DETECTION OF MODIFIED LIVE SWINE INFLUENZA VIRUS VACCINES

Abstract

The present invention relates i.a. to diagnostic kits and methods for detecting an animal vaccinated with a modified live Swine Influenza virus specific vaccine and diagnostic kits and methods for differentiating animals vaccinated with a modified live Swine Influenza virus specific vaccine from animals infected with Swine Influenza virus, respectively.

Claims

1. (canceled)

2. (canceled)

3. A method for detecting an animal vaccinated with a modified live Swine Influenza virus specific vaccine in a biological sample comprising the steps of: a. obtaining a biological sample containing at least one nucleic acid from an animal; b. providing at least one forward and a reverse-oligonucleotide primer pair and an oligonucleotide probe specific for the modified live Swine Influenza virus specific vaccine for detecting a vaccination with a Swine Influenza virus specific vaccine, said oligonucleotide probe comprises at least fourteen contiguous nucleotides of the sequence shown in SEQ ID NO:3 (tagatcttgattaattaa) or its reverse complementary sequence (SEQ ID NO:4 ttaattaatcaagatcta) or a sequence having at least 70% sequence identity thereto; c. contacting said oligonucleotide primer pair with said biological sample under conditions which allow for amplification of polynucleotides; d. generating a signal using said oligonucleotide probe specific for the modified live Swine Influenza virus specific vaccine; and e. detecting said signal, wherein detection of said signal indicates a vaccination with a Swine Influenza virus specific vaccine in the biological sample.

4. The method of claim 3 further providing an oligonucleotide probe specific for the Swine Influenza virus for detecting an infection with Swine Influenza virus; and a. contacting said oligonucleotide primer pair with said biological sample under conditions which allow for amplification of polynucleotides; b. generating a signal using said oligonucleotide probe specific for the modified live Swine Influenza specific vaccine and/or said oligonucleotide probe specific for the Swine Influenza virus; and c. differentiating animals vaccinated with a modified live Swine Influenza virus specific vaccine from animals infected with Swine Influenza virus by detecting said signal, wherein i) detection of a signal using said oligonucleotide probe specific for the modified live Swine Influenza specific vaccine indicates a vaccination with a Swine Influenza specific vaccine in the biological sample, and, ii) detection of signal using said oligonucleotide probe specific for the Swine Influenza virus indicates an infection with a Swine Influenza virus in the biological sample.

5. The method of claim 3 further comprising detecting animals vaccinated within a group of animals comprising the steps of: a. obtaining an environmental Sample containing at least one nucleic acid from an animal; b. contacting said oligonucleotide primer pair and said oligonucleotide probe with said environmental Sample under conditions which allow for amplification of polynucleotides; c. generating a signal using said oligonucleotide probe specific for the modified live Swine Influenza specific vaccine; and d. detecting the oligonucleotide probe signal, wherein the presence of the oligonucleotide probe signal indicates a vaccination with the Swine Influenza virus specific vaccine within said group of animals.

6. A method for determining a ratio between animals vaccinated with a modified live Swine Influenza virus specific vaccine and animals infected with Swine Influenza virus within a group of animals comprising the steps of: a. obtaining an environmental Sample containing at least one nucleic acid from an animal; b. providing i) at least one forward and one reverse-oligonucleotide primer pair, and, ii) an oligonucleotide probe specific for the modified live Swine Influenza virus specific vaccine for detecting a vaccination with a Swine Influenza virus specific vaccine, said oligonucleotide probe comprises at least fourteen contiguous nucleotides of the sequence shown in SEQ ID NO:3 (tagatcttgattaattaa) or its reverse complementary sequence (SEQ ID NO:4 ttaattaatcaagatcta) or a sequence having at least 70% sequence identity thereto, and, iii) an oligonucleotide probe specific for the Swine Influenza virus for detecting an infection with Swine Influenza virus; c. contacting said oligonucleotide primer pair and said oligonucleotide probes with said environmental Sample under conditions which allow for amplification of polynucleotides; d. generating a signal using said oligonucleotide probe specific for the modified live Swine Influenza specific vaccine and/or said oligonucleotide probe specific for the Swine Influenza virus; and e. detecting the oligonucleotide probe signal from i) the oligonucleotide probe specific for the modified live Swine Influenza virus specific vaccine, and, ii) from the oligonucleotide probe specific for the Swine Influenza virus; f. generating a ratio of i) and ii) or ii) and i) of step e.

7. (canceled)

8. (canceled)

9. (canceled)

10. The method for detecting of claim 3, wherein the oligonucleotide probe specific for the modified live Swine Influenza virus specific vaccine comprises at least twelve contiguous nucleotides of the sequence shown in SEQ ID NO:3 or its reverse complementary sequence (SEQ ID NO:4) or a sequence having at least 70% sequence identity thereto.

11. The method for detecting of claim 3, wherein the oligonucleotide probe specific for the modified live Swine Influenza virus specific vaccine binds to a non-naturally occurring sequence within the modified live Swine Influenza specific vaccine within the NS (non-structural protein) gene segment.

12. The method for detecting of claim 11, wherein the signal is an enzymatic signal, a fluorescent signal or an electrochemical signal.

13. The method for detecting of claim 12, wherein said amplification of polynucleotides is PCR (polymerase chain reaction) or real time PCR (polymerase chain reaction).

14. The method for detecting of claim 11, wherein said forward and said reverse-oligonucleotide primer is specific for the NS (non-structural protein) gene segment.

15. The method for detecting of claim 10, wherein said animal is swine.

16. The method for detecting of claim 10, wherein the biological sample is a nasal sample, oral fluid sample, respiratory tissue sample or lung sample.

17. The method for detecting of claim 5, wherein the environmental Sample is an air filter sample or a sample of a rope for collecting oral fluid.

18. The method for detecting of claim 17, wherein the oligonucleotide probe specific for the modified live Swine Influenza virus specific vaccine comprises at least twelve contiguous nucleotides of the sequence shown in SEQ ID NO:3 or its reverse complementary sequence (SEQ ID NO:4) or a sequence having at least 70% sequence identity thereto.

19. The method for detecting of claim 3, wherein the concentration of the modified live Swine Influenza virus specific vaccine or the Swine Influenza virus is between 2 to 12 log EID50.

20. The method for detecting of claim 19, wherein the oligonucleotide probe specific for the modified live Swine Influenza virus specific vaccine comprises at least twelve contiguous nucleotides of the sequence shown in SEQ ID NO:3 or its reverse complementary sequence (SEQ ID NO:4) or a sequence having at least 70% sequence identity thereto.

21. A diagnostic kit for the detection of an animal vaccinated with a modified live Swine Influenza virus specific vaccine comprising an oligonucleotide probe specific for the modified live Swine Influenza virus specific vaccine comprising at least fourteen contiguous nucleotides of the sequence shown in SEQ ID NO:3 (tagatcttgattaattaa) or its reverse complementary sequence (SEQ ID NO:4 ttaattaatcaagatcta) or a sequence having at least 70% sequence identity thereto.

22. The diagnostic kit of claim 20 further comprising an oligonucleotide probe specific for the Swine Influenza virus for detecting an infection with Swine Influenza virus, wherein said oligonucleotide probe is used for differentiating animals vaccinated with a modified live Swine Influenza virus specific vaccine from animals infected with Swine Influenza virus.

23. The diagnostic kit according to claim 21, wherein said kit comprises at least one forward and reverse-oligonucleotide primer pair.

24. The diagnostic kit of claim 22, wherein said kit comprises at least one forward and reverse-oligonucleotide primer pair, and wherein said at least one forward and one reverse-oligonucleotide primer pair, said oligonucleotide probe specific for the modified live Swine Influenza virus specific vaccine and said oligonucleotide probe specific for the Swine Influenza virus are in one container.

25. The diagnostic kit of claim 24, wherein said at least one forward and one reverse-oligonucleotide primer pair, said oligonucleotide probe specific for the modified live Swine Influenza virus specific vaccine and said oligonucleotide probe specific for the Swine Influenza virus are in two or more separate containers.

Description

DETAILED DESCRIPTION

[0295] The following Clauses are described herein: [0296] 1. A diagnostic kit for the detection of an animal vaccinated with a modified live Swine Influenza virus specific vaccine comprising an oligonucleotide probe specific for the modified live Swine Influenza virus specific vaccine comprising at least twelve contiguous nucleotides of the sequence shown in SEQ ID NO:3 (tagatcttgattaattaa) or its reverse complementary sequence (SEQ ID NO:4 ttaattaatcaagatcta) or a sequence having at least 70% sequence identity thereto. [0297] 2. A diagnostic kit for differentiating animals vaccinated with a modified live Swine Influenza virus specific vaccine from animals infected with Swine Influenza virus comprising [0298] a. an oligonucleotide probe specific for the modified live Swine Influenza virus specific vaccine comprising at least twelve contiguous nucleotides of the sequence shown in SEQ ID NO:3 (tagatcttgattaattaa) or its reverse complementary sequence (SEQ ID NO:4 ttaattaatcaagatcta) or a sequence having at least 70% sequence identity thereto; [0299] b. an oligonucleotide probe specific for the Swine Influenza virus for detecting an infection with Swine Influenza virus. [0300] 3. A method for detecting an animal vaccinated with a modified live Swine Influenza virus specific vaccine in a biological sample comprising the steps of: [0301] a. obtaining a biological sample containing at least one nucleic acid from an animal; [0302] b. providing a forward and a reverse-oligonucleotide primer pair and an oligonucleotide probe specific for the modified live Swine Influenza virus specific vaccine, said oligonucleotide probe comprises at least twelve contiguous nucleotides of the sequence shown in SEQ ID NO:3 (tagatcttgattaattaa) or its reverse complementary sequence (SEQ ID NO:4 ttaattaatcaagatcta) or a sequence having at least 70% sequence identity thereto; [0303] c. contacting said oligonucleotide primer pair with said biological sample under conditions which allow for amplification of polynucleotides; [0304] d. generating a signal using said oligonucleotide probe specific for the modified live Swine Influenza virus specific vaccine; and [0305] e. detecting said signal, wherein detection of said signal indicates a vaccination with a Swine Influenza virus specific vaccine in the biological sample. [0306] 4. A method for detecting an animal vaccinated with a modified live Swine Influenza virus specific vaccine in a biological sample comprising the steps of: [0307] a. obtaining a biological sample containing at least one nucleic acid from an animal; [0308] b. providing a forward and a reverse-oligonucleotide primer pair and an oligonucleotide probe specific for the modified live Swine Influenza virus specific vaccine, said oligonucleotide probe comprises at least twelve contiguous nucleotides of the sequence shown in SEQ ID NO:3 (tagatcttgattaattaa) or its reverse complementary sequence (SEQ ID NO:4 ttaattaatcaagatcta) or a sequence having at least 70% sequence identity thereto; [0309] c. contacting said oligonucleotide primer pair and said oligonucleotide probe with said biological sample under conditions which allow for amplification of polynucleotides; [0310] d. generating an amplification product and an oligonucleotide probe signal; and [0311] e. detecting said oligonucleotide probe signal, wherein detection of the oligonucleotide probe signal indicates a vaccination with a Swine Influenza virus specific vaccine in the biological sample. [0312] 5. A method of differentiating animals vaccinated with a modified live Swine Influenza virus specific vaccine from animals infected with Swine Influenza virus, comprising [0313] a. obtaining a biological sample containing at least one nucleic acid from an animal; [0314] b. providing [0315] i) at least one forward and one reverse-oligonucleotide primer pair, and, [0316] ii) an oligonucleotide probe specific for the modified live Swine Influenza virus specific vaccine for detecting a vaccination with a Swine Influenza virus specific vaccine, said oligonucleotide probe comprises at least twelve contiguous nucleotides of the sequence shown in SEQ ID NO:3 (tagatcttgattaattaa) or its reverse complementary sequence (SEQ ID NO:4 ttaattaatcaagatcta) or a sequence having at least 70% sequence identity thereto, and, [0317] iii) an oligonucleotide probe specific for the Swine Influenza virus for detecting an infection with Swine Influenza virus; [0318] c. contacting said oligonucleotide primer pair with said biological sample under conditions which allow for amplification of polynucleotides; [0319] d. generating a signal using said oligonucleotide probe specific for the modified live Swine Influenza specific vaccine and/or said oligonucleotide probe specific for the Swine Influenza virus; and [0320] e. detecting said signal, wherein [0321] i) detection of a signal using said oligonucleotide probe specific for the modified live Swine Influenza specific vaccine indicates a vaccination with a Swine Influenza specific vaccine in the biological sample, and, [0322] ii) detection of signal using said oligonucleotide probe specific for the Swine Influenza virus indicates an infection with a Swine Influenza virus in the biological sample. [0323] 6. A method of differentiating animals vaccinated with a modified live Swine Influenza virus specific vaccine from animals infected with Swine Influenza virus, comprising [0324] a. obtaining a biological sample containing at least one nucleic acid from an animal; [0325] b. providing [0326] i) at least one forward and one reverse-oligonucleotide primer pair, and, [0327] ii) an oligonucleotide probe specific for the modified live Swine Influenza virus specific vaccine for detecting a vaccination with a Swine Influenza virus specific vaccine, said oligonucleotide probe comprises at least twelve contiguous nucleotides of the sequence shown in SEQ ID NO:3 (tagatcttgattaattaa) or its reverse complementary sequence (SEQ ID NO:4 ttaattaatcaagatcta) or a sequence having at least 70% sequence identity thereto, and, [0328] iii) an oligonucleotide probe specific for the Swine Influenza virus for detecting an infection with Swine Influenza virus; [0329] c. contacting said oligonucleotide primer pair and said oligonucleotide probes with said biological sample under conditions which allow for amplification of polynucleotides; [0330] d. generating an amplification product and an oligonucleotide probe signal; and [0331] e. detecting said oligonucleotide probe signal, wherein [0332] i) detection of an oligonucleotide probe signal from the oligonucleotide probe specific for the modified live Swine Influenza virus specific vaccine indicates a vaccination with a Swine Influenza specific vaccine in the biological sample, and, [0333] ii) detection of an oligonucleotide probe signal from the oligonucleotide probe specific for the Swine Influenza virus indicates an infection with a Swine Influenza virus in the biological sample. [0334] 7. A method for detecting animals vaccinated with a modified live Swine Influenza virus specific vaccine within a group of animals comprising the steps of: [0335] a. obtaining an environmental Sample containing at least one nucleic acid from an animal; [0336] b. providing a forward and a reverse-oligonucleotide primer pair and an oligonucleotide probe specific for the modified live Swine Influenza virus specific vaccine, said oligonucleotide probe comprises at least twelve contiguous nucleotides of the sequence shown in SEQ ID NO:3 (tagatcttgattaattaa) or its reverse complementary sequence (SEQ ID NO:4 ttaattaatcaagatcta) or a sequence having at least 70% sequence identity thereto; [0337] c. contacting said oligonucleotide primer pair and said oligonucleotide probe with said environmental Sample under conditions which allow for amplification of polynucleotides; [0338] d. generating a signal using said oligonucleotide probe specific for the modified live Swine Influenza specific vaccine; and [0339] e. detecting the oligonucleotide probe signal, wherein the presence of the oligonucleotide probe signal indicates a vaccination with the Swine Influenza virus specific vaccine within said group of animals. [0340] 8. A method for detecting animals vaccinated with a modified live Swine Influenza virus specific vaccine within a group of animals comprising the steps of: [0341] a. obtaining an environmental Sample containing at least one nucleic acid from an animal; [0342] b. providing a forward and a reverse-oligonucleotide primer pair and an oligonucleotide probe specific for the modified live Swine Influenza virus specific vaccine, said oligonucleotide probe comprises at least twelve contiguous nucleotides of the sequence shown in SEQ ID NO:3 (tagatcttgattaattaa) or its reverse complementary sequence (SEQ ID NO:4 ttaattaatcaagatcta) or a sequence having at least 70% sequence identity thereto; [0343] c. contacting said oligonucleotide primer pair and said oligonucleotide probe with said environmental Sample under conditions which allow for amplification of polynucleotides; [0344] d. generating an amplification product and an oligonucleotide probe signal; and [0345] e. detecting the oligonucleotide probe signal, wherein the presence of the oligonucleotide probe signal indicates a vaccination with the Swine Influenza virus specific vaccine within said group of animals. [0346] 9. A method for determining a ratio between animals vaccinated with a modified live Swine Influenza virus specific vaccine and animals infected with Swine Influenza virus within a group of animals comprising the steps of: [0347] a. obtaining an environmental Sample containing at least one nucleic acid from an animal; [0348] b. providing [0349] i) at least one forward and one reverse-oligonucleotide primer pair, and, [0350] ii) an oligonucleotide probe specific for the modified live Swine Influenza virus specific vaccine for detecting a vaccination with a Swine Influenza virus specific vaccine, said oligonucleotide probe comprises at least twelve contiguous nucleotides of the sequence shown in SEQ ID NO:3 (tagatcttgattaattaa) or its reverse complementary sequence (SEQ ID NO:4 ttaattaatcaagatcta) or a sequence having at least 70% sequence identity thereto, and, [0351] iii) an oligonucleotide probe specific for the Swine Influenza virus for detecting an infection with Swine Influenza virus; [0352] c. contacting said oligonucleotide primer pair and said oligonucleotide probes with said environmental Sample under conditions which allow for amplification of polynucleotides; [0353] d. generating a signal using said oligonucleotide probe specific for the modified live Swine Influenza specific vaccine and/or said oligonucleotide probe specific for the Swine Influenza virus; and [0354] e. detecting the oligonucleotide probe signal from [0355] i) the oligonucleotide probe specific for the modified live Swine Influenza virus specific vaccine, and, [0356] ii) from the oligonucleotide probe specific for the Swine Influenza virus;

[0357] f. generating a ratio of i) and ii) or ii) and i) of step e. [0358] 10. A method for determining a ratio between animals vaccinated with a modified live Swine Influenza virus specific vaccine and animals infected with Swine Influenza virus within a group of animals comprising the steps of: [0359] a. obtaining an environmental Sample containing at least one nucleic acid from an animal; [0360] b. providing [0361] i) at least one forward and one reverse-oligonucleotide primer pair, and, [0362] ii) an oligonucleotide probe specific for the modified live Swine Influenza virus specific vaccine for detecting a vaccination with a Swine Influenza virus specific vaccine, said oligonucleotide probe comprises at least twelve contiguous nucleotides of the sequence shown in SEQ ID NO:3 (tagatcttgattaattaa) or its reverse complementary sequence (SEQ ID NO:4 ttaattaatcaagatcta) or a sequence having at least 70% sequence identity thereto, and, [0363] iii) an oligonucleotide probe specific for the Swine Influenza virus for detecting an infection with Swine Influenza virus; [0364] c. contacting said oligonucleotide primer pair and said oligonucleotide probes with said environmental Sample under conditions which allow for amplification of polynucleotides; [0365] d. generating an amplification product and an oligonucleotide probe signal; and [0366] e. detecting the oligonucleotide probe signal from [0367] i) the oligonucleotide probe specific for the modified live Swine Influenza virus specific vaccine, and, [0368] ii) from the oligonucleotide probe specific for the Swine Influenza virus; [0369] f. generating a ratio of i) and ii) or ii) and i) of step e. [0370] 11. The method of any one of clauses 3 to 10, wherein step a or c comprises extracting said nucleic acid from said biological sample or said environmental Sample. [0371] 12. The method of any one of clauses 3 to 11, wherein step a or c comprises a reverse transcription of the RNA. [0372] 13. The diagnostic kit according to clause 1 or 2, wherein said kit comprises at least one forward and reverse-oligonucleotide primer pair. [0373] 14. The diagnostic kit, method for detecting or method of differentiating of any one of clauses 1 to 13, wherein the oligonucleotide probe specific for the modified live Swine Influenza virus specific vaccine comprises at least fourteen contiguous nucleotides of the sequence shown in SEQ ID NO:3 or its reverse complementary sequence (SEQ ID NO:4) or a sequence having at least 70% sequence identity thereto. [0374] 15. The diagnostic kit, method for detecting or method of differentiating of any one of clauses 1 to 14, wherein the oligonucleotide probe specific for the modified live Swine Influenza virus specific vaccine comprises at least fifteen contiguous nucleotides of the sequence shown in SEQ ID NO:3 or its reverse complementary sequence (SEQ ID NO:4) or a sequence having at least 70% sequence identity thereto. [0375] 16. The diagnostic kit, method for detecting or method of differentiating of any one of clauses 1 to 15, wherein the oligonucleotide probe specific for the modified live Swine Influenza virus specific vaccine comprises at least sixteen contiguous nucleotides of the sequence shown in SEQ ID NO:3 or its reverse complementary sequence (SEQ ID NO:4) or a sequence having at least 70% sequence identity thereto. [0376] 17. The diagnostic kit, method for detecting or method of differentiating of any one of clauses 1 to 16, wherein the oligonucleotide probe specific for the modified live Swine Influenza virus specific vaccine comprises at least seventeen contiguous nucleotides of the sequence shown in SEQ ID NO:3 or its reverse complementary sequence (SEQ ID NO:4) or a sequence having at least 70% sequence identity thereto. [0377] 18. The diagnostic kit, method for detecting or method of differentiating of any one of clauses 1 to 17, wherein the oligonucleotide probe specific for the modified live Swine Influenza virus specific vaccine comprises a sequence shown in SEQ ID NO:3 or its reverse complementary sequence (SEQ ID NO:4) or a sequence having at least 70% sequence identity thereto. [0378] 19. The diagnostic kit, method for detecting or method of differentiating of any one of clauses 1 to 18, wherein the oligonucleotide probe specific for the modified live Swine Influenza virus specific vaccine comprises at least twelve contiguous nucleotides of the sequence shown in SEQ ID NO:5 (agtagatcttgattaattaagagggagc) or SEQ ID NO 7: (atggaaaagtagatcttgattaattaagagg), SEQ ID NO 9: (agtagatcttgattaattaagagggagcaatcg) or SEQ ID NO: 39 (AGTAGATCTTGATTAATTAAGAGGGAGCAATCG) or its complementary reverse sequences (SEQ ID NO:6; SEQ ID NO:8; SEQ ID NO:10; SEQ ID NO: 40) or a sequence having at least 70% sequence identity thereto. [0379] 20. The diagnostic kit, method for detecting or method of differentiating of any one of clauses 1 to 19, wherein the oligonucleotide probe specific for the modified live Swine Influenza virus specific vaccine comprises at least fourteen contiguous nucleotides of the sequence shown in SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9 or SEQ ID NO: 39 or its complementary reverse sequences (SEQ ID NO:6; SEQ ID NO:8; SEQ ID NO:10; SEQ ID NO: 40) or a sequence having at least 70% sequence identity thereto. [0380] 21. The diagnostic kit, method for detecting or method of differentiating of any one of clauses 1 to 20, wherein the oligonucleotide probe specific for the modified live Swine Influenza virus specific vaccine comprises at least sixteen contiguous nucleotides of the sequence shown in SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9 or SEQ ID NO: 39 or its complementary reverse sequences (SEQ ID NO:6; SEQ ID NO:8; SEQ ID NO:10; SEQ ID NO: 40) or a sequence having at least 70% sequence identity thereto. [0381] 22. The diagnostic kit, method for detecting or method of differentiating of any one of clauses 1 to 21, wherein the oligonucleotide probe specific for the modified live Swine Influenza virus specific vaccine comprises at least eighteen contiguous nucleotides of the sequence shown in SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9 or SEQ ID NO: 39 or its complementary reverse sequences (SEQ ID NO:6; SEQ ID NO:8; SEQ ID NO:10; SEQ ID NO: 40) or a sequence having at least 70% sequence identity thereto. [0382] 23. The diagnostic kit, method for detecting or method of differentiating of any one of clauses 1 to 22, wherein the oligonucleotide probe specific for the modified live Swine Influenza virus specific vaccine comprises at least twenty contiguous nucleotides of the sequence shown in SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9 or SEQ ID NO: 39 or its complementary reverse sequences (SEQ ID NO:6; SEQ ID NO:8; SEQ ID NO:10; SEQ ID NO: 40) or a sequence having at least 70% sequence identity thereto. [0383] 24. The diagnostic kit, method for detecting or method of differentiating of any one of clauses 1 to 23, wherein the oligonucleotide probe specific for the modified live Swine Influenza virus specific vaccine comprises at least twenty-two contiguous nucleotides of the sequence shown in SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9 or SEQ ID NO: 39 or its complementary reverse sequences (SEQ ID NO:6; SEQ ID NO:8; SEQ ID NO:10; SEQ ID NO: 40) or a sequence having at least 70% sequence identity thereto. [0384] 25. The diagnostic kit, method for detecting or method of differentiating of any one of clauses 1 to 24, wherein the oligonucleotide probe specific for the modified live Swine Influenza virus specific vaccine comprises at least twenty-four contiguous nucleotides of the sequence shown in SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9 or SEQ ID NO: 39 or its complementary reverse sequences (SEQ ID NO:6; SEQ ID NO:8; SEQ ID NO:10; SEQ ID NO: 40) or a sequence having at least 70% sequence identity thereto. [0385] 26. The diagnostic kit, method for detecting or method of differentiating of any one of clauses 1 to 25, wherein the oligonucleotide probe specific for the modified live Swine Influenza virus specific vaccine comprises at least twenty-six contiguous nucleotides of the sequence shown in SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9 or SEQ ID NO: 39 or its complementary reverse sequences (SEQ ID NO:6; SEQ ID NO:8; SEQ ID NO:10; SEQ ID NO: 40) or a sequence having at least 70% sequence identity thereto. [0386] 27. The diagnostic kit, method for detecting or method of differentiating of any one of clauses 1 to 26, wherein the oligonucleotide probe specific for the modified live Swine Influenza virus specific vaccine comprises a sequence shown in SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9 or SEQ ID NO: 39 or its complementary reverse sequences (SEQ ID NO:6; SEQ ID NO:8; SEQ ID NO:10; SEQ ID NO: 40) or a sequence having at least 70% sequence identity thereto. [0387] 28. The diagnostic kit, method for detecting or method of differentiating of any one of clauses 1 to 27, wherein said sequence identity of the oligonucleotide probe is at least 80%. [0388] 29. The diagnostic kit, method for detecting or method of differentiating of any one of clauses 1 to 28, wherein said sequence identity of the oligonucleotide probe is at least 90%. [0389] 30. The diagnostic kit, method for detecting or method of differentiating of any one of clauses 1 to 29, wherein said sequence identity of the oligonucleotide probe is at least 95%. [0390] 31. The diagnostic kit, method for detecting or method of differentiating of any one of clauses 1 to 30, wherein said sequence identity of the oligonucleotide probe is at least 97.5%. [0391] 32. The diagnostic kit, method for detecting or method of differentiating of any one of clauses 1 to 31, wherein the sequence of the oligonucleotide probe specific for the modified live Swine Influenza virus specific vaccine comprises the sequence shown in SEQ ID NO:5 or its complementary reverse sequence (SEQ ID NO:6). [0392] 33. The diagnostic kit, method for detecting or method of differentiating of any one of clauses 1 to 31, wherein the sequence of the oligonucleotide probe specific for the modified live Swine Influenza virus specific vaccine comprises the sequence shown in SEQ ID NO:7 or its complementary reverse sequence (SEQ ID NO:8). [0393] 34. The diagnostic kit, method for detecting or method of differentiating of any one of clauses 1 to 31, wherein the sequence of the oligonucleotide probe specific for the modified live Swine Influenza virus specific vaccine comprises the sequence shown in SEQ ID NO:9 or its complementary reverse sequence (SEQ ID NO:10) or wherein the sequence of the oligonucleotide probe specific for the modified live Swine Influenza virus specific vaccine comprises the sequence shown in SEQ ID NO:39 or its complementary reverse sequence (SEQ ID NO:40). [0394] 35. The diagnostic kit, method for detecting or method of differentiating of any one of clauses 1 to 34, wherein the oligonucleotide probe specific for the modified live Swine Influenza virus specific vaccine binds to a non-naturally occurring sequence within the modified live Swine Influenza specific vaccine. [0395] 36. The diagnostic kit, method for detecting or method of differentiating of any one of clauses 1 to 35, wherein the oligonucleotide probe specific for the modified live Swine Influenza virus specific vaccine binds to a non-naturally occurring sequence within the modified live Swine Influenza specific vaccine within the NS (non-structural protein) gene segment. [0396] 37. The diagnostic kit, method for detecting or method of differentiating of any one of clauses 1 to 36, wherein the oligonucleotide probe specific for the modified live Swine Influenza virus specific vaccine binds to a non-naturally occurring sequence within the modified live Swine Influenza specific vaccine between the NS-1 (non-structural protein) and NS-2 ORF. [0397] 38. The diagnostic kit, method for detecting or method of differentiating of any one of clauses 2, 5, 6 and 9 to 37, wherein the oligonucleotide probe specific for the Swine Influenza virus binds to a naturally occurring sequence within the Swine Influenza virus. [0398] 39. The diagnostic kit, method for detecting or method of differentiating of any one of clauses 2, 5, 6, and 9 to 38, wherein the oligonucleotide probe specific for the Swine Influenza virus is specific for the HA, NA, PB1, PB2, PA, NP, M, or NS gene segment of a Swine Influenza virus. [0399] 40, The diagnostic kit, method for detecting or method of differentiating of any one of clauses 2, 5, 6 and 9 to 39, wherein the oligonucleotide probe specific for the Swine Influenza virus is specific for the NS (non-structural protein) gene segment. [0400] 41. The diagnostic kit, method for detecting or method of differentiating of any one of clauses 2, 5, 6 and 9 to 40, wherein the oligonucleotide probe specific for the Swine Influenza virus is specific for the NS-1 (non-structural protein-1) ORF. [0401] 42. The diagnostic kit, method for detecting or method of differentiating of any one of clauses 2, 5, 6 and 9 to 41, wherein the oligonucleotide probe specific for the Swine Influenza virus comprises at least twelve contiguous nucleotides of the sequence shown in SEQ ID NO:11 (gtgtgatctttaaccgattagagactttgt) or SEQ ID NO:13 (TGATACTACTAAGGGCTTTCACTGA) or SEQ ID NO:15 (TGATACTACTAAGAGCTTTCACTGA) or SEQ ID NO:17 (TAATACTACTAAGGGCTTTCACTGA) or SEQ ID NO:19 (TGATACTACTGAGAGCTTTCACTGA) or SEQ ID NO:21 (TGGTACTACTAAGGGCTTTCACTG) or SEQ ID NO:23 (TGATACTACTAAGGGCTTTCACCG) or SEQ ID NO:25 (TGATACTACTGAGGGCTTTCACTG) or its complementary reverse sequences (SEQ ID NO:12; SEQ ID NO:14; SEQ ID NO:16; SEQ ID NO:18; SEQ ID NO:20; SEQ ID NO:22; SEQ ID NO:24; SEQ ID NO:26) or a sequence having at least 70% sequence identity thereto. [0402] 43. The diagnostic kit, method for detecting or method of differentiating of any one of clauses 2, 5, 6 and 9 to 42, wherein the oligonucleotide probe specific for the Swine Influenza virus comprises at least fourteen contiguous nucleotides of the sequence shown SEQ ID NO:11; SEQ ID NO:13; SEQ ID NO:15; SEQ ID NO:17; SEQ ID NO:19; SEQ ID NO:21; SEQ ID NO:23 or SEQ ID NO:25 or its complementary reverse sequences (SEQ ID NO:12; SEQ ID NO:14; SEQ ID NO:16; SEQ ID NO:18; SEQ ID NO:20; SEQ ID NO:22; SEQ ID NO:24; SEQ ID NO:26) or a sequence having at least 70% sequence identity thereto. [0403] 44. The diagnostic kit, method for detecting or method of differentiating of any one of clauses 2, 5, 6 and 9 to 43, wherein the oligonucleotide probe specific for the Swine Influenza virus comprises at least sixteen contiguous nucleotides of the sequence shown in SEQ ID NO:11; SEQ ID NO:13; SEQ ID NO:15; SEQ ID NO:17; SEQ ID NO:19; SEQ ID NO:21; SEQ ID NO:23 or SEQ ID NO:25 or its complementary reverse sequences (SEQ ID NO:12; SEQ ID NO:14; SEQ ID NO:16; SEQ ID NO:18; SEQ ID NO:20; SEQ ID NO:22; SEQ ID NO:24; SEQ ID NO:26) or its complementary reverse sequences or a sequence having at least 70% sequence identity thereto. [0404] 45. The diagnostic kit, method for detecting or method of differentiating of any one of clauses 2, 5, 6 and 9 to 44, wherein the oligonucleotide probe specific for the Swine Influenza virus comprises at least eighteen contiguous nucleotides of the sequence shown in SEQ ID NO:11; SEQ ID NO:13; SEQ ID NO:15; SEQ ID NO:17; SEQ ID NO:19; SEQ ID NO:21; SEQ ID NO:23 or SEQ ID NO:25 or its complementary reverse sequences (SEQ ID NO:12; SEQ ID NO:14; SEQ ID NO:16; SEQ ID NO:18; SEQ ID NO:20; SEQ ID NO:22; SEQ ID NO:24; SEQ ID NO:26) or a sequence having at least 70% sequence identity thereto. [0405] 46. The diagnostic kit, method for detecting or method of differentiating of any one of clauses 2, 5, 6 and 9 to 45, wherein the oligonucleotide probe specific for the Swine Influenza virus comprises at least twenty contiguous nucleotides of the sequence shown in SEQ ID NO:11; SEQ ID NO:13; SEQ ID NO:15; SEQ ID NO:17; SEQ ID NO:19; SEQ ID NO:21; SEQ ID NO:23 or SEQ ID NO:25 or its complementary reverse sequences (SEQ ID NO:12; SEQ ID NO:14; SEQ ID NO:16; SEQ ID NO:18; SEQ ID NO:20; SEQ ID NO:22; SEQ ID NO:24; SEQ ID NO:26) or a sequence having at least 70% sequence identity thereto. [0406] 47. The diagnostic kit, method for detecting or method of differentiating of any one of clauses 2, 5, 6 and 9 to 46, wherein the oligonucleotide probe specific for the Swine Influenza virus comprises at least twenty-two contiguous nucleotides of the sequence shown in SEQ ID NO:11; SEQ ID NO:13; SEQ ID NO:15; SEQ ID NO:17; SEQ ID NO:19; SEQ ID NO:21; SEQ ID NO:23 or SEQ ID NO:25 or its complementary reverse sequences (SEQ ID NO:12; SEQ ID NO:14; SEQ ID NO:16; SEQ ID NO:18; SEQ ID NO:20; SEQ ID NO:22; SEQ ID NO:24; SEQ ID NO:26) or a sequence having at least 70% sequence identity thereto. [0407] 48. The diagnostic kit, method for detecting or method of differentiating of any one of clauses 2, 5, 6 and 9 to 47, wherein the oligonucleotide probe specific for the Swine Influenza virus comprises at least twenty-four contiguous nucleotides of the sequence shown in SEQ ID NO:11; SEQ ID NO:13; SEQ ID NO:15; SEQ ID NO:17; SEQ ID NO:19; SEQ ID NO:21; SEQ ID NO:23 or SEQ ID NO:25 or its complementary reverse sequences (SEQ ID NO:12; SEQ ID NO:14; SEQ ID NO:16; SEQ ID NO:18; SEQ ID NO:20; SEQ ID NO:22; SEQ ID NO:24; SEQ ID NO:26) or a sequence having at least 70% sequence identity thereto. [0408] 49. The diagnostic kit, method for detecting or method of differentiating of any one of clauses 2, 5, 6 and 9 to 48, wherein the oligonucleotide probe specific for the Swine Influenza virus comprises at least twenty-six contiguous nucleotides of the sequence shown in SEQ ID NO:11; SEQ ID NO:13; SEQ ID NO:15; SEQ ID NO:17; SEQ ID NO:19; SEQ ID NO:21; SEQ ID NO:23 or SEQ ID NO:25 or its complementary reverse sequences (SEQ ID NO:12; SEQ ID NO:14; SEQ ID NO:16; SEQ ID NO:18; SEQ ID NO:20; SEQ ID NO:22; SEQ ID NO:24; SEQ ID NO:26) or a sequence having at least 70% sequence identity thereto. [0409] 50. The diagnostic kit, method for detecting or method of differentiating of any one of clauses 2, 5, 6 and 9 to 49, wherein the oligonucleotide probe specific for the Swine Influenza virus comprises at least twenty-eight contiguous nucleotides of the sequence shown in SEQ ID NO:11; SEQ ID NO:13; SEQ ID NO:15; SEQ ID NO:17; SEQ ID NO:19; SEQ ID NO:21; SEQ ID NO:23 or SEQ ID NO:25 or its complementary reverse sequences (SEQ ID NO:12; SEQ ID NO:14; SEQ ID NO:16; SEQ ID NO:18; SEQ ID NO:20; SEQ ID NO:22; SEQ ID NO:24; SEQ ID NO:26) or a sequence having at least 70% sequence identity thereto. [0410] 51. The diagnostic kit, method for detecting or method of differentiating of any one of clauses 2, 5, 6 and 9 to 50, wherein the oligonucleotide probe specific for the Swine Influenza virus comprises a sequence shown in SEQ ID NO:11; SEQ ID NO:13; SEQ ID NO:15; SEQ ID NO:17; SEQ ID NO:19; SEQ ID NO:21; SEQ ID NO:23 or SEQ ID NO:25 or its complementary reverse sequences (SEQ ID NO:12; SEQ ID NO:14; SEQ ID NO:16; SEQ ID NO:18; SEQ ID NO:20; SEQ ID NO:22; SEQ ID NO:24; SEQ ID NO:26) or a sequence having at least 70% sequence identity thereto. [0411] 52, The diagnostic kit, method for detecting or method of differentiating of any one of clauses 42 to 51, wherein said sequence identity of the oligonucleotide probe is at least 80%. [0412] 53. The diagnostic kit, method for detecting or method of differentiating of any one of clauses 42 to 52, wherein said sequence identity of the oligonucleotide probe is at least 90%. [0413] 54, The diagnostic kit, method for detecting or method of differentiating of any one of clauses 42 to 53, wherein said sequence identity of the oligonucleotide probe is at least 95%. [0414] 55. The diagnostic kit, method for detecting or method of differentiating of any one of clauses 42 to 54, wherein said sequence identity of the oligonucleotide probe is at least 97.5%. [0415] 56, The diagnostic kit, method for detecting or method of differentiating of any one of clauses 38 to 55, wherein the sequence of the oligonucleotide probe specific for the Swine Influenza virus comprises the sequence shown in SEQ ID NO:11; SEQ ID NO:13; SEQ ID NO:15; SEQ ID NO:17; SEQ ID NO:19; SEQ ID NO:21; SEQ ID NO:23 or SEQ ID NO:25 or its complementary reverse sequences (SEQ ID NO:12; SEQ ID NO:14; SEQ ID NO:16; SEQ ID NO:18; SEQ ID NO:20; SEQ ID NO:22; SEQ ID NO:24; SEQ ID NO:26). [0416] 57. The method for detecting or method of differentiating of any one of clauses 3 to 12 and 14 to 56, wherein the signal is an enzymatic signal, a fluorescent signal or an electrochemical signal. [0417] 58. The diagnostic kit, method for detecting or method of differentiating of any one of clauses 1 to 57, wherein the oligonucleotide probe or primer is coupled with a detectable label selected from the group consisting of a radioactive element and a fluorescent chemical. [0418] 59. The diagnostic kit, method for detecting or method of differentiating of any one of clauses 1 to 57, wherein the oligonucleotide probe is coupled with a detectable label selected from the group consisting of a radioactive element and a fluorescent chemical. [0419] 60. The diagnostic kit, method for detecting or method of differentiating of clause 58 or 59, wherein the fluorescent chemical label is selected from a fluorescein, a cyanine dye, a coumarin, a phycoerythrin, a phycobiliprotein, a dansyl chloride, a lanthanide complex or a fluorochrome. [0420] 61. The diagnostic kit, method for detecting or method of differentiating of clause 60, wherein said fluorochrome is R-phycoerythrin, Cy3, Cy5, Quasar 670, Rhodamin, Alexa, or Texas Red. [0421] 62. The diagnostic kit, method for detecting or method of differentiating of clause 60, wherein said fluorescein is 6-FAM (6-carboxyfluorescein), TET (6-carboxy-4,7,2′,7′-tetrachlorofluorescein), JOE (2,7-dimethoxy-4,5-dichloro-6-carboxyfluorescein) or HEX (6-carboxy-2′,4′,7′,4,7-hexachlorofluorescein). [0422] 63. The diagnostic kit, method for detecting or method of differentiating of any one of clauses 1 to 62, wherein the oligonucleotide probe is further labeled with a quencher selected from 6-carboxytetramethylrhodamine (TAMRA), black hole quencher (BHQ) BHQ-1 and 2 or 6-carboxy-X-rhodamine (ROX). [0423] 64. The diagnostic kit, method for detecting or method of differentiating of any one of clauses 1 to 63, wherein the oligonucleotide probe or primer is coupled with a fluorescent label. [0424] 65. The diagnostic kit, method for detecting or method of differentiating of any one of clauses 1 to 64, wherein the oligonucleotide probe or primer is coupled with a first coupling group. [0425] 66. The diagnostic kit, method for detecting or method of differentiating of any one of clauses 3 to 64, wherein the primer is coupled with a first coupling group. [0426] 67. The diagnostic kit, method for detecting or method of differentiating of clause 65 or 66, wherein the generation of a signal comprises providing a second coupling group. [0427] 68. The diagnostic kit, method for detecting or method of differentiating of any one of clauses 65 to 67, wherein said first and second coupling groups are selected from the group consisting of antibody-antigen, receptor-ligand, biotin-streptavidin, sugar-lectins, and complementary oligonucleotides. [0428] 69. The diagnostic kit, method for detecting or method of differentiating of any one of clauses 65 to 68, wherein the second coupling group is labelled. [0429] 70. The diagnostic kit, method for detecting or method of differentiating of clause 69, wherein the label is selected from the group consisting of a radioactive element, a fluorescent chemical or an enzyme. [0430] 71. The diagnostic kit, method for detecting or method of differentiating of clause 70, wherein said fluorescent chemical label is a fluorescent according to clauses 60 to 62. [0431] 72. The diagnostic kit, method for detecting or method of differentiating of clause 70, wherein said enzyme label is selected from horseradish peroxidase (HRP), esterase, alkaline phosphatase (AP), Glucose oxidase, β-galactosidase or Luciferase. [0432] 73, The diagnostic kit, method for detecting or method of differentiating of any one of clauses 3 to 12, 14 to 57, 65 to 70 and 72, wherein the oligonucleotide probe or primer signal is an enzymatic signal. [0433] 74. The diagnostic kit, method for detecting or method of differentiating of clause 70 or 72, wherein said enzyme converts a substrate into a reversible redox couple. [0434] 75. The diagnostic kit, method for detecting or method of differentiating of any one of clauses 3 to 12, 14 to 57, 65 to 70 and 72 to 74, wherein the oligonucleotide probe or primer signal is an electrochemical signal. [0435] 76. The diagnostic kit, method for detecting or method of differentiating of any one of clauses 3 to 12 and 14 to 75, wherein said amplification of polynucleotides is PCR (polymerase chain reaction) or real time PCR (polymerase chain reaction). [0436] 77. The diagnostic kit, method for detecting or method of differentiating of any one of clauses 3 to 76, wherein said forward and said reverse-oligonucleotide primer is specific for the NS (non-structural protein) gene segment. [0437] 78. The diagnostic kit, method for detecting or method of differentiating of any one of clauses 3 to 77, wherein said forward-oligonucleotide primer is specific for the NS-1 (non-structural protein-1) ORF. [0438] 79. The diagnostic kit, method for detecting or method of differentiating of any one of clauses 3 to 78, wherein said reverse-oligonucleotide primer is specific for the NS-2 (non-structural protein-2) ORF. [0439] 80. The diagnostic kit, method for detecting or method of differentiating of any one of clauses 3 to 79, wherein said forward and said reverse-oligonucleotide primer specific for the NS (non-structural protein) gene segment comprise at least twelve contiguous nucleotides of the sequence shown in SEQ ID NO:1 (gataataggctctctttgtg) or SEQ ID NO:2 (aggtaatggtgaaatttctc) or SEQ ID NO:27 to SEQ ID NO:38 or a sequence having at least 70% sequence identity thereto. [0440] 81. The diagnostic kit, method for detecting or method of differentiating of any one of clauses 3 to 80, wherein said forward and said reverse-oligonucleotide primer specific for the NS (non-structural protein) gene segment comprise at least fourteen contiguous nucleotides of the sequence shown in SEQ ID NO:1; SEQ ID NO:2 or SEQ ID NO:27 to SEQ ID NO:38 or a sequence having at least 70% sequence identity thereto. [0441] 82. The diagnostic kit, method for detecting or method of differentiating of any one of clauses 3 to 81, wherein said forward and said reverse-oligonucleotide primer specific for the NS (non-structural protein) gene segment comprise at least sixteen contiguous nucleotides of the sequence shown in SEQ ID NO:1; SEQ ID NO:2 or SEQ ID NO:27 to SEQ ID NO:38 or a sequence having at least 70% sequence identity thereto. [0442] 83. The diagnostic kit, method for detecting or method of differentiating of any one of clauses 3 to 82, wherein said forward and said reverse-oligonucleotide primer specific for the NS (non-structural protein) gene segment comprise at least eighteen contiguous nucleotides of the sequence shown in SEQ ID NO:1; SEQ ID NO:2 or SEQ ID NO:27 to SEQ ID NO:38 or a sequence having at least 70% sequence identity thereto. [0443] 84. The diagnostic kit, method for detecting or method of differentiating of any one of clauses 3 to 83, wherein said forward and said reverse-oligonucleotide primer specific for the NS (non-structural protein) gene segment comprise the sequence shown in SEQ ID NO:1; SEQ ID NO:2 or SEQ ID NO:27 to SEQ ID NO:38 or a sequence having at least 70% sequence identity thereto. [0444] 85. The diagnostic kit, method for detecting or method of differentiating of any one of clauses 80 to 84, wherein said sequence identity of the oligonucleotide primer is at least 80%. [0445] 86. The diagnostic kit, method for detecting or method of differentiating of any one of clauses 80 to 85, wherein said sequence identity of the oligonucleotide primer is at least 90%. [0446] 87. The diagnostic kit, method for detecting or method of differentiating of any one of clauses 80 to 86, wherein said sequence identity of the oligonucleotide primer is at least 95%. [0447] 88. The diagnostic kit, method for detecting or method of differentiating of any one of clauses 80 to 87, wherein said sequence identity of the oligonucleotide primer is at least 97.5%. [0448] 89, The diagnostic kit, method for detecting or method of differentiating of any one of clauses 80 to 88, wherein said forward and said reverse-oligonucleotide primer specific for the NS (non-structural protein) gene segment comprise the sequence shown in SEQ ID NO:1; SEQ ID NO:2 or SEQ ID NO:27 to SEQ ID NO:38. [0449] 90. The diagnostic kit, method for detecting or method of differentiating of any one of clauses 1 to 89, wherein said animal is swine. [0450] 91. The diagnostic kit, method for detecting or method of differentiating of any one of clauses 3 to 6, 11 to 12 and 14 to 90, wherein the biological sample is a nasal sample, oral fluid sample, respiratory tissue sample or lung sample. [0451] 92. The diagnostic kit, method for detecting or method of differentiating of any one of clauses 7 to 12 and 14 to 90, wherein the environmental Sample is an air filter sample or a sample of a rope for collecting oral fluid. [0452] 93. The diagnostic kit, method for detecting or method of differentiating of any one of clauses 3 to 12 and 14 to 92, wherein the concentration of the modified live Swine Influenza virus specific vaccine or the Swine Influenza virus is between 2 to 12 log EID50. [0453] 94. The diagnostic kit, method for detecting or method of differentiating of any one of clauses 3 to 12 and 14 to 93, wherein the concentration of the modified live Swine Influenza virus specific vaccine or the Swine Influenza virus is between 4 to 10 log EID50. [0454] 95. The diagnostic kit, method for detecting or method of differentiating of any one of clauses 3 to 12 and 14 to 94, wherein the concentration of the modified live Swine Influenza virus specific vaccine or the Swine Influenza virus is between 6 to 8 log EID50. [0455] 95. The diagnostic kit, method for detecting or method of differentiating of any one of clauses 1 to 95, wherein the modified live Swine Influenza virus specific vaccine comprises a sequence which is identical or complementary to the oligonucleotide probe specific for the modified live Swine Influenza virus specific vaccine according to any one of clauses 14 to 34. [0456] 97. The diagnostic kit, method for detecting or method of differentiating of any one of clauses 1 to 96, wherein said identical or complementary sequence according to clause 96 is a non-naturally occurring sequence within the modified live Swine Influenza virus specific vaccine. [0457] 98. The diagnostic kit, method for detecting or method of differentiating of any one of clauses 1 to 97, wherein said identical or complementary sequence according to clause 96 or 97 is within the NS (non-structural protein) gene segment of the modified live Swine Influenza virus specific vaccine. [0458] 99. The diagnostic kit, method for detecting or method of differentiating of any one of clauses 1 to 98, wherein said identical or complementary sequence according to clause 96 to 98 is between the NS-1 (non-structural protein) and NS-2 ORF of the modified live Swine Influenza virus specific vaccine. [0459] 100. The diagnostic kit, method for detecting or method of differentiating of any one of clauses 1 to 99, wherein the modified live Swine Influenza virus specific vaccine is attenuated. [0460] 101. The diagnostic kit, method for detecting or method of differentiating of any one of clauses 1 to 100, wherein the modified live Swine Influenza virus specific vaccine is bivalent. [0461] 102. The diagnostic kit, method for detecting or method of differentiating of any one of clauses 1 to 101, wherein the modified live Swine Influenza virus specific vaccine comprises modified live H3N2 and H1N1 Swine Influenza virus. [0462] 103. The diagnostic kit, method for detecting or method of differentiating of any one of clauses 1 to 102, wherein the modified live H3N2 and H1N1 viruses of swine influenza virus have a deletion within the NS1 gene. [0463] 104. The diagnostic kit, method for detecting or method of differentiating of any one of clauses 1 to 103, wherein the modified live H3N2 and H1N1 viruses of swine influenza virus encode for a carboxy-terminal truncated NS1 protein. [0464] 105. The diagnostic kit, method for detecting or method of differentiating of any one of clauses 1 to 104, wherein the modified live H3N2 and H1N1 viruses of swine influenza virus encode for a carboxy-terminal truncated NS1 protein comprising NS1 amino acids 1 through 124, 1 through 125, 1 through 126, 1 through 127 or 1 through 128, wherein the amino terminal amino acid is number 1. [0465] 106 The diagnostic kit, method for detecting or method of differentiating of any one of clauses 1 to 105, wherein the modified live H3N2 and H1N1 viruses of swine influenza virus encode for a carboxy-terminal truncated NS1 protein comprising NS1 amino acids 1 through 126, wherein the amino terminal amino acid is number 1. [0466] 107. The diagnostic kit, method for detecting or method of differentiating of any one of clauses 1 to 106, wherein the modified live H3N2 and H1N1 viruses of swine influenza virus have a carboxy-terminal truncated NS1 protein resulting in a deletion of 91, 92, 93 or 94 amino acid residues from the carboxy terminus of NS1. [0467] 108. The diagnostic kit, method for detecting or method of differentiating of any one of clauses 1 to 107, wherein the modified live H3N2 and H1N1 viruses of swine influenza virus have a NS1 gene or protein from A/Swine/Texas/4199-2/98. [0468] 109. The diagnostic kit, method for detecting or method of differentiating of any one of clauses 1 to 108, wherein the modified live H3N2 virus of swine influenza is TX/98/del 126 containing the HA, NA, PB2, PB1, PA, NP, and M from A/Swine/Texas/4199-2/98 and the NS1-126 gene is from A/Swine/Texas/4199-2/98 and, wherein the modified live H1N1 virus of swine influenza contains HA and NA from A/swine/Minnesota/37866/1999 (H1N1) and PB2, PB1, PA, NP, M from A/Swine/Texas/4199-2/98 (H3N2) and the NS1-126 gene is from A/Swine/Texas/4199-2/98 (H3N2). [0469] 110. The diagnostic kit of any one of clauses 13 to 109, wherein said at least one forward and one reverse-oligonucleotide primer pair and said oligonucleotide probe specific for the modified live Swine Influenza virus specific vaccine are in one container. [0470] 111. The diagnostic kit of any one of clauses 13 to 109, wherein said at least one forward and one reverse-oligonucleotide primer pair and said oligonucleotide probe specific for the modified live Swine Influenza virus specific vaccine are in two or more separate containers. [0471] 112. The diagnostic kit of any one of clauses 13 to 109, wherein said at least one forward and one reverse-oligonucleotide primer pair, said oligonucleotide probe specific for the modified live Swine Influenza virus specific vaccine and said oligonucleotide probe specific for the Swine Influenza virus are in one container. [0472] 113. The diagnostic kit of any one of clauses 13 to 109, wherein said at least one forward and one reverse-oligonucleotide primer pair, said oligonucleotide probe specific for the modified live Swine Influenza virus specific vaccine and said oligonucleotide probe specific for the Swine Influenza virus are in two or more separate containers. [0473] 114. The diagnostic kit of any one of clauses 2 and 13 to 109, wherein said oligonucleotide probe specific for the modified live Swine Influenza virus specific vaccine and said oligonucleotide probe specific for the Swine Influenza virus are in one container. [0474] 115. The diagnostic kit of any one of clauses 2 and 13 to 109, wherein said oligonucleotide probe specific for the modified live Swine Influenza virus specific vaccine and said oligonucleotide probe specific for the Swine Influenza virus are in two or more separate containers. [0475] 116. The diagnostic kit of any one of clauses 1 or 2 and 13 to 115, wherein said kit comprises one or more control samples. [0476] 117. The diagnostic kit of clause 116, wherein said control sample is a RNA, cDNA or DNA sample. [0477] 118. The diagnostic kit of clause 116 or 117, wherein the control is a positive control comprising RNA, cDNA or DNA specific for the modified live Swine Influenza virus specific vaccine. [0478] 119, The diagnostic kit of clause 116 or 117, wherein the control is a positive control comprising RNA, cDNA or DNA specific for the Swine Influenza virus. [0479] 120. The diagnostic kit of any one of clauses 1 or 2 and 13 to 119, wherein said kit comprises an instruction letter providing information for use of the kit. [0480] 121. The diagnostic kit, method for detecting or method of differentiating of any one of clauses 1 to 118, wherein said Swine Influenza virus is a Swine Influenza A virus.

EXAMPLES

[0481] The following examples are only intended to illustrate the present invention. They shall not limit the scope of the claims in any way.

Materials and Methods

[0482] 1. Preparation of the Primers/Probes Mix

TABLE-US-00002 TABLE 1 Primers/Probes sequences: NSfor 5′-gataataggctctctttgtg-3′ (SEQ ID NO: 1) NSrev 5′-aggtaatggtgaaatttctc-3′ (SEQ ID NO: 2) MLV probe 1 Quasar 670 5′-atggaaaagtagatcttgatta attaagagg-3′ BHQ2 (SEQ ID NO: 7) MLVfluprobe2 Quasar 670 5′-agtagatcttgattaattaaga gggagc-3′ BHQ-2 (SEQ ID NO: 5) WTfluprobe Fam 5′-gtgtgatctttaaccgattagagacttt g-3′ BHQ-1 (SEQ ID NO: 11)

TABLE-US-00003 TABLE 2 Primers/Probes concentration Primers/Probes Final Mix concentration: NSfor gataataggctctctttgtg (SEQ ID NO: 1)  0.5 μM NSrev aggtaatggtgaaatttctc (SEQ ID NO: 2)  0.4 μM WTfluprobe gtgtgatctttaaccgattagagactttg (SEQ ID NO: 11) 0.25 μM MLVfluprobe1 atggaaaagtagatcttgattaattaagagg (SEQ ID NO: 7) 0.25 μM MLVfluprobe2 agtagatcttgattaattaagagggagc (SEQ ID NO: 5) 0.25 μM
Primers and probes were purchased from Biosearch Technologies.
NS (non-structural protein); for (forward); rev (reverse); WT (wildtype); MLV (modified live virus)

[0483] 2. Preparation of the Master Mix

TABLE-US-00004 TABLE 3 Preparation of the master mix Life Tech FAST viral mix 1x (μl) Fast viral Mix 3 Multiplex RT-PCR Enzyme Mix 0.5 Primer mix 1.0 Probe or probe mix (WT and/or MLV) 1.0 Template RNA 5.5 Final volume 11.0 5.5 μl mix + 5.5 μl RNA

[0484] 3. Cycling Protocol

TABLE-US-00005 TABLE 4 Cycling protocol Sample Ramp Step Time Temperature Rate RT  5′ 50° C. 4.4 Initial Denaturation 20″ 95° C. 4.4 Denaturation  3″ 95° C. 4.4 40x Annealing/Extension 45″ 60° C. 2.2 Cooling 20″ 40° C. 4.4

[0485] 4. Extraction Information

[0486] Samples were extracted using the Life Tech CORE kit (Thermofisher Scientific).

TABLE-US-00006 TABLE 5 Extraction Oral Fluids Step Core Oral Fluids Procedure 1 Add 450 μL of Lysis solution to 96 deep well plate 2 Load 300 μL sample 3 Shake 3 minutes, spin 3 minutes 4 In a new 96 dw plate, load 30 μL of beads 5 Add 600 μL of clarified lysate from step 3 to beads 6 Add 350 μL of ISO to samples 7 Load on KF

TABLE-US-00007 TABLE 6 Extraction Nasal Swab Step Core (Serum) Swab Procedure 1 Load 30 μL bead mix into deep well plate 2 Load 100 μl of sample to beads 3 Add 700 μL lysis/binding solution to samples 4 Load on KF

[0487] 5. Equipment Used

Samples were extracted using the KingFisher FLEX 96 robot (Thermofisher Scientific).
Real-Time PCR was conducted using a Lightcycler 480 system 2 (Roche Applied Science)

[0488] 6. Principle of Detection

Two hydrolysis probes are designed to bind downstream of the primers during the PCR reaction. The 5′ end of each probe is labeled with a fluorescent reporter molecule (see Table 1). On the 3′ end, the probe has been labeled with a quencher that limits the fluorescent output. During the PCR reaction, the reporter and quencher are cleaved by the polymerase enzyme.
The WT probe is labeled with a FAM reporter which has a peak excitation at a wave length of 495 nanometers (nm) and a peak emission of 520 nm. The MLV probe is labeled with a Quasar 670 reporter which has a peak excitation at a wave length of 647 nm and a peak emission of 670 nm. These reporter dyes and quenchers are recommended for use on the Lightcycler 480 II (Roche), but other commonly used dyes may also be used.

TABLE-US-00008 TABLE 7 Information on samples tested Virus Information Concentration Code Provenza vaccine 6-8 log EID50 A A/Swine/Indiana/1726/1988 (H1N1) 6-8 log EID50 B A/Swine/Texas/4199-2/1998 (H3N2) 6-8 log EID50 C A/Swine/Nebraska/97901-10/2008 (H3N2) 6-8 log EID50 D A/Swine/North Carolina/001169/2006 (H1N2) 6-8 log EID50 E
Whole virus sequencing for all viruses mentioned in table 7 were done at Newport Labs to confirm probe match with WT probe
The Provenza vaccine is a bivalent SIAV vaccine that already has been described in WO 2016/137929 A1.

Study Design—Experiment #1

[0489] A spike study was created where each of the above viruses was spiked into negative nasal swab media or negative oral fluid samples. A 1:10 dilution series for each spiked sample was created with in the appropriate sample. Exemplary, A is the undiluted (Provenza vaccine) sample, A1 is the 1:10 dilution, A2 is the 1:100 dilution and so forth. Each sample was extracted one time and tested by qPCR (quantitative PCR) in triplicate using the master mix (WT and Provenza probe) and cycling protocol as described above. The average Ct (cycle threshold) value of the 3 replicates was reported.

Study Design—Experiment #2

[0490] Samples from Experiment #1 were mixed and tested to assess cross reactivity and detection to mimic wild infection of influenza virus around the time of vaccination. Samples were tested by qPCR in triplicate and the average Cycle threshold (Ct) values were reported.

Study Design—Experiment #3

[0491] Experiment #3 was conducted to assess the potential use of an alternative Probe design called MLV probe 1 (atggaaaagtagatcttgattaattaagagg). A 1:10 dilution series (provenza 1 to provenza 5) was created using the Ingelvac Provenza vaccine. PCR was performed which compared results of the MLV1 and MLV2 probe designs. Samples were tested in duplicate and the average cycle threshold (Ct) was reported for comparison.

Experiment #1 Results—Nasal Swab Samples:

[0492]

TABLE-US-00009 TABLE 8 Provenza (MLV) WT MLV A Not detected 22.75 A1 Not detected 22.43 A2 Not detected 26.14 A3 Not detected 26.56 A4 Not detected 31.03

TABLE-US-00010 TABLE 9 H1N1 Ind 88 (WT) WT MLV B 30.56 Not detected B1 31.73 Not detected B2 35.65 Not detected B3 38.13 Not detected B4 41.02 Not detected

TABLE-US-00011 TABLE 10 H3N2 Tx 98 (WT) WT MLV C 23.01 Not detected C1 25.20 Not detected C2 29.08 Not detected C3 32.35 Not detected C4 35.34 Not detected

TABLE-US-00012 TABLE 11 H3N2 NE 08 (WT) WT MLV D 18.59 Not detected D1 23.31 Not detected D2 28.11 Not detected D3 32.10 Not detected D4 35.94 Not detected

TABLE-US-00013 TABLE 12 H1N2 NC 06 (WT) WT MLV E 20.51 Not detected E1 22.09 Not detected E2 29.58 Not detected E3 33.45 Not detected E4 35.92 Not detected

Experiment #1 Results—Oral Fluid Samples:

[0493]

TABLE-US-00014 TABLE 13 Provenza (MLV) WT MLV A Not detected 20.42 A1 Not detected 25.86 A2 Not detected 26.80 A3 Not detected 30.87 A4 Not detected 35.12

TABLE-US-00015 TABLE 14 H1N1 Ind 88 (WT) WT MLV B 23.68 Not detected B1 29.75 Not detected B2 32.61 Not detected B3 36.01 Not detected B4 39.68 Not detected

TABLE-US-00016 TABLE 15 H3N2 Tx 98 (WT) WT MLV C 17.90 Not detected C1 21.68 Not detected C2 25.87 Not detected C3 29.16 Not detected C4 33.24 Not detected

TABLE-US-00017 TABLE 16 H3N2 NE 08 (WT) WT MLV D 14.91 Not detected D1 20.45 Not detected D2 25.50 Not detected D3 29.24 Not detected D4 32.43 Not detected

TABLE-US-00018 TABLE 17 H1N2 NC 06 (WT) WT MLV E 16.10 Not detected E1 21.06 Not detected E2 28.32 Not detected E3 31.51 Not detected E4 35.17 Not detected
Experiment #2 Results—Provenza Strong to Weak Mixed with WT Virus Strong to Weak:

TABLE-US-00019 TABLE 18 Provenza (MLV) + H1N1 Ind 88 (WT) Nasal Swab Oral Fluid WT MLV WT MLV A + B 33.81 26.73 29.57 25.86 A1 + B1 38.64 30.44 34.76 31.98 A2 + B2 33.36 33.40 33.77 32.91 A3 + B3 40.43 36.92 Not detected 37.60 A4 + B4 41.66 38.23 Not detected 37.90

TABLE-US-00020 TABLE 19 Provenza (MLV) + H3N2 Tx 98 (WT) Nasal Swab Oral Fluid WT MLV WT MLV A + C 27.65 30.49 21.47 28.97 A1 + C1 29.33 34.70 26.89 35.49 A2 + C2 29.99 36.26 27.21 36.47 A3 + C3 34.47 39.89 32.18 40.32 A4 + C4 38.01 42.09 36.32 42.89

Experiment #3 Results—MLV Probe Comparison:

[0494]

TABLE-US-00021 TABLE 20 WT probe Provenza Probe Ct Ct Ct Ct Name MLV1 MLV2 Name MLV1 MLV2 WT Pos Ctrl 34.67 34.65 WT Pos Ctrl Neg Ctrl Neg Ctrl Provenza Provenza 21.88 21.48 undiluted undiluted provenza -1 provenza -1 25.75 24.84 provenza -2 provenza -2 29.95 28.74 provenza -3 provenza -3 32.82 31.9 provenza -4 provenza -4 37.99 33.93 provenza -5 provenza -5 40.79 37.75 WT Pos Ctrl 36.07 35.53 Pos Ctrl Neg Ctrl Neg Ctrl Provenza Provenza 20.1 21.84 undiluted undiluted provenza -1 provenza -1 26.08 25.58 provenza -2 provenza -2 29.82 28.79 provenza -3 provenza -3 32.8 32.45 provenza -4 provenza -4 34.2 35.89 provenza -5 provenza -5

Discussion and Conclusions

[0495] The results for experiment #1 show that when only Provenza (MLV) is present in a sample, it is the only virus detected with the MLV probe. Further, when a wild strain of influenza virus is the only virus present it is only detected with the WT probe. Thus, the probes are specific for detection of WT virus and MLV respectively.
Further, this experiment demonstrates that WT and MLV virus can be detected in different samples such as nasal swab samples and oral fluid samples, but could also be detected in other samples such as respiratory tissues, or environmental samples.
Furthermore, the virus can be detected in multiple dilutions of a sample.
Thus, Experiment #1 shows that the assay can detect the correct virus using the intended probe in different samples at various dilutions. There is no interference between the different probes.
The conclusion for Experiment #2 is that the assay can detect and differentiate influenza viruses (Ingelvac Provenza vaccine from wild type influenza A viruses) in different samples at various dilutions. There is no interference between the different probes.
The conclusion for experiment 3 is that an alternate probe design for the detection of the Ingelvac Provenza vaccine is possible. The results from table 20 show a slightly improved detection using MLV2. Neither probe design cross reacts with the WT probe to produce unwanted signal in that detection channel.

Experiment #4—Field Study Summary

[0496] Study design—Experiment #4
Field validation—Wean age vaccination
A farm was identified where wean age (3 weeks of age) piglets were vaccinated with Provenza per label upon arrival at a finishing unit. 5 animals per each of the 9 pens in barn 1 and barn 2 were nasal swabbed on the following days post vaccination: 0, 1, 2, 3, 4, 5, 6, 7, 8, 10, 12, 14, 17, and 21. Prior to the first collection, animals were ear tagged so the same animals could be sampled over the course of the study. Additionally, 1 cotton rope was hung per pen on the above collection days to collect pen level oral fluids. All samples were tested by 2 PCR tests: IAV-S screen PCR from Life Technologies (Matrix and Nucleoprotein targets) according to manufacturer instruction as well as Provenza™ PCR (NS1 target) as described above.
Using nasal swabs, PCR positives can be detected to 4 days post-vaccination (data not shown). Using oral fluids, positives can be detected to 10 days post-vaccination. The data suggests that both oral fluids and nasal swabs can be used for testing in the field to measure vaccination status of a herd in young piglets.

Field Validation—Processing Age Vaccination

[0497] A customer farm was identified where young piglets (3-8 days of age, average is 4) were vaccinated with Provenza™ per label. 5 animals per farrowing crate were nasal swabbed on the following days post vaccination: 0, 1, 2, 3, 4, 5, 6, 7, 8, 10, 12, 14, 17, and 21. Prior to the first collection, animals were ear tagged so the same animals could be sampled over the course of the study. Sow ID numbers were also recorded. All samples were tested by 2 PCR tests: IAV-S screen PCR from Life Technologies (Matrix and Nucleoprotein targets) according to manufacturer instruction as well as Provenza™ PCR (NS1 target) as described above.
Using nasal swabs, PCR positives can be detected to 14 days post-vaccination (data not shown). The data suggests that testing in the field to measure vaccination status of a herd in weaned animals works as well.

Experiment #5 Mobinostics Method

Materials and Methods

[0498] 1. Primers/Probes Sequences:

TABLE-US-00022 NSfor: (SEQ ID NO: 37) 5′ gataataggctctctttgtgtgc 3′ NSrev: (SEQ ID NO: 38) 5′Biotin-gagaaggtaatggtgaaatttctc 3′ CMOS Thiol Probes: 5′ ttttttttttttttttttttttttttttttttttttttttAGTAGAT CTTGATTAATTAAGAGGGAGCAATCG 3′ (SEQ ID NO: 39: AGTAGATCTGATTAATTAAGAGGGAGCAATCG)
Primers and probes were purchased from Metabion.

[0499] 2. Reagents, RT-PCR Cycles

All reagents (primers, probes, master mix) and cycling conditions are integrated into the Mobinostics card.
The two Provenza components were analyzed separately on RNA basis (H3N2 RNA component and H1N1 RNA component). First, the RNA copies in the RNA samples were determined by reference influenza virus RNAs based on NP RNA standard. A 1535nt long NP (Nucleoprotein) RNA standard was ordered from Eurofins. 1e08 NP RNA copy was prepared as a stock and aliquoted in the way that each aliquot was thawed one time. Serial dilutions (1e08-1e02 NP RNA copies) were prepared for the quantitative real time RT-PCR. The one-step real time RT-PCR was performed with NP primers and TaqMan NP probe using 4×TagMan Fast Virus 1-Step Master Mix. The RNA copies of reference influenza virus RNAs were calculated based on the NP standard curve.
Then, 20 RNA copies/μl, 200 RNA copies/μl, 1000 RNA copies/μl and 10000 RNA copies/μl were applied to the Mobinostics card and measured in 4-10 technical replicates on the Mobinostics device.
The CMOS Chip technology has been well described in the prior art. Exemplary, WO 2018/065104 A1, Roland Thewes (Enabling CMOS-based DNA array chips) and Frey et al 2005 (A Digital CMOS DNA Chip) describe the CMOS technology. In general, redox cycling techniques comprise chip technologies such as exemplary the CMOS Chip technology. In general, the electrochemical principle behind this is an enzyme-label-based, current-generation process, so that hybridization of complementary DNA strands translates into sensor currents at the sensor electrodes between 1 pA to 100 nA. Probe molecules are immobilized on the surface of a sensor element. The amplification product tagged by biotin label (by biotin labelled primers) is applied to the chip. After the hybridization and washing phases, Streptavidin-AP is applied to the chip. After incubation and washing steps, a chemical substrate (para-aminophenyl-phosphate) is applied to the chip. The enzyme label, available at the sites where hybridization occurred, cleaves the phosphate group and the electrochemically active para-aminophenol is generated. Simultaneously applying an oxidation and a reduction potential to the sensor electrodes, para-aminophenol is oxidized to quinoneimine at the one electrode, and quinoneimine is reduced to para-aminophenol at the other one.

TABLE-US-00023 TABLE 21 Mobinostics results of the H1N1 and H3N2 components: Sample: Mean MLV-NS Standard deviation Negative control −0.08 0.08 H1N1 MLV 20 RNA copies/μl 0.17 0.15 H1N1 MLV 200 RNA copies/μl 0.73 0.05 H1N1 MLV 1000 RNA copies/μl 0.78 0.04 H1N1 MLV 10000 RNA copies/μl 0.84 0.02 H3N2 MLV 20 RNA copies/μl −0.09 0.06 H3N2 MLV 200 RNA copies/μl 0.13 0.33 H3N2 MLV 1000 RNA copies/μl 0.52 0.09 H3N2 MLV 10000 RNA copies/μl 0.79 0.01
The results as shown in Table 21 show that also DNA Chip technology can be used for detecting RNA/DNA components of Provenza.