System for DNA editing and uses thereof
20210189435 · 2021-06-24
Inventors
Cpc classification
C12N2310/20
CHEMISTRY; METALLURGY
C12N9/22
CHEMISTRY; METALLURGY
C12N15/11
CHEMISTRY; METALLURGY
C12N2310/344
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
C12N15/90
CHEMISTRY; METALLURGY
C12N15/63
CHEMISTRY; METALLURGY
C12N9/96
CHEMISTRY; METALLURGY
C12N15/82
CHEMISTRY; METALLURGY
International classification
C12N15/90
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
Abstract
Provided is a system for DNA editing, comprising crRNA and tracrRNA. The crRNA is an RNA shown in formula I: Nx-ncrRNA (formula I), wherein the Nx is a spacer, and the ncrRNA is an RNA shown in SEQ ID NOs. 1-4 of the Sequence Listing. The tracrRNA is an RNA shown in SEQ ID NOs. 5-8 of the Sequence Listing.
Claims
1. A system for DNA editing, comprising A or B: A, the following N1) and N2): N1) is a RNA named as RNA-2 or a biological material related to the RNA-2; N2) is a RNA named as RNA-1 or a biological material related to the RNA-1; The RNA-2 is the RNA as shown in a formula I:
Nx-ncrRNA The formula I: wherein, the Nx is a spacer in the CRISPR/Cas system; The ncrRNA is any one of the following a1) to a4): a1) a RNA as shown in SEQ ID NO.1 of the sequence listing; a2) a RNA acquired by adding one or more nucleotides to 5′-terminal and/or 3′-terminal of the a1); a3) a RNA having more than 85% of identity with the RNA defined in a1) or a2); and a4) a modifier of the RNA as shown in SEQ ID NO.1 of the sequence listing. The biological material related to the RNA-2 is any one of the following A1) to A5: A1) a DNA molecule for encoding the RNA-2; A2) an expression cassette containing the DNA molecule of A1); A3) a recombinant vector containing the DNA molecule of A1), or a recombinant vector containing the expression cassette of A2); A4) a recombinant microorganism containing the DNA molecule of A1), or a recombinant microorganism containing the expression cassette of A2), or a recombinant microorganism containing the recombinant vector of A3); and A5) a cell line containing the DNA molecule of A1), or a cell line containing the expression cassette of A2). The RNA-1 is any one of the following b1) to b4): b1) a RNA as shown in SEQ ID NO.5 of the sequence listing; b2) a RNA acquired by adding one or more nucleotides to 5′-terminal and/or 3-terminal of the b1); b3) a RNA having more than 85% of identity with the RNA defined in b1) or b2); and b4) a modifier of the RNA as shown in SEQ ID NO.5 of the sequence listing. The biological material related to the RNA-1 is any one of the following B1) to B5: B1) a DNA molecule for encoding the RNA-1; B2) an expression cassette containing the DNA molecule of B1); B3) a recombinant vector containing the DNA molecule of B1), or a recombinant vector containing the expression cassette of B2); B4) a recombinant microorganism containing the DNA molecule of B1), or a recombinant microorganism containing the expression cassette of B2), or a recombinant microorganism containing the recombinant vector of B3); and B5) a cell line containing the DNA molecule of 1), or a cell line containing the expression cassette of B2). The ncrRNA is partially complemented to the RNA-1. B, the RNA-2.
2. The system as claimed in claim 1, wherein the RNA of a2) is any one of the following a21) to a23): a21) a 12-14nt RNA; a22) a 12-16nt RNA; a23) a 12-18nt RNA; and/or, the RNA of b2) is any one of the following b21) to b24): b21) a 64-66nt RNA; b22) a 64-68nt RNA; b23) a 64-70nt RNA; b24) a 64-86nt RNA; and/or, the modifier of the RNA is a substance obtained by modification of ribonucleotide on a ribose, a phosphate skeleton and/or a basic group; the modifier is a substance obtained by modification at least one nucleotide in the RNA on the ribose, the phosphate skeleton and/or the basic group; and/or, the DNA is any one of the following M1)-M5): M1) an eukaryote DNA; M2) an animal DNA; M3) a mammalian DNA; M4) a human DNA; and M5) a mouse DNA.
3. The system as claimed in claim 1 or 2, wherein: the RNA of a21) is the RNA as shown in SEQ ID NO.2 of the sequence listing; the RNA of a22) is the RNA as shown in SEQ ID NO.3 of the sequence listing; the RNA of a23) is the RNA as shown in SEQ ID NO.4 of the sequence listing; and/or, the RNA of b21) is the RNA as shown in SEQ ID NO.6 of the sequence listing; the RNA of b22) is the RNA as shown in SEQ ID NO.7 of the sequence listing; the RNA of b23) is the RNA as shown in SEQ ID NO.8 of the sequence listing; and/or, the modification is 2′-O-methyl modification, 2′-deoxidation modification, 2′-fluorination modification or cholesterol modification; and/or, the DNA is a VEGFA gene, an EMX1 gene, an Oct4 gene, a Beta-3 gene, a Beta5 gene, a TP53 gene or a promoter of the TP53 gene.
4. The system as claimed in claim 1-3, wherein: while the DNA is the VEGFA gene, the RNA-2 is the RNA as shown in at least one sequence of SEQ ID NO.9-12, SEQ ID NO.28 and SEQ ID NO.29; while the DNA is the Oct4 gene, the RNA-2 is the RNA as shown in at least one sequence of SEQ ID NO.13-15; while the DNA is the EMX1 gene, the RNA-2 is the RNA as shown in at least one sequence of SEQ ID NO.16-19; while the DNA is the 13 thalassemia gene, the RNA-2 is the RNA as shown in SEQ ID NO. 20-22; while the DNA is the TP53 gene, the RNA-2 is the RNA as shown in SEQ ID NO.23 and/or 24; and while the DNA is the promoter of the TP53 gene, the RNA-2 is the RNA as shown in at least one sequence of SEQ ID NO.25-27.
5. The system as claimed in claims 1-4, wherein the system further comprises Cas9 nuclease or a biological material related to the Cas9 nuclease; and the biological material related to the Cas9 nuclease is any one of the following C1) to C7): C1) a nucleic acid molecule for encoding the Cas9 nuclease; C2) an expression cassette containing the nucleic acid molecule of C1); C3) a recombinant vector containing the nucleic acid molecule of C1), or a recombinant vector containing the expression cassette of C2); C4) a recombinant microorganism containing the nucleic acid molecule of C1), or a recombinant microorganism containing the expression cassette of C2), or a recombinant microorganism containing the recombinant vector of C3); and C5) a cell line containing the nucleic acid molecule of C1), or a cell line containing the expression cassette of C2).
6. The system as claimed in claim 5, wherein the Cas9 nuclease is derived from R1) or R2): R1) bacteria; and R2) Streptococcus, Staphylococcus, Rothia, Neisseria, Corynebacterium or Lactobacillus.
7. The following O1) or O2): O1) the RNA-2 or a biological material related to the RNA-2 as claimed in any one of claims 1-4; and O2) the RNA-1 or a biological material related to the RNA-1 as claimed in any one of claims 1-3.
8. Any one of the following applications: X1. Use of the ncrRNA as claimed in any one of claims 1-4 in preparing the crRNA; X2. Use of the ncrRNA as claimed in any one of claims 1-4 in DNA editing; X3. Use of the ncrRNA as claimed in any one of claims 1-4 in preparing a DNA editing product; X4. Use of the RNA-1 as claimed in any one of claims 1-3 in serving as tracrRNA; X5. Use of the RNA-1 or the biological material related to the RNA-1 as claimed in any one of claims 1-3 in DNA editing; X6. Use of the RNA-1 or the biological material related to the RNA-1 as claimed in any one of claims 1-3 in preparing a DNA editing product; X7. Use of the RNA-2 as claimed in any one of claims 1-4 in serving as crRNA; X8. Use of the RNA-2 or the biological material related to the RNA-2 as claimed in any one of claims 1-4 in DNA editing; X9. Use of the RNA-2 or the biological material related to the RNA-2 as claimed in any one of claims 1-4 in preparing a DNA editing product; X10. Use of the system as claimed in any one of claims 1-6 in DNA editing; X11. Use of the system as claimed in any one of claims 1-6 in interfering gene expression in-vivo or in-vitro; and X12. Use of the system as claimed in any one of claims 1-6 in establishing animal, plant or cell models of which the DNA is edited.
9. A method for editing DNA, comprising: processing the DNA to realize the DNA editing with the system as claimed in any one of claims 1-6.
10. A preparation method for the system as claimed in any one of claims 1-6, comprising independently packaging each substance in the system.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0133]
[0134]
[0135]
[0136]
[0137]
[0138]
[0139]
[0140]
[0141]
[0142]
[0143]
[0144]
[0145]
[0146]
[0147]
[0148]
[0149]
[0150]
[0151]
[0152]
DETAILED DESCRIPTION OF THE EMBODIMENTS
[0153] The present invention is further described in detail below in combination with specific implementation modes, provided embodiments are only used for illuminating the present invention, but not intended to limit a scope of the present invention. Experiment methods in the following embodiments are conventional methods unless otherwise specified. Materials, reagents, instruments and the like used in the following embodiments may be obtained from a business approach unless otherwise specified. Quantitative tests in the following embodiments set three times of a repeated experiment, and a result is taken from an average value.
TABLE-US-00001 TABLE 1 reagent source Name Source Article number THP-1 cell ATCC THP-1 (ATCC ® TIB-202<TM>) 293T cell ATCC PTA-554 HeLa cell ATCC HeLa (ATCC ®CCL-2 ™) HUVEC cell ATCC HUVEC (ATCC ®CRL-1730 ™) C2C12 mouse ATCC C2C12 (ATCC ® CRL-1772 ™) myoblast DMEM culture GIBCO C11995 medium Opti-MEM culture GIBCO 31985-070 medium Phusion High-Fidelity Thermo F-530L DNA Polymerase Fisher Scientific Blood/tissue/cell TIANGEN DP304 genome extracting kit Lipofectamine2000 Thermo 12566014 Fisher Scientific TurboFect in-vivo Thermo R0541 Transfection Reagent Scientific T7EI endonuclease NEB M0302L Cas9 nuclease NEB M0386M 10 × Cas9 buffer NEB M0386M pX260 Addgene Plasmid: #42229
[0154] Herein, a sequence of Cas9 nuclease is a sequence as shown in Genbank ID: AQM52323.1 on the NCBI. The protein is derived from Streptococcus pyogenes.
[0155] A Cas9-293T cell, a Cas9-HeLa cell, a Cas9-THP-1 cell and a Cas9-HUVEC cell in the following embodiments are the cells obtained by respectively importing an encoding gene of Cas9 to the 293T cell, the HeLa cell, the THP-1 cell and the HUVE cell by using a Genome-TALER™ & Genome-CRISPR™ human AAVS1 Safe Harbor gene knock-in kit (Catalog #SH-AVS-K100) of the Guangzhou Yijing bio-technology Co., Ltd.
TABLE-US-00002 TABLE 2 primer sequence table Primer sequence(5′-3′) VEGFA-F1 TGCCGCTCACTTTGATGTCT VEGFA-R1 GAGCCTCAGCCCCTCCA VEGFA-F3 ATGGCACATTGTCAGAGGGA VEGFA-R3 GGGAGCAGGAAAGTGAGGTTA VEGFA-outer-F1 GGTCAGAGAGAGCGCGCGGG (mouse) VEGFA-outer-R1 GGGCACGACCGCTTACCTTGG (mouse) VEGFA-inner-F1 GACCAGTCGCGCTGACGGACAGA (mouse) VEGFA-inner-R1 CGCGGCTCGCGCTCCCTCT (mouse) Oct4-outer-F1 CTTCTGAGACATGATGCTCTTCCT Oct4-outer-R1 TCATGGGTGAGGGTAGTCTG 0ct4-inner-F1 CATCCCTTGGATGTGCCAGT 0ct4-inner-R1 TTAGAGGGGAGATGCGGTCA E1-1R/2F-WF/NF TGCGTGTCAAGGAATGGAGAG E1-1R/2F-WR GACAGCCTTTCCAGTGATTCAG E1-1R/2F-NR AGGCTCTAAAGACGGGCTTGAC E1-e3F-NF TCAGGAGGCCCAACCCAGAT E1-e3F-NR ACACGCAGAAGCAGCCTGAC E1-7-F-NF CTGGGCCTGGTGGGAAATAG E1-7-F-NR GTAAGGTCCGCCGAAGAAAG E1-e3F-WF TTTCGGAGCAGTCGAGTG E1-e3F-WR GTCTGAAGCTGCGACCTTG E1-7-F-WF CTGGCTTTGCTGCTGTTCCTG E1-7-F-WR GCAGTTAGAACAGCCCAGCTAGT Beta-outer-F1 CTGAGACTTCCACACTGATGC Beta-outer-R1 GCATATTCTGGAGACGCAGGA Beta3-inner-F1 TGGTGTCTGTTTGAGGTTGCTA Beta3-inner-R1 CATATTCTGGAGACGCAGGAAGA Beta5-inner-F1 AAACATCAAGCGTCCCATAGA Beta5-inner-R1 ACTGTGTTCACTAGCAACCTCA TP53-outer-FP GGGTGTGATATTACGGAAAGCC TP53-outer-RP TACACCCAGGTCTCCCAACA TP53-inner-FP CCAGCTGAGAGCAAACGCAA TP53-inner-RP AATACACGGAGCCGAGAGCC
Embodiment 1, Preparation of a CRISPR/Cas9 System Element for DNA Editing
[0156] The CRISPR/Cas9 system element for the DNA editing provided by the embodiment is crRNA and tracrRNA.
[0157] The crRNA is RNA as shown in a formula I:
Nx-ncrRNA The formula I:
[0158] wherein, N is any one of ribonucleotides and ribonucleotide modifier, the ribonucleotide is any one of A, U, C and G, and the ribonucleotide modifier is a substance obtained by performing 2′-O-methyl modification or cholesterol modification on A, U, C and G;
[0159] x is a number of N, and x is 20;
[0160] ncrRNA is any one of ncrRNA1, ncrRNA2, ncrRNA2y, ncrRNA3 and ncrRNA4;
[0161] ncrRNA1 is a RNA as shown in SEQ ID NO.1 of the sequence listing;
[0162] ncrRNA2 is a RNA as shown in SEQ ID NO.2 of the sequence listing;
[0163] ncrRNA2y is a substance obtained by respectively performing the 2′-O-methyl modification on the 10-th, 11-th and 13-th nucleotides starting from the 5′-terminal of the ncrRNA2;
[0164] ncrRNA 3 is a RNA as shown in SEQ ID NO.3 of the sequence listing;
[0165] ncrRNA 4 is a RNA as shown in SEQ ID NO.4 of the sequence listing;
[0166] tracrRNA is tracrRNA1, tracrRNA2, tracrRNA3 and tracrRNA4;
[0167] tracrRNA1 is a RNA as shown in SEQ ID NO.5 of the sequence listing;
[0168] tracrRNA2 is a RNA as shown in SEQ ID NO.6 of the sequence listing;
[0169] tracrRNA3 is a RNA as shown in SEQ ID NO.7 of the sequence listing; and
[0170] tracrRNA4 is a RNA as shown in SEQ ID NO.8 of the sequence listing.
[0171] In the sequence listing, the first site of each sequence is the 5-terminal of the sequence.
Embodiment 2, Effect of Different ncrRNA Lengths on DNA Editing Efficiency
[0172] I, In-Vitro Enzyme Digestion Detection
[0173] 1, DNA Template Preparation
[0174] The 293T cell genomic DNA is used as a template, Phusion enzyme (namely Phusion High-Fidelity DNA Polymerase) is used for performing secondary PCR amplification to obtain a vascular endothelial growth factor A (VEGFA) target gene fragment, namely the DNA template. The primer used for the first PCR amplification is VEGFA-F1/VEGFA-R1, the second PCR amplification is performed through using the first PCR amplification product as the template, using VEGFA-F3/VEGFA-R3 as primers, and a length of a second PCR amplification product (namely the DNA template) is 485 bp.
[0175] 2, Cas9 In-Vitro Enzyme Digestion
[0176] Cas9 nuclease, 10×Cas9 buffer, crRNA, tracrRNA and H.sub.2O are uniformly mixed, and incubated at 37 DEG C. for 15 min, then the DNA template of the step 1 is added, after uniformly mixed, the incubation is performed for 70 min at 37 DEG C., and the reaction system is specifically as shown in Table 3. The H.sub.2O for replacing crRNA is used as a negative control (neg.). Herein, crRNA is VEGFA-crRNA1, VEGFA-crRNA2, VEGFA-crRNA3 and VEGFA-crRNA4, one crRNA for each reaction system. The structural formula of the VEGFA-crRNA1, the VEGFA-crRNA2, the VEGFA-crRNA3 and the VEGFA-crRNA4 is as shown in the formula I of the embodiment 1, the Nx part is the same, ncrRNA is respectively ncrRNA1, ncrRNA2, ncrRNA3 and ncrRNA4, a sequence of the Nx is 5′-CCACAGGGAAGCUGGGUGAA-3′, the sequence is complemented with a partial sequence of VEGFA gene; and tracrRNA is the tracrRNA2 of the embodiment 1.
TABLE-US-00003 TABLE 3 in-vitro enzyme digestion reaction system of Cas9 Final Reagent Volume concentration Cas9 nuclease (1.2 μM) 2.5 μl 100 nM 10 × Cas9Buffer 3 μl 1× crRNA(4 μM) 3 μl 400 nM tracrRNA(4 μM) 3 μl 400 nM DNA template 2 μl(192 ng) 20 nM H.sub.2O 16.5 μl — Total 30 μl —
[0177] 3, Magnetic Beads Purification
[0178] 1) 30 μl of an enzyme digestion product of the step 2 is transferred to an EP tube;
[0179] 2) Twice the volume of magnetic beads is uniformly mixed with a sample in the EP tube by vortex oscillation, static-standing for 5-10 min;
[0180] 3) The EP tube is placed on a magnetic force frame, after the magnetic beads are totally adhered to a side wall, supernatant is absorbed;
[0181] 4) 200 μl of 80% (percentage by volume) ethyl alcohol water solution is added to the EP tube, and the magnetic beads are eluted;
[0182] 5) The supernatant is absorbed, static-standing for 3-5 min at room temperature, while the magnetic beads adhered to the wall are dried until a crack occurs, 20 μl of water is added for dissolving;
[0183] 6) After the water is added, the EP tube is taken out from the magnetic force frame, and static-standing for 3-5 min;
[0184] 7) The EP tube is placed back to the magnetic force frame, and the supernatant is the recycled sample namely.
[0185] 4, Agilent2200 nucleic acid automatic electrophoresis system detection 1-2 μl of the sample and dye in equal volume are taken and detected on the machine.
[0186] 5, Enzyme Digestion Result
[0187] (1) Calculating Method
[0188] A DNA fragment distribution and concentration result is obtained through the Agilent2200 nucleic acid automatic electrophoresis system detection, and enzyme digestion efficiency is obtained through a calculating formula.
[0189] The calculating formula: Indel % (enzyme digestion efficiency)=100×√{square root over ((1−f(cut)))} %
[0190] f(cut)=(b+c)/(a+b+c):a is the mole concentration (pmol/l) of an undigested fragment, b and c are the mole concentration (pmol/l) of digested fragments.
[0191] (2) Result Analysis
[0192]
[0193] II, Cas9 Intracellular Enzyme Digestion Detection
[0194] 1, Cell Transfection
[0195] (1) In culture conditions of 37 DEG C. and 5% of CO.sub.2, Cas9-293T cells are cultured in a culture box with a DMEM culture medium containing 10% of fetal calf serum. Herein, the Cas9-293T cells are stably imported with the Cas9 nuclease encoding gene through gene editing, and the Cas9 nuclease (sequence is a sequence shown in Genbank ID: AQM52323.1 on the NCBI) is expressed.
[0196] (2) In the day before transfection, the Cas9-293T cells for stably expressing the Cas9 nuclease are laid in a 24-pore plate.
[0197] (3) Cell density is adjusted to be about 4×10.sup.4-5×10.sup.4 cells/mL, and lipo2000 (Lipofectamine2000) is used for transfecting the crRNA and the tracrRNA. Herein, the crRNA is the VEGFA-crRNA1, VEGFA-crRNA2, VEGFA-crRNA and VEGFA-crRNA4 of the step I, one type of the crRNA in each reaction system, and the tracrRNA is the tracrRNA2 of the embodiment 1. H.sub.2O for replacing the crRNA is used as a negative control (neg.). The method specifically includes the following steps:
[0198] A. 50 μl of a opti-MEM culture medium is taken and placed in 1.5 mL of the EP tube, 1 μl of the lipo2000 is added, gently mixing, and static-standing for 5 min at room temperature;
[0199] B. 50 μl of the opti-MEM culture medium is taken and placed in 1.5 mL of the EP tube, 200 ng of the crRNA and 300 ng of the tracrRNA are added, adequately mixing;
[0200] C. solutions obtained in the steps A and B are mixed, and static-standing for 20 min at room temperature;
[0201] D. a part of the culture medium in the 24-pore culture plate in the step (1) is absorbed, the residual culture medium in pores is about 300 μl, and the solution obtained in the step C is added to the culture pores for uniformly mixing; and
[0202] E. after 3-6 h, the DMEM culture medium containing 10% of the fetal calf serum is replenished to the culture pores until 1 ml, and the cells are placed back to the culture box for culturing for 48 h, then the cell genomic DNA is extracted.
[0203] 2, Cell Genomic DNA Extraction
[0204] (1) The DNA is extracted according to a specification of a TIANGEN blood/tissue/cell genomic DNA extracting kit.
[0205] (2) The DNA extracting effect is detected by agarose gel electrophoresis and DNA concentration and purity are tested.
[0206] 3, Nested PCR Amplification of the Target DNA Fragment
[0207] (1) Nested PCR Amplification
[0208] The VEGFA target gene is amplified using Phusion enzyme. The primer used for the first PCR amplification is VEGFA-F1/VEGFA-R1, and the second PCR amplification is performed using the first PCR amplification product as the template, and using the primer VEGFA-F3/VEGFA-R3
[0209] (2) The product of the second PCR obtained in the step (1) is annealed, and an annealing product is directly used for the next step of enzyme digestion.
[0210] An annealing system is as follows, herein buffer2 is T7 Endonuclease I (NEB, article number: M0302L):
TABLE-US-00004 PCR product 5 μl buffer2 2 μl H.sub.2O 12 μl
[0211] An annealing reaction is performed on a PCR instrument, and annealing conditions are as follows:
TABLE-US-00005 95 DEG C. 5 min 95 DEG C. to 85 DEG C. 2 DEG C./circulating 85 DEG C. to 25 DEG C. 0.1 DEG C./circulating
[0212] 4, T7EI Enzyme Digestion Efficiency Detection
[0213] The annealing product in the step 3 is enzymatic-digested by using NEB T7 endonuclease I (T7E1), after incubation at 37 DEG C. for 40 min, 1 μl of protease K is added, and the incubation is performed for 5 min at 37 DEG C.
[0214] Enzyme Digestion System (20 μl):
TABLE-US-00006 Annealing product 19 μl T7EI 1 μl
[0215] 5, Electrophoresis Detection
[0216] An enzyme digestion sample is used for detection with the Agilent2200 nucleic acid automatic electrophoresis system.
[0217] 6, Enzyme Digestion Result
[0218] (1) The calculating method is the same as the step I.
[0219] (2) Analysis
[0220] The result is shown in
Embodiment 3, Effect of Different tracrRNA Lengths on DNA Editing Efficiency
[0221] I, In-Vitro Enzyme Digestion Detection
[0222] 1, Method
[0223] According to the method in the step I of the embodiment 2, while crRNA is VEGFA-crRNA5, and tracrRNA is respectively tracrRNA1, tracrRNA2, tracrRNA3 and tracrRNA4 of the embodiment 1, the enzyme digestion efficiency of an in-vitro enzyme digestion system including the crRNA, tracrRNA and Cas9 is respectively detected, each reaction system includes one tracrRNA, and water for replacing tracrRNA is used as a negative control (neg.).
[0224] Herein, the sequence of the VEGFA-crRNA5 is UGACUGCCGUCUGCACACCC GUUUUAGAGCUAUG (SEQ ID NO.28).
[0225] 2, Result
[0226] Through a DNA fragment distribution and concentration result (
[0227] II, Intracellular Enzyme Digestion Detection
[0228] 1, Method
[0229] According to the method in the step II of the embodiment 2, while the crRNA is the VEGFA-crRNA5 in the step I, and the tracrRNA is respectively the tracrRNA1, the tracrRNA2, the tracrRNA3 and the tracrRNA4 of the embodiment 1, the enzyme digestion efficiency of Cas 9 is respectively detected, each reaction system includes one tracrRNA, and the water for replacing the tracrRNA is used as the negative control (neg.).
[0230] 2, Result
[0231] Through a DNA fragment distribution and concentration result (
Embodiment 4, Enzyme Digestion Detection of Different Modifications
[0232] I, In-Vitro Enzyme Digestion Detection
[0233] 1, Method
[0234] The 293T cell genome is used as a template for amplifying a target gene VEGFA fragment, the specific method is the same as the embodiment 1.
[0235] According to the method of the step I of the embodiment 2, while crRNA respectively is VEGFA-crRNA2-1 and VEGFA-crRNA2-2, and tracrRNA is the tracrRNA2 of the embodiment 1, the enzyme digestion efficiency of an in-vitro enzyme digestion system including the crRNA, tracrRNA and Cas9 is respectively detected, each reaction system includes one crRNA. The VEGFA-crRNA2 of the embodiment 2 is used as a control, and H.sub.2O for replacing crRNA is used as a negative control (neg.).
[0236] Herein, the VEGFA-crRNA2-1 is a substance obtained by performing 2′-O-methyl modification on the 2nd site, the 30th site, the 31st site and the 33rd site of the crRNA5 of the embodiment 3, details are as follows:
[0237] UGmACUGCCGUCUGCACACCCGUUUUAGAGCmUmAUmG, m represents the 2′-O-methyl modification; and
[0238] the VEGFA-crRNA2-2 is a substance obtained by performing cholesterol modification on crRNA2, details are as follows:
[0239] Chol-UGACUGCCGUCUGCACACCCGUUUUAGAGCUAUG, Chol represents the cholesterol modification.
[0240] 2, Result
[0241] Through a DNA fragment distribution and concentration result obtained by Agilent2200 nucleic acid automatic electrophoresis system detection, it is known from
[0242] II, Intracellular Enzyme Digestion Detection
[0243] 1, Method
[0244] According to the method of the step II of the embodiment 2, while the crRNA respectively is the VEGFA-crRNA2-1 and the VEGFA-crRNA2-2 of the step I, and the tracrRNA is the tracrRNA2 of the embodiment 1, the enzyme digestion efficiency of the Cas9 is respectively detected, and each reaction system includes one crRNA. The VEGFA-crRNA2 of the embodiment 2 is used as a control, and H.sub.2O for replacing the crRNA is used as a negative control (neg.).
[0245] 2, Result
[0246] Through the DNA fragment distribution and concentration result obtained by Agilent2200 nucleic acid automatic electrophoresis system detection, it is known from
Embodiment 5, Enzyme Digestion Detection of Different Cell Lines
[0247] 1, Method
[0248] According to the method in the step II of the embodiment 2, the Cas9-293T cell is respectively replaced by the Cas9-HeLa cell, the Cas9-THP-1 cell and the Cas9-HUVEC cell, the other steps are not changed, the effect of the different cell lines to the Cas9 enzyme digestion efficiency is detected, and each reaction system includes one type of the cell. Used crRNA is the VEGFA-crRNA2 of the embodiment 2, and tracrRNA is the tracrRNA2 of the embodiment 1, H.sub.2O for replacing tracrRNA is used as a negative control (neg.).
[0249] 2, Result
[0250] Through a DNA fragment distribution and concentration result obtained by Agilent2200 nucleic acid automatic electrophoresis system detection, it is known from
Embodiment 6, Enzyme Digestion Efficiency Detection of Different Genes
[0251] Target gene: an organic cation/carnitine transporter 4 (Oct4) gene, an Empty spiracles homeobox 1 (EMX1) gene, a Beta-3 gene and a Beta-5 gene, herein both the Beta-3 and the Beta-5 are a β thalassemia gene, the Beta-3 gene contains a β thalassemia gene mutation site CD17 (HBB:c.52A>T), and the Beta-5 gene contains the β thalassemia gene mutation site CD17 (HBB:c.52A>T).
[0252] crRNA used for the Oct4 gene is Oct4-E-T1-crRNA, Oct4-E-T2-crRNA and Oct4-E-T3-crRNA, and tracrRNA is the tracrRNA2 of the embodiment 1. A structure of the crRNA is as shown in the formula I of the embodiment 1, the ncrRNA part of each crRNA is the same, and is the ncrRNA2 of the embodiment 1, Nx parts are different, and a sequence of each crRNA is as follows:
TABLE-US-00007 Oct4-E-T1-crRNA: (SEQ ID NO. 13) GGUUAUUUCUAGAAGUUAGG GUUUUAGAGCUAUG Oct4-E-T2-crRNA: (SEQ ID NO. 14) CUUCUACAGACUAUUCCUUG GUUUUAGAGCUAUG Oct4-E-T3-crRNA: (SEQ ID NO. 15) GGAAAGGGGAGAUUGAUAAC GUUUUAGAGCUAUG.
[0253] The crRNA used for the EMX1 gene is E1R-crRNA, E7F-crRNA, Ee3F-crRNA and E2F-crRNA, the tracrRNA is the tracrRNA2 of the embodiment 1. The structure of the crRNA is as shown in the formula I of the embodiment 1, the ncrRNA part of each crRNA is the same, and is the ncrRNA2 of the embodiment 1, the Nx parts are different, and the sequence of each crRNA is as follows:
TABLE-US-00008 E1R-crRNA: (SEQ ID NO. 16) AAGGCCGUGCGGAUCCGCUU GUUUUAGAGCUAUG E7F-crRNA: (SEQ ID NO. 17) AGGUCCGACGUGUUGGAGUG GUUUUAGAGCUAUG Ee3F-crRNA: (SEQ ID NO. 18) CGAUGUCACCUCCAAUGACU GUUUUAGAGCUAUG E2F-crRNA: (SEQ ID NO. 19) UCUCGCCCUCGCAGCUGCUG GUUUUAGAGCUAUG.
[0254] The crRNA used for the Beta-3 gene is Beta-3-T1-crRNA and Beta-3-T3-crRNA, the tracrRNA is the tracrRNA2 of the embodiment 1. The structure of the crRNA is as shown in the formula I of the embodiment 1, the ncrRNA part of each crRNA is the same, and is the ncrRNA2 of the embodiment 1, the Nx parts are different, and the sequence of each crRNA is as follows:
TABLE-US-00009 Beta-3-T1-crRNA: (SEQ ID NO. 20) GUGUGGCAAAGGUGCCCUUG GUUUUAGAGCUAUG. Beta-3-T3-crRNA: (SEQ ID NO. 21) ACCAAUAGAAACUGGGCAUG GUUUUAGAGCUAUG.
[0255] The crRNA used for the Beta-5 gene is Beta-5-T3-crRNA, the tracrRNA is the tracrRNA2 of the embodiment 1. The structure of the crRNA is as shown in the formula I of the embodiment 1, and the sequence is as follows:
TABLE-US-00010 Beta-5-T3-crRNA: (SEQ ID NO. 22) CGUAAAUACACUUGCAAAGG GUUUUAGAGCUAUG.
[0256] I, In-Vitro Enzyme Digestion Detection
[0257] 1, DNA Template Preparation
[0258] The 293T cell genome is used as a template to amplify fragments of the target gene of Oct4 gene, EMX1 gene, Beta-3 gene and Beta-5 gene, that is, a DNA template.
[0259] The primers used for the first amplification of the Oct4 gene DNA template are Oct4-outer-F1 and Oct4-outer-R1, and primers used for the second amplification are Oct4-inner-F1 and Oct4-inner-R1.
[0260] The EMX1 gene DNA template is EMX1-E2F, EMX1-E1R, EMX1-E7F and EMX1-Ee3F, the primer used for each template is as follows:
[0261] EMX1-E2F: the primers used for the first amplification of the DNA template are E1-1R/2F-WF/NF and E1-1R/2F-WR, and the primers used for the second amplification are E1-1R/2F-WF/NF and E1-1R/2F-NR.
[0262] EMX1-E1R: the primers used for the first amplification of the DNA template are E1-1R/2F-WF/NF and E1-1R/2F-WR, and the primers used for the second amplification are E1-1R/2F-WF/NF and E1-1R/2F-NR.
[0263] EMX1-E7F: the primers used for the first amplification of the DNA template are E1-7-F-WF and E1-7-F-WR, and the primers used for the second amplification are E1-7-F-NF and E1-7-F-NR.
[0264] EMX1-Ee3F: the primers used for the first amplification of the DNA template are E1-e3F-WF and E1-e3F-WR, and the primers used for the second amplification are E1-e3F-NF and E1-e3F-NR.
[0265] The primers used for the first amplification of the Beta-3 gene DNA template are Beta-outer-F1 and Beta-outer-R1, the primers used for the second amplification are Beta3-inner-F1 and Beta3-inner-R1.
[0266] The primers used for the first amplification of the Beta-5 gene DNA template are Beta-outer-F1 and Beta-outer-R1, the primers used for the second amplification are Beta5-inner-F1 and Beta5-inner-R1.
[0267] 2, Cas9 In-Vitro Enzyme Digestion
[0268] According to the methods 2-5 in the step I of the embodiment 2, an in-vitro enzyme digestion system containing crRNA, tracrRNA and Cas9 is used for performing enzyme digestion on each DNA template of the step 1, and each reaction system includes one crRNA. H.sub.2O for replacing crRNA is used as a negative control (neg).
[0269] 2.1 Oct4 Gene
[0270] The enzyme digestion efficiency of the in-vitro enzyme digestion system of Cas9 is detected in different concentration (200 nM, 400 nM and 800 nM) of Oct4-E-T1-crRNA, concentration of tracrRNA in each system is different along with different crRNA concentration, the concentration of the tracrRNA in the same reaction system is kept to be the same as the crRNA concentration, concentration of other substances is the same as Table 3.
[0271] It is displayed from the result that while the concentration of the Oct4-E-T1-crRNA is 200 nM, 400 nM and 800 nM, the Cas9 can digest the Oct4 gene DNA template (
[0272] 2.2 EMX1 Gene
[0273] The enzyme digestion efficiency of the in-vitro enzyme digestion EMX1 gene DNA template of the Cas9 of different crRNAs (E1R-crRNA, E7F-crRNA, Ee3F-crRNA and E2F-crRNA) is detected, the crRNA corresponding to the EMX1 gene DNA template EMX1-E2F, EMX1-E1R, EMX1-E7F and EMX1-Ee3F respectively is E2F-crRNA, E1R-crRNA, E7F-crRNA and Ee3F-crRNA, and each system is the same as Table 3.
[0274] It is displayed from the result that the different crRNAs can digest the EMX1 gene DNA template (
[0275] 2.3 Beta-3 Gene and Beta-5 Gene
[0276] The enzyme digestion efficiency of the in-vitro enzyme digestion Beta-3 gene DNA template of the Cas9 in the presence of Beta-3-T1-crRNA and Beta-3-T3-crRNA is detected, and the enzyme digestion efficiency of the in-vitro enzyme digestion Beta-5 gene DNA template of the Cas9 in the presence of Beta-5-T3-crRNA is detected.
[0277] It is displayed from the result that in the presence of Beta-3-T1-crRNA and Beta-3-T3-crRNA, the Cas9 can digest the Beta-3 gene DNA template, and in the presence of Beta-5-T3-crRNA, the Cas9 may digest Beta-5 gene DNA template (
[0278] II, Intracellular Enzyme Digestion Detection
[0279] According to the method in the step II of the embodiment 2, the enzyme digestion efficiency of Cas9 nuclease to the Oct4 gene, the EMX1 gene, the Beta-3 gene and the Beta-5 gene is detected, and each reaction system includes one crRNA. H.sub.2O for replacing crRNA is used as a negative control (neg.).
[0280] The crRNA used for the Oct4 gene is Oct4-E-T1-crRNA, Oct4-E-T2-crRNA and Oct4-E-T3-crRNA, and the method is the same as the step II of the embodiment 2. In a nested PCR amplification of the target DNA fragment, the primers used for the Oct4 gene are as follows: the primers used for the first amplification are Oct4-outer-F1 and Oct4-outer-R1, and the primers used for the second amplification are Oct4-inner-F1 and Oct4-inner-R1. It is displayed from the result that in the presence of different crRNAs, Cas9 nuclease can digest the Oct4 gene (
[0281] The crRNA used for the EMX1 gene is Ee3F-crRNA, a dosage of the Ee3F-crRNA respectively is 50 ng, 100 ng, 200 ng and 400 ng, concentration of tracrRNA in the same reaction system is kept to be the same as crRNA concentration, a dosage of other substances and a method are the same as the step II of the embodiment 2. In the target DNA fragment of the nested PCR amplification, the primers used for the EMX1 gene are as follows: the primers used for the first amplification are E1-e3F-WF and E1-e3F-WR, and the primers used for the second amplification are E1-e3F-NF and E1-e3F-NR. It is displayed from the result that under the dosages of different crRNAs, the Cas9 nuclease can digest the EMX1 gene (
[0282] The crRNA used for the Beta-3 gene is Beta-3-T1-crRNA and Beta-3-T3-crRNA, the crRNA used for the Beta-5 gene is Beta-5-T3-crRNA, and the methods are the same as the step II of the embodiment 2. In the target DNA fragment of the nested PCR amplification, the primers used for the Beta-3 gene are as follows: the primers used for the first amplification are Beta-outer-F1 and Beta-outer-R1, and the primers used for the second amplification are Beta3-inner-F1 and Beta3-inner-R1; and the primers used for the Beta-5 gene are as follows: the primers used for the first amplification are Beta-outer-F1 and Beta-outer-R1, and the primers used for the second amplification are Beta5-inner-F1 and Beta5-inner-R1. It is displayed from the result that in the presence of the Beta-3-T1-crRNA and Beta-3-T3-crRNA, the Cas9 nuclease can digest the Beta-3 gene, and in the presence of the Beta-5-T3-crRNA, the Cas9 nuclease can digest the Beta-5 gene (
Embodiment 7, Mouse Genome VEGFA Gene Enzyme Digestion Detection
[0283] I, Intracellular Enzyme Digestion Detection
[0284] According to the method in the step II of the embodiment 2, the Cas9-293T cell is replaced by the C2C12 mouse myoblast containing Cas9, other steps are not changed, the effect of Cas9 on enzyme digestion efficiency of VEGFA gene in C2C12 mouse myoblast containing Cas9 is detected, used crRNA is a modified VEGFA-crRNA6, namely VEGFA-crRNA6-1, and tracrRNA is the tracrRNA2 of the embodiment 1. H.sub.2O for replacing crRNA is used as a negative control (neg.).
TABLE-US-00011 VEGFA-crRNA6: (SEQ ID NO. 29) AAGAGGAGAGGGGGCCGCAG GUUUUAGAGCUAUG.
[0285] The VEGFA-crRNA6-1 is a substance obtained by performing 2′-O-methyl modification on the 2nd site, the 30th site, the 31st site and the 33rd site of the VEGFA-crRNA6, and details are as follows:
[0286] AAmGAGGAGAGGGGGCCGCAG GUUUUAGAGCmUmAUmG, m represents the 2′-O-methyl modification.
[0287] A preparation method for the C2C12 mouse myoblast containing the Cas9 is as follows:
[0288] 1, Transfecting Plasmid PX260 by Lipo2000
[0289] (1) 50 μl of an opti-MEM culture medium is taken and placed in 1.5 ml of an EP tube, 1 μl of the lipo2000 is added, after uniformly mixing, static-standing for 5 min at room temperature;
[0290] (2) 50 μl of the opti-MEM culture medium is taken and placed in 1.5 ml of the EP tube, 1 μg of the plasmid PX260 is added, and uniformly mixing;
[0291] (3) solutions obtained in steps (1) and (2) are mixed, static-standing for 20 min at room temperature; and
[0292] (4) a part of a culture medium in a 24-pore culture plate for culturing the C2C12 mouse myoblast is absorbed, the residual culture medium in pores is about 300-500 μl, the sample of the step (3) is added to the culture pores, after 3-6 h, a DMEM culture medium containing 10% of fetal calf serum is replenished to the culture pores until 1 ml, and the cells are placed back to a culture box for culturing.
[0293] 2, After transfecting the plasmid for 24 h, crRNA and tracrRNA are transfected with Lipo2000. The transfection method is the same as (3) of 1 in the step I of the embodiment 2.
[0294] II, C57bl/6 Mouse In-Vivo Enzyme Digestion Detection
[0295] 1, C57bl/6 Mouse In-Vivo Transfection:
[0296] (1) A C57bl/6 mouse (Beijing Charles River Labs) is injected with pentobarbital sodium for anesthesia: 30 mg/kg of intravenous or intraperitoneal injection.
[0297] (2) Preparation Mixing
[0298] 5 μg of a Cas9 plasmid (namely PX260), 4 μM of crRNA (20 μl) and 4 μM of tracrRNA (20 μl) are dissolved in 200 μl of normal saline, and oscillating and mixing uniformly. 6 μl of a transfection reagent (namely TurboFect in vivo Transfection Reagent) is added and mixed adequately. The above mixed solution is placed for 15-20 minutes at room temperature, and used as a transfection preparation for intramuscular injection. Used crRNA is a modified VEGFA-crRNA6, namely VEGFA-crRNA6-1, and tracrRNA is the tracrRNA2 of the embodiment 1.
[0299] 2.2 Mouse Intramuscular Injection
[0300] 200 μl of the transfection preparation in the step 2.1 is injected to mouse biceps.
[0301] 2.3 Mouse Muscular Tissue Genomic DNA Extraction
[0302] In the seventh day after transfecting, a blood/tissue/cell genome extracting kit is used for extracting biceps genome DNA.
[0303] 2.4 Nested PCR Amplification of the Target DNA Fragment
[0304] A method is the same as 3 in the step II of the embodiment 2. Primers used are VEGFA-outer-F1 (mouse), VEGFA-outer-R1 (mouse), VEGFA-inner-F1 (mouse) and VEGFA-inner-R1 (mouse).
[0305] 2.5 T7E1 Enzyme Digestion Efficiency Detection
[0306] NEB T7 endonuclease I(T7E1) is used for performing enzyme digestion, a specific method is the same as 4 in the step II of the embodiment 2.
[0307] 2.6 Electrophoresis Detection
[0308] An enzyme digestion sample is used for Agilent2200 nucleic acid automatic electrophoresis system detection.
[0309] 3, Result Analysis
[0310] A calculating method is the same as the embodiment 2.
[0311] Through a DNA fragment distribution and concentration result obtained by the Agilent2200 nucleic acid automatic electrophoresis system detection, it is known that in the mouse, the crRNA, tracrRNA and Cas9 plasmid are imported into a mouse cell or a mouse body, a target fragment of 526 bp of a target DNA can be digested into two DNA chains (
Embodiment 8, Promoter and Exon Enzyme Digestion Detection
[0312] The enzyme digestion efficiency of TP53 (tumor protein p53) gene and an exons is detected, the used crRNA respectively is TP53-P-T1, TP53-P-T2, TP53-E-T1, TP53-E-T2 and TP53-E-T3, each reaction system includes one crRNA, the used tracrRNA is the tracrRNA2 of the embodiment 1. H.sub.2O for replacing crRNA is used as a negative control (neg.). A sequence of the used crRNA is as follows:
TABLE-US-00012 TP53-P-T1: (SEQ ID NO. 23) CAAUUCUGCCCUCACAGCUC GUUUUAGAGCUAUG. TP53-P-T2: (SEQ ID NO. 24) CCCCAAAAUGUUAGUAUCUA GUUUUAGAGCUAUG. TP53-E-T1: (SEQ ID NO. 25) CCCUCCCAUGUGCUCAAGAC GUUUUAGAGCUAUG. TP53-E-T2: (SEQ ID NO. 26) UGGGAGCGUGCUUUCCACGA GUUUUAGAGCUAUG TP53-E-T3: (SEQ ID NO. 27) CCAGUCUUGAGCACAUGGGA GUUUUAGAGCUAUG.
[0313] (P represents the promoter, and E represents the exon).
[0314] I, In-Vitro Enzyme Digestion Detection
[0315] 1, DNA Template Preparation
[0316] The 293T cell genome is used as a template for amplifying a target gene TP53 fragment, namely a DNA template.
[0317] Primers used for the first amplification are TP53-outer-FP and TP53-outer-RP, and the primers used for the second amplification are TP53-inner-FP and TP53-inner-RP.
[0318] 2. Cas9 In-Vitro Enzyme Digestion
[0319] According to the methods of 2-5 in the step I of the embodiment 2, an in-vitro enzyme digestion system containing crRNA, tracrRNA and Cas9 is used for performing enzyme digestion on the DNA template in the step 1.
[0320] II, Intracellular Enzyme Digestion Detection
[0321] According to the method in the step II of the embodiment 2, the enzyme digestion efficiency of Cas9 nuclease to a TP53 fragment is detected. H.sub.2O for replacing crRNA is used as a negative control (neg.).
[0322] Through a DNA fragment distribution and concentration result obtained by Agilent2200 nucleic acid automatic electrophoresis system detection, it is known from
Embodiment 9, Enzyme Digestion Detection of Multiple crRNAs
[0323] I, In-Vitro Enzyme Digestion Detection
[0324] 1, Cas9 In-Vitro Enzyme Digestion
[0325] Cas9 nuclease, 10×Cas9 buffer, crRNA, tracrRNA and H.sub.2O are uniformly mixed, and incubated at 37 DEG C. for 15 min, after that, the DNA template is added and mixed uniformly, then the incubation is performed for 70 min at 37 DEG C. The H.sub.2O for replacing crRNA is used as a negative control (neg.). The DNA template is the Oct4 gene DNA template of the embodiment 6, crRNAs used are Oct4-E-T1-crRNA, Oct4-E-T2-crRNA and Oct4-E-T3-crRNA, and tracrRNA is the tracrRNA2 of the embodiment 1. A Cas9 in-vitro enzyme digestion system is as follows, the system contains three types of the crRNAs, namely Oct4-E-T1-crRNA, Oct4-E-T2-crRNA and Oct4-E-T3-crRNA:
TABLE-US-00013 Final Reagent Volume concentration Cas9 nuclease (1.2 μM) 2.5 μl 100 nM 10 × Cas9 Buffer 3 μl 1× crRNA(all are 4 μM) Oct4-E-T1-crRNA 1 μl 133.3 nM Oct4-E-T2-crRNA 1 μl 133.3 nM Oct4-E-T3-crRNA 1 μl 133.3 nM tracrRNA(4 μM) 3 μl 400 nM DNA template 2 μl 192 ng 20 nM H.sub.2O 16.9 μl — total 30 μl —
[0326] The Oct4-E-T2-crRNA is used alone as the crRNA for performing the experiment, as a comparison, a concentration of the Oct4-E-T2-crRNA is 400 nM.
[0327] 2, Magnetic Beads Purification
[0328] Same as 3 in the step I of the embodiment 2.
[0329] 3, Agilent2200 Nucleic Acid Automatic Electrophoresis System Detection
[0330] Same as 4 in the step I of the embodiment 2.
[0331] II, Intracellular Enzyme Digestion Detection
[0332] According to the method in the step II of the embodiment 2, the Oct4-E-T1-crRNA, the Oct4-E-T2-crRNA, the Oct4-E-T3-crRNA and the tracrRNA2 of the embodiment 1 are used for transfecting together, a dosage of the crRNA6 is 66.7 ng, and a dosage of the tracrRNA2 is 300 ng. The Oct4-E-T2-crRNA is used alone as the crRNA for performing the experiment, as a comparison, a dosage of the Oct4-E-T2-crRNA is 200 ng.
[0333] Through a DNA fragment distribution and concentration result obtained by the Agilent2200 nucleic acid automatic electrophoresis system detection, it is known from
Embodiment 10, Cell Enzyme Digestion Detection of Different Cas9 Donors
[0334] I, Cells for Stably Expressing Cas9
[0335] The Cas9 donor is a 293T cell for stably expressing Cas9, namely Cas9-293T, a specific method is the same as the step I of the embodiment 2. Used crRNA and tracRNA respectively are the crRNA2 of the embodiment 2 and the tracrRNA2 of the embodiment 1.
[0336] 2, Cas9 Plasmid
[0337] The Cas9 donor is a Cas9 plasmid (namely PX260).
[0338] 2.1 Transfecting Plasmid PX260 by Lipo2000
[0339] (1) 50 μl of an opti-MEM culture medium is taken and placed in 1.5 ml of an EP tube, 1 μl of the lipo2000 is added, after uniformly mixing, static-standing for 5 min at room temperature;
[0340] (2) 50 μl of the opti-MEM culture medium is taken and placed in 1.5 ml of the EP tube, 1 μg of the plasmid PX260 is added, and uniformly mixing;
[0341] (3) solutions obtained in steps (1) and (2) are mixed, static-standing for 20 min at room temperature; and
[0342] (4) a part of a culture medium in a 24-pore culture plate for culturing the 293T cell is absorbed, the residual culture medium in pores is about 300-500 μl, a sample of the step (3) is added to the culture pores, after 3-6 h, a DMEM culture medium containing 10% of fetal calf serum is replenished to the culture pores until 1 ml, and the cells are placed back to a culture box for culturing.
[0343] 2.2, After transfecting the plasmid for 24 h, crRNA and tracrRNA are transfected by the Lipo2000. A transfection method is the same as (3) of 1 in the step I of the embodiment 2. The used crRNA and tracRNA respectively are the crRNA2 of the embodiment 2 and the tracrRNA2 of the embodiment 1.
[0344] According to the method of 2-6 in the step Hof the embodiments, through a DNA fragment distribution and concentration result obtained by Agilent2200 nucleic acid automatic electrophoresis system detection, it is known from
Embodiment 11, In-Vitro Enzyme Digestion Detection of Different Cas9 Concentration
[0345] 1, Method
[0346] According to the method in the step I of the embodiment 2, the enzyme digestion efficiency of an in-vitro enzyme digestion system containing crRNA, tracrRNA and different concentration of Cas9 is respectively detected. The concentration of the Cas9 respectively is 20 nM, 100 nM, 200 nM and 400 nM, and content of other components is the same as the step I of the embodiment 2.
[0347] Used crRNA and tracRNA respectively are the VEGFA-crRNA2 of the embodiment 2 and the tracrRNA2 of the embodiment 1.
[0348] 2, Result
[0349] Through a DNA fragment distribution and concentration result (