Nonviral minicircle vector carrying SOX gene and construction method therefor
11045498 · 2021-06-29
Assignee
Inventors
Cpc classification
A61K35/00
HUMAN NECESSITIES
A61K48/0066
HUMAN NECESSITIES
Y02A50/30
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
A61K35/28
HUMAN NECESSITIES
International classification
A61K35/28
HUMAN NECESSITIES
A61K48/00
HUMAN NECESSITIES
Abstract
The present invention relates to a non-viral minicircle vector expressing a SOX gene, a stem cell into which the vector is introduced, a pharmaceutical composition for preventing or treating a cartilage disease, including the stem cell, and a method for constructing the vector. The transformation of mesenchymal stem cells with MC/SOX-Trio or MC/SOX-Duo, which is a non-viral minicircle vector according to the present invention, can completely exclude the necessity of expensive growth factors that have been indispensably used in inducing the differentiation of mesenchymal stem cells into chondrocytes. Accordingly, the mesenchymal stem cells transformed therewith, when implanted in vivo, can differentiate into chondrocytes by themselves, and thus have an advantage capable of simplifying the existing complicated steps of culturing cells to induce differentiation and then transplanting the cells. Further, unlike existing vector systems in which antibiotic-resistant genes and other bacteria-derived exogenous genes are simultaneously transferred to cells even after transformation, the vector of the present invention minimizes transfer of unnecessary genes into target cells by allowing two or three SOX genes necessary only for differentiation into chondrocytes to be regulated under one promoter, and thus can be utilized as a non-viral vector system in the most advantageous form for use in clinical application of stem cell-gene therapeutic agents.
Claims
1. A non-viral minicircle vector comprising: (a) a promoter; (b) a gene encoding SRY (sex determining region Y)-box 6 (SOX6), and a gene encoding SRY-box 9 (SOX9); and (c) a gene expression cassette consisting of a terminator, wherein the non-viral minicircle vector does not comprise (d) a bacterial backbone; wherein the vector sequentially comprises the gene encoding SOX9 and the gene encoding SOX6; and wherein the vector consists of a base sequence of SEQ ID NO: 1 or SEQ ID NO: 2.
2. The non-viral minicircle vector of claim 1, wherein the vector consists of a base sequence of SEQ ID NO: 1.
3. The non-viral minicircle vector of claim 1, wherein the vector consists of a base sequence of SEQ ID NO: 2.
4. The non-viral minicircle vector of claim 1, wherein the promoter is a cytomegalovirus (CMV).
5. The non-viral minicircle vector of claim 1, wherein the terminator comprises an SV40 polyadenylation sequence.
6. The non-viral minicircle vector of claim 1, wherein the vector is a double-stranded DNA in a circular supercoiled form.
7. A stem cell into which the non-viral minicircle vector of claim 1 is introduced.
8. The stem cell of claim 7, wherein the stem cell is an adult stem cell.
9. A pharmaceutical composition for preventing or treating a cartilage disease, comprising the stem cell of claim 7 as an active ingredient.
10. The pharmaceutical composition of claim 9, wherein the cartilage disease is degenerative arthritis, rheumatic arthritis, ankylosing spondylitis, posttraumatic arthritis, osteochondritis dissencans, or osteomalacia.
11. The pharmaceutical composition of claim 9, wherein the composition promotes the differentiation of stem cells into chondrocytes.
12. A method for constructing a non-viral minicircle vector to which a SOX gene is transferred, the method including the following steps: (a) sequentially transferring and connecting (sex determining region Y)-box 9 (SOX9) and SRY-box 6 (SOX6) genes to a parental plasmid to form a constructed parental plasmid; (b) introducing the constructed parental plasmid into E. coli; and (c) obtaining a non-viral minicircle vector for expressing a SOX gene from which a bacterial backbone vector is removed by treating a culture solution of E. coli into which the parental plasmid is introduced with arabinose, wherein the non-viral minicircle vector consists of a base sequence of SEQ ID NO: 1 or SEQ ID NO: 2.
13. The method of claim 12, wherein the E. coli in step (b) simultaneously expresses a ΦC31 integrase and an I-SceI endonuclease.
14. The method of claim 12, wherein the non-viral minicircle vector consists of a base sequence of SEQ ID NO:1.
15. The method of claim 12, wherein the non-viral minicircle vector consists of a base sequence of SEQ ID NO: 2.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
DETAILED DESCRIPTION
(10) The present invention relates to a non-viral minicircle vector to which a SOX gene is transferred, a stem cell into which the vector is introduced, a pharmaceutical composition for preventing or treating a cartilage disease, including the stem cell, and a method for constructing the vector.
(11) Hereinafter, the present invention will be described in more detail.
(12) The present invention provides a non-viral minicircle vector including:
(13) (a) a promoter;
(14) (b) a gene encoding two or more proteins selected from the group consisting of SRY (sex determining region Y)-box 5 (SOX5), SRY-box 6 (SOX6), and SRY-box 9 (SOX9); and
(15) (c) a gene expression cassette consisting of a terminator,
(16) in which the non-viral minicircle vector does not include (d) a bacterial backbone.
(17) In order to solve all the problems of the biological stability such as immunogenicity possessed by a viral vector system conventionally used in the gene therapy method and the transfer efficiency possessed by a non-viral vector system in the present invention, a highly safe vector system capable of efficiently delivering a therapeutic gene to a target cell and expressing the gene sustainably for a long period of time was developed.
(18) Specifically, the vector system of the present invention includes a promoter, a gene encoding a SOX protein, and a gene expression cassette consisting only of a minimum essential component such as a transcription terminator, and does not include a bacterial backbone including a selectable marker gene such as an origin of replication and an antibiotic resistance gene used in an existing vector system.
(19) Since an origin of replication may usually cause an unnecessary immune response in the human body as a sequence derived from bacteria and a selectable marker gene such as an antibiotic resistance gene may be delivered even to bacteria present in the body, there is a problem in that the administration of a therapeutic antibiotic of the same group due to other diseases may cause unnecessary antibiotic resistance. Thus, the present invention does not include an origin of replication and a selectable marker gene, thereby eliminating the problems of unnecessary immune response and antibiotic resistance. In addition, the immune response can be reduced by removing unmethylated CpG motifs derived from prokaryotic cells. Furthermore, accordingly, the vector of the present invention has a smaller physical size than the existing vector, and thus may be easily constructed, increase the delivery efficiency, and improve the biological stability.
(20) Thus, in the Examples of the present invention, it was confirmed that polycistronic and bicistronic vectors in which the expression of three or two SOX genes are regulated to be simultaneously expressed under one promoter were constructed by using the vector system, and the chondrogenic differentiation induction efficiency was enhanced by introducing the vectors into stem cells.
(21) In an Example of the present invention, two 2A (E2A and T2A) systems are introduced into a parental plasmid vector such that three SOX genes (SOX9, SOX5, and SOX6) or two SOX genes (SOX9 and SOX6) can be simultaneously expressed to sequentially connect the genes in descending order of size, thereby constructing a pMC/SOX-trio vector to which SOX9, SOX5, and SOX6 genes are transferred and a pMC/SOX-duo vector to which SOX9 and SOX6 genes are transferred (see Example 1).
(22) In another Example of the present invention, it was confirmed through electrophoresis that each SOX gene was transferred well in the pMC/SOX-trio and pMC/SOX-duo vectors, and it was confirmed through electrophoresis that the vectors were introduced into E. coli and cultured and the culture solution was treated with 0.5% arabinose to construct a minicircle DNA from which a bacterial backbone vector is removed, that is, MC/SOX-trio and MC/SOX-duo vectors (see Example 2).
(23) In still another Example of the present invention, in order to verify the chondrogenic differentiation efficiency by the minicircle DNA constructed in the above Example, adipose stem cells were transformed by introducing the DNA into adipose stem cells and cultured for 3 weeks, and then based on the form of a chondrogenic pellet, the expression levels of mRNAs of SOX9, Type II collagen (COLII), and Aggrecan in the pellet, and a chondrogenic pellet tissue analysis by Safranin-O staining, it was confirmed that the chodrogenic differentiation could be promoted with high efficiency only by transformation caused by a minicircle DNA to which the SOX gene was transferred without a separate growth factor treatment (see Example 3).
(24) Accordingly, each of the non-viral MC/SOX-trio vector and the MC/SOX-duo vector of the present invention promotes the chondrogenic differentiation with high efficiency, and thus can be usefully used in the clinical setting of a stem cell-gene therapeutic agent for treating a cartilage disease.
(25) In the present invention, the non-viral MC/SOX-trio vector is characterized by consisting of a base sequence of SEQ ID NO: 1 and the MC/SOX-duo vector is characterized by consisting of a base sequence of SEQ ID NO: 2.
(26) The vector of the present invention is characterized by being a double-stranded DNA in a circular supercoiled form.
(27) A promoter used in the vector of the present invention may use a promoter used in the art without particular limitation, includes an inducible or constitutive promoter, and preferably, may use a cytomegalovirus (CMV) promoter.
(28) A terminator used in the vector of the present invention may use a terminator used in the art without particular limitation, but preferably, may be a terminator including an SV40 polyadenylation sequence.
(29) The vector of the present invention may additionally include a promoter, a gene (SOX5, SOX6, or SOX9) encoding a SOX protein as a therapeutic gene, and a site specific recombinant region outside a gene expression cassette consisting of a terminator, and the site specific recombination region refers to a region where a recombination may occur between two specific base sequences on a DNA, and a gene cloning method using the site specific recombinant region is useful as a gene manipulation method capable of replacing an existing method using a restriction enzyme and a ligase. Preferably, the site specific recombinant region in the present invention is an att attachment sequence derived from E. coli or bacteriophage lambda, a substrate sequence of attB or attP, or a hybrid sequence of attR or attL, and more preferably, may be attR.
(30) As another aspect of the present invention, the present invention provides a stem cell into which the non-viral minicircle vector is introduced.
(31) The term “stem cell” used in the present invention is an undifferentiated cell that has differentiation ability, but is not differentiated yet, and is characterized by having a function as a pluripotent cell that can be converted into any organ from primitive stage cells, and preferably, includes a germline stem cell, an embryonic stem cell, an induced pluripotent stem cell, and a multipotent adult stem cell isolated from a bone marrow and the like of an adult body, and the like.
(32) In the present invention, the stem cell includes all the multipotent stem cells derived from an adult tissue such as an embryo or fetus, cord blood or an adult organ or bone marrow of a mammal, the skin or blood, includes a stem cell having a character similar to that of an embryonic stem cell, and more preferably, may be an adult stem cell including a mesenchymal stem cell, a hematopoietic stem cell, a neural stem cell, an adipose stem cell, and the like.
(33) As still another aspect of the present invention, the present invention provides a pharmaceutical composition for preventing or treating a cartilage disease, including a stem cell into which the non-viral minicircle vector is introduced as an active ingredient.
(34) The term “prevention” used in the present invention means all actions that suppress a cartilage disease or delay the onset of the cartilage disease by administering the pharmaceutical composition according to the present invention.
(35) The term “treatment” used in the present invention means all actions that ameliorate or beneficially change symptoms caused by a cartilage disease by administering the pharmaceutical composition according to the present invention.
(36) The term “cartilage disease” used in the present invention means a disease caused by dysfunction or damage of the cartilage, and the cartilage disease in the present invention includes a disease that can be alleviated or treated through chondrogenic differentiation of a transformed stem cell into which the non-viral minicircle vector according to the present invention is introduced, and more specifically, may be degenerative arthritis, rheumatic arthritis, ankylosing spondylitis, posttraumatic arthritis, osteochondritis dissencans, or osteomalacia, but is not limited thereto.
(37) In the present invention, a vector expressing a SOX gene may be introduced into cells or tissues by a plurality of publicly known methods, for example, transient transfection, micro-injection, transduction, electroporation, DEAE dextran-mediated transfection, monovalent cationic liposome fusion, multivalent cationic liposome fusion, protoplast fusion, lipofectamine, naked DNA delivery, and the like, but the method is not limited thereto.
(38) The stem cells according to the present invention are administered in a manner of direct implantation or migration to a desired tissue site, and thus can provide a therapeutic effect in such a manner to reconstitute or regenerate a functionally deficient site.
(39) The pharmaceutical composition according to the present invention includes a non-viral minicircle vector to which a SOX gene is transferred as an active ingredient, and may include a pharmaceutically acceptable carrier. The pharmaceutically acceptable carrier is typically used in formulation, and includes saline, sterile water, Ringer's solution, buffered saline, cyclodextrin, a dextrose solution, a maltodextrin solution, glycerol, ethanol, liposome, and the like, but is not limited thereto, and may further include other typical additives such as an antioxidant and a buffer, if necessary. Further, the composition may be formulated into an injectable formulation, such as an aqueous solution, a suspension, and an emulsion, a pill, a capsule, a granule, or a tablet by additionally adding a diluent, a dispersant, a surfactant, a binder, a lubricant, and the like. With regard to suitable pharmaceutically acceptable carriers and formulations, the composition may be preferably formulated according to each ingredient by using the method disclosed in Remington's literature. The pharmaceutical composition of the present invention is not particularly limited to the dosage form, but may be formulated into an injectable agent, an inhalant, an external preparation for skin, an oral ingestible agent, or the like.
(40) The pharmaceutical composition of the present invention may be orally administered or may be parenterally administered (for example, applied intravenously, subcutaneously, and through the skin, the nasal cavity, or the respiratory tract) according to the target method, and the administration dose may vary depending on the patient's condition and body weight, severity of disease, drug form, and administration route and period, but may be appropriately selected by the person skilled in the art.
(41) The composition of the present invention is administered in a pharmaceutically effective amount. In the present invention, “the pharmaceutically effective amount” means an amount sufficient to treat a disease at a reasonable benefit/risk ratio applicable to medical treatment, and the level of the effective dosage can be determined according to the type and severity of disease of a patient, the activity of the drug, the sensitivity to drugs, the administration time, the administration route and release rate, the treatment duration, elements including drugs that are simultaneously used with the composition of the present invention, or other elements well-known in the medical field. The composition according to the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, may be administered sequentially or simultaneously with therapeutic agents in the related art, and may be administered in a single dose or multiple doses. It is important to administer the composition in a minimum amount that can obtain the maximum effect without any side effects, in consideration of all the aforementioned elements, and this amount can be easily determined by the person skilled in the art.
(42) Specifically, the effective amount of the composition according to the present invention may vary depending on the patient's age, sex, and body weight, and generally, 0.001 to 150 mg of the composition and preferably, 0.01 to 100 mg of the composition, per 1 kg of the body weight, may be administered daily or every other day or may be administered once to three times a day. However, since the effective amount may be increased or decreased depending on the administration route, the severity of obesity, the sex, the body weight, the age, and the like, the administration dose does not limit the scope of the present invention by any method.
(43) As yet another aspect of the present invention, the present invention provides a method for constructing a non-viral minicircle vector to which a SOX gene is transferred, the method including the following steps:
(44) (a) constructing a parental plasmid to which SOX genes are transferred by sequentially transferring and connecting three or two SOX genes to a parental plasmid;
(45) (b) introducing the constructed parental plasmid into E. coli; and
(46) (c) obtaining a minicircle vector for expressing a SOX gene from which a bacterial backbone vector is removed by treating a culture solution of E. coli into which the parental plasmid is introduced with arabinose.
(47) The three or two SOX genes in step (a) are SOX9, SOX5, and SOX6; and SOX9 and SOX6; respectively, and the genes may be sequentially transferred to a parental plasmid by using two 2A systems (E2A and T2A).
(48) The E. coli in step (b) includes an E. coli simultaneously expressing a ΦC31 integrase and an I-SceI endonuclease, and preferably, may be E. coli ZYCY10P3S2T.
(49) Hereinafter, preferred Examples for helping the understanding of the present invention will be suggested. However, the following Examples are provided only to more easily understand the present invention, and the contents of the present invention are not limited by the following Examples.
EXAMPLES
Example 1. Construction of Non-Viral Minicircle Vector Expressing Polycistronic and Bicistronic SOX Genes
(50) 1-1. Preparation of Parental Plasmid and DNA for Transformation
(51) In order to construct a non-viral minicircle vector of the present invention, pMC.CMV-MCS-EF1-RFP(MN512A-1), which is a vector for constructing a minicircle (MC), was purchased from SBI, Inc., and was used as a basic backbone. The vector for constructing a minicircle is homologously recombined into two vectors of an MC site including only an exogenous gene to be expressed by arabinose induction and a bacterial backbone including antibiotic-resistant genes and a bacterial origin when proliferated in bacteria in which a ΦC31 integrase and an I-SceI endonuclease are simultaneously expressed, as illustrated in the drawing of
(52) In the SOX gene for this purpose, an MGC clone supplied by Invitrogen Corp., was purchased and used as a template for DNA PCR, and primers for PCR reactions of the respective genes are shown in the following Table 1. The genes secured after the PCR reaction were connected to the pGEM-T-Easy vector to confirm whether the gene sequence was abnormal or not through the full gene sequencing, and only the SOX gene exactly matching the gene sequence was used for cloning.
(53) TABLE-US-00001 TABLE 1 SEQ ID Name Sequence (5′ to 3′) NO: SOX9-E2A- TCTAGAGCCACCATGAATCTCCTGGACCCCTTCA 3 XbaI_F SOX9-E2A- GAATTCAGGACCGGGGTTATTACTTTCAACATCGCCAGCGAGTTTCAACAAAGCGTA 4 EcoRI_R GTTAGTACATTGACCCGACCCGTTTGAATGCATAGGTCGAGTGAGCTGTGT SOX5-T2A- GAATTCATGTCTTCCAAGCGACCAG 5 EcoRI_F SOX5-T2A- ATTTAAATAGGGCCGGGATTCTCCTCCACGTCACCGCATGTTAGAAGACTTCCTCTG 6 SwaI_R CCCTCGTTGGCTTGTCCTGCAATA SOX6-SwaI_F ATTTAAATGTCTTCCAAGCAAGCCA 7 SOX6-SalI_R GTCGACTCAGTTGGCACTGACAGC 8 SOX9-T2A- GAATTCAGGGCCGGGATTCTCCTCCACGTCACCGCATGTTAGAAGACTTCCTCTGCC 9 EcoRI_R CTCAGGTCGAGTGAGCTGTGTGTA SOX6-EcoRI_F GAATTCATGTCTTCCAAGCAAGCCA 10
(54) 1-2. Construction of Non-Viral Minicircle Vector Expressing Polycistronic and Bicistronic SOX Genes
(55) In order to construct polycistronic and bicistronic pMC vectors simultaneously expressing SOX genes, two 2A (E2A and T2A) systems were introduced such that the SOX genes could be simultaneously expressed under a single promoter (CMV) by using single restriction enzyme sites for gene cloning in a parental plasmid (pMC). The E2A and T2A sequences used in the present invention are denoted as SEQ ID NO: 11 and SEQ ID NO: 12.
(56) More specifically, as illustrated in
Example 2. Construction of Minicircle Vector (DNA)
(57) 2-1. Confirmation of Transfer of SOX Gene in Constructed SOX-Trio and SOX-Duo Vectors (pMC)
(58) Before a minicircle vector was constructed from a parental plasmid, it was initially attempted to confirm whether SOX5, 6, or 9 genes were transferred well to the pMC/SOX-trio and pMC/SOX-duo vectors constructed by the method in Example 1. For this purpose, the vectors were treated with each restriction enzyme used during the gene cloning and allowed to react, and then electrophoresis was performed.
(59) As a result, as illustrated in
(60) 2-2. Construction of Minicircle Vector According to Introduction of pMC/SOX-Trio and pMC/SOX-Duo Vectors into E. coli
(61) Based on the result of Example 2-1, pMC/SOX-trio and pMC/SOX-duo vectors to which SOX5, 6, and 9 genes were normally transferred were introduced into E. coli ZYCY10P3S2T and cultured, and then a mixture for inducing a minicircle was prepared by treating the culture medium with 0.5% arabinose. Thereafter, the vectors were additionally cultured, a DNA was extracted from the vectors, and electrophoresis was performed in order to confirm whether the minicircle DNA was properly produced.
(62) As a result, as illustrated in
Example 3. Verification of Chondrogenic Differentiation Efficiency by Constructed Minicircle DNA
(63) 3-1. Confirmation of Gene Expression in Adipose Stem Cells Transformed with Minicircle DNA
(64) Before verifying the chondrogenic differentiation efficiency of mesenchymal stem cells transformed with the minicircle DNA constructed according to the method in Example 2, first, it was attempted to confirm the expression levels of the SOX genes in the mesenchymal stem cells. For this purpose, the expression levels of the SOX6 and SOX9 genes transferred to the SOX-duo minicircle DNA were measured through RTPCR by transforming the SOX-duo minicircle DNA into adipose stem cells and extracting the RNA from the adipose stem cells.
(65) As a result, as illustrated in
(66) 3-2. Confirmation of Chondrogenic Differentiation Efficiency of Adipose Stem Cells Transformed with Minicircle DNA
(67) Base on the result in Example 3-1, a chondrogenic pellet differentiation inducing culture was performed for 3 weeks by using adipose stem cells transformed with the SOX-trio and SOX-duo minicircle DNAs, and then a morphological analysis of the chondrogenic pellets was performed. In this case, TGF-β and BMP7, which are growth factors during the culture, were not added to a negative control, 10 ng/ml of TGF-β and 100 ng/ml of BMP7 were added to a chondrogenic differentiation induction culture solution in a positive control, and cells were cultured for 3 weeks by replacing the culture solution with fresh culture solution every 2 or 3 days. Further, the adipose stem cells used in the negative control and the positive control were transformed with MC/RFP DNA, and growth factors TGF-β and BMP7 were not added during the chondrogenic differentiation induction of cells transformed with MC/SOX-trio and MC/SOX-duo.
(68) As a result of observing the morphology of the chondrogenic pellet after a total of three weeks of the chondrogenic differentiation induction culture, as illustrated in
(69) Next, after RNA was extracted from the chondrogenic differentiation induction pellet and cDNA was synthesized by using the same, the expression levels of mRNAs of SOX9, Type II collagen (COLII), and aggrecan were measured through real-time PCR. As a result, as illustrated in
(70) Furthermore, after a frozen tissue section was prepared by the chondrogenic differentiation induction pellet of each group, a histological analysis was performed through Safranin-O staining. As a result, as illustrated in
(71) The above-described description of the present invention is provided for illustrative purposes, and the person skilled in the art to which the present invention pertains will understand that the present invention can be easily modified into other specific forms without changing the technical spirit or essential features of the present invention. Therefore, it should be understood that the above-described Examples are only exemplary in all aspects and are not restrictive.