.5 mm), two electrodes on the temporal lobes (AP-2.4 mm, ML±2.4 mm), and one electrode on the cerebellum. After more than 4 days of recovery from surgery, EGG signals were recorded between 6 p.m. and 2 a.m. for 2-5 days (6 hrs per day). Signals were amplified with an amplifier (GRASS model 9 EEG/Polysomnograph, GRASS technologies, USA), and analyzed with the pCLAMP program (Molecular Devices, USA). Alternatively, a RHD2000 amplifier and board (Intan Technologies, USA) and MATLAB EEGLAB (http://sccn.ucsd.edu/eeglab) were used for analysis.

    [0238] For EGG analysis, 10-12 h continuous recording data was analyzed for interictal spike and nonconvulsive electrographic seizure counts. 1-min samples were selected from the data at standardized preset time points separated by exactly 1 h.

    [0239] Each 1-min sample was assessed for the number of interictal epileptiform spikes and nonconvulsive electrographic seizures therein by an observer who was unaware of the treatment of the mice. Interictal spikes were defined as fast (<200 ms) epileptiform wave forms that occurred regularly and were at least twice the amplitude of the background activity. Nonconvulsive electrographic seizure episodes were counted when the EEG recording showed at least two connected spike-wave complexes (1-4 Hz) with amplitudes as at least twice as background, and were observed simultaneously in the majority of the four recording channels per mouse.

    [0240] Surprisingly, as shown in FIGS. 3b and 12a, more than 90% of the mice expressing mTOR mutant constructs displayed spontaneous seizures with epileptic discharge, including high-voltage fast activity, high-voltage spikes and waves, and low-voltage fast activity. These mutant mice also showed interictal spikes and electrographic seizures (FIG. 12b). The mice in which spontaneous seizures were induced were observed to exhibit systemic tonic-clonic seizures consisting of a tonic phase, a clonic phase, and a postictal phase, similar to those found in FCDII patients. Further, brain waves are characterized by synchronized multi-waves of low-voltage, fast activity in the tonic phase, high-voltage standing waves in the clonic phase, and synchronized attenuated amplitudes in the postictal phase. However, neither spontaneous seizures with epileptic discharges nor electrographic seizure were observed in control mice electroporated with the mTOR wild-type construct, as shown in FIG. 3b.

    [0241] The average seizure onset of p.Leu2427Pro mice started on average roughly 6 weeks after birth (FIG. 12e), which is approximately equivalent to that of human FCDII patients (˜4 years). The seizure frequency was about 6 events per day (FIG. 3c).

    [0242] After the confirmation of seizures, investigation was made to see whether the mice electroporated with mTOR mutant constructs showed abnormal neuronal morphology, such as cytomegalic neurons.

    [0243] It was observed that the soma sizes of GFP-positive neurons were greatly increased in affected cortical regions of electroporated mice carrying mTOR mutations (FIG. 3d).

    Example 6-2. Effect of Drug on Spontaneous Seizure and Abnormal Neuron

    [0244] Animal models with spontaneous seizures or abnormal neurons were monitored after administration with rapamycin.

    [0245] Briefly, rapamycin or everolimus (LC Labs, USA) was dissolved in 100% ethanol to give a 20 mg/ml stock solution and stored at −20° C. Immediately before injection, the stock solution was diluted in 5% polyethyleneglycol 400 and 5% Tween80 to yield final concentrations of 1 mg/ml rapamycin and 4% ethanol. Mice were injected with 1 to 10 mg/kg rapamycin for 2 weeks (10 mg/kg/d intraperitoneal injection, two weeks).

    [0246] Rapamycin, as shown in FIGS. 3c, 12c and 12d, almost completely freed the mTOR mutant construct-carrying mice from spontaneous seizures, with a simultaneous dramatic decrease in the onset frequency of interictal spikes and nonconvulsive electrographic seizure.

    [0247] Also, abnormal soma sizes of neurons were reduced in the animal model administered with rapamycin, as shown in FIG. 3d.

    Example 7: Identification of Mutation in Intractable Epilepsy Patient by Sequencing

    [0248] Genomic DNA was extracted in substantially the same manner as that of Example 2 from samples from a total of 77 patients, listed in Examples 1 and 2, and subjected to hybrid capture sequencing and PCR-based amplicon sequencing. Of mutations found in both the sequencing analyses, those that met the selection standards (a total read depth of 100 or more, 3 or more mutated calls, and a mapping quality score of 30 or more) were detected in TSC1, TSC2, AKT3, and PIK3CA.

    [0249] TSC1 c.64C>T (p.Arg22Trp), c.610C>T (p.Arg204Cys), c.2432G>T (p.Arg811Leu); TSC2 c.4639C>T (p.Va11547Ile); AKT3 c.740G>A (p.Arg247His), PIK3CA c.3052G>A (p.Asp1018Asn).

    [0250] In eight of 51 patients negative for mTOR mutations, TSC1, TSC2, AKT3, and PIK3CA gene mutations were detected only in affected brain regions. Accordingly, 21 of a total of 77 intractable epilepsy patients were found to have mutations only in affected brain regions.

    [0251] mTOR c.616C>T (p.Arg206Cys) mTOR c.1871G>A (p.Arg624His), c. 4348T>G (p.Tyr1450Asp), c.4447T>C (p.Cys1483Arg), c.5126G>A (p.Arg1709His), c.5930C>A (p.Thr1977Lys), c.6577C>T (p.Arg2193Cys), c.6644C>T (p.Ser2215Phe), and c.7280T>A (p.Leu2427G1n); TSC1 c.64C>T (p.Arg22Trp), c.610C>T (p.Arg204Cys), c.2432G>T (p.Arg811Leu); TSC2 c.4639C>T (p.Va11547Ile); AKT3 c.740G>A (p.Arg247His), PIK3CA c.3052G>A (p.Asp1018Asn).

    TABLE-US-00005 TABLE 5 PCR Hybrid amplicon Capture sequencing % % Age at Modified Modified Mutated Mutated Disease/gender surgery phathology MRI result protein nucleotide Amino acid allele allele FCD 4/female 5 yr 2 m Cortical dyslamination, No abnormal MTOR c.7280T > C p.Leu2427Pro 7.94% 12.6% Dysmorphic neurons, signal intensity consistent with FCDIIa FCD 6/female  5 yr Cortical dyslamination, No abnormal MTOR c.7280T > C p.Leu2427Pro 6.90% 7.28% Dysmorphic neurons, signal intensity consistent with FCDIIa FCD 64/female 6 yr 9 m Cortical dyslamination, Cortical dysplasia TSC1 c.610C > T p.Arg204Cys 1.75%  1.0% Dysmorphic neurons, involving left consistent with FCDIIa fronto-parietal lobe HME 66/male 2 yr 8 m Cortical laminar Rt. PIK3CA c.3052G > A p.Asp1018Asn 1.03% 2.30% disturbance with hemimegalencephDaly large giant neurons SWS 77/male 11 m Cortical dyslamination, Difuse brain MTOR c.616C > T p.Arg206Cys 3.93% 3.45% Dysmorphic neurons, atrophy, Right consistent with FCDIIa hemisphere FCD 81/female 12 yr Cortical dyslamination, No abnormal TSC1 c.64C > T p.Arg22Trp 2.81%  2.0% Dysmorphic neurons, signal intensity consistent with FCDIIa HS86/male 13 yr 2 m Hippocampal sclerosis Suggestive of AKT3 c.740G > A p.Arg247His 1.72% .sup. 10% HS, left. FCD 91/female 7 yr 1 m Cortical dyslamination, Volume decrease of MTOR c.6577C > T p.Arg2193Cys 2.99% 1.26% Dysmorphic neurons, the left cerebral consistent with FCDIIa hemisphere and multifocal lesions in the WM FCD 94/female 10 yr 3 m Cortical dyslamination, Subependymal TSC2 c.4639C > T p.Val1547Ile 1.19% 1.55% Dysmorphic neurons, heterotopia, Rt consistent with FCDIIa peri-trigone area FCD 98/male 14 yr 3 m Cortical dyslamination, No abnormal TSC1 c.64C > T p.Arg22Trp 2.52% 1.98% Dysmorphic neurons, signal intensity consistent with FCDIIa FCD 104/male 1 yr 2 m Cortical dyslamination, Cortical dysplasia MTOR c.1871G > A p.Arg624His 1.80% 4.41% Dysmorphic neurons, involving right consistent with FCDIIa precentral and postcentral gyri, FCD 105/male 3 yr 7 m Cortical dyslamination, No abnormal MTOR c.5126G > A p.Arg1709His 1.63% 1.52% Dysmorphic neurons, signal intensity consistent with FCDIIa FCD 107/female 7 yr 3 m Cortical dyslamination, Cortical Dysplasia MTOR c.6644C > T p.Ser2215Phe 2.41% 2.11% dysmorphic neurons, involving left balloon cells, occipitoparietal consistent with FCDIIb lobe and precentral gyrus FCD 113/female 10 yr Cortical dyslamination, Cortical dysplasia MTOR c.7280T > A pLeu2427Gln 3.05% 5.11% dysmorphic neurons, involving left balloon cells, occipital and consistent with FCDIIb parietal lobe FCD 116/male 7 yr 9 m Cortical dyslamination, Cortical dysplasia MTOR c.5930C > A p.Thr1977Lys 3.25% 2.93% dysmorphic neurons, involving left balloon cells, superior frontal consistent with FCDIIb gyrus FCD 121/male 11 m Cortical dyslamination, Cortical dysplasia MTOR c.4348T > G p.Tyr1450Asp 2.64% 3.76% dysmorphic neurons, involving entire right balloon cells, lobe and left superior/ consistent with FCDIIb middle frontal gyrus FCD 123/female 12 yr 4 m Cortical dyslamination, Cortical Dysplasia TSC1 c.64C > T p.Arg22Trp 2.21% 1.37% dysmorphic neurons, involving right balloon cells, frontal lobe consistent with FCDIIb FCD 128/female 4 yr 4 m Cortical dyslamination, Cortical dysplasia, MTOR c.4447T > C p.Cys1483Arg 6.38% 9.77% dysmorphic neurons, right frontal lobe balloon cells, consistent with FCDIIb HME141female 1 yr 9 m Cortical laminar Lt. TSC1 c.2432G > T p.Arg811Leu 1.03% 1.68% disturbance with hemimegalencephaly large giant neurons FCD 143/female 2 yr 10 m Cortical dyslamination, No abnormal MTOR c.6644C > T p.Ser2215Phe 2.82% 2.33% dysmorphic neurons, signal intensity balloon cells, consistent with FCDIIb FCD 145/female 4 yr 1 m Cortical dyslamination, Cortical dysplasia MTOR c.5930C > A p.Thr1977Lys 1.46% 1.51% dysmorphic neurons, involving left balloon cells, precentral gyrus consistent with FCDIIb

    Example 8: In Vivo Analysis of mTOR Hyperactivation

    [0252] 8-1. Mutagenesis and Construction of TSC1, TSC2, and AKT3 mutant constructs pcDNA3 carrying HA-tagged wild-type TSC1, TSC2 or AKT3 (pcDNA3 HA-tagged wild-type TSC1, TSC2, AKT3 construct) was purchased from Addgene (USA). The construct was used to generate mutant vectors with a QuikChange II site-directed mutagenesis kit (200523, Stratagene, USA).

    [0253] pcDNA3 carrying HA-tagged wild-type TSC1, TSC2 or AKT3 (pcDNA3 HA-tagged wild-type TSC1, TSC2, AKT3 construct) was purchased from Addgene (USA). In the pcDNA3 TSC1, TSC2, AKT3 wild-type vector, the mutagenesis of TSC-1 R22W and R204C was achieved by use of TSC-1 R22W-F and R22W-R primers for R22W mutagenesis and by use of TSC-1 R204C-F and R204C-R primers for R204C mutagenesis. TSC-2 V1547I-F and V1547I-R primers were used for TSC-2 V15471 mutagenesis in the pcDNA3 TSC2 wild-type vector. For the mutagenesis of AKT3 R247H in the pcDNA3 AKT3 wild-type vector, R247H-F and R247H-R primer were designed.

    [0254] A QuikChange II site-directed mutagenesis kit (200523, Stratagene, USA) was used to create point mutations. Because each primer has a site-specific point mutation sequence, a mutation is induced in copies of the sequence upon PCR Primers useful for the mutagenesis are listed in Table 6, below.

    TABLE-US-00006 TABLE 6 Location n of gene Modification Primer SEQ ID NO TSC-1 C64T R22W TSC-1 R22W-F gtcacgtcgtcccacacacccagcatg 29 TSC-1 R22W-R catgctgggtgtgtgggacgacgtgac 30 C610T R204C TSC-1 R204C-F ctttcatactgtaatgagaacacaaaaaggagacgaagttgca 31 TSC-1 R204C-R tgcaacttcgtctcctttttgtgttctcattacagtatgaaag 32 TSC-2 G4639A V1547I TSC-2 V15471-F tctccaacatacaggatggcgatcttgtgggtg 33 TSC-2 V1547I-R cacccacaagatcgccatcctgtatgttggaga 34 AKT3 G740A R247H AKT3 R247H-F caccatagaaacgtgtgtggtcctcagagaacacc 35 AKT3 R247H-R ggtgttctctgaggaccacacacgtttctatggtg 36

    [0255] 8-2. Cell Culture, Transfection, and Western Blot

    [0256] In order to examine whether TSC-1, TSC-2 or AKT3 mutation causes the aberrant activation of mTOR, wild-type or mutant vectors were transfected into HEK293T and the phosphorylation of SK6, widely known as an mTOR gene marker, was analyzed by Western blotting.

    [0257] Briefly, HEK293T cells (Thermo Scientific) were cultured in DMEM (Dulbecco's Modified Eagle's Medium) supplemented with 10% FBS at 37° C. and 5% CO.sub.2. The cells were transfected with empty flag-tagged vector, HA-tagged TSC1 wild-type, HA-tagged TSC2 wild-type, HA-tagged AKT3 wild-type, HA-tagged TSC1 mutant, HA-tagged TSC2 mutant and HA-tagged AKT3 mutant, respectively, using jetPRIME transfection reagent (Polyplus, France).

    [0258] The cells were serum-starved with 0.1% FBS in DMEM for 24 hours after transfection and then incubated at 37° C. and 5% CO.sub.2 in PBS containing 1 mM MgCl.sub.2 and CaCl.sub.2 for 1 hour. The cells were lysed with PBS containing 1% Triton X-100 and Halt protease and phosphatase inhibitor cocktail (78440, Thermo Scientific, USA). Proteins were resolved by SDS-PAGE and transferred to PVDF membranes (Millipore, USA). The membranes were blocked with 3% BSA in TBS containing 0.1% Tween 20 (TBST). They were washed 4 times with TBST. The membranes were incubated overnight with primary antibodies including a 1/1000 dilution of anti-phospho-S6 ribosomal protein (5364, Cell Signaling Technology, USA), anti-56 ribosomal protein (2217, Cell Signaling Technology, USA), and anti-flag M2 (8164, Cell Signaling Technology, USA) in TBST at 4° C., respectively. After incubation, the membranes were washed 4 times with TBST. They were incubated with a 1/5000 dilution of HRP-linked anti-rabbit or anti-mouse secondary antibodies (7074, Cell Signaling Technology, USA) for 2 hours at room temperature. After washing with TBST, immunodetection was performed using ECL reaction reagents.

    [0259] 8-3. Treatment of Mutant-Expressing Cells with Rapamycin and Western Blot

    [0260] After treatment with rapamycin, the mutant-expressing cells of Example 8-2 were monitored for S6K phosphorylation.

    [0261] Briefly, HEK293T cells were transfected with mTOR, TSC1, TSC2, or AKT3 mutants in the same manner as in Example 8-2. The transfected cells were starved for 24 hrs with empty DMEM and incubated at 37° C. and 5% CO.sub.2 for 1 hr with rapamycin in PBS containing 1 mM MgCl.sub.2 and CaCl.sub.2, followed by Western blotting in the same manner as in Example 2-2.

    [0262] 8-4. Experiment Data

    [0263] In order to examine whether the p.Arg22Trp and p.Arg204Cys mutations of TSC-1, the p.Va11547Ile mutation of TSC-2, or the p.Arg247His mutation of AKT3 induces mTOR activation, HEK293T cells were transfected with vectors carrying TSC1, TSC2, and AKT3 wild-type and mutants, and S6K phosphorylation, a well-known index for mTOR mutation, was monitored via Western blotting. The mutant-expressing cells were treated with rapamycin before monitoring the phosphorylation of S6K, as described in Examples 8-2 and 8-3. The results are depicted in FIGS. 15 to 17, and can be described for individual mutant genes) as follows:

    [0264] (1) In Vitro Activity of TSC-1 Mutant

    [0265] As can be seen in FIG. 15, S6K phosphorylation was increased in cells expressing mutant TSC-1, and reduced by rapamycin treatment.

    [0266] (2) In Vitro Activity of TSC-2 Mutant

    [0267] As can be seen in FIG. 16, S6K phosphorylation was increased in cells expressing mutant TSC-2, and reduced by rapamycin treatment.

    [0268] (3) In Vitro Activity of AKT3 Mutant

    [0269] As can be seen in FIG. 17, S6K phosphorylation was increased in cells expressing mutant AKT3, and reduced by rapamycin treatment.

    Example 9: Activation of mTOR Pathway by TSC1 and TSC2 Mutants

    [0270] 9-1: Immunoprecipitation Assay

    [0271] To examine whether mutations in TSC1 and TSC2 disrupt the formation of the TSC complex, immunoprecipitation assays were conducted on wild-type and mutant TSC1 or TSC2-expressing HEK293T cells. In this regard, TSC1 and TSC2 mutant proteins prepared in the same manner as in Example 8-3 were incubated overnight with an anti-TSC2 antibody (3990, Cell signaling Technology, USA) or an anti-myc antibody (2276, cell signaling technology, USA), and then with protein A+G magnetic beads for 2 hrs. After washing with PBS containing 1% Triton-X100, the beads were incubated in an SDS buffer at 37° C. for 10 min. After being eluted, proteins were resolved on SDS/PAGE gel and transferred to a PVDF membrane. Immunoblotting was performed in the same manner as in Example 2-3.

    [0272] The results are depicted in FIG. 18. It was found that the TSC-1 p.Arg22Trp and p.Arg204Cys mutations located near the TSC2 binding domain strongly inhibited TSC1 binding to TSC2. These data imply that the TSC1 mutant disrupted the formation of the TSC complex, leading to the hyperactivation of mTOR kinase.

    [0273] 9-2: GTP-Agarose Pull Down Assay

    [0274] Cells were harvested in a lysis buffer (20 mM Tris-HCl pH: 7.5, 5 mM MgCl.sub.2, 2 mM PMSF, 20 μg/mL leupeptin, 10 μg/mL aprotinin, 150 mM NaCl and 0.1% Triton X-100) and then lysed by sonication for 15 sec. The cell lysates were centrifuged at 4° C. and 13,000 g. The supernatant was separated and incubated with 100 μl of GTP-agarose beads (Sigma-Aldrich, cat no. G9768) at 4° C. for 30 min. The beads were washed with a lysis buffer and again incubated overnight with the supernatant. GTP-bound proteins were extracted and visualized by immunoblots.

    [0275] The expression of GTP-bound Rheb protein was found to decrease in wild-type TSC2-expressing cells, but not in TSC2 p.Va11547Ile mutant-expressing cells because the GAP (GTPase activating protein) activity of TSC2 was decreased (FIG. 19(custom-character 2 FIG. 2)), suggesting that the TSC2 mutant reduces the function of the GAP domain, thereby activating the mTOR pathway.

    Example 10: Monitoring of S6K Phosphorylation Level in Drug-Treated, Mutant mTOR-Expressing Cells

    [0276] 10-1. Mutant mTOR-Expressing Cell

    [0277] Mutant mTOR-expressing cells were treated with drugs (rapamycin, everolimus, compounds of Chemical Formulas 1 to 4) and monitored for S6K phosphorylation level.

    [0278] In this regard, HEK293T cells were transfected with the mutants in the same manners as in Examples 8-2 and 8-3, serum-starved for 24 hrs with 01.% FBS in DMEM, and incubated at 37° C. and 5% CO.sub.2 for 1 hr with 1 mM MgCl.sub.2 and CaCl.sub.2 in PBS before treatment with rapamycin, everolimus, or the compounds of Chemical Formulas 1 to 4 (Torinl, INK128, AZD8055, GSK2126458): Torin was purchased from TOCRIS; INK128, AZD8055 and GSK2126458 were from Selleckchem; and everolimus was from LC laboratory. Subsequently, Western blotting was performed in the same manner as in Example 2-4.

    [0279] As is understood from the data of FIGS. 20 and 21, S6K phosphorylation was inhibited in mutant mTOR-expressing cells. Briefly, FIG. 20 shows levels of S6K phosphorylation in cells respectively expressing the mOTR mutants C1483R, L2427P and L2427Q after rapamycin treatment. FIG. 21 shows levels of S6K phosphorylation in mTOR mutation Y1450D-expressing cells after rapamycin treatment.

    [0280] FIG. 22 shows levels of S6 in mTOR mutation L2427P-expressing cells after treatment with 0, 25, 50, 100, and 200 nM of rapamycin.

    [0281] S6K phosphorylation was monitored following treatment with everolimus, or the compounds of Chemical Formulas 1 to 4. As can be seen in FIG. 22, the phosphorylation of S6 in mutant mTOR-expressing cells was inhibited by everolimus or the compounds of Chemical Formulas 1 to 4. A distinct decrease in S6 phosphorylation was apparent at a concentration of 50 nM or higher.

    Example 10-2. Change of S6K Phosphorylation with Various mTOR Inhibitors

    [0282] Cells expressing various mTOR mutations were treated in the same manner as in Example 9-1 with rapamycin, everolimus, or the compounds of Chemical Formulas 1 to 4, and monitored for S6K phosphorylation. The mTOR variants were R624H, Y1450D, C1483R, R1709H, Y1977K, S2215F, L2427P, and L2427Q.

    [0283] Briefly, the mutant mTOR-expressing cells were monitored for S6K phosphorylation level after treatment with everolimus or the compounds of Chemical Formulas 1 to 4. The results are depicted in FIGS. 23a and 23b. As shown, the phosphorylation of S6K in all the mutant mTOR-expressing cells was inhibited by everolimus or the compounds of Chemical Formulas 1 to 4.

    Example 11: Monitoring of S6K Phosphorylation in TSC1 or TSC2 Mutant-Expressing Cells Treated with Drugs

    [0284] HEK293T cells were transfected with TSC1 or TSC2 mutants in the same manner as in Example 8, serum-starved for 24 hrs with 01.% FBS in DMEM, and incubated at 37° C. and 5% CO.sub.2 for 1 hr with 1 mM MgCl.sub.2 and CaCl.sub.2 in PBS.

    [0285] Thereafter, the cells were treated with rapamycin, everolimus, or the compounds of Chemical Formulas 1 to 4 (Torinl, INK128, AZD8055, GSK2126458): Torin was purchased from Tocris; INK128, AZD8055 and GSK2126458 were from Selleckchem; and everolimus was from LC laboratory. Subsequently, Western blotting was performed in the same manner as in Example 10.

    [0286] The TSC1 or TSC2 mutant-expressing cells were treated with rapamycin and monitored for S6K phosphorylation. The results are depicted in FIGS. 24a and 24b for the TSC1 mutant and in FIGS. 25a and 25b for the TSC2 mutant.

    [0287] As is understood from the data of FIGS. 24a, 24b, 25a and 25b, S6K phosphorylation in TSC1 or TSC2 mutant-expressing cells was inhibited by rapamycin. Also, S6K phosphorylation was monitored in the TSC1 or TSC2-expressing cells following treatment with everolimus or the compounds of Chemical Formulas 1 to 4. As can be seen, everolimus or compounds of Chemical Formulas 1 to 4 was found to inhibit the phosphorylation of S6K in TSC1 or TSC2 mutant-expressing cells.

    Example 12: Immunostaining of Brain Tissue Section of FCD Patient

    [0288] To determine whether the affected brains of FCDII patients carrying mutations are associated with mTOR hyperactivation, immunostaining was performed for S6 phosphorylation and NeuN (a neuronal marker) in brain tissue sections obtained from FCD patients carrying the p.Leu2427Pro mutation.

    [0289] Non-malformations of cortical development (non-MCD) brain specimens were collected in the operating room from the tumor-free margin of individual patients with glioblastoma as part of a planned resection, which was pathologically conformed as a normal brain without tumors. Surgical tissue blocks were fixed overnight in freshly prepared phosphate-buffered (PB) 4% paraformaldehyde, cryoprotected overnight in 20% buffered sucrose, and prepared into gelatin-embedded tissues blocks (7.5% gelatin in 10% sucrose/PB) before storage at −80° C. Cryostat-cut sections (10 um thick) were collected and placed on glass slides. FFPE slides were deparaffinized and rehydrated to remove paraffin. Then, a heat-induced retrieval process was performed on the deparaffinized FFPE slides using a citrate buffer to enhance the staining intensity of the antibodies. The slides were then blocked in PBS-GT (0.2% gelatin and 0.2% Triton X-100 in PBS) at room temperature for 1 hr before staining with the following antibodies: rabbit antibody to phosphorylated S6 ribosomal protein (Ser240/Ser244) (1:100 dilution; 5364, Cell signaling Technology) and mouse antibody to NeuN (1:100 dilution; MAB377, Millipore). Subsequently, samples were washed in PBS and stained with the following secondary antibodies: Alexa Fluor 555-conjugated goat antibody to mouse (1:200 dilution; A21422, Invitrogen) and Alexa Fluor 488-conjugated goat antibody to rabbit (1:200 dilution; A11008, Invitrogen).

    [0290] DAPI, included in a mounting solution (P36931, Life technology), was used for nuclear staining. Images were acquired using a Leica DMI3000 B inverted microscope. Cells positive for NeuN were counted using a 10× objective lens; 4-5 fields were acquired per subject within neuron-rich regions, and 100 or more cells were scored per region. The number of DAPI-positive cells represents total cell counts. Neuronal cell sizes were measured in NeuN-positive cells using the automated counting protocol of ImageJ software (http://rsbweb.nih.gov/ij/). The experimental results are given in FIGS. 26a to 26f.

    [0291] As seen in FIGS. 2a to 26f, the results showed a marked increase in the number of neuronal cells positive for phosphorylated S6 in FCD patients #64, 81, 94, 98, and 128 carrying TSC1 or TSC2 mutations, but not in non-FCD brains. In addition, the results revealed a robust increase in the number of neuronal cells that were positive for phosphorylated S6 in patients carrying TSC1 and TSC2 mutations compared with non-FCD brains, as shown in FIGS. 26b and 26d, and in the soma size of phosphorylated S6-positive neurons in the pathological samples, as shown in FIGS. 26e and 26f.

    Example 13: Construction of TSC1 or TSC2 Mouse Model

    [0292] 13-1: Construction of TSC1- or TSC2-Targeting CRISPR/Cas9 Vector

    [0293] A commercially available pX330 plasmid (Addgene, #42230) was used as an initial template. Using a QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, Calif.), the sgRNA (single guide ribonucleotide) cloning site was modified to change the restriction enzyme recognition site BbsI (GAAGAC) to BsaI (GGTCTC). Subsequently, sgRNAs, targeting respective TSC1 and TSC2 genes, was inserted, the sequences of which are as follows.

    TABLE-US-00007 TSC1: (SEQ ID NO. 37) 5′-TGCTGGACTCCTCCACACTG-3′ TSC2: (SEQ ID NO. 38) 5′-AATCCCAGGTGTGCAGAAGG-3′

    [0294] To generate a plasmid carrying an mCheny fluorescent reporter (U6-sgRNA-Cas9-IRES-mCherry), IRES-mCherry was amplified PCR with the IRES3-mCherry-CL plasmid serving as a template. After PCR amplification, the IRES-mCheny was inserted between the Cas9 sequence and the NLS of px330.

    Example 13-2. Construction of Mouse Model

    [0295] First, the TSC1- or TSC2-targeting U6-sgRNA-Cas9-IRES-mCheny plasmid, prepared in Example 19-1, was diluted at a ratio of 3:1 with pCAG-Dsred (Addgene #11151) to enhance red signals. Timed pregnant mice (E14) (Damul Science) were anesthetized with isoflurane (0.4 L/min of oxygen and isoflurane vaporizer gauge 3 during surgery operation). The uterine horns were exposed, and the lateral ventricle of each embryo was injected using pulled glass capillaries with 2 μg/ml of Fast Green (F7252, Sigma, USA) combined with 2-3 μg of the mixture of the two plasmids. Plasmids were electroporated on the head of the embryo by discharging 50 V with the ECM830 eletroporator (BTX-Harvard apparatus) in five electric pulses of 100 ms at 900-ms intervals. After delivery, selection was made of the mouse pups that exhibited fluorescence, screened using a flashlight (Electron Microscopy Science, USA).

    [0296] 13-3: Assay for Neuronal Migration in TSC1 or TSC2 Mouse Model

    [0297] Brains were harvested from adult mice (P>56) prepared in Example 13-2, fixed overnight in freshly prepared phosphate-buffered (PB) 4% paraformaldehyde, cryoprotected overnight in 30% buffered sucrose, and prepared into gelatin-embedded tissue blocks (7.5% gelatin in 10% sucrose/PB) before storage at −80° C.

    [0298] Cryostat-cut sections (30 urn thick) were collected and placed on glass slides. DAPI, included in a mounting solution (P36931, Life technology), was used for nuclear staining. Images were acquired using a Zeiss LSM780 confocal microscope. Fluorescence intensities, reflecting the distribution of electroporated cells within the cortex, were converted into gray values and measured from layer II/III to layer V/VI using ImageJ software (http://rsbweb.nih.gov/ij/).

    [0299] As can be seen in FIGS. 27a and 27b, dsRed-positive neurons in brain tissue sections of the TSC mouse models were decreased in the cortical layer II/III and increased in the layer II and layer V/VI, indicating that the radial migration of cortical neurons was prevented.

    [0300] 13-4: Video-Electroencephalography Monitoring

    [0301] After weaning (>3 weeks), the mice were observed for seizures through video monitoring. Thereafter, electrodes for recoding electroencephalograms were surgically implanted. A total of five electrodes were located in the epidural layer: based on the bregma, two electrodes on the frontal lobes (AP+2.8 mm, ML±1.5 mm), two electrodes on the temporal lobes (AP-2.4 mm, ML±2.4 mm), and one electrode on the cerebellum. After 4 days of recovery from surgery, EGG signals were recorded for 6 hrs per day between 6 p.m. and 2 a.m. over 2-5 days. Signals were amplified using an RHD2000 amplifier and board (Intan Technologies, USA) and analyzed using MATLAB EEGLAB (http://sccn.ucsd.edu/eeglab).

    [0302] The mice whose brains exhibited local TSC1- or TSC2-knockout resulting from use of the CRISPR/Cas9 plasmid displayed spontaneous seizures with epileptic discharges, including high-voltage fast activity, high-voltage spikes and waves, and low-voltage fast activity. The mice in which spontaneous seizures were induced were observed to exhibit systemic tonic-clonic seizures consisting of a tonic phase, a clonic phase, and a postictal phase, similar to those found in FCDII patients. Further, brain waves are characterized by synchronized multi-waves of low-voltage, fast activity in the tonic phase, high-voltage standing waves in the clonic phase, and synchronized attenuated amplitudes in the postictal phase. The seizure frequency was about 10 events per day.

    [0303] 13-5: Soma Size of Neurons in TSC1 or TSC2 Mouse Model

    [0304] After EGG monitoring, the brains of the mice were excised by perfusion fixation using a phosphate-buffered (PB) 4% paraformaldehyde solution with the aid of a Masterflex compact peristaltic pump (Cole-Parmer international, USA). The brains were fixed in a freshly prepared phosphate-buffered (PB) 4% paraformaldehyde solution, ciyoprotected overnight in 30% buffered sucrose, and prepared into gelatin-embedded tissue blocks (7.5% gelatin in 10% sucrose/PB) before storage at −80° C. Cryostat-cut sections (30 um thick) were collected, placed on glass slides, and blocked in PBS-GT (0.2% gelatin and 0.2% Triton X-100 in PBS) at room temperature for 1 hr before staining with the following antibodies: mouse antibody to NeuN (1:500 dilution; MAB377, Millipore). Subsequently, samples were washed in PBS and stained with the following secondary antibody: Alexa Fluor 488-conjugated goat antibody to mouse (1:200 dilution; A11008, Invitrogen). DAPI included in a mounting solution (P36931, Life technology) was used for nuclear staining. Images were acquired using a Zeiss LSM780 confocal microscope. Neuronal cell sizes were measured using ImageJ software (http://rsbweb.nih.gov/ij/).

    [0305] Neurons were found to significantly increase in soma size for the mice with the local TSC1- or TSC2-knockout by use of the CRISPR/Cas9 plasmid, compared to normal neurons, but remained unchanged in size for the mice into which the plasmid was electroporated without sgRNA, which was consistent with the dysmorphic neurons of patients with Malformations of Cortical Developments.

    Example 14: Effect of Drug on Spontaneous Seizure in TSC2 Mouse Model

    [0306] The animal models exhibiting spontaneous seizures were monitored after administration with rapamycin. Briefly, rapamycin (LC Labs, USA) was dissolved in 100% ethanol to give a 20 mg/ml stock solution, and stored at −20° C. Immediately before injection, the stock solution was diluted in 5% polyethyleneglycol 400 and 5% Tween80 to final concentrations of 1 mg/ml rapamycin and 4% ethanol. Mice were injected with 1 to 10 mg/kg rapamycin for 2 weeks (10 mg/kg/d intraperitoneal injection).

    [0307] Rapamycin, as shown in FIG. 28, almost completely freed the animal models from spontaneous seizures.