KIT AND METHOD FOR DETECTING DROPLET DRIFT OR DEPOSITION CHARACTERISTICS OF SPRAY

Abstract

A kit is employed in the method for detecting droplet drift or deposition characteristics of spray. The detection kit includes detection membranes carrying immobilized probes, transition probes capable of specifically binding to the immobilized probes, and biotinylated chromogenic probes capable of specifically binding to the transition probes. The transition probes are added to the agricultural spray as tracers. After spraying, the sprayed transition probes specifically bind to the immobilized probes on the detection membranes. The biotinylated chromogenic probes are added to bind to the transition probes through hybridization. After the chromogenic treatment, the deposition volume of droplets is determined according to the color depth, and the droplet parameters are determined according to the position and size of chromogenic spots. The method can qualitatively detect the droplet drift or deposition distribution of spray, and to determine the droplet drift or deposition volume and the droplet coverage density and droplet size.

Claims

1. A method for detecting droplet drift or deposition characteristics of spray, comprising the following steps: adding transition probes as tracers to pesticide liquid or liquid fertilizer or other liquid formulations, after spraying, specifically binding the transition probes to the immobilized probes on the detection membranes, wherein the detection membranes are substrates carrying the immobilized probes, and detecting the transition probes on the detection membranes to determine the droplet drift or deposition of spray.

2. The method according to claim 1, wherein the transition probes and the immobilized probes are single-stranded deoxyribonucleic acids with characteristic sequences; the length of the immobilized probe is 12-25 nt; one end of the immobilized probe is amino-modified and covalently binds to an exposed carboxyl of the substrate.

3. The method according to claim 1, wherein the transition probes are not biotinylated.

4. The method according to claim 3, comprising the following steps: after the specific binding of the transition probes to the immobilized probes on the detection membranes, binding the chromogenic probes labeled with biotin to the transition probes through hybridization, performing chromogenic treatment, determining the droplet deposition volume according to the color depth, and determining the coverage rate and the amount of droplets according to the position and the size of chromogenic spots.

5. The method according to claim 4, wherein the complementary pairing region of the chromogenic probe and the transition probe is of 15-40 nt; if the immobilized probe is 5′-labeled, the chromogenic probe is 3′-biotinylated, and if the immobilized probe is 3′-labeled, the chromogenic probe is 5′-biotinylated.

6. The method according to claim 1, wherein the complementary pairing region of the transition probe and the immobilized probe is of 15-25 nt.

7. The method according to claim 1, wherein the detection membrane is prepared according to the following method: acquiring a substrate of a required area, treating the substrate with 0.1-0.3 M HCl, and washing; incubating the substrate in 10-20% EDC solution and washing; incubating the substrate in 0.3-1.0 M NaHCO.sub.3 solution containing 0.025-0.2 μM immobilized probe; and incubating the substrate in NaOH solution, washing and drying; wherein the carboxyl of the substrate is exposed.

8. The method according to claim 7, wherein the detection membrane is prepared according to the following method: acquiring a substrate of a required area, treating the substrate with 0.1 M HCl, and washing; incubating the substrate in 15% EDC for 0.5-1 h and washing; incubating the substrate in 0.5 M NaHCO.sub.3 solution containing 0.03 μM immobilized probe for 10-20 min; and incubating the substrate in 0.05-0.5 M NaOH solution for 5-15 min, washing and drying.

9. A kit for detecting droplet drift or deposition characteristics of spray, comprising detection membranes, transition probes and chromogenic probes, wherein the detection membrane is a substrate carrying the immobilized probes, one end of the immobilized probe is amino-modified, covalently binding to an exposed carboxyl of the substrate, and the substrate is carboxyl-exposed material; the 3′ or 5′ end of the chromogenic probe is labeled with biotin, and the chromogenic probe can specifically bind to the transition probe but cannot specifically bind to the immobilized probe; preferably, the length of the immobilized probe is 12-25 nt, and the length of the transition probe is 24-50 nt.

10. The kit according to claim 9 for detecting droplet drift or deposition characteristics of spray, further comprising a TMB (3,3′,5,5′-tetramethylbenzidine) single-component solution and streptavidin-labeled horseradish peroxidase.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0046] FIG. 1 is a schematic flow chart of the three-stage reverse dot blot for detecting the droplet deposition of spray.

[0047] FIG. 2 shows the result of the establishment of the standard curve according to the detection method of the present invention.

[0048] FIG. 3 shows the detection result of the sensitivity of the droplet drift of pesticide spray according to the detection method of the present invention.

[0049] FIG. 4A shows the result of the droplet amount of spray boom track system-simulated field spraying according to detection method of the present invention, and FIG. 4B shows the result of the coverage rate of droplets of spray boom track system-simulated field spraying according to detection method of the present invention.

[0050] FIG. 5 shows the result of the droplet deposition of spray boom track system-simulated field spraying according to detection method of the present invention.

[0051] FIG. 6 shows the detection results of the coverage rate, amount and deposition volume of the droplets per unit area after unmanned aerial vehicle (UAV) field spraying according to detection of the present invention.

[0052] FIG. 7 is a photograph of the arrangement of the detection membranes in the deposition distribution test on rice canopy in Example 6.

[0053] FIG. 8 shows the detection result of the spray droplet deposition in Example 6.

[0054] FIG. 9 is a photograph of the arrangement of the detection membranes in the deposit distribution test of cotton defoliant in Example 7.

[0055] FIG. 10 shows the detection result of the spray droplet deposition in Example 7.

[0056] FIG. 11 shows the detection result of spray droplet drift in an integrated rice-crayfish farming system in Example 8.

DETAILED DESCRIPTION

[0057] The present invention will be further illustrated below with reference to examples, which should not be construed as limiting the present invention. Modifications or substitutions to the methods, procedures or conditions of the present invention may be implemented without departing from the spirit and scope of the present invention.

[0058] Unless otherwise specified, the techniques used in the examples are conventional techniques well known to those skilled in the art.

Example 1: Establishment of Method for Detecting Droplet Drift or Deposition of Spray

[0059] In the present invention, “three-stage” reverse dot blot hybridization is adopted, and the process is shown in FIG. 1. Firstly, “immobilized probes” were immobilized on substrates by chemical bonding, then “transition probes” as tracers were added to pesticide, liquid fertilizer or other liquid formulations to be sprayed; and after spraying, complementary pairing of part of bases of the “immobilized probes” and the “transition probes” was performed to capture the “transition probes”. After the membrane was recovered, “chromogenic probes” labeled with biotin or enzyme were added to interact with the other part of bases of the “transition probes”. After the chromogenic reaction was catalyzed through the signal amplification of the enzyme, information such as the size, distribution, and coverage rate of droplets was observed. Finally, a digital image file was obtained by means such as photographing or scanning, the gray difference was read by an image processing software, and the spray droplet deposition was calculated according to the standard curve.

[0060] 1. Determination of Probes

[0061] The length of the immobilized probe was 12-25 nt, preferably 18-20 nt. One end of the immobilized probe was amino-modified, and the other end was covalently bound to an exposed carboxyl of the substrate.

[0062] The transition probe was a single-stranded deoxyribonucleic acid with a characteristic sequence of 24-50 nt (preferably 36-40 nt) without biotinylation. The complementary pairing region of the transition probe and the immobilized probe was of 15-25 nt.

[0063] The chromogenic probe was a single-stranded deoxyribonucleic acid with a characteristic sequence of 12-25 nt (preferably 18-20 nt). The complementary pairing region of the chromogenic probe and the transition probe was of 15-40 nt. If the immobilized probe was 5′-labeled, the chromogenic probe was 3′-biotinylated; and if the immobilized probe was 3′-labeled, the chromogenic probe was 5′-biotinylated.

[0064] The chromogenic probe could specifically bind to the transition probe but could not specifically bind to the immobilized probe. The sequences of three probes in Table 1 are exemplary probe sequences. In addition to the nucleotide sequences of the probes in Table 1, any single-stranded deoxyribonucleic acid sequence that satisfies the above requirements can be used for the techniques in the present invention.

TABLE-US-00001 TABLE 1 1 Immobilized probe 1 5′-NH.sub.2- ATCAAGAAGGTGGTGAA -3′ Transition probe 1 5′- TGCTCAGTGTAGCCCATTCACCACCTTCTTGAT -3′ Chromogenic probe 1 5′ TGGGCTACACTGAGCA -Biotin-3′ 2 Immobilized probe 1 5′-NH.sub.2- ATCAAGAAGGTGGTGAA -3′ Transition probe 1-2 5′- TGACTGCGAGTAGTAGCCATTCACCACCTTCTTGAT -3′ Chromogenic probe 2 5′ TGGCTACTACTCGCAGTCA -Biotin-3′ 3 Immobilized probe 1 5′-NH.sub.2- ATCAAGAAGGTGGTGAA -3′ Transition probe 1-3 5′- TCTCAGGTACCA TTCACCACCTTCTTGAT -3′ Chromogenic probe 3 5′ TGGTACCTGAGA -Biotin-3′ 4 Immobilized probe 2 5′-NH.sub.2-CCACCGTTTTTCCTCAG-3′ Transition probe 2 5′-TGCTCAGTGTAGCCCACTGAGGAAAAACGGTGG -3′ Chromogenic probe 1 5′ TGGGCTACACTGAGCA -Biotin-3′ 5 Immobilized probe 2 5′-NH.sub.2-CCACCGTTTTTCCTCAG-3′ Transition probe 2-2 5′- TGACTGCGAGTAGTAGCCACTGAGGAAAAACGGTGG -3′ Chromogenic probe 2 5′ TGGCTACTACTCGCAGTCA -Biotin-3′ 6 Immobilized probe 2 5′-NH.sub.2-CCACCGTTTTTCCTCAG-3′ Transition probe 2-3 5′- TCTCAGGTACCA CTGAGGAAAAACGGTGG -3′ Chromogenic probe 3 5′ TGGTACCTGAGA -Biotin-3′ 7 Immobilized probe 3 5′-NH.sub.2-ATCTTAAATCGCAAGGT-3′ Transition probe 3 5′- TGCTCAGTGTAGCCCAACCTTGCGATTTAAGAT -3′ Chromogenic probe 1 5′ TGGGCTACACTGAGCA -Biotin-3′ 8 Immobilized probe 3 5′-NH.sub.2-ATCTTAAATCGCAAGGT-3′ Transition probe 3-2 5′- TGACTGCGAGTAGTAGCCAACCTTGCGATTTAAGAT -3′ Chromogenic probe 2 5′ TGGCTACTACTCGCAGTCA -Biotin-3′ 9 Immobilized probe 3 5′-NH.sub.2-ATCTTAAATCGCAAGGT-3′ Transition probe 3-3 5′- TCTCAGGTACCA ACCTTGCGATTTAAGAT -3′ Chromogenic probe 3 5′ TGGTACCTGAGA -Biotin-3′ 10 Immobilized probe 1 5′-NH.sub.2- ATCAAGAAGGTGGTGAA -3′ Transition probe 2 5′- TGCTCAGTGTAGCCCACTGAGGAAAAACGGTGG -3′ Chromogenic probe 3 5′ TGGTACCTGAGA -Biotin-3′

[0065] 2. Preparation of Detection Membranes

[0066] A required area of a nylon membrane enriched with carboxyl on the surface was prepared, treated with 0.1 M HCl, and washed; the membrane was incubated in 15% EDC solution for 1 h and washed; then the membrane was incubated in 0.5 M NaHCO.sub.3 solution containing 0.03 μM immobilized probe (e.g., immobilized probe 1 in Table 1) for 20 min; the treated membrane was incubated in 0.2 M NaOH solution for 15 min, washed and dried. The prepared detection membranes were arranged on spraying targets for collecting spray droplets and the subsequent detection.

[0067] 3. Preparation and Spraying of Spray Liquid

[0068] A spray liquid containing 30 mM trisodium citrate, 0.9% SDS and 0.06 μM transition probe (e.g., transition probe 1 in Table 1) was added to a dosing tank, and after spraying, the detection membranes were recovered for chromogenic treatment.

[0069] 4. Establishment of Standard Curve

[0070] 0.5 μL of the transition probe spray liquid was applied on 5 detection membranes carrying immobilized probes using a pipette to form 1, 2, 3, 4 or 5 spots, wherein the volumes of the transition probe solutions on the 5 detection membranes were 0.5 μL, 1.0 μL, 1.5 μL, 2.0 μL and 2.5 μL, respectively. Another detection membrane was taken as background. An image file was obtained by photographing or scanning, the gray values of unit areas were read by an image processing software (e.g., Photoshop, Image J, and the like), and a total gray value of a selected area was calculated. Finally, a standard curve with total gray value as the ordinate against the volume of the spray liquid as the abscissa was plotted, and a corresponding linear equation was calculated. The results are shown in FIG. 2. The linear equation is y=13.618x−0.5876, with a linear correlation coefficient of 0.98, which meets the standard curve requirements for quantitative detection.

[0071] 5. Chromogenic Treatment

[0072] The detection membranes sprayed with the transition probe spray liquid were collected and incubated in 50 mL of hybridization buffer (an aqueous solution containing 30 mmol/L trisodium citrate and 26 mmol/L SDS) at 34° C. for 40 min; the detection membranes were transferred into 50 mL of hybridization buffer for washing for 2 min; the detection membranes were transferred into a hybridization buffer containing chromogenic probes (e.g., chromogenic probe 1 in Table 1) for reaction at 37° C. for 15 min, then were washed 3 times with 50 mL of washing buffer (an aqueous solution containing 7.5 mmol/L trisodium citrate and 6 mmol/L SDS) and washed once with 50 mL of hybridization buffer. 15 μL of catalase solution was added to a hybridization buffer to prepare an enzyme solution, then the detection membranes were incubated in the enzyme solution for enzyme-linked reaction at 37° C. for 20 min; the detection membranes were washed with 50 mL of hybridization buffer, and transferred into a TMB single-component solution for chromogenic reaction, wherein the TMB single-component solution was catalyzed by horseradish peroxidase binding to the detection membranes, resulting in chromogenic spots on the detection membranes. After 3 min, the membranes were washed with water to terminate the reaction, and dried. Information such as the distribution and size of the droplets could be directly observed through the chromogenic reaction. Finally, an image file was obtained by photographing or scanning, the gray values of unit areas were read by an image processing software (e.g., Photoshop, Image J, and the like), a total gray value of a selected area was calculated, and the deposition was calculated according to the standard curve.

Example 2: Experiment of Droplet Drift of Pesticide Spray

[0073] The projection of the nozzle of air-assisted sprayer on the ground was taken as the original point, and sites were taken at 3.0 m, 4.0 m, 5.0 m, 6.0 m, 6.5 m, 7.0 m, 7.5 m, 8.0 m, 8.5 m, 9.0 m, 9.5 m and 10.0 m away from the original point in the Y axis direction. Then one pre-prepared detection membrane (prepared by referring to the preparation of detection membranes in Example 1) and one sheet of water sensitive paper (purchased from Syngenta) were placed at each site, with a cork block serving as a support. At the beginning of the experiment, a baffle was used to block the jet (where the jet liquid was the transition probe spray liquid as described in Example 1, and group 1 in Table 1 was selected as the probes). The baffle was removed when the jet liquid was stable, a stopwatch was used to time the spraying, and the spraying was 30 s in total. The detection membranes and the water sensitive paper were collected. The water sensitive paper directly developed color after spraying; the detection membranes developed color according to the chromogenic treatment as described in Example 1. The results are shown in FIG. 3.

[0074] After comparison, it is found that the detection membrane and the water sensitive paper can better reflect information such as the size and the coverage density of droplets at sites of 3-6 m. On this basis, the detection membrane can develop colors of different depth, from which the distribution of droplets can be preliminarily determined. In contrast, the water sensitive paper cannot develop colors of different depth; At sites of 6.5-8 m, the sensitivity of the water sensitive paper is greatly reduced, while the detection membrane can well reflect the condition of droplets. At sites more than 8 m, the water sensitive paper is substantially unable to detect the drop of droplets, while the detection membrane is still able to receive droplets and develop color at sites up to 10 m. This suggests that the detection membrane has lower detection limit and higher sensitivity for qualitative determination of information such as the coverage density and size of the droplets, as compared with the water sensitive paper.

Example 3: Experiment of Spray Boom Track System-Simulated Field Spraying—Droplet Volume and Coverage Rate

[0075] Culture dishes were placed on the iron support below the pathway of the spray boom track system. The culture dishes each contained 2 detection membranes (prepared by referring to Example 1, the results of the 2 detection membranes being averaged as the result of the culture dish) and 1 sheet of water sensitive paper, and 3 culture dishes were placed in total. The culture dishes were placed just in the middle of the pathway of the spray boom track system. Spray (the spray liquid was the transition probe spray liquid as described in Example 1, and group 1 in Table 1 was selected for probes) was applied to the detection membranes under a pressure of 3 bar by the spray boom track system (speed: 5 km/h, height: 0.5 m) equipped with Lechler ST110-03 standard flat spray nozzle. After spraying, the experimental materials were retrieved respectively, and the detection membranes were subjected to chromogenic reactions according to the chromogenic treatment as described in Example 1. The droplet coverage area on the detection membranes and the water sensitive paper was read by an instrument, and the droplet volume and the coverage rate were calculated. The results show that the droplet coverage rate of the detection membrane is consistent with that of the water sensitive paper (see FIG. 4A and FIG. 4B for specific results).

Example 4: Experiment of Spray Boom Track System-Simulated Field Spraying—Spray Droplet Deposition

[0076] Culture dishes were placed on iron support below the pathway of the spray boom track system. The culture dishes each contained 3 detection membranes (prepared by referring to Example 1, the results of the 3 detection membranes being averaged as the result of the culture dish) and 1 sheet of water sensitive paper, and 6 culture dishes were placed in total. The culture dishes were just placed in the middle of the pathway of the crane. Spray (the spray liquid was the transition probe spray liquid as described in Example 1, and group 1 in Table 1 was selected for probes) was applied to the detection membranes under a pressure of 3 bar by the spray boom track system (speed: 5 km/h, height: 0.5 m) equipped with Lechler ST110-03 standard fan-shaped nozzle. After spraying, the experimental materials were retrieved respectively, and the detection membranes were subjected to chromogenic reactions and drying according to the chromogenic treatment as described in Example 1. A digital image was obtained by means such as photographing or scanning, the gray values of unit areas were read by an image processing software (e.g., Photoshop and Image J), and a total gray value of a selected area was calculated. Finally, the spray droplet deposition was calculated according to the standard curve.

[0077] Culture dishes were placed on iron support below the pathway of the spray boom track system. One culture dish containing a sheet of filter paper with a diameter of 9 cm in diameter was placed, followed by one empty culture dish at an interval, and a total of 8 culture dishes were placed in this order. The culture dishes were placed just in the middle of the pathway of the spray crane. Spray (the spray liquid was the transition probe spray liquid containing 1 g/L BSF as described in Example 1) was applied to sample membranes under a pressure of 3 bar by the spray boom track system (speed: 5 km/h, height: 0.5 m) equipped with Lechler ST110-03 standard flat spray nozzle. After spraying, the experimental materials were retrieved, respectively. The empty culture dishes were washed with deionized water (10 mL), the resulting solutions were poured into valve bags, and the fluorescence value of the solution in each valve bag was determined by a fluorescence spectrometer after 10 min. A filter paper section was added into each valve bag, the latter was then added with deionized water (10 mL) and shaken for 10 min, and the fluorescence value of the solution in each valve bag was determined by a fluorescence spectrometer. Finally, the deposition volume was calculated according to the standard curve. The results are shown in FIG. 5. The results show that the detection membranes prepared by the reverse dot blot can obtain consistent results with the conventional method in terms of the determination of the amount, coverage area and deposition volume of the droplets. By using single-stranded deoxyribonucleic acids with characteristic sequences as tracers, as compared with traditional tracers, the dosing concentration of the detection membranes used are greatly reduced, and the color contamination risk is avoided.

Example 5: Experiment of Unmanned Aerial Vehicle-Simulated Field Spraying

[0078] A culture dish was placed every 0.5 m in the direction perpendicular to the pathway of the multi-rotor unmanned aerial vehicle (UAV) sprayer. The culture dishes each contained 3 detection membranes (prepared by referring to Example 1, the results of the 3 detection membranes being averaged as the result of the culture dish), 10 culture dishes were placed in total. Spray was applied to sample membranes under a pressure of 3 bar by the UAV equipped with Lechler LU 120-015 universal flat fan-shaped spray nozzle (height: 3 m, speed: 5 m/s, and spray rod length: 2.0 m). After spraying, the experimental materials were retrieved respectively, and the detection membranes were subjected to chromogenic reactions and drying according to the chromogenic treatment as described in Example 1 to calculate the coverage area and coverage rate of droplets collected by different detection membranes. A digital image was obtained by means such as photographing or scanning, the gray values of unit areas were read by an image processing software (e.g., Photoshop and Image J), and a total gray value of a selected area was calculated. Finally, the deposition volume was calculated according to the standard curve. The results are shown in FIG. 6. The results show that this technique can be used for detecting the droplets of UAV spraying. In addition, the drift and deposition during the spraying process can be well reflected on the amount, coverage rate and deposition volume of the droplets.

Example 6: Deposition Distribution Test on Rice Canopy

[0079] A 1 m steel pipe was inserted into the rice plant, and the detection membranes (prepared by referring to Example 1) were fixed with double-head clips at the height of 10 cm, 40 cm and 70 cm from water surface, which were marked as the lower layer, middle layer and upper layer of rice canopy respectively. In the test, 4 plots were set up, and 10 steel pipes were arranged in each plot (FIG. 7). Spray was applied to the 4 plots of the rice fields by the UAV equipped with Lechler LU 120-015 universal flat fan-shaped spray nozzle (height: 3 m, speed: 5 m/s, and spraying width: 4 m). The spray liquids were spray liquid A (group 1 in Table 1 was selected for probes), spray liquid B (group 5 in Table 1 was selected for probes), spray liquid C (group 1 in Table 1 was selected for probes) and spray liquid D (group 5 in Table 1 was selected for probes), which were marked as treatment 1, treatment 2, treatment 3 and treatment 4 respectively; wherein, spray liquid A contained 0.06 μM transition probe, 40% chlorantraniliprole⋅thiamethoxam water dispersible granules and 1% organic silicon flight prevention adjuvant, and corresponded to the detection membrane carrying immobilized probe 1; spray liquid B contained 0.06 μM transition probe, 40% chlorantraniliprole⋅thiamethoxam water dispersible granules and 1% surfactant flight prevention adjuvant, and corresponded to the detection membrane carrying immobilized probe 2; spray liquid C contained 0.06 μM transition probe, 40% chlorantraniliprole⋅thiamethoxam water dispersible granules and 1% oil flight prevention adjuvant, and corresponded to the detection membrane carrying immobilized probe 1; and spray liquid D contained 0.06 μM transition probe and 40% chlorantraniliprole⋅thiamethoxam water dispersible granules, and corresponded to the detection membrane carrying immobilized probe 2.

[0080] After spraying, the experimental materials were retrieved respectively, and the detection membranes were subjected to chromogenic reactions and drying using corresponding chromogenic probes according to the chromogenic treatment as described in Example 1 to calculate the coverage area and coverage rate of droplets collected by different detection membranes. A digital image was obtained by means such as photographing or scanning, the gray values of unit areas were read by an image processing software (Photoshop and Image J), and a total gray value of a selected area was calculated. Finally, the spray droplet deposition was calculated according to the standard curve. The results are shown in FIG. 8. The results show that this technique can be used for detecting the droplets in rice field experiments under various conditions, and can be combined with the pesticide formulations for direct detection. In addition, the drift and deposition during the spraying process can be well reflected on the amount, coverage rate and deposition volume of the droplets.

Example 7: Deposit Distribution Test of Cotton Defoliant

[0081] Both front and back sides of detection membranes (prepared by referring to Example 1) were pasted on the selected leaves of the lower, middle and upper layers of cotton plants with a double-sided tape (FIG. 9). In the test, 3 plots were set up, corresponding to cotton test fields with the plant heights of 1.5 m, 1.2 m and 1.0 m respectively. Spray was applied to the 3 plots of the cotton test fields by the UAV equipped with Lechler LU 120-015 universal flat fan-shaped spray nozzle (height: 3 m, speed: 5 m/s, and spraying width: 4 m). The spray liquid contained 0.06 μM transition probe (group 1), 15 mL/L Dropp Ultra and 40 mL/L ethephon. After spraying, the experimental materials were retrieved respectively, and the detection membranes were subjected to chromogenic reactions and drying according to the chromogenic treatment as described in Example 1 to calculate the coverage area and coverage rate of droplets collected by different detection membranes. A digital image was obtained by means such as photographing or scanning, the gray values of unit areas were read by an image processing software (Photoshop and Image J), and a total gray value of a selected area was calculated. Finally, the deposition volume was calculated according to the standard curve. The results are shown in FIG. 10. The results show that this technique can be used for detecting the droplets in cotton defoliant test. As the detection membranes can be pasted on the leave surface due to their light weight, the real leaves conditions can be reflected accurately. In addition, the deposition during the spraying process can be well reflected on the amount, coverage rate and deposition volume of the droplets.

Example 8: Pesticide Spray Drift Test in an Integrated Rice-Crayfish Farming System

[0082] In the canal of shrimp paddy field, foams were used as the sample receiving devices, on which the detection membrane and water sensitive paper were pasted. The canal was divided into sites according to its width. Three receiving devices as a group were placed at each site, and a group was placed every 2 m for 11 groups in total. The detection membranes were prepared by referring to Example 1, and group 1 in Table 1 was selected for immobilized probes on the detection membranes. Spray was applied to the shrimp paddy fields around the canal by the UAV equipped with Lechler LU 120-015 universal flat fan-shaped spray nozzle (height: 3 m, speed: 5 m/s, and spraying width: 4 m). The spray liquid contained 0.06 μM transition probe (group 1 in Table 1) and 10 mL/L thiamethoxam⋅cyalothrin.

[0083] After spraying, the experimental materials were retrieved respectively, and the detection membranes were subjected to chromogenic reactions and drying using chromogenic probes in group 1 of Table 1 according to the chromogenic treatment as described in Example 1 to calculate the coverage area and coverage rate of droplets collected by different detection membranes. A digital image was obtained by means such as photographing or scanning, the gray values of unit areas were read by an image processing software (e.g., Photoshop, Image J and the like), and a total gray value of a selected area was calculated. Finally, the spray droplet drift volume was calculated according to the standard curve. The results are shown in FIG. 11. The results show that this technique can be used for detecting the drift in the integrated rice-crayfish farming system, and can avoid the situation that the water sensitive paper cannot be detected because it turns blue due to moisture. In addition, the droplet drift during the spraying process can be well reflected on the amount, coverage rate and deposition volume of the droplets in this method.

TABLE-US-00002 TABLE 2 Detection results of droplet deposition of pesticide in the integrated rice-crayfish farming system field. Num- Coverage Droplet Deposition volume ber rate % amount/cm.sup.2 (μL/cm.sup.2)  1-1 0.10 3.4 0.003  1-2 0.60 16.2 0.029  1-3 8.76 44.8 0.376  2-1 0.69 19.0 0.029  2-2 1.91 12.3 0.165  2-3 5.41 34.2 0.472  3-1 0.32 11.7 0.010  3-2 0.06 2.2 0.002  3-3 1.73 8.5 0.227  4-1 0.62 16.8 0.022  4-2 6.67 23.1 0.403  4-3 0.01 0.6 0.001  5-1 0.89 14.5 0.040  5-2 2.40 9.5 0.329  5-3 14.61 29.7 1.536  6-1 0.47 13.4 0.016  6-2 0.46 13.4 0.017  6-3 0.94 29.6 0.032  7-1 0.29 10.6 0.010  7-2 2.79 8.6 0.406  7-3 2.41 37.6 0.119  8-1 0.76 19.2 0.027  8-2 1.23 9.9 0.124  8-3 1.48 31.7 0.057  9-1 1.19 34.3 0.046  9-2 0.20 6.6 0.006  9-3 0.80 25.1 0.029 10-1 0.33 15.2 0.009 10-2 0.26 16.5 0.007 10-3 0.56 10.6 0.029 11-1 0.13 4.4 0.004 11-2 1.25 32.3 0.056 11-3 0.72 16.9 0.027