METHOD OF DIFFERENTIATION OF HUMAN INDUCED PLURIPOTENT STEM CELL TO DERMAL PAPILLA PRECURSOR CELL AND USE THEREOF

20210171906 · 2021-06-10

Assignee

Inventors

Cpc classification

International classification

Abstract

Provided is a medium composition for differentiation of a human induced pluripotent stem cell to a dermal papilla precursor cell, a differentiation method, and a use for inducing hair follicle neogenesis using the differentiated dermal papilla precursor cell. Further provided is a method for differentiating a human induced pluripotent stem cell into a dermal papilla precursor cell having hair follicle forming ability and a composition of a dermal papilla precursor cell specific differentiation medium for the above differentiation, and have effectively induced hair follicle neogenesis consisting only of human cells without conventional mouse-human hybrid hair follicles by using the human induced dermal papilla precursor cell and a human induced epidermal precursor cell obtained through the differentiation method. Human hair follicle tissue produced is expected to be useful as a therapeutic method for patients suffering from hair loss by overcoming the limitations of hair loss treatments.

Claims

1. A medium composition for differentiation of dermal papilla precursor cells from human pluripotent stem cells, the medium composition comprising, in Dulbecco's Modified Eagle's Medium/Nutrient Mixture F-12 (DMEM/F12) Glutamax medium, fibroblast growth factor-2 (FGF2), a glycogen synthase kinase-3 (GSK-3) inhibitor, and bone morphogenetic protein 4 (BMP4).

2. The medium composition of claim 1, wherein the glycogen synthase kinase-3 (GSK-3) inhibitor comprises one or more selected from the group consisting of 6-bromoindirubin-3′-oxime (BIO), CHIR-99021, and SB-216763.

3. The medium composition of claim 1, wherein the FGF2 is included at a concentration of 5 ng/ml to 30 ng/ml, the GSK-3 inhibitor is included at a concentration of 0.1 μM to 10 μM, and the BMP4 is included at a concentration of 0.5 ng/ml to 5 ng/ml.

4. The medium composition of claim 2, wherein the BIO is included at a concentration of 0.5 μM to 5 μM, and the CHI R 99021 is included at a concentration of 0.1 μM to 10 μM.

5. The medium composition of claim 1, wherein the human pluripotent stem cells are human embryonic stem cells or human induced pluripotent stem cells.

6. The medium composition of claim 1, wherein human neonatal fetal tissue is not incorporated into the medium composition for differentiation.

7. A method of differentiating dermal papilla precursor cells from human pluripotent stem cells, the method comprising the following processes: (a) culturing embryonic bodies of human pluripotent stem cells in a neural crest stem cell induction medium to differentiate into neural crest stem cells; and (b) culturing the differentiated neural crest stem cells in the medium composition for differentiation of claim 1 to differentiate into dermal papilla precursor cells.

8. The method of claim 7, further comprising the following process: (c) aging the differentiated dermal papilla precursor cells to obtain spherical dermal papilla precursor cells.

9. The method of claim 7, wherein the neural crest stem cell induction medium is DMEM/F12 Glutamax medium containing fibroblast growth factor-2 (FGF2), fibronectin, insulin, N.sub.2 supplement, and transferrin.

10. The method of claim 8, wherein process (c) is performed by culturing the differentiated dermal papilla precursor cells in DMEM/F12 Glutamax medium supplemented with FGF2 alone.

11. The method of claim 7, wherein process (a) is performed for 5 days to 9 days, and process (b) is performed for 11 days to 17 days.

12. The method of claim 7, wherein the method of differentiating dermal papilla precursor cells from human pluripotent stem cells is performed for 26 days to 50 days.

13. Human dermal papilla precursor cells differentiated from human pluripotent stem cells by using the differentiation method of claim 7, wherein the human dermal papilla precursor cells have hair follicle-forming ability.

14. The dermal papilla precursor cells of claim 13, wherein the dermal papilla precursor cells exhibit one or more characteristics selected from the group consisting of the following (a), (b), and (c): (a) positive immunological characteristics for alkaline phosphatase (ALP), α-smooth muscle actin (αSMA), versican (VCAN), and nestin; (b) structural properties of dermal papilla cells that spontaneously form spheres; and (c) genetic characteristics expressing one or more dermal papilla signature genes selected from the group consisting of ALX Homeobox 3 (ALX3), SRY-Box 2 (SOX2), Hes Related Family BHLH Transcription Factor With YRPW Motif 1 (HEY1), Bone Morphogenetic Protein 4 (BMP4), Lymphoid Enhancer Binding Factor 1 (LEF1), WNT inhibitory factor 1 (WIF1), and Versican (VCAN).

15. The dermal papilla precursor cells of claim 13, wherein the dermal papilla precursor cells are CD133(−).

16. Subcultured human dermal papilla precursor cells differentiated from human pluripotent stem cells using the differentiation method of claim 7 and having hair follicle-forming ability.

17. A composition for inducing human hair follicle neogenesis, the composition comprising, as active ingredients, epithelial stem cells differentiated from human pluripotent stem cells and the human dermal papilla precursor cells differentiated from human pluripotent stem cells of claim 13 and having hair follicle-forming ability.

18. The composition of claim 17, wherein the dermal papilla precursor cells are differentiated from the human pluripotent stem cells for 30 days to 50 days.

19. The composition of claim 17, wherein the epithelial stem cells are differentiated from the human pluripotent stem cells for 15 days to 21 days.

20. A method of inducing human hair follicle neogenesis by delivering, to an individual, epithelial stem cells differentiated from human pluripotent stem cells and the human dermal papilla precursor cells differentiated from human pluripotent stem cells of claim 13 and having hair follicle-forming ability.

21. A method of producing human hair follicles by co-culturing the human dermal papilla precursor cells differentiated from human pluripotent stem cells of claim 13 and having hair follicle-forming ability and epithelial stem cells differentiated from human pluripotent stem cells.

22. A use of a composition for human hair follicle neogenesis, the composition comprising epithelial stem cells differentiated from human pluripotent stem cells and the human dermal papilla precursor cells differentiated from human pluripotent stem cells of claim 13 and having hair follicle forming ability.

23. A cell therapeutic agent for treating hair loss, the cell therapeutic agent comprising, as active ingredients, epithelial stem cells differentiated from human pluripotent stem cells and the human dermal papilla precursor cells of claim 13.

24. A method of treating hair loss, the method comprising administering, to an individual in need thereof, a cell therapeutic agent comprising, as active ingredients, epithelial stem cells differentiated from human pluripotent stem cells and the human dermal papilla precursor cells differentiated from human pluripotent stem cells of claim 13 and having hair follicle-forming ability.

25. (canceled)

26. The method of claim 8, wherein process (c) is performed for 7 days to 13 days.

Description

BRIEF DESCRIPTION OF DRAWINGS

[0047] FIG. 1 illustrates the results of performing immunostaining to observe the expression of SDC1 and CD133 in hair placode, hair germ, and hair peg stage in the human fetal scalp.

[0048] FIGS. 2A to 2F illustrate the results of confirming the differentiation process and properties of dermal papilla precursor cells, wherein FIG. 2A depicts a process of differentiating dermal papilla precursor cells from human dedifferentiated pluripotent stem cells over time; FIG. 2B illustrates the results of observing the morphology of neural crest stem cells (hi-NCSCs) differentiated for 7 days, and the results showing the expression of the HNK1 and p75NTR proteins; FIG. 2C illustrates the results of observing the morphology of differentiated dermal papilla precursor cells (hi-DPPCs) and showing alkaline phosphatase (ALP) activity; FIG. 2D illustrates flow cytometry results showing the possibility of differentiating into SDC1+CD133 cells according to various factor combinations; FIG. 2E illustrates the results of performing flow cytometry on SDC1+CD133 cells after treatment with CHIR-99021 as a BIO substitute; and FIG. 2F illustrates the results showing the possibilities of various kinds of human pluripotent stem cells to differentiate into SDC1+CD133 DPPCs.

[0049] FIGS. 3A to 3C illustrate the results showing the expression patterns of various genes in a process of differentiation of dermal papilla precursor cells from human induced pluripotent stem cells, wherein FIG. 3A illustrates flow cytometry results showing changes in expression of SDC1 and CD133 in cells (iPSC, NCSC, DPPC D25, DPPC D40, and DPPC P5) of each differentiation stage during a differentiation process; FIG. 3B illustrates the results showing changes in gene expression according to stage in the cells of each differentiation stage; and FIG. 3C illustrates the results of comparing the expression levels of ALX3, CTNNB1, SOX2, LEF1, and VCAN, which are genes expressed in dermal papilla after isolating CD133+ and CD133− from dermal papilla precursor cells on day 25 of differentiation.

[0050] FIG. 4A to 4C illustrate the results of comparing the properties of human dermal papilla precursor cells (hi-DPPC) according to the present invention with those of human dermal papilla cells (hDPCs), wherein FIG. 4A illustrates the results of confirming ALP activity for the two types of cells and the expression of the αSMA, VCAN, and nestin genes through immunocytochemistry staining; FIG. 4B illustrates the results showing spontaneous sphere-forming ability; and FIG. 4C illustrates the results of comparing the expression levels of dermal papilla signature genes through transcript analysis by quantitative RT-PCR.

[0051] FIGS. 5A and 5B illustrate the results of performing patch assay using dermal papilla precursor cell spheres (hi-DPPC 3D) or dermal papilla cell spheres (hDPC 3D) in order to determine the hair follicle-forming ability of dermal papilla precursor cells according to the present invention, wherein FIG. 5A illustrates the results showing that, as a result of subcutaneous transplantation of the two types of cells along with C57BL/6 mouse-derived epidermal cells, hybrid hair follicle neogenesis was induced; and FIG. 5B illustrates the results of confirming the contribution of dermal papilla precursor cells to hair follicle neogenesis by labeling the dermal papilla precursor cells with a cell tracer (CM-DiI).

[0052] FIGS. 6A to 6D illustrates the results of confirming the gene expression profile of dermal papilla precursor cells, wherein FIGS. 6A and 6B illustrate a heatmap (FIG. 6A) and clustering results using distance matrix, obtained through RNA sequencing of neural crest stem cells (hi-NCSCs) derived from human induced pluripotent stem cells, human dermal papilla cell spheres (cDPC 3D), human dermal papilla cells (cDPC 2D), and dermal papilla precursor cell spheres (hi-DPPC 3D); FIG. 6C illustrates the results of analyzing the RNA sequencing results by a dimension reduction approach; and FIG. 6D illustrates the results of comparing the expression levels of dermal papilla signature genes and stem cell marker genes.

[0053] FIGS. 7A and 7B illustrate the results of analyzing in-vitro hair follicle neogenesis according to co-culture of human dermal papilla precursor cells and human epithelial stem cells, wherein FIG. 7A illustrates microscopic observation results showing changes in the morphology of the two types of cells due to co-culture, and FIG. 7B illustrates immunofluorescence staining results showing whether dermal marker proteins (SDC1, LEF1, SOX2, Nestin, VCAN, and WIF1) and epidermal marker proteins (CD133, BMP4, K15, K14, and WIF1) were expressed in in-vitro formed hair follicles and human fetal scalp.

[0054] FIGS. 8A to 8C illustrate chamber assay results showing hair follicle neogenesis according to the transplantation of dermal papilla precursor cells differentiated from human induced pluripotent stem cells (hi-DPPC) and epithelial stem cells (hi-EpSC) in the body of mice, FIG. 8A illustrates microscope images showing the structures of multiple root sheath and dermal papilla as a result of H&E staining of formed hair follicle tissue; FIG. 8B illustrates immunofluorescence staining results of human COX4 (hCOX4) and human mitochondria in formed hair follicles and hair follicles of fetal scalp; and FIG. 8C illustrates the results of performing immunofluorescence staining on K14, K15, K17, and K75 in formed hair follicles.

MODE OF INVENTION

[0055] The present invention relates to a medium composition for differentiation of dermal papilla precursor cells from human pluripotent stem cells, a differentiation method, and a use of dermal papilla precursor cells differentiated using the method for inducing hair follicle neogenesis.

[0056] Therefore, the present invention provides a medium composition for differentiation of dermal papilla precursor cells from human pluripotent stem cells, including Dulbecco's Modified Eagle's Medium/Nutrient Mixture F-12 (DMEM/F12) Glutamax containing fibroblast growth factor-2 (FGF2), a glycogen synthase kinase-3 (GSK-3) inhibitor, and bone morphogenetic protein 4 (BMP4).

[0057] In the medium composition, the glycogen synthase kinase-3 (GSK-3) inhibitor may be one or more selected from the group consisting of 6-bromoindirubin-3′-oxime (BIO), CHIR-99021, and SB-216763, but the present invention is not limited thereto, and any glycogen synthase kinase-3 inhibitor known in the art may be used without limitation.

[0058] In medium composition, preferably, the FGF2 may be included at a concentration of 5 ng/ml to 30 ng/ml, the GSK-3 inhibitor may be included at a concentration of 0.1 μM to 10 μM, and the BMP4 may be included at a concentration of 0.5 ng/ml to 5 ng/ml. The differentiation of dermal papilla precursor cells from human pluripotent stem cells may be most effective within the above-described concentration ranges.

[0059] In the medium composition, preferably, the BIO may be included at a concentration of 0.5 μM to 5 μM, and the CHIR 99021 may be included at a concentration of 0.1 μM to 10 μM. The differentiation of dermal papilla precursor cells from human pluripotent stem cells may be most effective within the above-described concentration ranges.

[0060] In the medium composition, the human pluripotent stem cells may be human embryonic stem cells or human induced pluripotent stem cells, but the present invention is not limited thereto.

[0061] In the medium composition, preferably, human tissue may not be incorporated. The expression “human tissue is not incorporated” means that the content of human tissue incorporated into the medium composition is 5% or less, 3% or less, 1% or less, most preferably 0%, with respect to a total content of the medium composition. The 0% incorporation means that no human tissue is incorporated into the medium composition.

[0062] The present invention also provides a method of differentiating dermal papilla precursor cells from human pluripotent stem cells, including the following processes:

[0063] (a) culturing embryonic bodies of human pluripotent stem cells in a neural crest stem cell induction medium to differentiate into neural crest stem cells; and

[0064] (b) culturing the differentiated neural crest stem cells in the above-described medium composition to differentiate into dermal papilla precursor cells.

[0065] Hereinafter, the medium composition and each process of the differentiation method will be described in detail.

[0066] The term “pluripotent stem cells (PSCs)” as used herein refers to stem cells having pluripotency, and PSCs may include various types of stem cells known in the art, for example, embryonic stem cells or induced pluripotent stem cells, but the present invention is not limited thereto.

[0067] The term “human pluripotent stem cells” as used herein means that the origin of pluripotent stem cells is a human, for example, tissue, blood, and the like of humans, and examples of the human pluripotent stem cells may include human embryonic stem cells, human fibroblast-derived hiPSCs (FB-derived hiPSCs), and human dermal papilla cell-derived hiPSCs (DPC-derived hiPSCs).

[0068] The term “induced pluripotent stem cells (iPSCs)” as used herein refers to cells that return to a pre-differentiated cell stage by transfecting differentiated somatic cells with cell differentiation-related genes and are induced to have pluripotency like embryonic stem cells. In 2006, Professor Shinya Yamanaka of Kyoto University produced stem cells with pluripotency like embryonic stem cells by introducing several genes into mouse skin fibroblasts, and successfully produced induced pluripotent stem cells by introducing genes into adult skin cells in 2007. The genes are SOX2, c-MYC, OCT4, and KLF4, which are also referred to as Yamanaka factors, and also in the present invention, to prepare induced pluripotent stem cells from skin fibroblasts isolated from humans, the four types of genes were introduced.

[0069] The induced pluripotent stem cells according to the present invention are produced from human skin fibroblasts, but any human adult cells capable of producing induced pluripotent stem cells are used without limitation.

[0070] The method may further include, before process (a), culturing the human pluripotent stem cells into embryonic bodies. Preferably, the present process may be performed for about 3 days to about 7 days.

[0071] The process (a) is a process of differentiating neural crest stem cells from the embryonic bodies of the human pluripotent stem cells. The neural crest stem cell induction medium may be supplemented with DMEM/F12 Glutamax, fibroblast growth factor-2 (FGF2), fibronectin, insulin, a N.sub.2 supplement, and transferrin, but the present invention is not limited thereto.

[0072] In one embodiment of the present invention, as a result of verifying the characteristics of neural crest stem cells differentiated through process (a) and observing the morphology of the neural crest stem cells using a microscope, it was confirmed that the HNK1 and p75NTR proteins, which are neural crest markers, were expressed, demonstrating that differentiation of neural crest stem cells from the pluripotent stem cells successfully occurred.

[0073] Process (b) is a process of differentiating dermal papilla precursor cells from the neural crest stem cells differentiated in process (a). To differentiate dermal papilla precursor cells from the neural crest stem cells, the inventors of the present invention screened factors essential for differentiation into dermal papilla precursor cells in a general DMEM/F12 Glutamax culture medium used in differentiation of dermal papilla-like cells from conventional neural crest stem cells, and as a result, finally demonstrated that, when FGF2, a GSK-3 inhibitor, and BMP4 were added as differentiation factors, differentiation into dermal papilla precursor cells are possible, and thus developed a medium composition for differentiation into dermal papilla precursor cells, containing the above-described factors.

[0074] Therefore, the neural crest stem cells differentiated in process (a) may be cultured in the medium for differentiation into dermal papilla precursor cells for 12 days to 40 days to differentiate into dermal papilla precursor cells.

[0075] In addition, the method may further include, after process (b), the following process:

[0076] (c) aging the differentiated dermal papilla precursor cells to obtain dermal papilla precursor cell spheres.

[0077] Process (c) is a process of proliferating the dermal papilla precursor cells differentiated in process (b) while subculturing to obtain dermal papilla precursor cell spheres.

[0078] Process (c) may be performed by culturing the differentiated dermal papilla precursor cells in a DMEM/F12 Glutamax medium supplemented with FGF2 alone.

[0079] In one embodiment of the present invention, to verify whether differentiation into dermal papilla precursor cells through the above method occurs well, microscopic observation was performed and the results showed that the morphology was changed from an astral shape to a spindle and polygonal shape similar to that of primary dermal papilla cells, and the resulting cells formed spheres and exhibited alkaline phosphatase activity.

[0080] In the differentiation method of the present invention, preferably, process (a) may be performed for 5 days to 9 days, process (b) may be performed for 11 days to 17 days, and process (c) may be performed for 7 days to 13 days, and at this time, differentiation of dermal papilla precursor cells from human pluripotent stem cells may be most effectively performed.

[0081] In the differentiation method of the present invention, preferably, the method of differentiating dermal papilla precursor cells from human pluripotent stem cells may be performed for 26 days to 50 days, more preferably 30 days to 45 days, and far more preferably about 40 days, and at this time, differentiation of dermal papilla precursor cells from human pluripotent stem cells may be most effectively performed. The starting point of the “26 days to 50 days” refers to a time point at which human pluripotent stem cells start to be applied to the differentiation method of the present invention. For example, in applying human pluripotent stem cells to the differentiation method of the present invention, when a process of forming embryonic bodies of human pluripotent stem cells is included before process (a), the process of forming embryonic bodies of human pluripotent stem cells may also be included in the period of 26 days to 50 days.

[0082] The present invention also provides human dermal papilla precursor cells differentiated from human pluripotent stem cells using the above-described differentiation method, wherein the human dermal papilla precursor cells have hair follicle-forming ability.

[0083] The dermal papilla precursor cells exhibit one or more characteristics selected from the group consisting of the following (a), (b), and (c):

[0084] (a) positive immunological characteristics for alkaline phosphatase (ALP), α-smooth muscle actin (αSMA), versican (VCAN), and nestin;

[0085] (b) structural properties of dermal papilla cells that spontaneously form spheres; and

[0086] (c) genetic characteristics expressing one or more dermal papilla signature genes selected from the group consisting of ALX Homeobox 3 (ALX3), SRY-Box 2 (SOX2), Hes Related Family BHLH Transcription Factor With YRPW Motif 1 (HEY1), Bone Morphogenetic Protein 4 (BMP4), Lymphoid Enhancer Binding Factor 1 (LEF1), WNT inhibitory factor 1 (WIF1), and Versican (VCAN).

[0087] The dermal papilla precursor cells exhibit CD133(−), or exhibit CD133(−) and SDC1(+).

[0088] CD133 is known as a surface marker of hair-induced skin cells in mice. However, in the case of dermal papilla precursor cells according to the present invention, as illustrated in FIG. 3C, it was confirmed that the expression of genes expressed in typical dermal papilla, i.e., ALX homeobox3 (ALX3), catenin beta 1 (CTNNB1), SOX2, and lymphoid enhancer binding factor 1 (LEF1) was significantly increased in CD133-negative cells, whereas the above results were not shown in CD133-positive cells.

[0089] The present invention also provides subcultured human dermal papilla precursor cells as human dermal papilla precursor cells differentiated from human pluripotent stem cells by the differentiation method, wherein the human dermal papilla precursor cells have hair follicle-forming ability.

[0090] In one embodiment of the present invention, to verify whether the differentiated dermal papilla precursor cells have hair follicle-forming ability, the inventors of the present invention performed patch assay by subcutaneously transplanting the dermal papilla precursor cells into immunodeficient mice along with epidermal cells of C57BL/6 neonatal mice (mEPI). As a result, it was confirmed that, after 2 weeks, mouse-human hybrid hair follicle neogenesis was induced.

[0091] In another embodiment of the present invention, RNA sequencing was performed on induced neural crest stem cells, induced dermal papilla precursor cell spheres, cultured dermal papilla cell spheres, and cultured dermal papilla cells, and then gene expression profiling was analyzed. The results showed that the dermal papilla cells exhibit a gene expression pattern that was very different from that of neural crest stem cells, and highly expressed the key genes of dermal papilla cells, through which it was shown that the dermal papilla cells were similar to human dermal papilla cells and exhibited an early stage molecular signature.

[0092] Based on the above results, in another embodiment of the present invention, as a result of in-vitro co-culture of epithelial stem cells and the dermal papilla precursor cells, the formation of a spherical structure very similar to the morphology of hair follicle production and a gene expression pattern similar to human fetal scalp were observed.

[0093] In another embodiment of the present invention, chamber assay was performed using the dermal papilla precursor cells and epithelial stem cells to verify whether human hair follicle neogenesis was induced in mice. As a result, it was confirmed that, when both dermal papilla precursor cells on day 40 after differentiation started and epithelial stem cells on day 18 thereafter were transplanted into mice, the two types of cells exhibited structure and genetic characteristics similar to those of fetal hair follicles, from which it was confirmed that human hair follicle neogenesis could be induced using the dermal papilla precursor cells and epithelial stem cells, which consist of human cells alone.

[0094] Therefore, the present invention provides a composition for inducing human hair follicle neogenesis, including epithelial stem cells differentiated from human pluripotent stem cells and the human dermal papilla precursor cells as active ingredients.

[0095] The present invention also provides a method of inducing human hair follicle neogenesis by delivering, to an individual, epithelial stem cells differentiated from human pluripotent stem cells and the human dermal papilla precursor cells differentiated from human pluripotent stem cells and having hair follicle-forming ability.

[0096] The present invention also provides a method of producing human hair follicles by co-culturing human dermal papilla precursor cells differentiated from the human pluripotent stem cells and having hair follicle-forming ability and epithelial stem cells differentiated from human pluripotent stem cells. In the present invention, preferably, the co-culture may be performed in vitro.

[0097] The present invention also provides a use of a composition for human hair follicle neogenesis, the composition including, as active ingredients, epithelial stem cells differentiated from human pluripotent stem cells and the human dermal papilla precursor cells differentiated from human pluripotent stem cells and having hair follicle-forming ability.

[0098] The term “human hair follicles” as used herein means human hair follicles, but does not mean that an individual who wishes to newly form hair follicles is limited to humans, and the individual who wishes to newly form hair follicles may include various animals known in the art capable of having hair follicles, including humans. For example, the various animals known in the art capable of having hair follicles may include mammals, and the mammals may include mice and the like. According to a specific embodiment of the present invention, human hair follicle neogenesis was induced in mice.

[0099] The present invention also provides a cell therapeutic agent for treating hair loss, including epithelial stem cells differentiated from human pluripotent stem cells and the human dermal papilla precursor cells as active ingredients.

[0100] The present invention also provides a method of treating hair loss, including administering, to an individual, a cell therapeutic agent including, as active ingredients, epithelial stem cells differentiated from human pluripotent stem cells and the human dermal papilla precursor cells differentiated from human pluripotent stem cells and having hair follicle-forming ability.

[0101] The present invention also provides a use of a composition for hair loss treatment, the composition including, as active ingredients, epithelial stem cells differentiated from human pluripotent stem cells and the human dermal papilla precursor cells differentiated from human pluripotent stem cells and having hair follicle-forming ability.

[0102] The present invention also provides a method of inducing hair follicle neogenesis, including transplanting, into tissue except for humans, human epithelial stem cells and the human dermal papilla precursor cells.

[0103] The dermal papilla precursor cells may be differentiated from the human pluripotent stem cells for 30 days to 50 days, and the epithelial stem cells may be differentiated from the human pluripotent stem cells for 15 days to 21 days.

[0104] The dermal papilla precursor cells may be CD133(−), and the epithelial stem cells may be CD133(+).

[0105] Hereinafter, exemplary examples will be described to aid in understanding of the present invention. However, the following examples are provide only to facilitate the understanding of the present invention and are not intended to limit the scope of the present invention.

Examples

Example 1

Experiment Preparation and Experimental Method

1-1. Production of Induced Pluripotent Stem Cells from Human Skin Fibroblasts

[0106] Human skin fibroblasts (ATCC PCS-201-012) were subcultured three times, and then reprogramming factors OCT4, SOX2, KLF4, and c-MYC were transduced using a retrovirus. At 24 hours after transduction, a virus-containing medium was replaced with a fresh growth medium, and two weeks after transduction, induced pluripotent stem cell (iPSC)-like colonies were observed in the transduced human skin fibroblasts. The colonies were picked up and transferred to a new STO feeder, and after 2 days of colony attachment, the culture medium was replaced with a fresh embryonic stem cell culture medium supplemented with 10 ng/ml of bFGF.

[0107] Subsequently, the embryonic stem cell culture medium was replaced daily, the colonies were incubated under 5% O.sub.2 conditions on a mitomycin C-inactivated mouse STO feeder in a human embryonic stem cell medium containing DMEM/F12 Glutamax (Thermo Fisher, catalog no. 10565042), 20% knockout serum replacement (Thermo Fisher), 1% non-essential amino acids (Invitrogen), 2 mM glutamine (Thermo Fisher), 0.1 mM β-mercaptoethanol (Thermo Fisher), and 10 ng/ml of bFGF (Thermo Fisher). The subculture was performed using a general method or 1 mg/ml of collagenase-type IV (Thermo Fisher) at intervals of 5 days to 7 days. All parental lineages were maintained for 50 passages or more, and it was confirmed that OCT3/4, NANOG, and SSEA4 were stably expressed.

[0108] 1-2. Differentiation of Neural Crest Stem Cells from Human Induced Pluripotent Stem Cells

[0109] First, to form embryonic bodies (EBs), when the colonies of induced pluripotent stem cells reached 80% to 90% of the area of a culture dish, the colonies were treated with 2 mg/ml of collagenase IV at 37° C. for 1 hour, the differentiated colonies were separated with a pipette tip, and then the separated colonies were gently collected. Subsequently, the supernatant was discarded, the resulting colonies were resuspended in a culture medium of the induced pluripotent stem cells, which was free of bFGF, and then embryonic bodies were transferred to 10 cm culture dishes and cultured in 8 ml of the medium per culture dish. The next day, the medium was replaced, an aggregate was further cultured for 5 days, and the induced pluripotent stem cell culture medium was supplemented every other day.

[0110] After culture, the embryonic bodies were dispensed onto cell culture dishes coated with 15 μg/ml of poly-L-ornithine (Sigma-Aldrich) and 10 μg/ml of fibronectin (BD), and cultured overnight in an N.sub.2 medium of the following composition: DMEM/F12 Glutamax (Thermo Fisher, catalog no. 10565042), 1% N.sub.2 supplement (Thermo Fisher), 20 μg/ml of insulin (Sigma-Aldrich), 0.1 mg/ml of transferrin (Sigma-Aldrich), 20 ng/ml of bFGF (Thermo Fisher), 2.5 μg/ml of fibronectin (Sigma-Aldrich), 1× penicillin/streptomycin. The medium was replaced daily.

[0111] 1-3. Differentiation of Dermal Papilla Precursor Cells from Neural Crest Stem Cells

[0112] (1) Development of Medium Composition

[0113] To develop a dermal papilla precursor cell medium composition for inducing differentiation of dermal papilla precursor cells from neural crest stem cells, the possibility of differentiation into dermal papilla precursor cells was examined by treatment with several factors alone known as vital materials for dermal papilla cell differentiation or a combination thereof. To confirm differentiation into dermal papilla precursor cells, mouse anti-human SDC1 and CD133/2 antibodies were stained using PBS supplemented with 2% FBS, and then the stained cells were analyzed using a flow cytometer (BD Biosciences).

[0114] A DMEM/F12 glutamax (Thermo Fisher, catalog no. 10565042), 10% FBS basal medium was treated with one of a GSK-3 inhibitor (6-Bromoindirubin-3′-oxime (BIO)), bFGF, BMP4, purmophamine, and EGF, treated with a combination of two of a GSK-3 inhibitor (6-Bromoindirubin-3′-oxime (BIO)), bFGF, and BMP4, or treated with all of a GSK-3 inhibitor (6-Bromoindirubin-3′-oxime (BIO)), bFGF, and BMP4, and after about 2 weeks, dermal papilla precursor cells, differentiation of which was induced from neural crest stem cell, were analyzed using SDC1 and CD133, and the analysis results showed that the differentiated cells were significantly increased only in a group treated with all of a GSK-3 inhibitor (6-Bromoindirubin-3′-oxime (BIO)), bFGF, and BMP4.

[0115] (2) Differentiation of Dermal Papilla Precursor Cells from Neural Crest Stem Cells

[0116] To induce differentiation of dermal papilla precursor cells from neural crest stem cells, neural crest stem cells were induced from embryonic bodies at 50% to 60% of the culture area for 5 days. The differentiation-induced neural crest stem cells were cultured in a dermal papilla precursor cell differentiation medium containing DMEM/F12 Glutamax (Thermo Fisher, catalog no. 10565042), 10% FBS, a GSK-3 inhibitor (1 μM 6-bromoindirubin-3′-oxime (BIO)) (Sigma-Aldrich)), 20 ng/ml of bFGF, 1× penicillin/streptomycin without subculture, and the medium was replaced every other days.

[0117] Spindle-shaped neural crest stem cells changed when 1 ng/ml of human recombinant bone morphogenetic protein 4 (BMP4) (R&D Systems) was added to the dermal papilla precursor cell differentiation medium at time at which the cell shape was changed to a shape similar to that of fibroblasts for 2 days.

[0118] After about 2 weeks, the isolated dermal papilla precursor cells were washed with PBS, 1 ml of Tryple express (Life technologies) was added thereto, followed by incubation at 37° C. for 5 minutes, and the dermal papilla precursor cells were recovered with PBS and centrifuged at 1,200 rpm and room temperature for 5 minutes. For initial passages, 1:2 or 1:3 culture was performed in uncoated culture dishes using a dermal papilla precursor cell differentiation medium free of BIO (Sigma-Aldrich) and human recombinant BMP4 (R&D Systems). After the passages, it was confirmed that most undifferentiated cells were not attached and only the differentiated dermal papilla precursor cells survived.

[0119] (3) Use of CHIR-99021 as GSK-3 Inhibitor

[0120] To determine the role of a GSK-3 inhibitor as a WNT signal activator in the dermal papilla precursor cell medium composition for inducing differentiation of dermal papilla precursor cells from neural crest stem cells, the possibility of differentiation into dermal papilla precursor cells was examined by treatment with not only 6-bromoindirubin-3′-oxime (BIO) but also CHIR-99021 at 0.1 μM, 1 μM, and 10 μM. To confirm the possibility of differentiation into dermal papilla precursor cells, mouse anti-human SDC1 and CD133/2 antibodies were stained using PBS supplemented with 2% FBS, and then the stained cells were analyzed using a flow cytometer (BD Biosciences).

[0121] A DMEM/F12 Glutamax (Thermo Fisher, catalog no. 10565042), 10% FBS basal medium was treated with all of a GSK-3 inhibitor (CHIR-99021), bFGF, and BMP4, and after about 2 weeks, neural crest stem cells, differentiation of which was induced from human pluripotent stem cells, were subjected to flow cytometry using dermal papilla precursor cell markers SDC1 and CD133, and from the results, it was confirmed that differentiation efficiency increased according to the concentration of GSK-3 inhibitor (CHIR-99021), through which concentration-dependent differentiation induction patterns as well as the importance of WNT signal activation were confirmed in differentiation into dermal papilla precursor cells.

[0122] 1-4. Differentiation of Epithelial Stem Cells from Human Induced Pluripotent Stem Cells

[0123] Differentiation of epithelial stem cells (EpSCs) from induced pluripotent stem cells obtained by dedifferentiation from human skin fibroblasts in Example 1-1 was carried out according to a conventionally known differentiation protocol. Briefly, before differentiation, induced pluripotent stem cells were isolated by treatment with 2 mg/ml of collagenase IV (Thermo Fisher) at 37° C. for 1 hour, and cell aggregates were grown for 24 hours in an embryonic stem cell medium containing 1 ng/ml of human recombinant BMP4. On day 2, embryonic bodies were collected and the supernatant was discarded, and then the cultures were dispensed into STO cells treated with mitomycin-C. The dispensed cells were grown in a differentiation medium containing 1 μM all-trans RA (Sigma-Aldrich), and after 2 days, the cells of the ectoderm lineage migrated from the embryonic bodies, the medium was replaced with a differentiation medium containing 25 ng/ml of human recombinant BMP4, 20 ng/ml of human EGF (Sigma-Aldrich), and 1 μM all-trans RA, and then the cells were cultured in the differentiation medium until clones of the epithelial stem cells were observed, and isolated on about day 11. In the differentiated epithelial stem cells, the amount of CD200+/ITGA6+ cells reached the maximum level on about day 18 after culture, and the CD200+/ITGA6+ cells were isolated through MACS analysis, and then used in hair follicle neogenesis experiments.

[0124] 1-5. Isolation and Culture of Human Dermal Papilla Cells

[0125] To obtain human dermal papilla cells (hDPCs), skin biopsy samples (1.5 cm×1.0 cm scalp tissue samples at the occiput) were taken from healthy male volunteers (mean age: 36.6±9.4 years old). Human dermal papilla cells were isolated from each hair follicle which is considered to be morphologically growing, and the isolated dermal papilla cells were incubated in Dulbecco's Modified Eagle's Medium (DMEM)(Welgene) supplemented with 10% FBS (Thermo Fisher) and 1× penicillin/streptomycin (Thermo Fisher) at 37° C. under 5% CO.sub.2.

[0126] 1-6. Histology and Immunofluorescence Staining

[0127] Scalp tissue from human fetuses was mounted on Tissue-Tek cryo-OCT (Fisher Scientific) and frozen using methyl butane/dry ice. Tissue blocks were cut to a thickness of 10 μm at 25° C. and stored at 80° C. until immunofluorescence staining was performed.

[0128] 1-7. Staining of Antibody Against Cell Membrane Proteins

[0129] Tissue embedded in paraffin was cut to a thickness of 4 μm, and the obtained sections were stained with hematoxylin & eosin. In other cases, for antigen searching, sections of 4 μm-thick microcut tissue were treated with citrate buffer (DAKO) at 120° C. for 15 minutes.

[0130] Meanwhile, the frozen tissues cleaved for antibody staining were fixed with 4% paraformaldehyde for 20 minutes, and then the fixed tissues were incubated with an Ultravision protein blocking solution (Thermo Fisher) for 30 minutes. Next, the cells were treated with primary antibodies and cultured, and then treated with a solution obtained by diluting secondary antibodies and an antibody dilution solution (Life Technologies) at a ratio of 1:200, followed by culture for 1 hour and washing. Thereafter, the cells were counterstained with 4′,6-diamidino-2-phenylindole (DAPI) (Thermo Fisher), and then mounted on immuno-mount (Thermo Fisher).

[0131] 1-8. Staining of Antibody Against Transcription Factors

[0132] The frozen tissue sections fixed with 4% paraformaldehyde or formed human hair follicles were treated with a blocking solution containing 0.01% saponin (Sigma-Aldrich) and 0.25% fish gelatin (Sigma-Aldrich) to increase cell membrane permeability. Thereafter, primary and secondary antibody staining was performed using a blocking solution, and the cells were treated with isotype control to confirm background staining in each experiment.

[0133] 1-9. Flow Cytometry and Cell Sorting

[0134] Induced pluripotent stem cells (iPSCs), neural crest stem cells (NCSCs), and dermal papilla precursor cells (DPPCs) (Day 25, 40, Passage 5) were incubated with mouse anti-human SDC1, CD133/2, and SSEA3, and staining was performed using PBS supplemented with 2% FBS. Subsequently, the stained cells were analyzed using an LSRII flow cytometer (BD Biosciences).

[0135] For cell sorting, cells were isolated in PBS at a concentration of 10.sup.6 cells/ml using an AriaTMII cell separator (BD Biosciences). A Miltenyi MACS bead separation system was used for magnetic bead separation according to the manufacturer's instructions and separation conditions. The results were analyzed using FlowJo software (FlowJo, LLC).

[0136] 1-10. Hair Follicle Neogenesis Analysis through Patch Assay

[0137] Before performing hair follicle neogenesis analysis, SSEA3− cells were isolated from human induced pluripotent stem cell-derived dermal papilla precursor cells (hiPSC-derived DPPCs) through MACS analysis and undifferentiated cells were removed. 20 μl of 10% DMEM containing 1×10.sup.4 of the sorted dermal papilla precursor cells or the cultured human dermal papilla cells was added dropwise onto the lid of each petri-dish. Dermal papilla cell spheres or human induced pluripotent stem cell-derived dermal papilla precursor cell spheres were dispensed and obtained after 48 hours. Cultured human dermal papilla cells or human induced pluripotent stem cell-derived dermal papilla precursor cells were incubated with epithelial cells of C57BL/6 neonatal mice or human induced pluripotent stem cell-derived CD200+/ITGA6+/SSEA3 cells. In all experiments, cultured human dermal papilla cells (a total of 1×10.sup.6, 100 spheres) or human induced pluripotent stem cell-derived dermal papilla precursor cells (a total of 1×10.sup.6, 100 spheres) and epithelial cells (5×10.sup.5 cells) were mixed in DMEM/F12 Glutamax and the resulting mixture was subcutaneously injected into severe combined immunodeficient hairless outbred (SHO) female mice aged 7 weeks (18 g-20 g; Jackson Laboratory). To confirm the origin of human dermal papilla precursor cells in the formed hair follicles, the dermal papilla precursor cells were labeled with a fluorescent dye reagent, CM-DiI (Invitrogen). Host mice were sacrificed at week 5 to week 6 after transplantation to obtain a regenerated hair follicle structure. The present experiment was approved by Seoul National University Hospital Institutional Review Board (Approval No. 15-0178-C1A0).

[0138] 1-11. Hair Follicle Neogenesis Analysis through Chamber Assay

[0139] Cells were prepared in the same manner as described in the patch assay above. Briefly, human induced pluripotent stem cell-derived dermal papilla precursor cells (hiPSC-DPPC) (a total of 5×10.sup.6, 500 spheres) and human induced pluripotent stem cell-derived epithelial stem cells (5×10.sup.6 cells), which were co-cultured in DMEM/F12 Glutamax, were transferred to a silicone chamber implanted in the back epidermis of each SHO mouse. After 2 weeks, the chamber was removed and the implanted site was subjected to dressing, and then 5 weeks later, the implanted site was obtained for histological analysis.

[0140] 1-12. Quantitative Reverse Transcription Polymerase Chain Reaction

[0141] Total RNA was isolated from induced pluripotent stem cells, neuronal stem cells, dermal papilla precursor cells, 2D cultured dermal papilla cells, and 3D cultured dermal papilla cells using RNAiso Plus (Takara Bio). cDNA was synthesized using the isolated RNA as a template using a Revert First strand cDNA synthesis kit (Thermo Fisher). Thereafter, quantitative reverse transcription polymerase chain reaction analysis was performed using SYBR premix Ex Taq II (Takara Bio), and the used primer sequences are shown in Table 1 below.

TABLE-US-00001 TABLE 1 SEQ ID GENE DIRECTION SEQUENCE (5′-3′) NO SDC1 Forward CTCTGTGCCTTCGTCTTTCC 1 Reverse CCACCTTCCTTTGCCATTTA 2 BGN Forward GTCTATCTGCACTCCAACAA 3 Reverse TGGATGGCCAGGCGGTCAGT 4 BMP4 Forward GCCCGCAGCCTAGCAA 5 Reverse CGGTAAAGATCCCGCATGTAG 6 HEY1 Forward GCGCACGCCCTTGCT 7 Reverse GCCAGGCATTCCCGAAA 8 WIF1 Forward TGGCATGGAAGACACTGCAA 9 Reverse GGCCTCAGGGCATGTATGA 10 WNT5A Forward AGGGCTCCTACGAGAGTGCT 11 Reverse GACACCCCATGGCACTTG 12 OCT3/4 Forward GACAGGGGGAGGGGAGGAGCTAGG 13 Reverse CTTCCCTCCAACCAGTTGCCCCAAAC 14 NANOG Forward CCTGTGATTTGTGGGCCTG 15 Reverse GACAGTCTCCGTGTGAGGCAT 16 p75NTR Forward CCCCCTTCTCCCACACTGCTA 17 Reverse AACCCCAAACCTGACTCCAT 18 HNK1 Forward GCAAGAAGGGCTTCACTGAC 19 Reverse GCCCCCAGAATAGAAAGGAG 20 SOX10 Forward AGCCCAGGTGAAGACAGAGA 21 Reverse AGGAGAAGGCCGAGTAGAGG 22 ALX3 Forward GAATGAGCTGCCCACCTCTT 23 Reverse CCTGTAACGTGTTCCCTGCT 24 CTNNB1 Forward CTGCCATCTGTGCTCTTCGT 25 Reverse CAGTGGGATGGTGGGTGTAA 26 SOX2 Forward TGCGAGCGCTGCACAT 27 Reverse TTCTTCATGAGCGTCTTGGTTTT 28 LEF1 Forward ATTCCGGGTACATAATGATGCC 29 Reverse GAGAAAAGTGCTCGTCACTGT 30 VCAN Forward TGTTCCTCCCACTACCCTTG 31 Reverse CTTCCACAGTGGGTGGTCTT 32 NOG Forward CCTCATCGAACACCCAGAC 33 Reverse CATGAAGCCTGGGTCGTAGT 34 GAPDH Forward ATTGTTGCCATCAATGACCC 35 Reverse AGTAGAGGCAGGGATGATGT 36 OCT4 Forward CCTCACTTCACTGCACTGTA 37 (endo) Reverse CAGGTTTTCTTTCCCTAGCT 38 SOX2 Forward CCCAGCAGACTTCACATGT 39 (endo) Reverse CCTCCCATTTCCCTGTTTT 40 NANOG Forward TGAACCTCAGCTACAAACAG 41 (endo) Reverse TGGTGGTAGGAAGAGTAAAG 42 REX1 Forward TCGCTGAGCTGAAACAAATG 43 Reverse CCCTTCTTGAAGGTTTACAC 44 TERT Forward TGTGCACCAACATCTACAAG 45 Reverse GCGTTCTTGGCTTTCAGGAT 46

[0142] 1-13. Alkaline Phosphatase Activity

[0143] Alkaline phosphatase activity for cells dispensed onto a plate was analyzed. More specifically, the cells were fixed with 4% paraformaldehyde for 20 minutes, and then treated with a solution obtained by diluting NBT/BCIP (Roche) in NTMT buffer for 20 minutes.

[0144] 1-14. RNA Sequencing

[0145] Total RNA was isolated from human neural crest stem cells, human dermal papilla precursor cells, cultured dermal papilla cells, and cultured dermal papilla cell spheres using RNAiso Plus (Takara Bio). Next, a transcript library for 1 μg of the isolated RNA was prepared using an Illumina's TruSeq Stranded mRNA kit. Poly(A)+ RNA was isolated using AMPure XP beads (Beckman Coulter) and fragmented using an Ambion Fragmentation Reagents kit (Ambion, Austin, Tex., USA). cDNA synthesis, terminal repair, base addition, and conjugation of Illumina indexed adapters were all performed according to the Illumina's protocol. The library was selected to a size of 250300 bp using BluePipin (Sage Science, MA, USA) and amplified by 14 cycles of PCR using Phusion DNA polymerase (New England Biolabs), and the amplified library was purified with AMPure XP beads. The quality of the library was evaluated by measuring the size and concentration thereof using an Agilent 2100 Bioanalyzer.

[0146] A bilateral terminal library was then sequenced using Illumina HiSeq 2000 (2×100 nucleotide read length), and reads having passed through a purity filter of Illumina BaseCall software were used for subsequent analysis. R package “Cuffdiff” was used for differentially expressed gene analysis, and for the production of a heatmap of a total of 3,065 genes, hierarchical clustering analysis was performed on genes with a q value of less than 0.05. In addition, distance matrix analysis, multidimensional scaling plots, and gene cluster analysis were performed using R package “CummeRbund”. To generate 50 clusters out of a total of 3,471 genes, gene cluster analysis was performed on important genes with an alpha value of less than 0.01.

[0147] 1-15. Accession Codes

[0148] The raw data of RNA sequencing received accession number GSE100793 and was deposited in NCBI Gene Expression Omnibus.

[0149] 1-16. Statistical Analysis

[0150] Gene expression and flow cytometry results were analyzed using a Student's t test or ANOVA, and qPCR results were analyzed after correction with β-actin. p<0.05 was considered to be statistically significant.

Example 2

Expression Analysis of SDC1 and CD133 in Human Hair Follicle Placode Stage In Vivo

[0151] To induce human hair follicle neogenesis, the inventors of the present invention established a simple strategy to mimic the biological state of the hair placode stage based on the morphogenesis of hair follicles occurring in human embryos. More specifically, it was focused to obtain dermal papilla precursor cells in the dermis and skin fibroblasts at a hair follicle placode stage.

[0152] To monitor the differentiation process, specific surface markers for human dermal papilla precursor cells were needed. Syndecan-1 (SDC1) is a well-known surface marker that is strongly expressed in the scalp of human fetuses not only in mouse skin but also in the hair follicle placode stage, and is also known as a human dermal papilla signature gene. Meanwhile, CD133 was originally known as a surface marker of hair-derived dermal papilla cells in mice, but human dermal papilla cells have been reported to have no expression pattern similar to that in mice. Therefore, the inventors of the present invention first verified the expression of SDC1 and CD133 in the scalp skin of human embryos aged 16 weeks.

[0153] As a result, as shown in FIG. 1, it was confirmed that SDC1 was predominantly expressed in the dermis when the epidermal placode and the dermis were formed. In addition, although CD133 expression was not observed in the dermis at a very early stage, these results are similar to those observed in morphogenesis of hair follicles in mouse embryos. CD133 was expressed in epidermal placode cells along cells and peaks and flanks thereof, consistent with reports on the scalp of human fetuses.

Example 3

Preparation of Differentiation Medium of Human Dermal Papilla Precursor Cells

[0154] (1) Production of Human Induced Pluripotent Stem Cells (hiPSC)

[0155] In accordance with known methods (Cell 131, 861-872.), the inventors of the present invention produced induced pluripotent stem cells (hiPSCs) from isolated adult dermal fibroblasts using four genes called Yamanaka factors, i.e., octamer-binding transcription factor 4 (OCT4), sex determining region Y-box 2 (SOX2), Kruppel-like factor 4 (KLF4), and c-MYC. Induced pluripotent stem cell clones dedifferentiated using the method exhibited human embryonic stem cell (hESC) morphology and a high level of alkaline phosphatase (ALP) activity, and were confirmed to express various pluripotent markers including surface antigen stage-specific embryonic antigen 4 (SSEA4) as well as OCT3/4 and NANOG. It was also confirmed through quantitative real-time polymerase chain reaction (qPCR) that the expression of endogenous sternness genes including OCT3/4, SOX2, NANOG, REX1, and telomerase reverse transcriptase (TERT) was increased. In addition, teratoma formation analysis was performed to confirm the pluripotency of the induced pluripotent stem cell clones, and the clones were used as pluripotent stem cells after 100 or more consecutive passages.

[0156] (1) Differentiation of Dermal Papilla Precursor Cells from Human Pluripotent Stem Cells

[0157] Next, based on the study results showing that dermal papilla precursor cells originate from neural crest stem cells in the embryonic development stage, the inventors of the present invention attempted to differentiate dermal papilla precursor cells from the induced pluripotent stem cells using neural crest stem cells as an intermediate. To this end, to produce neural crest stem cells from the human induced pluripotent stem cells, first, embryonic bodies of the induced pluripotent stem cells were cultured in a N.sub.2 differentiation medium supplemented with fibroblast growth factor-2 (FGF2), fibronectin, and the like. After culture for 1 week, it was verified through immunocytochemical staining whether the HNK1 and p75NTR proteins, which are neural crest markers, were expressed on the cultured cells. As a result, it was confirmed as illustrated in FIG. 2B that the HNK1 and p75NTR proteins were expressed.

[0158] (2-1) Development of Specific Differentiation Medium Composition for Dermal Papilla Precursor Cells

[0159] Next, to develop a specific differentiation medium composition for dermal papilla precursor cells, the inventors of the present invention screened essential factors for differentiation of dermal papilla precursor cells other than Dulbecco's Modified Eagle's Medium (DMEM)/F12 Glutamax supplemented with 10% fetal bovine serum (FBS). In particular, it was focused to discover essential factors capable of maintaining intrinsic characteristics and endogenous molecular signatures of human dermal papilla cells or restoring the intrinsic dermal papilla characteristics during in vitro culture. As a result of conducting experiments, initial candidates containing signaling molecules such as WNT, fibroblast growth factor (FGF), bone morphogenetic protein 4 (BMP4), platelet-derived growth factor (PDGF), Sonic hedgehog (SHH), endothelin 3 (EDN3), and the like were obtained, and it was finally confirmed that, when three essential factors FGF2, 6-bromoindirubin-3′-oxime (BIO), and BMP4 were used, the differentiation of dermal papilla precursor cells could be induced.

[0160] More specifically, a DMEM/F12 glutamax (Thermo Fisher, catalog no. 10565042), 10% FBS basal medium was treated with one of a GSK-3 inhibitor (6-bromoindirubin-3′-oxime (BIO)), bFGF, BMP4, purmophamine, and EGF, treated with a combination of two of a GSK-3 inhibitor (6-bromoindirubin-3′-oxime (BIO)), bFGF, and BMP4, or treated with all of a GSK-3 inhibitor (6-bromoindirubin-3′-oxime (BIO)), bFGF, and BMP4, and after about 2 weeks, dermal papilla precursor cells, differentiation of which was induced from neural crest stem cells, were analyzed using SDC1 and CD133. As a result, it was confirmed that the cell fraction of SDC1+/CD133−, which is a marker of dermal papilla precursor cells, was significantly increased only in the group treated with all of a GSK-3 inhibitor (6-bromoindirubin-3′-oxime (BIO), bFGF, and BMP4 (see FIG. 2D).

[0161] (2-2) Use of CHIR-99021 as GSK-3 Inhibitor (see FIG. 2E)

[0162] To confirm the role of a GSK-3 inhibitor as a WNT signaling activator in a dermal papilla precursor cell differentiation medium composition, the possibility of differentiation into dermal papilla precursor cells was examined by treatment with not only 6-bromoindirubin-3′-oxime (BIO) but also CHIR-99021 at 0.1 μM, 1 μM, and 10 μM. A DMEM/F12 Glutamax (Thermo Fisher, catalog no. 10565042), 10% FBS basal medium was treated with all of a GSK-3 inhibitor (CHIR-99021), bFGF, and BMP4, and after about 2 weeks, dermal papilla precursor cells, differentiation of which was induced from neural crest stem cells, were subjected to flow cytometry using dermal papilla precursor cell markers SDC1 and CD133, and from the results, it was confirmed that differentiation efficiency increased according to the concentration of GSK-3 inhibitor (CHIR-99021), through which concentration-dependent differentiation induction patterns as well as the importance of WNT signal activation were confirmed in differentiation into dermal papilla precursor cells (see FIG. 2E).

[0163] (2-3) Differentiation of Dermal Papilla Precursor Cells from Various Types of Pluripotent Stem Cells Including Induced Pluripotent Stem Cells see FIG. 2F)

[0164] To confirm whether the dermal papilla precursor cell differentiation medium composition is commonly applicable to various human cell-derived induced pluripotent stem cells including human embryonic stem cells, the possibility of differentiation into dermal papilla precursor cells was examined using, as the origins of human pluripotent stem cells, one-week-old human embryonic stem cells, two-week-old human fibroblast-derived induced pluripotent stem cells, and one-week-old human dermal papilla cell-derived induced pluripotent stem cells. A DMEM/F12 Glutamax (Thermo Fisher, catalog no. 10565042), 10% FBS basal medium was treated with all of a GSK-3 inhibitor (CHIR-99021), bFGF, and BMP4, and after about 2 weeks, neural crest stem cells, differentiation of which was induced from human pluripotent stem cells, were subjected to flow cytometry using dermal papilla precursor cell markers SDC1 and CD133, and it was confirmed from the results that, although there was a difference in differentiation efficiency according to the origin of pluripotent stem cells, the cell fraction of SDC1+/CD133−, which is a dermal papilla precursor cell marker, was significantly increased in all pluripotent stem cell lines (see FIG. 2F).

[0165] (2-4) Induction of Differentiation of Dermal Papilla Precursor Cells

[0166] To induce differentiation of dermal papilla precursor cells using the essential factors selected as above, as illustrated in FIG. 2A, human induced pluripotent stem cells were differentiated into neural crest stem cells using the above-described method (STAGE 1), and then the differentiated cells were cultured in DMEM/F12 Glutamax medium supplemented with FGF2 (10 ng/mL), a GSK-g inhibitor, and BMP4 (1 ng/mL) for a short time to differentiate into dermal papilla precursor cells (STAGE 2), and subsequently, surrounding dermal papilla cell-like cells were proliferated by subculture in DMEM/F12 Glutamax supplemented with FGF2 (10 ng/mL) alone (STAGE 3).

[0167] After performing the differentiation of dermal papilla precursor cells from human induced pluripotent stem cells according to the above stages, changes in the morphology of cells were observed using a microscope and alkaline phosphatase (ALP) activity was measured in order to confirm whether the differentiation occurred well. As a result, as illustrated in FIG. 2C, it was observed that the cell shape was changed from a typical astral shape to a spindle and polygonal shape similar to human primary dermal papilla cells, and the proliferated dermal papilla precursor cells were isolated and it was confirmed that the isolated cells formed naturally three-dimensional spheres, which are the important intrinsic characteristic of dermal papilla cells.

Example 4

Production of Human Induced Pluripotent Stem Cell-Derived Dermal Papilla Precursor Cells (hiPSC-Derived DPPCs) in Hair Follicle Placode State

[0168] The inventors of the present invention performed flow cytometry on each stage during a process of differentiating dermal papilla precursor cells from the human induced pluripotent stem cells of Example 3 and FIG. 2A to observe temporary changes in expression levels of SDC1 and CD133. As a result, as illustrated in FIG. 3A, it was confirmed that SDC1 expression was gradually increased as differentiation into dermal papilla precursor cells proceeded, whereas the expression of a stem cell marker CD133 was reduced. From the above results, it can be seen that, to obtain the SDC1+/CD133− cell population, day 25 to day 40 after differentiation started is a specific period at which the percentage of the cells reached a peak, i.e., 99%. Consistent with the above results, the pluripotent stem cell (SSEA3+) population was also gradually decreased during the differentiation process.

[0169] In addition to the above results, the inventors of the present invention attempted to analyze transient gene expression profiles in the cells (iPSC, NCSC, DPPC D25, DPPC D40, DPPC P5) of each differentiation stage. To this end, about 7 days after differentiation induction, the step-by-step progression of differentiation from induced pluripotent stem cells (iPSCs) (OCT3/4 and NANOG were expressed) into neural crest stem cells (NCSCs) (p75NTR, HNK1, and SOX10 were expressed) into dermal papilla precursor cells (DPPCs) (SDC1, biglycan [BGN], WNT5A, BMP4, and Hes-related family BHLH transcription factor [HEY1] having YRPW motif 1) was examined. As a result, as illustrated in FIG. 3B, it was confirmed that the expression of dermal papilla signature genes was increased from about 25 days after differentiation and the greatest expression levels were shown on day 40, and the expression levels were reduced according to subsequent passages similar to in-vitro cultured human dermal papilla cells. This expression pattern is consistent with SDC1 expression by flow cytometry.

[0170] Meanwhile, CD133 is known as a surface marker of hair-induced skin cells in mice. Therefore, the inventors of the present invention attempted to isolate CD133.sup.+ and CD133 cells from dermal papilla precursor cells on differentiation day 25 using magnetic beads and analyze the characteristics thereof. As a result, as shown in FIG. 3C, the expression of genes expressed in typical dermal papilla, i.e., ALX homeobox3 (ALX3), catenin beta 1 (CTNNB1), SOX2, and lymphoid enhancer binding factor 1 (LEF1) was significantly increased in the CD133 cells. In contrast, it was confirmed that the above-described result was not shown in the CD133.sup.+ cells.

Example 5

Analysis of Characteristics and Hair Follicle-Forming Ability of Human Induced Pluripotent Stem Cell-Derived Dermal Papilla Precursor Cells (hiPSC-Derived DPPCs)

[0171] It was verified whether the dermal papilla precursor cells differentiated according to the method of Example 3 exhibited characteristics similar to those of human early dermal papilla cells (hDPCs). To this end, immunocytochemical staining was performed on human dermal papilla precursor cells (hi-DPPCs) to verify alkaline phosphatase (ALP) activity and the expression of genes, i.e., α-smooth muscle actin (αSMA), versican (VCAN), and nestin. As a result, as shown in FIG. 4A, alkaline phosphatase activity was observed even in dermal papilla precursor cells (hi-DPPCs) differentiated similar to human dermal papilla cells (hDPCs), and it was confirmed that αSMA, VCAN, and nestin were also strongly expressed.

[0172] In addition, the spontaneous formation of spheres similar to the in-vivo structure of dermal papilla is an inherent characteristic of dermal papilla, which is related to hair-inducing potency and restoration of the intrinsic characteristics of human dermal papilla cells, and thus it was verified whether the dermal papilla precursor cells according to the present invention had a spherical shape. As a result, as illustrated in FIG. 4B, it was confirmed that dermal papilla precursor cells effectively formed a 3D spherical structure under very low attachment conditions which reflect the characteristics of human dermal papilla cells.

[0173] In addition, as a result of analyzing transcripts through quantitative PCR, as illustrated in FIG. 4C, it was confirmed that the expression of ALX3, SOX2, HEY1, BMP4, LEF1, WNT inhibitory factor 1 [WIF1], and VCAN, which are dermal papilla signature genes, was increased in human dermal papilla precursor cell spheres (hi-DPPC 3D) compared with human dermal papilla cells (cDPC 2D) and dermal papilla cell spheres (cDPC 3D). In particular, it can be seen that the expression of dermal papilla transcription factors was rapidly reduced in one-dimensional culture of dermal papilla cells, whereas the expression of ALX3, SOX2, and HEY1 was significantly increased in the hi-DPPC spheres compared with other cases. In addition, the expression of factors involved in WNT signaling pathways, including LEF1 and WIF1 and factors involved in support matrix during hair follicle morphogenesis, such as VCAN was also significantly increased in the dermal papilla precursor cell spheres. These results indicate that dermal papilla precursor cells reflect the early precursor cell stage of human dermal papilla cells.

[0174] Furthermore, to determine whether the dermal papilla precursor cells according to the present invention are able to induce hair follicle formation when transplanted into severe combined immunodeficient hairless outbred (SHO) mice, the inventors of the present invention performed patch assay according to the method of Example 1-10. Specifically, human dermal papilla cell spheres (cDPD 3D) or dermal papilla precursor cell spheres (hiDPPC 3D) on differentiation day 40 were subcutaneously transplanted along with epithelial cells (mEPI) of C57BL/6 neonatal mice. Since the SHO mouse has no hair follicle and has an albino genetic background, it may be easy to distinguish black-colored hair follicles newly formed by C57BL/6 mouse-derived epithelial cells.

[0175] As a result, as illustrated in FIG. 5A, two weeks after experiment progression, a large number of new hybrid hair follicles was observed at a site where dermal papilla precursor cell spheres and dermal papilla cells were transplanted. In addition, as a result of labeling the dermal papilla precursor cells with red fluorescence cell tracer (CM-DiI) to determine whether the transplanted dermal papilla precursor cell spheres contribute to the dermal papilla of new hair follicles, as illustrated in FIG. 5B, red fluorescence was present in the dermal papilla of reconstructed hair follicles, from which it was confirmed that dermal papilla precursor cells were present and contributed to hair follicle neogenesis. In addition, the quantitative results of the hybrid hair follicle neogenesis are shown in Table 2 below.

TABLE-US-00002 TABLE 2 Hair follicle- Newly Dermal Epithelial forming formed Method component component Attempts ability structure Patch None Neonatal 13  1/13 Fibrotic assay mouse (0%) cyst epithelial cells Dermal Neonatal 13 10/13 Fibrotic papilla mouse (76.92%) cyst precursor epithelial including cells on cells newborn day 40 hair follicles Dermal Neonatal 13 3/13 Fibrotic papilla mouse (23.07%) cyst precursor epithelial including cells after cells newborn 5 passages hair follicles

Example 6

Gene Expression Profiling Analysis of Total RNA Isolated from Human Induced Pluripotent Stem Cell-Derived Dermal Papilla Precursor Cells (hiPSC-Derived DPPCs)

[0176] To confirm the gene expression profile of dermal papilla precursor cells according to the present invention, the inventors of the present invention performed RNA sequencing on human dermal papilla precursor cell spheres together with human induced pluripotent stem cell-derived neural crest stem cells (hi-NCSCs), human dermal papilla cell spheres (cDPC 3D), and human dermal papilla cells (cDPC 2D). As a result of generating a heatmap for a total of 3,065 genes and hierarchically clustering the same into a distance matrix, as illustrated in FIGS. 6A and 6B, the dermal papilla precursor cells were clustered with the dermal papilla cell spheres and the dermal papilla cells and exhibited a gene expression pattern very different from that of neural crest stem cells. In addition, as illustrated in FIG. 6C, based on the dimension reduction approach, the population of dermal papilla precursor cells was observed as an intermediate population distinguished in differentiation of dermal papilla cell spheres from neural crest stem cells.

[0177] In particular, as a result of observing the expression of various genes, as illustrated in FIG. 6D, it was confirmed that many dermal papilla signature genes such as WNT5A, SHH, transcriptional repressor GATA binding 1(TRPS1), HEY1, LEF1, and FOXO1 were very highly expressed in the dermal papilla precursor cells compared to the dermal papilla cell spheres and the dermal papilla cells. In contrast, the expression of stem cell markers such as NANOG and LIN28A was barely found in the differentiated dermal papilla precursor cells. These results indicate that, contrary to neural crest stem cells before differentiation, the dermal papilla precursor cells are more similar to the human dermal papilla cell spheres than the dermal papilla cells or share a precursor molecular signature at the early stage.

Example 7

In-Vitro Formation of Human New Hair Follicels and Characterization Thereof

[0178] To induce human hair follicle neogenesis in vitro, the inventors of the present invention induced differentiation of folliculogenic EpSCs from human induced pluripotent stem cells according to the known method of Example 1-4. Folliculogenic EpSCs (hi-EpSCs) differentiated according to the above method continuously expressed keratin 14 (K14), keratin 15 (K15), and integrin α6 on day 18 after differentiation induction, and induced hybrid hair follicles when bound to mouse neonatal skin cells (see FIG. 7B). Surprisingly, the human epithelial precursor cells expressed CD133 in the cell membrane together with β-catenin accumulation similar to in vivo epithelial placode cells at the hair follicle placode time.

[0179] Furthermore, to determine the hair follicle-forming ability of human dermal papilla precursor cells, the cells were cultured together with hi-EpSCs before analyzing in vivo hair follicle formation to perform in-vitro hair follicle formation analysis. First, dermal papilla precursor cells were dispensed onto a plate with very low adhesion at a density of 10,000 cells/well to form small spheres with their basement membranes containing recombinant human extracellular matrix proteins.

[0180] Next, the epithelial precursor cells were cocultured, at a density of 25,000 cells/well, with dermal papilla precursor cell spheres. As a result of culture, as illustrated in FIG. 7A, surprisingly, spherical structures very similar to follicular morphogenesis showing flat polarity and proliferation in the surrounding layer were produced through the mixing of the two types of cells (yield: ˜65%).

[0181] Next, the characteristics of skin and epithelial components were compared with the in vivo stage of the human fetal scalp. As a result, as illustrated in FIG. 7B, hair follicles exhibited expression patterns of skin markers (SDC1, LEF1, SOX2, Nestin, VCAN, and WIF1) and epithelial markers (CD133, BMP4, K15, K14, and WIF1) similar to the hair follicle placode stage. Interestingly, CD133 expression was shown to be slightly increased in skin components of cocultured hair follicles, similar to the hair germ or hair peg stage.

Example 8

Confirmation of Human Hair Follicle Neogenesis by Human Induced Pluripotent Stem Cell-Derived Dermal Papilla Precursor Cells (iPSC-Derived DPPCs) and Human Induced Pluripotent Stem Cell-Derived Epithelial Stem Cells (hiPSC-Derived EpSCs)

[0182] In the present invention, human hair follicle neogenesis was determined in mice using dermal papilla precursor cells differentiated from human induced pluripotent stem cells and epithelial stem cells. To this end, in vivo hair follicle neogenesis analysis was performed through chamber assay according to the method of Example 1-11, and dermal papilla precursor cell spheres (hi-DPPC D25, hi-DPPC D40, and hi-DPPC P25) at different times were transplanted together with epithelial stem cells (hi-EpSC D18) on day 18 after differentiation started, followed by histological analysis.

[0183] As a result, it was observed as illustrated in FIG. 8A that a new hair follicle having multiple layers of epidermis, a dermal papilla structure, and a non-pigment hair shaft was formed. It was confirmed that the hair follicle exhibited a structure similar to that of human fetal scalp and was clearly different from the hair follicle with an incomplete structure produced in SHO mice.

[0184] It was also confirmed as illustrated in FIG. 8B that, interestingly, the produced human hair follicle (hi-DPPC+hi-EpSC) was positively stained by anti-human cytochrome c oxidase subunit 4 (COX4) antibody and an anti-human mitochondria antibody in the cytoplasm, similar to the human fetal scalp.

[0185] Furthermore, the multilayered expression of hair-specific keratin markers (K14, K15, K17, and K75) were observed in the central circle of newly formed hair follicle. K14 represents the outer root sheath, K15 represents hair follicle stem cells, K17 represents the hair medulla and hair follicle matrix, and K75 reflects the presence of a companion layer in the new hair follicle. In addition, the quantitative results of hair follicle neogenesis through the chamber assay are shown in Table 3 below, and it can be seen that, when dermal papilla precursor cells on differentiation day 40 and epithelial stem cells on differentiation day 18 were co-transplanted, hair follicle neogenesis efficiency is very high.

TABLE-US-00003 TABLE 3 Hair follicle- Newly Dermal Epithelial forming formed component component Attempts ability structure None Epithelial 2 0/2 None stem cells (0%) on day 18 Dermal papilla None 2 0/2 None precursor cells (0%) on day 40 Dermal papilla Epithelial 2 0/2 None precursor cells stem cells (0%) on day 25 on day 18 Dermal papilla Epithelial 6 5/6 New hair precursor cells stem cells (83.33%) follicle on day 40 on day 18 having multiple layers of epidermis, dermal papilla structure, and non-pigment hair shaft

[0186] Through the above results, it was confirmed that human hair follicle neogenesis could be induced in mice using both dermal papilla precursor cells differentiated from the human induced pluripotent stem cells and epithelial precursor cells.

[0187] The foregoing description of the present invention is provided for illustrative purposes only, and it will be understood by those of ordinary skill in the art to which the present disclosure pertains that the present invention may be easily modified in other particular forms without changing the technical spirit or essential characteristics of the present invention. Thus, the above-described embodiments should be construed as being provided for illustrative purposes only and not for purposes of limitation.