ENGINEERED MICROORGANISMS FOR THE DECONSTRUCTION OF POLYMERS
20210180007 · 2021-06-17
Inventors
- Gregg Tyler Beckham (Golden, CO)
- Thelhawadigedara Lahiru Niroshan Jayakody (Wheat Ridge, CO)
- Adam Michael GUSS (Oak Ridge, TN, US)
- Thomas David MAND (Oak Ridge, TN, US)
- Christopher W. Johnson (Denver, CO, US)
- Isabel PARDO MENDOZA (Dos Hermanas, ES)
Cpc classification
International classification
Abstract
Disclosed herein are engineered P. putida KT2440 co-expressing PETase and MHETase enzymes that selectively degrades PET into monomers, ethylene glycol and terephthalate (TPA). In another embodiment, disclosed herein are methods for making and using a highly efficient EG metabolizing P. putida KT2440 strain. Given that native P. putida does not have a TPA metabolic pathway, nor the proteins to transport TPA into the cell, the next metabolic engineering challenge for developing synthetic P. putida strain to plastic upcycling was enabling TPA catabolism in P. putida KT2440. TPA transporters and catabolic pathway have been characterized in several microorganisms including Comamonas sp. strain E6 and Rhodococcus jostii RHA1.
Claims
1. A genetically modified organism comprising: an exogenous gene addition, wherein: the exogenous gene addition encodes functional enzymes comprising a PETase and a MHETase, and the genetically modified organism is capable of metabolizing poly (ethylene terephthalate) (PET) to produce PET deconstruction products.
2. The genetically modified organism of claim 1, wherein the exogenous gene is from Ideonella sakaiensis.
3. The genetically modified organism of claim 1, wherein the exogenous gene is codon optimized.
4. The genetically modified organism of claim 1, wherein the exogenous gene is incorporated into the genome of the genetically modified organism.
5. The genetically modified organism of claim 1, wherein the exogenous gene addition further comprises genes encoding a secretion signal peptide.
6. The genetically modified organism of claim 1, wherein the genetically modified organism is a species of Pseudomonas.
7. The genetically modified organism of claim 1, wherein the species is Pseudomonas putida.
8. The genetically modified organism of claim 1, wherein the PET deconstruction products comprise at least one of bis(2-Hydroxyethyl) terephthalate, mono-(2-hydroxyethyl) terephthalate, terephthalate, ethylene glycol, β-ketoadipate, or muconate.
9. A method comprising contacting poly (ethylene terephthalate) (PET) with the genetically modified organisms of claims 1 to produce PET deconstruction products.
10. The method of claim 9, wherein the contacting is performed in minimal salt medium.
11. A genetically modified organism comprising: an exogenous gene addition, wherein: the exogenous gene addition encodes functional enzymes comprising a PETase and a MHETase, and the genetically modified organism is capable of metabolizing poly (ethylene terephthalate) (PET) to produce PET deconstruction products; and wherein said genetically modified organism further comprises heterologous TPA transporters.
12. The genetically modified organism of claim 11 further comprising catabolic gene clusters I or II.
13. The genetically modified organism of claim 12 wherein the catabolic gene clusters I or II are from Comamonas sp. E6.
14. The genetically modified organism of claim 12 capable of using TPA as a sole carbon source.
15. The genetically modified organism of claim 14 wherein said organism is capable of metabolizing TPA at about 0.05 g L.sup.−1 h.sup.−1.
16. The genetically modified organism of claim 12 lacking a pcaIJ gene.
17. The genetically modified organism of claim 16 that is capable of metabolizing TPA to β-ketoadipate.
18. The genetically modified organism of claim 11, wherein the genetically modified organism is a species of Pseudomonas.
19. The genetically modified organism of claim 11, wherein the exogenous gene is from Ideonella sakaiensis.
20. The genetically modified organism of claim 11, wherein the PET deconstruction products comprise at least one of bis(2-Hydroxyethyl) terephthalate, mono-(2-hydroxyethyl) terephthalate, terephthalate, ethylene glycol, β-ketoadipate, or muconate.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0013]
[0014]
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
DETAILED DESCRIPTION
[0035] The present disclosure may address one or more of the problems and deficiencies of the prior art discussed above. However, it is contemplated that some embodiments as disclosed herein may prove useful in addressing other problems and deficiencies in a number of technical areas. Therefore, the embodiments described herein should not necessarily be construed as limited to addressing any of the particular problems or deficiencies discussed herein.
[0036] In an embodiment, disclosed herein is an engineered P. putida KT2440 co-expressing PETase and MHETase enzymes that selectively degrades PET into monomers, ethylene glycol and terephthalate (TPA). In another embodiment, disclosed herein are methods for making and using a highly efficient EG metabolizing P. putida KT2440 strain. Given that native P. putida does not have a TPA metabolic pathway, nor the proteins to transport TPA into the cell, the next metabolic engineering challenge for developing synthetic P. putida strain to plastic upcycling was enabling TPA catabolism in P. putida KT2440. TPA transporters and catabolic pathway have been characterized in several microorganisms including Comamonas sp. strain E6 and Rhodococcus jostii RHA1.
[0037] In an embodiment, disclosed herein are engineered P. putida KT2440 strains that use TPA through heterologous expression of a TPA transporter from Rhodococcus jostii RHA1 and catabolic genes from Comamonas sp. E6 (
[0038] Disclosed herein, in an embodiment, TPA catabolism is enabled in P. putida KT2440 by heterologous expression of TPA transporters (tpaK) and catabolic genes cluster I or II from R. jostii RHAI and Comamonas sp. E6, respectively. The engineered, non-naturally occurring strains can use TPA as a sole carbon source and use TPA at about 0.05 g L.sup.−1 h.sup.−1. In an embodiment, the pcaIJ gene was knocked out in an engineered TPA utilizing strain. The strain could convert TPA to β-ketoadipate. In another embodiment, TPA utilization strain can be engineered for consolidated bioprocessing of PET by enabling selective degradation of PET and ethylene glycol utilization. In an embodiment, strains could be evolved to enhance TPA catabolic rates.
[0039] The present disclosure also relates to a biological strategy for degrading PET, which can subsequently enable atom-efficient biological transformations to novel intermediates (e.g., β-ketoadipate and/or muconate), which may be converted to high strength composites. PETase hydrolyses PET to produce bis(2-hydroxyethyl) terephthalate (BHET), mono-(2-hydroxyethyl) terephthalate (MHET), terephthalate (TPA), and ethylene glycol (EG), and MHETase catalyzes MHET to TPA and EG. Hence, as shown herein, co-expression of PETase and MHETase in an engineered strain can enable PET degradation to TPA and EG. Thus, in some embodiments of the present disclosure, a biological method is provided for the selective degradation of PET into PET monomers via co-expression and secretion of PETase and MHETase in Pseudomonas putida, which can grow well in simple minimal salt medium.
[0040] Therefore, the present disclosure relates to biological methods for the selective degradation of PET into PET monomers via co-expression PETase and MHETase in Pseudomonas putida, which can grow well in simple minimal salt medium. Among other things, I. sakaiensis PETase, ISF6_4831 and MHETase, ISF6_0224 genes were codon optimized for expression in KT2440 including their secretion signal peptides, which are compatible to the P. putida chaperone SecB-dependent secretion system. In addition, the genes were integrated into the P. putida genome with the tac promoter to enable constitutive expression. In certain embodiment, the term “tac”, “Ptac” and “P-Tac” may be used interchangeable to mean a tac promoter. The developed LJ041 strain formed a biofilm on PET. LJ041 enables highly-selectively degradation of PET into monomer TPA via BHET and MHET and confirmed secretion of PETase and MHETase enzymes via the chaperone-dependent native P. putida secreting system. These innovations could lead to a P. putida strain for selective biological degradation and conversion of PET into bio-derived chemical building blocks.
[0041] I. sakaiensis PETase, ISF6_4831 and MHETase, ISF6_0224 genes were codon optimized to KT2440 including their secretion signal peptides, which are compatible to the P. putida chaperone Sec-dependent secretion system. To confirm secretion of codon optimized PETase in P. putida via the I. sakaienesis secretion signal peptide, green fluorescent protein (GFP) was genetically linked to the C-terminus of PETase and expressed in P. putida. Efficient secretion of GFP-tagged PETase was confirmed via microscopy and immunoprecipitation, see
[0042] Next, referring to
[0043]
[0044] Next, the LJ041 strain was tested for selective degradation of BHET to TPA (see
[0045] Materials and Methods:
[0046] Plasmid construction: Q5 Hot Start High-Fidelity 2X Master Mix (New England Biolabs) and primers synthesized by Integrated DNA Technologies (IDT) were used in all PCR amplification. Plasmids were constructed using Gibson Assembly® Master Mix (New England Biolabs) according to the manufacturer's instructions. Primers used for PCR amplification and Gibson assembly are listed in Table 1. The vector, pBLT-2 (Addgene plasmid # 22806) was used for plasmid-based overexpression of PETase with a green fluorescence protein (GFP) tag. Plasmids for gene integration were constructed in pK18sB, which is unable to replicate in P. putida KT2440, and contains the kanamycin-resistant marker to select for integration of the plasmid into the genome by homologous recombination and sacB to counter select for a second recombination event to subsequently remove the plasmid backbone from the genome. Detail of plasmids construction is provided in Table 2.
TABLE-US-00001 TABLE 1 List of Primers Primer ID 5′-3′ oLJ227 GACATGATTACGAATTCGAGCTCGGTACCCGTGCGATTA CTGTGGGAG oLJ232 CCGGAGGCTTTTGACTCGGAGGCGCGGCGCAGGC oLJ228 CGGATAACAATTTCACACTGAGTATTGCCTGAACCG oLJ229 TTCAGGCAATACTCAGTGTGAAATTGTTATCCGCTCACA ATTCCACACATTATACGAGCCGATGATTAATTGTCAACA GCTCTTCATCAAGTCAAAACACTATATAGGAACG oLJ230 ATGTAATCCTTGTTATAGGCTGCAGTTCGCAGTGCG oLJ231 ACTGCGAACTGCAGCCTATAACAAGGATTACATATAAGG GTATATCAAATGCAGACCACCGTCACC oLJ233 TGCGCCGCGCCTCCGAGTCAAAAGCCTCCGGTCGGAGGC TTTTGACTTCAAAACCACCCTGCTGTCGATG oLJ234 CGGCCAGTGCCAAGCTTGCATGCCTGCAGGAAATCTAAC TGCCTTCGCCC oLJ406 TATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACAC TTTCATCAAGTCAAAACACTATATAGGAACGAAAC oLJ407 TCCGCACTGCGAACTGCAGCGGTGGTTCTGAGGAATCTT ACATGAGC oLJ408 GTAAGATTCCTCAGAACCACCGCTGCAGTTCGCAGTGCG oLJ409 AGTCCAGTTACGCTGGAGTCTGAGGCTCGTCCTGAATGA TCTACTTGTAGAGTTCGTC
TABLE-US-00002 TABLE 2 Plasmid construction details Plasmid Purpose Construction detail pLJ080 Genome The PETase genes cassette was amplified with integration primers oLJ229 (Fwd) and oLJ230 (Rev), and of over- MHETase oLJ231 (Fwd) and oLJ232 (Rev) using expressing synthesizes gBlock as a temple. The 5′ homology cassette of region was amplified from P. putida KT2440 PETase genomic DNA with primers oLJ227(Fwd), and and oLJ228 (Rev), and 3′ homology region was MHETase amplified with oLJ233 (Fwd) and oLJ234 (Rev). These products were assembled into pK18sB digested with SmaI and SalI. pLJ081 Over- A DNA fragment containing the PETase genewas expressing amplified from pLJ080 with primers oLJ406 PETase-GFP (Fwd) and oLJ407 (Rev), and GFP gene fragment was obtained with primers oLJ408 (Fwd) and oLJ409 (Rev), amplified from GFP containing plasmid. This product was assembled into pBLT-2 digested with XbaI and EcoRV.
[0047] The PETase and MHETase genes from Ideonella sakaiensis 201-F6 were codon optimized to P. putida KT2440 using online program Optimizer with a random approach (http://genomes.urv.es/OPTIMIZER/), gene fragments were synthesized at Integrated DNA Technologies, Inc, and obtained the double-stranded and linear gBlock, see
[0048] Strain construction: P. putida KT2440 (ATCC 47054) was used as the basis of strain engineering and gene replacements were made using the antibiotic/sacB system of selection and counter-selection. In an embodiment, the properties and description of some strains disclosed herein is depicted in Table 3. To prepare electrocompetent cells of P. putida KT2440 strains, a modified sucrose-based protocol was used. The plasmid was introduced to competent cells via electroporated at 1.6 kV, 25 μF, 200 Ohms. The transformation was plated on an LB agar plate containing 50 μg/ml kanamycin antibiotics and incubated at 30° C. overnight. Initial colonies from the transformation plates were re-streaked on selective LB agar plates and grown at 30° C. overnight to obtain clonal transformants. For sucrose counter-selection, clonal transformants were streaked on YT plates containing 25% (YT+25%; w/v) sucrose (10 g/L yeast extract, 20 g/L tryptone, 250 g/L sucrose, 18 g/L agar), and incubated at 30° C. overnight. The single colony of P. putida KT2440 containing the PETase and MHETase genes were successfully isolated. The strain was analyzed for the correct gene replacement by performing a colony PCR at the site of integration. The LJ102 was constructed by transforming pLJ081 plasmid into P. putida KT2440, the plasmid map and sequence are provided in
TABLE-US-00003 TABLE 3 Strains Strain ID Genotype Description of strain KT2440 P. putida KT2440 Wild-type P. putida KT2440 (ATCC 47054) EM42 P. putida KT2440 Genome reduced strain derived from Δprophage1-4 P. putida KT2440 obtained from Δflagellum Victor de Lorenzo's laboratory (Centro ΔendA-1 Nacional de Biotecnología ΔendA-2 ΔTn7 (CNB-CSIC), Madrid, Spain) ΔhsdRMS ΔTn4652 LJ102 KT2440 + pBTL-2- KT2440 containing the pBTL-2 plasmid PETase_GFP with PETase and GFP LJ041 KT2440 1642::Ptac:: KT2440 with the PETase and MHETase PETase-MHET cassette integrated within the intergenic region between PP_1642 and PP_1643 LJ042 EM42 PP 1642::Ptac:: EM42 with the PETase and MHETase PETase-MHET cassette integrated within the intergenic region between PP_1642 and PP_1643
[0049] PET and BHET degradation experiment: To assess the selective degradation of PET/BHET by the PETase and MHETase expressing strain, shake flask experiments were performed using 125 mL baffled flasks containing 25 mL modified M9 media (6.78 g/L Na.sub.2HPO.sub.4, 3.00 g/L K.sub.2HPO.sub.4, 0.50 g/L NaCl, 1.66 g/L NH.sub.4Cl, 0.24 g/L MgSO.sub.4, 0.01 g/L CaCl.sub.2, and 0.002 g/L FeSO.sub.4) supplemented with 20 mM of glucose and amorphous PET coupons (amorphous PET films with a crystallinity of 14.8±0.2%, synthesized at NREL) or BHET (Obtained from IBM Almaden Research Center, BHET was derived from waste PET bottles via chemical depolymerization process), and inoculated to OD.sub.600 0.1 with pre-culture. Pre-cultures of the strains were prepared by inoculating 25 mL M9 medium supplemented with 20 mM glucose in a 125 mL baffled flask to an OD.sub.600 of 0.05-0.1 and incubating shaking at 225 rpm, 30° C. At mid log phase (OD.sub.600 0.5-1.0) cells were harvested by centrifugation at 13,000 rpm, and the cell pellets were washed twice and resuspended in M9 medium without a carbon source. Cultures were incubated shaking at 225 rpm, 30° C. 1 mL samples were collected periodically and subjected to HPLC analysis to detect the degraded products. After the fermentation, PET coupons were subjected to microscopic observation.
[0050] Scanning Electron Microscopy (SEM): Imaging by scanning electron microscopy (SEM) was performed using a FEI Quanta 400 FEG instrument under low vacuum (0.45 Torr) operating with the gaseous solid-state detector (GAD). Samples were prepared for imaging by fixation in 2.5% gluteraldehyde buffered in 1× PBS (EMS, Hatfield, PS), dehydration in an ethanol series, then freezing in liquid nitrogen followed by lyophilization. Dry samples were mounted on aluminum stubs using carbon tape, and sputter coated with 9 nm of Ir metal. Images were captured at a beam accelerating voltage of 24 keV.
[0051] High performance liquid chromatography (HPLC) analysis: Concentrations of TPA, MHET, and BHET were measured using HPLC by injecting 6 μL of 0.2-μm filter-sterilized culture supernatant onto an Agilent1100 series system (Agilent USA, Santa Clara, Calif.) equipped with a Phenomenex Rezex RFQ-Fast Fruit H+ column (Phenomenex, Torrance, Calf.) and cation H+ guard cartridge (Bio-Rad Laboratories, Hercules, Calif.) at 85° C. A mobile phase of 0.1N sulfuric acid was used at a flow rate of 1.0 mL/min. Diode array detectors were used for compound detection. Compounds were identified by relating the retention times and spectral profiles with standard HPLC grade pure compounds (Sigma Aldrich, St. Louis, Mo., USA) and the concentration of each compound was calculated based on a calibration curves generated using pure compounds.
[0052] To enable TPA catabolism in P. putida KT2440, genes for TPA transport and for conversion of TPA into protocatechuic acid (PCA), an intermediate metabolite of β-ketoadipate pathway were introduced into the chromosome of P. putida strain KT2440. Three different operons containing genes required for TPA catabolism [two operons from Comamonas sp. E6 (operon I: tphA2I, tphA3I, tphBI, and tphA1I) and (operon II: tphA2II, tphA3II, tphBII, and tphA1II), and one from R. jostii RHA1 (tpaA1, tpaA2, tpaC, and tpaB)], and two different operons containing transport genes [one from Comamonas sp. E6 (tphC, tpiA, and tpiB) and one from R. jostii RHA1(tpaK) were tested in various combinations (Table 4). Additionally, each operon was placed under control of 3 different promoters of varying strengths (from strongest to weakest: P-Tac, P-549, P-Lac, P-3079). Those gene clusters were successfully integrated into a modified version of P. putida KT2440 that has 3 poly-attB genetic islands for DNA insertion via highly efficient phage integrase system.
TABLE-US-00004 TABLE 4 Generated strains of P. putida containing genes for terephthalic acid transport and catabolism under control of promoters with varying strengths. Catabolic Genes Transport Gene(s) Source Source TPA TDM# Organism Operon Promoter Organism Operon Promoter growth 56 Comamonas tphA2.sub.IA3.sub.IB.sub.IA1.sub.I P-Tac Comamonas tphC- P-549 No 57 sp. E6 P-Tac sp. E6 tpiBA No 58 P-Lac No 59 Comamonas tphA2.sub.IIA3.sub.IIB.sub.IIA1.sub.II P-Tac Comamonas tphC- P-549 No 60 sp. E6 P-Tac sp. E6 tpiBA No 61 P-Lac No 62 Rhodococcus tpaA1A2CB P-Tac Comamonas tphC- P-549 No 63 jostii RHA1 P-Tac sp. E6 tpiBA No 64 P-Lac No 65 Comamonas tphA2.sub.IA3.sub.IB.sub.IA1.sub.I P-Tac Comamonas tphC- P-Lac No 66 sp. E6 P-Tac sp. E6 tpiBA No 67 P-Lac No 68 Comamonas tphA2.sub.IIA3.sub.IIB.sub.IIA1.sub.II P-Tac Comamonas tphC- P-Lac No 69 sp. E6 P-Tac sp. E6 tpiBA No 70 P-Lac No 71 Rhodococcus tpaA1A2CB P-Tac Comamonas tphC- P-Lac No 72 jostii RHA1 P-Tac sp. E6 tpiBA No 73 P-Lac No 74 Comamonas tphA2.sub.IA3.sub.IB.sub.IA1.sub.I P-Tac Comamonas tphC- P-3079 No 75 sp. E6 P-Tac sp. E6 tpiBA No 76 P-Lac No 77 Comamonas tphA2.sub.IIA3.sub.IIB.sub.IIA1.sub.II P-Tac Comamonas tphC- P-3079 No 78 sp. E6 P-Tac sp. E6 tpiBA No 79 P-Lac No 80 Rhodococcus tpaA1A2CB P-Tac Comamonas tphC- P-3079 No 81 jostii RHA1 P-Tac sp. E6 tpiBA No 82 P-Lac No 83 Comamonas tphA2.sub.IA3.sub.IB.sub.IA1.sub.I P-Tac Rhodococcus tpaK P-549 Yes 84 sp. E6 P-Tac jostii RHA1 Yes 85 P-Lac No 86 Comamonas tphA2.sub.IIA3.sub.IIB.sub.IIA1.sub.II P-Tac Rhodococcus tpaK P-549 Yes 87 sp. E6 P-Tac jostii RHA1 Yes 88 P-Lac No 89 Rhodococcus tpaA1A2CB P-Tac Rhodococcus tpaK P-549 No 90 jostii RHA1 P-Tac jostii RHA1 No
[0053] In an embodiment, thirty-five strains were generated, of which four had substantial growth with TPA as the sole carbon source. Each of the four strains that were able to metabolize TPA contained one of the two Comamonas sp. E6 catabolic operons (I or II) in combination with the R. jostii transporter. Robust expression was a requirement for TPA utilization, as growth was only detected when catabolic and transport genes were expressed from the strongest tested promoters (P-Tac or P-549). Of note, the growth data revealed that neither Comamonas sp. E6 TPA transporter nor R. jostii RHAI catabolic genes enable TPA catabolism in P. putida KT2440. Growth in minimal media containing either 10 mM TPA or 10 mM PCA was compared for each of the TPA catabolizing strains. An extended lag phase and about a 3-fold slower growth rate for all strains indicated that TPA is not used as efficiently as PCA as a substrate (
TABLE-US-00005 TABLE 5 Growth characteristics of TPA utilizing strains of P. putida in minimal medium containing either 10 mM TPA or 10 mM PCA as the sole growth substrate. Lag Growth Doubling Strain Substrate Phase (h) Rate (h.sup.−1) Time (h) TDM083 TPA 16.4 ± 0.1 0.108 ± 0.002 6.41 ± 0.13 TDM084 TPA 16.4 ± 0.8 0.102 ± 0.003 6.81 ± 0.20 TDM086 TPA 17.4 ± 0.9 0.099 ± 0.003 7.01 ± 0.19 TDM087 TPA 17.6 ± 0.5 0.099 ± 0.001 6.98 ± 0.07 KT2440 TPA No Growth No Growth No Growth TDM083 PCA 2.8 ± 0.0 0.395 ± 0.024 1.76 ± 0.10 TDM084 PCA 2.8 ± 0.0 0.378 ± 0.026 1.84 ± 0.13 TDM086 PCA 2.9 ± 0.1 0.327 ± 0.066 2.17 ± 0.40 TDM087 PCA 2.8 ± 0.3 0.311 ± 0.029 2.24 ± 0.22 KT2440 PCA 2.6 ± 0.3 0.300 ± 0.010 2.31 ± 0.08
[0054] Different versions of a synthetic operon coding for a terephthalic acid degradation pathway were constructed for chromosomal integration and expression in Acinetobacter baylyi ADP1. This operon includes codon-optimized versions of the genes tphC.sub.IIA2.sub.IIA3.sub.IIB.sub.IIA.sub.II and tpiBA from Comamonas sp. E6 under control of a constitutive promoter, with each gene being preceded by a synthetic ribosome binding site sequence. The description and accession numbers for the wild-type Comamonas sp. E6 tphC.sub.IIA2.sub.IIA3.sub.IIB.sub.IIA.sub.II and tpiBA genes are listed in Table 6. For the homologous recombination and insertion of the operon in the chromosome of Acinetobacter baylyi ADP1, upstream and downstream homology arms of ˜2000 bp were amplified from genomic DNA and assembled by overlap extension PCR to flank the synthetic genes. Linear DNA fragments were transformed into naturally competent Acinetobacter baylyi ADP1 cells as described in the literature.
TABLE-US-00006 TABLE 6 Protein accession Gene number Description tphC.sub.II BAE47084.1 Periplasmic terephthalate binding receptor tphA2.sub.II BAE47085.1 Oxygenase large subunit of terephthalate 1,2-dioxygenase tphA3.sub.II BAE47086.1 Oxygenase small subunit of terephthalate 1,2-dioxygenase tphB.sub.II BAE47087.1 1,2-dihydroxy-3,5-cyclohexadiene-1,4- dicarboxylate dehydrogenase tphA1.sub.II BAE47088.1 Reductase component of terephthalate 1,2-dioxygenase tpiB BAN66715.1 Small transmembrane protein of the aromatic acids transporter tpiA BAN66716.1 Large transmembrane protein of the aromatic acids transporter
[0055] In a first shake-flask experiment, an engineered Acinetobacter baylyi ADP1 strain, IP103, expressing the tphC.sub.IIA2.sub.IIA3.sub.IIB.sub.IIA.sub.II synthetic genes was grown in Acinetobacter minimal media in the presence of 5 mM terephthalic acid and 20 mM pyruvate, the latter being fed every 24 hours to support cell growth. As seen in
[0056] Genes expressing the terephthalate transporter from Comamonas sp. E6, tpiBA, were then similarly codon optimized and incorporated into the genome of IP103 downstream of the tphC.sub.IIA2.sub.IIA3.sub.IIB.sub.IIA.sub.II genes, such that expression of all of these genes was driven as an operon by the same promoter. In a shake-flask experiment, this new strain expressing the synthetic terephthalate transporter genes, tpiAB, as well as the tphC.sub.IIA2.sub.IIA3.sub.IIB.sub.IIA.sub.II genes, IP131, and the parent strain expressing only the tphC.sub.IIA2.sub.IIA3.sub.IIB.sub.IIA.sub.II genes, IP103, were grown in Acinetobacter minimal media supplemented with 5 mM terephthalic acid and 20 mM pyruvate, fed only at the beginning of the experiment. As seen in
[0057] The foregoing discussion and examples have been presented for purposes of illustration and description. The foregoing is not intended to limit the aspects, embodiments, or configurations to the form or forms disclosed herein. In the foregoing Detailed Description for example, various features of the aspects, embodiments, or configurations are grouped together in one or more embodiments, configurations, or aspects for the purpose of streamlining the disclosure. The features of the aspects, embodiments, or configurations, may be combined in alternate aspects, embodiments, or configurations other than those discussed above. This method of disclosure is not to be interpreted as reflecting an intention that the aspects, embodiments, or configurations require more features than are expressly recited in each claim. Rather, as the following claims reflect, inventive aspects lie in less than all features of a single foregoing disclosed embodiment, configuration, or aspect. While certain aspects of conventional technology have been discussed to facilitate disclosure of some embodiments of the present invention, the Applicants in no way disclaim these technical aspects, and it is contemplated that the claimed invention may encompass one or more of the conventional technical aspects discussed herein. Thus, the following claims are hereby incorporated into this Detailed Description, with each claim standing on its own as a separate aspect, embodiment, or configuration.