FEEDBACK ENABLED SYNTHETIC GENES, TARGET SEED MATCH CASSETTES, AND THEIR USES
20210170051 · 2021-06-10
Inventors
Cpc classification
A61P25/28
HUMAN NECESSITIES
C12N2750/14141
CHEMISTRY; METALLURGY
A61K48/005
HUMAN NECESSITIES
International classification
A61K48/00
HUMAN NECESSITIES
A61P25/28
HUMAN NECESSITIES
Abstract
This invention relates to feedback-enabled synthetic genes, polynucleotide target cassettes, vectors, and pharmaceutical compositions for the purpose of providing transgene expression in target tissues that is capable of endogenous regulation for treating disorders such as dose-sensitive intellectual ability disorders, as well as methods of making and methods of using the same.
Claims
1. A synthetic gene comprising: a polynucleotide comprising a coding region encoding a protein or nucleic acid of interest and one or more regulatory regions; the polynucleotide further comprising one or more nucleic acid segments each comprising a seed match identified as a binding site for an endogenous miRNA and a 5′ flanking sequence and a 3′ flanking sequence neighboring said seed match; wherein said one or more nucleic acid segments are inserted into a regulatory region of said polynucleotide such that expression of said protein or nucleic acid of interest when said synthetic gene is delivered to a cell expressing the endogenous miRNA is reduced relative to expression of a protein or nucleic acid of interest when a synthetic gene that does not comprise the one or more nucleic acid segments is delivered to a cell expressing the endogenous miRNA.
2. The synthetic gene of claim 1, wherein the coding region encoding a protein or nucleic acid of interest comprises the coding region of a gene selected from TCF4, UBE3A, DYRK1A, MEF2C, NSD1, ZEB2, MBD5, RPS6KA3, ATRX, MECP2, SLC6A1, FOXG1, AKT3, or an active fragment thereof.
3. The synthetic gene of claim 1, wherein the coding region encoding a protein or nucleic acid of interest comprises the coding region of the gene MECP2 or an active fragment thereof.
4. The synthetic gene of any one of claims 1-3, wherein the seed matches and 5′ and 3′ flanking sequences bind to one or more miRNAs selected from miR-690, miR-124-3p, miR-451a, miR-9-5p, miR-26-5p, miR-23-3p, miR-218-5p, miR-27-3p, let-7-5p/98-5p, miR-29-3p, miR-338-3p, miR-98-5p, miR-7-5p, miR-494-3p, or any combination thereof.
5. The synthetic gene of any one of claims 1-3, wherein the seed matches and 5′ and 3′ flanking sequences bind to the miRNAs miR-9-5p, miR-26-5p miR-23-3p, miR-218-5p, miR-27-3p, and let-7-5p.
6. The synthetic gene of any one of claims 1-3, wherein the seed matches and 5′ and 3′ flanking sequences bind to the miRNAs miR-690, miR-451a, and let-7-5p.
7. The synthetic gene of any one of claims 1-6, wherein the seed match is about 5 to about 10 nucleotides in length.
8. The synthetic gene of any one of claims 1-6, wherein the seed match is about 6 to about 8 nucleotides in length.
9. The synthetic gene of any one of claims 1-6, wherein the 5′ and 3′ flanking sequences neighboring the seed match are each about 9 to about 13 nucleotides in length.
10. The synthetic gene of any one of claims 1-6, wherein the 5′ and 3′ flanking sequences neighboring the seed match are each 11 nucleotides in length.
11. The synthetic gene of any one of claims 1-6, wherein the polynucleotide comprises at least two seed matches and the seed matches are separated by about 7 to about 40 nucleotides.
12. The synthetic gene of claim 11, wherein the at least two seed matches are separated by about 20 to about 25 nucleotides.
13. The synthetic gene of claim 11, wherein the at least two seed matches are separated by 22 nucleotides.
14. The synthetic gene of any one of claims 11-13, wherein the polynucleotide comprises 3-8 seed matches.
15. The synthetic gene of any one of claims 1-14 wherein the seed matches and flanking 3′ and 5′ sequences neighboring the seed matches comprise a nucleotide sequence at least 70% identical to SEQ ID NO:1.
16. The synthetic gene of any one of claims 1-14 wherein the seed matches and flanking 3′ and 5′ sequences neighboring the seed matches comprise a nucleotide sequence at least 70% identical to SEQ ID NO:2.
17. A vector comprising the synthetic gene of any one of claims 1-16.
18. The vector of claim 17, wherein the vector is a plasmid, a viral vector, an expression cassette, a transformed cell or a nanoparticle.
19. A pharmaceutical composition comprising the synthetic gene of any one of claims 1-16 or the vector of claim 17 or 18 and a pharmaceutically acceptable carrier.
20. A polynucleotide target cassette for providing dose dependent inhibitory feedback to a synthetic gene, the cassette comprising one or more nucleic acid segments comprising a seed match identified as a binding site for an endogenous miRNA and 5′ and 3′ flanking sequences neighboring said seed match.
21. The polynucleotide target cassette of claim 20, wherein the seed matches and 5′ and 3′ flanking sequences bind to one or more miRNAs selected from miR-690, miR-124-3p, miR-451a, miR-9-5p, miR-26-5p, miR-23-3p, miR-218-5p, miR-27-3p, let-7-5p/98-5p, miR-29-3p, miR-338-3p, miR-98-5p, miR-7-5p, miR-494-3p, or any combination thereof.
22. The polynucleotide target cassette of claim 20, wherein the seed matches and 5′ and 3′ flanking sequences bind to the miRNAs miR-9-5p, miR-26-5p miR-23-3p, miR-218-5p, miR-27-3p, and let-7-5p.
23. The polynucleotide target cassette of claim 20, wherein the seed matches and 5′ and 3′ flanking sequences bind to the miRNAs miR-690, miR-451a, and let-7-5p.
24. The polynucleotide target cassette of any one of claims 20-23, wherein the seed match is about 5 to about 10 nucleotides in length.
25. The polynucleotide target cassette of any one of claims 20-23, wherein the seed match is about 6 to about 8 nucleotides in length.
26. The polynucleotide target cassette of any one of claims 20-25, wherein the 5′ and 3′ flanking sequences neighboring the seed match are each about 9 to about 13 nucleotides in length.
27. The polynucleotide target cassette of any one of claims 20-25, wherein the 5′ and 3′ flanking sequences neighboring the seed match are each 11 nucleotides in length.
28. The polynucleotide target cassette of any one of claims 20-27, wherein the seed matches and flanking 3′ and 5′ sequences neighboring the seed matches comprise a nucleotide sequence at least 70% identical to SEQ ID NO:1.
29. The polynucleotide target cassette of any one of claims 20-27, wherein the seed matches and flanking 3′ and 5′ sequences neighboring the seed matches comprise a nucleotide sequence at least 70% identical to SEQ ID NO:2.
30. A method of preparing a synthetic gene comprising a polynucleotide comprising a coding region encoding a protein or nucleic acid of interest and one or more regulatory regions, comprising the step of inserting the polynucleotide target cassette of any one of claims 20-29 into a regulatory region of the synthetic gene.
31. A method of making the synthetic gene of any one of claims 1-16, comprising the steps of: inserting one or more nucleic acid segments each comprising a seed match identified as a binding site for an endogenous miRNA and 5′ and 3′ flanking sequences neighboring said seed match into a regulatory region of the polynucleotide comprising a coding region encoding a protein or nucleic acid of interest and one or more regulatory regions.
32. The method of claim 31, wherein the coding region encoding a protein or nucleic acid of interest comprises the coding region of a gene selected from TCF4, UBE3A, DYRK1A, MEF2C, NSD1, ZEB2, MBD5, RPS6KA3, ATRX, MECP2, SLC6A1, FOXG1, AKT3 or an active fragment thereof.
33. The method of claim 31, wherein the coding region encoding a protein or nucleic acid of interest comprises the coding region of a gene MECP2 or an active fragment thereof.
34. The method of any one of claims 31-33, wherein the seed matches and 5′ and 3′ flanking sequences bind to one or more miRNAs selected from selected from miR-690, miR-124-3p, miR-451a, miR-9-5p, miR-26-5p, miR-23-3p, miR-218-5p, miR-27-3p, let-7-5p/98-5p, miR-29-3p, miR-338-3p, miR-98-5p, miR-7-5p, miR-494-3p, or any combination thereof.
35. The method of any one of claims 31-33, wherein the seed matches and 5′ and 3′ flanking sequences bind to the miRNAs miR-9-5p, miR-26-5p miR-23-3p, miR-218-5p, miR-27-3p, and let-7-5p.
36. The method of any one of claims 31-33, wherein the seed matches and 5′ and 3′ flanking sequences bind to the miRNAs miR-690, miR-451a, and let-7-5p.
37. The method of claim 31, further comprising the steps of: screening for miRNAs with increased expression when the protein or nucleic acid of interest is expressed in a cell relative to when the protein or nucleic acid of interest is not expressed; identifying a seed match and 5′ and 3′ flanking sequences for one or more miRNAs having increased expression; and preparing a nucleic acid segment comprising said seed match and 5′ and 3′ flanking sequences to be inserted into a regulatory region of said polynucleotide.
38. A method of identifying one or more seed matches and 5′ and 3′ flanking sequences to be inserted in a synthetic gene, comprising the steps of: identifying a seed match and 5′ and 3′ flanking sequences for one or more miRNAs having increased expression when a protein or nucleic acid of interest is expressed in a cell relative to when the protein or nucleic acid of interest is not expressed in the cell; and inserting said seed match and 5′ and 3′ flanking sequences into a regulatory region of a synthetic gene comprising a polynucleotide comprising a coding region encoding the protein or nucleic acid of interest and one or more regulatory regions.
39. The method of claim 38, further comprising the step of: screening a nucleic acid dataset for a validated or putative seed match and 5′ and 3′ flanking sequences.
40. The method of claim 38 or 39, further comprising the step of: identifying miRNAs with increased expression when a protein or nucleic acid of interest is expressed in a cell relative to when the protein or nucleic acid of interest is not expressed in the cell.
41. The method of any one of claims 38-40, further comprising the step of: screening a nucleic acid dataset for miRNAs with increased expression when a protein or nucleic acid of interest is expressed in a cell relative to when the protein or nucleic acid of interest is not expressed in the cell.
42. The method of any one of claims 38-41, further comprising the steps of: expressing the protein or nucleic acid of interest in a cell; collecting miRNA from the cell; and calculating expression levels of said miRNAs when said protein or nucleic acid of interest is expressed in the cell relative to when said protein or nucleic acid of interest is not expressed in the cell, thereby creating a nucleic acid dataset of said miRNAs.
43. The method of any one of claim 39, 41, or 42, wherein the nucleic acid dataset is a 3′ UTR dataset.
44. The method of any one of claims 38-43, wherein the protein or nucleic acid of interest is a transcription or translation product of a gene selected from TCF4, UBE3A, DYRK1A, MEF2C, NSD1, ZEB2, MBD5, RPS6KA3, ATRX, SLC6A1, FOXG1, AKT3, MECP2, or an active fragment thereof.
45. The method of any one of claims 38-43, wherein the protein or nucleic acid of interest is a transcription or translation product of a gene MECP2 or an active fragment thereof.
46. A method of delivering a synthetic gene to a subject, the method comprising administering to the subject the synthetic gene of any one of claims 1-16, the vector of claim 17 or 18, or the pharmaceutical composition of claim 19, thereby delivering the synthetic gene to the subject.
47. A method of treating a disease associated with abnormal expression of an endogenous gene or expression of a mutant protein encoded by an endogenous gene, the method comprising administering the synthetic gene of any one of claims 1-16, the vector of claim 17 or 18, or the pharmaceutical composition of claim 19 encoding a protein or nucleic acid of interest encoded by the endogenous gene, thereby treating the disease.
48. The method of claim 46 or 47, wherein the subject is a human.
49. The method of any one of claims 46-48, wherein the subject has or is at risk for an intellectual ability gene-dose sensitive disorder.
50. The method of any one of claims 46-48, wherein the subject has or is at risk for a disorder selected from the group consisting of Rett syndrome, MeCP2 duplication syndrome, Angelman syndrome, dup15Q, DYRK1A haploinsufficiency, Down syndrome, MEF2C haploinsufficiency syndrome, dup5Q14.3, Sotos syndrome, Reverse Sotos syndrome, Alpha-thalassemia X-linked intellectual disability syndrome, Xq13.2q21.1 duplication, Coffin-Lowry syndrome, Xp22.12 duplication, Pitt Hopkins syndrome, Mowat-Wilson Syndrome, 2q22.3 triplication, 2q23.1 duplication, 2q23.1 microdeletion, FOXG1 syndrome, West Syndrome, megalencephaly-polymicrogyria-polydactyly-hydrocephalus syndrome, AKT3 duplication, Doose syndrome, SLC6A1 duplication and Trisomy 18.
51. The method of any one of claims 46-50, wherein the subject has or is at risk for Rett syndrome or MeCP2 duplication syndrome.
52. The method of any one of claims 46-51, wherein the synthetic gene, vector, or pharmaceutical composition is delivered by a delivery route selected from the group consisting of enteral, parenteral, intrathecal, intracisternal, intracerebral, intraventricular, intranasal, intra-aural, intra-ocular, peri-ocular, intrarectal, intramuscular, intraperitoneal, intravenous, oral, sublingual, subcutaneous and transdermal.
53. The method of any one of claims 46-51, wherein the synthetic gene is delivered intravenously.
54. The method of any one of claims 46-51, wherein the synthetic gene is delivered intraCSF.
55. The method of claims 46-54, the method further comprising genetically knocking down an endogenous gene encoding the protein or nucleic acid of interest in the subject.
56. The method of claim 55, wherein the endogenous gene is MECP2.
57. A method of treating a disease associated with abnormal expression of an endogenous gene or expression of a mutant protein encoded by an endogenous gene in a subject, the method comprising genetically knocking down the endogenous gene in a cell of the subject, and administering the synthetic gene of any one of claims 1-14, the vector of claim 15 or 16, or the pharmaceutical composition of claim 17 encoding a protein or nucleic acid of interest encoded by the endogenous gene, thereby treating the disease.
58. The method of claim 57, wherein the disease is Rett syndrome, MeCP2 duplication syndrome, Angelman syndrome, dup15Q, DYRK1A haploinsufficiency, Down syndrome, MEF2C haploinsufficiency syndrome, dup5Q14.3, Sotos syndrome, Reverse Sotos syndrome, Alpha-thalassemia X-linked intellectual disability syndrome, Xq13.2q21.1 duplication, Coffin-Lowry syndrome, Xp22.12 duplication, Pitt Hopkins syndrome, Mowat-Wilson Syndrome, 2q22.3 triplication, 2q23.1 duplication, 2q23.1 microdeletion, FOXG1 syndrome, West syndrome, megalencephaly-polymicrogyria-polydactyly-hydrocephalus syndrome, AKT3 duplication, Doose syndrome, SLC6A1 duplication and/or Trisomy 18.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
DETAILED DESCRIPTION OF THE INVENTION
[0034] The present invention is explained in greater detail below. This description is not intended to be a detailed catalog of all the different ways in which the invention may be implemented, or all the features that may be added to the instant invention. For example, features illustrated with respect to one embodiment may be incorporated into other embodiments, and features illustrated with respect to a particular embodiment may be deleted from that embodiment. In addition, numerous variations and additions to the various embodiments suggested herein will be apparent to those skilled in the art in light of the instant disclosure which do not depart from the instant invention. Hence, the following specification is intended to illustrate some particular embodiments of the invention, and not to exhaustively specify all permutations, combinations and variations thereof.
[0035] Unless the context indicates otherwise, it is specifically intended that the various features of the invention described herein can be used in any combination. Moreover, the present invention also contemplates that in some embodiments of the invention, any feature or combination of features set forth herein can be excluded or omitted. To illustrate, if the specification states that a complex comprises components A, B and C, it is specifically intended that any of A, B or C, or a combination thereof, can be omitted and disclaimed singularly or in any combination.
[0036] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used in the description of the invention herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention.
[0037] Nucleotide sequences are presented herein by single strand only, in the 5′ to 3′ direction, from left to right, unless specifically indicated otherwise. Nucleotides and amino acids are represented herein in the manner recommended by the IUPAC-IUB Biochemical Nomenclature Commission, or (for amino acids) by either the one-letter code, or the three letter code, both in accordance with 37 C.F.R. § 1.822 and established usage.
[0038] Except as otherwise indicated, standard methods known to those skilled in the art may be used for production of recombinant and synthetic genes, polypeptides, antibodies or antigen-binding fragments thereof, manipulation of nucleic acid sequences, production of transformed cells, the construction of vector constructs, and the generation and analysis of datasets. Such techniques are known to those skilled in the art. See, e.g., SAMBROOK et al., MOLECULAR CLONING: A LABORATORY MANUAL 2nd Ed. (Cold Spring Harbor, N.Y., 1989); F. M. AUSUBEL et al. CURRENT PROTOCOLS IN MOLECULAR BIOLOGY (Green Publishing Associates, Inc. and John Wiley & Sons, Inc., New York).
[0039] All publications, patent applications, patents, nucleotide sequences, amino acid sequences and other references mentioned herein are incorporated by reference in their entirety.
Definitions
[0040] As used in the description of the invention and the appended claims, the singular forms “a,” “an” and “the” are intended to include the plural forms as well, unless the context clearly indicates otherwise.
[0041] As used herein, “and/or” refers to and encompasses any and all possible combinations of one or more of the associated listed items, as well as the lack of combinations when interpreted in the alternative (“or”).
[0042] “Optional” or “optionally” means that the subsequently described event or circumstance can or cannot occur, and that the description includes instances where the event or circumstance occurs and instances where it does not.
[0043] Moreover, the present invention also contemplates that in some embodiments of the invention, any feature or combination of features set forth herein can be excluded or omitted.
[0044] Furthermore, the term “about,” as used herein when referring to a measurable value such as an amount of a compound or agent of this invention, dose, time, temperature, and the like, is meant to encompass variations of ±10%, ±5%, ±1%, ±0.5%, or even ±0.1% of the specified amount.
[0045] As used herein, the transitional phrase “consisting essentially of” is to be interpreted as encompassing the recited materials or steps and those that do not materially affect the basic and novel characteristic(s) of the claimed invention. Thus, the term “consisting essentially of” as used herein should not be interpreted as equivalent to “comprising.”
[0046] The term “consists essentially of” (and grammatical variants), as applied to a polynucleotide or polypeptide sequence of this invention, means a polynucleotide or polypeptide that consists of both the recited sequence (e.g., SEQ ID NO) and a total of ten or fewer (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) additional nucleotides or amino acids on the 5′ and/or 3′ or N-terminal and/or C-terminal ends of the recited sequence or between the two ends (e.g., between domains) such that the function of the polynucleotide or polypeptide is not materially altered. The total of ten or fewer additional nucleotides or amino acids includes the total number of additional nucleotides or amino acids added together. The term “materially altered,” as applied to polynucleotides of the invention, refers to an increase or decrease in ability to express the encoded polypeptide of at least about 50% or more as compared to the expression level of a polynucleotide consisting of the recited sequence. The term “materially altered,” as applied to polypeptides of the invention, refers to an increase or decrease in biological activity of at least about 50% or more as compared to the activity of a polypeptide consisting of the recited sequence.
[0047] The term “sequence identity,” as used herein, has its standard meaning in the art. As is known in the art, a number of different programs can be used to identify whether a polynucleotide or polypeptide has sequence identity or similarity to a known sequence. Sequence identity or similarity may be determined using standard techniques known in the art, including, but not limited to, the local sequence identity algorithm of Smith & Waterman, Adv. Appl. Math. 2:482 (1981), by the sequence identity alignment algorithm of Needleman & Wunsch, J Mol. Biol. 48:443 (1970), by the search for similarity method of Pearson & Lipman, Proc. Natl. Acad. Sci. USA 85:2444 (1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Drive, Madison, Wis.), the Best Fit sequence program described by Devereux et al., Nucl. Acid Res. 12:387 (1984), preferably using the default settings, or by inspection.
[0048] An example of a useful algorithm is PILEUP. PILEUP creates a multiple sequence alignment from a group of related sequences using progressive, pairwise alignments. It can also plot a tree showing the clustering relationships used to create the alignment. PILEUP uses a simplification of the progressive alignment method of Feng & Doolittle, J. Mol. Evol. 35:351 (1987); the method is similar to that described by Higgins & Sharp, CABIOS 5:151 (1989).
[0049] Another example of a useful algorithm is the BLAST algorithm, described in Altschul et al., J Mol. Biol. 215:403 (1990) and Karlin et al., Proc. Natl. Acad. Sci. USA 90:5873 (1993). A particularly useful BLAST program is the WU-BLAST-2 program which was obtained from Altschul et al., Meth. Enzymol., 266:460 (1996); blast.wustl/edu/blast/README.html. WU-BLAST-2 uses several search parameters, which are preferably set to their default values. The parameters are dynamic values and are established by the program itself depending upon the composition of the particular sequence of interest and the composition of the particular database against which the sequence of interest is being searched; however, the values may be adjusted to increase sensitivity.
[0050] An additional useful algorithm is gapped BLAST as reported by Altschul et al., Nucleic Acids Res. 25:3389 (1997).
[0051] A percentage amino acid sequence identity value is determined by the number of matching identical residues divided by the total number of residues of the “longer” sequence in the aligned region. The “longer” sequence is the one having the most actual residues in the aligned region (gaps introduced by WU-BLAST-2 to maximize the alignment score are ignored).
[0052] In a similar manner, percent nucleic acid sequence identity is defined as the percentage of nucleotide residues in the candidate sequence that are identical with the nucleotides in the polynucleotide specifically disclosed herein.
[0053] The alignment may include the introduction of gaps in the sequences to be aligned. In addition, for sequences that contain either more or fewer nucleotides than the polynucleotides specifically disclosed herein, it is understood that in one embodiment, the percentage of sequence identity will be determined based on the number of identical nucleotides in relation to the total number of nucleotides. Thus, for example, sequence identity of sequences shorter than a sequence specifically disclosed herein, will be determined using the number of nucleotides in the shorter sequence, in one embodiment. In percent identity calculations, relative weight is not assigned to various manifestations of sequence variation, such as insertions, deletions, substitutions, etc.
[0054] In one embodiment, only identities are scored positively (+1) and all forms of sequence variation including gaps are assigned a value of “0,” which obviates the need for a weighted scale or parameters as described below for sequence similarity calculations. Percent sequence identity can be calculated, for example, by dividing the number of matching identical residues by the total number of residues of the “shorter” sequence in the aligned region and multiplying by 100. The “longer” sequence is the one having the most actual residues in the aligned region.
[0055] As used herein, an “isolated” nucleic acid or nucleotide sequence (e.g., an “isolated DNA” or an “isolated RNA”) means a nucleic acid or nucleotide sequence separated or substantially free from at least some of the other components of the naturally occurring organism or virus, for example, the cell or viral structural components or other polypeptides or nucleic acids commonly found associated with the nucleic acid or nucleotide sequence.
[0056] Likewise, an “isolated” polypeptide means a polypeptide that is separated or substantially free from at least some of the other components of the naturally occurring organism or virus, for example, the cell or viral structural components or other polypeptides or nucleic acids commonly found associated with the polypeptide.
[0057] The term “endogenous” refers to a component naturally found in an environment, i.e., a gene, nucleic acid, miRNA, protein, cell, or other natural component expressed in the subject, as distinguished from an introduced component, i.e., an “exogenous” component.
[0058] As used herein, the term “heterologous” refers to a nucleotide/polypeptide that originates from a foreign species, or, if from the same species, is substantially modified from its native form in composition and/or genomic locus by deliberate human intervention.
[0059] As used herein, the term “nucleic acid” refers to a single or double-stranded polymer of deoxyribonucleotide or ribonucleotide bases read from the 5′ to the 3′ end. The “nucleic acid” may also optionally contain non-naturally occurring or modified nucleotide bases. The term “nucleotide sequence” or “nucleic acid sequence” refers to both the sense and antisense strands of a nucleic acid, either as individual single strands or in the duplex. The term “ribonucleic acid” (RNA) is inclusive of RNAi (inhibitory RNA), dsRNA (double stranded RNA), siRNA (small interfering RNA), shRNA (short/small hairpin RNA), mRNA (messenger RNA), miRNA (micro-RNA), tRNA (transfer RNA, whether charged or discharged with a corresponding acylated amino acid), long non-coding RNA (lncRNA), ribosomal RNA (rRNA), small nuclear RNA (snRNA), small nucleolar RNA (snoRNA) and cRNA (complementary RNA), and the term “deoxyribonucleic acid” (DNA) is inclusive of cDNA and genomic DNA and DNA-RNA hybrids.
[0060] MicroRNAs are a class of noncoding small RNAs that originate from primary miRNA (pri-miRNA) transcripts that are encoded by miRNA genes. The pri-miRNA transcripts are processed into smaller 19-24 nucleotide RNAs, which can regulate gene expression, for example, through silencing reactions mediated by translational inhibition or cleavage.
[0061] The terms “nucleic acid segment,” “nucleotide sequence,” or more generally “segment” will be understood by those in the art as functional terms that include genomic sequences, ribosomal RNA sequences, transfer RNA sequences, messenger RNA sequences, small regulatory RNAs, operon sequences and smaller engineered nucleotide sequences that express or may be adapted to express, proteins, polypeptides or peptides. Nucleic acids of the present disclosure may also be synthesized, either completely or in part, by methods known in the art. Thus, all or a portion of the nucleic acids of the present disclosure may be synthesized using codons preferred by a selected host. Such species-preferred codons may be determined, for example, from the codons used most frequently in the proteins expressed in a particular host species. Other modifications of the nucleotide sequences may result in mutants having slightly altered activity.
[0062] As used herein with respect to nucleic acids, the term “fragment” refers to a nucleic acid that is reduced in length relative to a reference nucleic acid and that comprises, consists essentially of and/or consists of a nucleotide sequence of contiguous nucleotides identical or almost identical (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical) to a corresponding portion of the reference nucleic acid. Such a nucleic acid fragment may be, where appropriate, included in a larger polynucleotide of which it is a constituent. In some embodiments, the nucleic acid fragment comprises, consists essentially of or consists of at least about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 200, 225, 250, 300, 350, 400, 450, 500, or more consecutive nucleotides. In some embodiments, the nucleic acid fragment comprises, consists essentially of or consists of less than about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 200, 225, 250, 300, 350, 400, 450 or 500 consecutive nucleotides.
[0063] As used herein with respect to polypeptides, the term “fragment” refers to a polypeptide that is reduced in length relative to a reference polypeptide and that comprises, consists essentially of and/or consists of an amino acid sequence of contiguous amino acids identical or almost identical (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical) to a corresponding portion of the reference polypeptide. Such a polypeptide fragment may be, where appropriate, included in a larger polypeptide of which it is a constituent. In some embodiments, the polypeptide fragment comprises, consists essentially of or consists of at least about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 200, 225, 250, 300, 350, 400, 450, 500, or more consecutive amino acids. In some embodiments, the polypeptide fragment comprises, consists essentially of or consists of less than about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 200, 225, 250, 300, 350, 400, 450 or 500 consecutive amino acids.
[0064] As used herein with respect to nucleic acids, the term “functional fragment” or “active fragment” refers to nucleic acid that encodes a functional fragment of a polypeptide.
[0065] As used herein with respect to polypeptides, the term “functional fragment” or “active fragment” refers to polypeptide fragment that retains at least about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5% or more of at least one biological activity of the full-length polypeptide (e.g., the ability to up- or down-regulate gene expression). In some embodiments, the functional fragment actually has a higher level of at least one biological activity of the full-length polypeptide.
[0066] As used herein, the term “modified,” as applied to a polynucleotide or polypeptide sequence, refers to a sequence that differs from a wild-type sequence due to one or more deletions, additions, substitutions, or any combination thereof.
[0067] As used herein, by “isolate” or “purify” (or grammatical equivalents) a virus vector, it is meant that the virus vector is at least partially separated from at least some of the other components in the starting material.
[0068] The terms “enhance” and “increase” refer to an increase in the specified parameter of at least about 1.25-fold, 1.5-fold, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 8-fold, 10-fold, twelve-fold, or even fifteen-fold.
[0069] The terms “inhibit” and “reduce” or grammatical variations thereof as used herein refer to a decrease or diminishment in the specified level or activity of at least about 15%, 25%, 35%, 40%, 50%, 60%, 75%, 80%, 90%, 95% or more. In particular embodiments, the inhibition or reduction results in little or essentially no detectible activity (at most, an insignificant amount, e.g., less than about 10% or even 5%).
[0070] As used herein, “expression” refers to the process by which a polynucleotide is transcribed from a DNA template (such as into an mRNA or other RNA transcript) and/or the process by which a transcribed mRNA is subsequently translated into peptides, polypeptides, or proteins. Transcripts may be referred to as “transcription products” and encoded polypeptides may be referred to as “translation products.” Transcripts and encoded polypeptides may be collectively referred to as “gene products.” If the polynucleotide is derived from genomic DNA, expression may include splicing of the mRNA in a eukaryotic cell. The expression product itself, e.g., the resulting nucleic acid or protein, may also be said to be “expressed.” An expression product can be characterized as intracellular, extracellular or secreted. The term “intracellular” means something that is inside a cell. The term “extracellular” means something that is outside a cell. A substance is “secreted” by a cell if it appears in significant measure outside the cell, from somewhere on or inside the cell.
[0071] As used herein, the term “synthetic gene” refers to a nucleic acid sequence generated non-naturally by deliberate human design, the synthetic gene comprising, among other components, a coding region for a protein or nucleic acid of interest, and regulatory regions for expression of the coding region. Structural and functional components of the synthetic gene may be incorporated from differing and/or a plurality of source material. The synthetic gene may be delivered exogenously to a subject, wherein it would be exogenous in comparison to a corresponding endogenous gene. When expressed in a cell, the synthetic gene product may be referred to as a synthetic product (e.g., “synthetic RNA” or “synthetic polypeptide”). Under certain conditions, the synthetic gene may also be interchangeably referred to as a “transgene.” As used herein, the terms “transgenic” and/or “transgene” refer to a nucleic acid sequence containing a functional coding region for a gene that comprises one or more exogenous nucleic acids. The exogenous nucleic acid can be stably integrated within the genome such that the polynucleotide is passed on in successive cell divisions. The exogenous nucleic acid can be integrated into the genome alone or as part of a recombinant expression cassette. “Transgenic” may be used to designate any substrate the genotype of which has been altered by the presence of an exogenous nucleic acid.
[0072] The term “feedback” refers to molecular encoded information being provided to a substrate as a result of some result, effect, or function performed by that same substrate. The substrate may be any type of micro or macro molecule, including but not limited to genes or transcriptional or translation products of genes such as RNAs and proteins. The term “feedback loop” refers to the loop of a molecule performing a function, effect, and/or result, whereupon the information of that function, effect, and/or result is returned to the receiving source. For example, the function, effect, and/or result of the expression of a gene (e.g., MECP2) can result in feedback via the binding of miRNAs onto the mRNA derived from that gene, when those miRNAs were expressed due to the function, effect, and/or result of the expression of that gene. A feedback loop can be inhibitory/negative (i.e., suppressing the continuation of further function, effect, and/or result), or positive (enhancing continuation). A substrate capable of receiving feedback is said to be “feedback-enabled.” Feedback that is variable in strength of inhibition and/or enhancement dependent on the expression level and/or function of a nucleic acid or transcription or translation product of a gene can be said to be “dose dependent” feedback, and/or a “dose dependent feedback loop.”
[0073] The terms “polypeptide,” “peptide” and “protein” may be used interchangeably to refer to polymers of amino acids of any length. The terms “nucleic acid,” “nucleic acid sequence,” and “polynucleotide” may be used interchangeably to refer to polymers of nucleotides of any length. As used herein, the terms “nucleotide sequence,” “polynucleotide,” “nucleic acid sequence,” “nucleic acid molecule” and “nucleic acid fragment” refer to a polymer of RNA, DNA, or RNA and DNA that is single- or double-stranded, optionally containing synthetic, non-natural and/or altered nucleotide bases.
[0074] As used herein, the terms “gene of interest,” “nucleic acid of interest” and/or “protein of interest” refer to that gene/nucleic acid/protein desired under specific contextual conditions.
[0075] The term “regulatory element” refers to a genetic element which controls some aspect of the expression of nucleic acid sequences. For example, a promoter is a regulatory element that facilitates the initiation of transcription of an operably linked coding region. Other regulatory elements are splicing signals, polyadenylation signals, termination signals, etc. The region in a nucleic acid sequence or polynucleotide in which one or more regulatory elements are found is referred to as a “regulatory region.”
[0076] The term coding region as used herein, refers to the portion of a polynucleotide, e.g., a gene, that encodes a polypeptide.
[0077] As used herein with respect to nucleic acids, the term “operably linked” refers to a functional linkage between two or more nucleic acids. For example, a promoter sequence may be described as being “operably linked” to a heterologous nucleic acid sequence because the promoter sequences initiates and/or mediates transcription of the heterologous nucleic acid sequence. In some embodiments, the operably linked nucleic acid sequences are contiguous and/or are in the same reading frame.
[0078] As used herein, the term “binding site” refers to any general structural feature that acts as a location for binding between components. As applied to nucleic acids or polynucleotides, the term “binding site” can refer to, though is not limited to, a nucleotide sequence in a specific motif of primary, secondary, or tertiary structure wherein that motif provides a binding location for an interacting molecule, which may comprise other nucleic acids or proteins. As applied to peptides, polypeptides, or proteins, the term “binding site” can refer to, though is not limited to, a sequence of amino acids in a specific motif of primary, secondary, tertiary or quaternary structure wherein that motif provides a binding location for an interacting molecule, which may comprise other nucleic acids or proteins.
[0079] As used herein, the term “seed match” specifically refers to a subset of nucleotides within a longer endogenous mRNA sequence empirically identified, validated, or putatively predicted to be the relevant target nucleotide sequence for recognition by, and complementary binding of, a miRNA species to the corresponding mRNA containing said seed match. The terms “seed” or “seed region” refer to a subset of nucleotides within the longer endogenous miRNA sequence empirically identified, validated, or putatively predicted to be the relevant nucleotide sequence for recognition of, and complementary binding to, a target seed match of an mRNA species by that miRNA species. In general, the seed match of an mRNA is encoded within its respective 3 prime (3′) untranslated region (3′ UTR), but may be present in other locations. A “validated” or “empirically identified” seed match is defined as a seed match currently known in the art and those identified in the future. A “putative” or “predicted” seed match is defined as a seed match not yet empirically known or defined.
[0080] The terms “5 prime (5′) flanking sequence” and/or “3′ flanking sequence” refer to a subset of nucleotides in sequence found immediately adjacent to (i.e. “neighboring”) a specified sequence (e.g., the seed match) on either end of the sequence of interest (i.e., the 5′ flanking end, and/or the 3′ flanking end) within the source sequence. In some cases, 5′ flanking sequences may provide additional Watson-Crick (WC) complementary binding to the matching miRNA. Together, the 5′ and 3′ flanking sequences contribute to an inter-seed match spacing that may promote cooperative repression by two or more miRNAs binding to neighboring seed matches (Grimson et al., 2007). 5′ and 3′ flanking sequences may also provide a high % adenylate-uridylate (AU) nucleotide context that has been correlated with effective seed matches (Grimson et al., 2007).
[0081] The term “3′ UTR” refers to the section of mRNA that immediately follows the translation termination codon. In general, an mRNA molecule is transcribed from a DNA sequence and later translated into a peptide, polypeptide, or protein. Several regions of sequence of the mRNA molecule are not translated into protein, including the 5′ cap, 5′ untranslated region (5′ UTR), 3′ UTR, and polyadenylation (polyA) tail. In general, the 3′ UTR contains regulatory regions that may influence gene expression post-transcriptionally.
[0082] As used herein, the terms “gene-dose sensitive” or “dose sensitive” disorders refer to diseases or disorders where the initiation, presentation, progression, symptoms, phenotypes and other related phenomena are variable due to and in congruence with the relative functional expression levels of nucleic acids (e.g., a gene) or transcription or translation products of that gene (e.g., an RNA species or protein) involved in the initiation, presentation, progression, symptoms, phenotypes or other related phenomena of the disease or disorder. For example, a disorder may be described as dose sensitive if its phenotype changes with different expression levels of a specific gene. For another example, a disorder may also be referred to as dose-sensitive when a gene is mutated to produce a hypo- or hyper-functioning protein that influences the initiation, presentation, progression, symptoms, phenotypes or other related phenomena of the disorder.
[0083] As used herein, the term “intellectual ability disorders” refers to a group of diseases, disorders, or disabilities that affect the neurodevelopmental intellectual functioning, mental abilities, cognitive abilities, and/or adaptive functioning of a subject, i.e., the “intellectual ability” of a subject, including the abilities to reason, plan, think, and communicate. The term “intellectual ability disorder” may be used interchangeably with “intellectual disability.” Other symptomology that may present along with intellectual ability disorders includes, but is not limited to, speech abnormalities, seizures, microcephaly, hypotonia, bruxism, and/or stereotypy. Intellectual ability disorders that vary in their initiation, presentation, progression, symptoms, phenotypes or other related phenomena may be referred to as “dose sensitive intellectual ability disorders,” and their causative genes may be referred to as “dose-sensitive genes that mediate intellectual ability.”
[0084] As used herein, the terms “target tissue” and “off-target tissue” refer to bodily regions, organs, tissues, structures and/or cells of the subject wherein a specified nucleic acid or protein of interest is expressed. “Target tissues” are those regions, organs, tissues, structures and/or cells of the subject wherein the endogenous nucleic acid or protein of interest is expressed under typical healthy and/or diseased conditions. “Off-target tissues” are those regions, organs, tissues, structures and/or cells of the subject wherein the endogenous nucleic acid or protein of interest is not expressed under typical healthy and/or diseased conditions.
[0085] A “vector” refers to a compound used as a vehicle to carry foreign genetic material into another cell, where it can be replicated and/or expressed. A cloning vector containing foreign nucleic acid is termed a recombinant vector. Examples of nucleic acid vectors are plasmids, viral vectors, cosmids, expression cassettes, and artificial chromosomes. Recombinant vectors typically contain an origin of replication, a multicloning site, and a selectable marker. The nucleic acid sequence typically consists of an insert (recombinant nucleic acid or transgene) and a larger sequence that serves as the “backbone” of the vector. The purpose of a vector which transfers genetic information to another cell is typically to isolate, multiply, or express the insert in the target cell. Expression vectors (expression constructs or expression cassettes) are for the expression of the exogenous gene in the target cell, and generally have a promoter sequence that drives expression of the exogenous gene. Insertion of a vector into the target cell is referred to transformation or transfection for bacterial and eukaryotic cells, although insertion of a viral vector is often called transduction. The term “vector” may also be used in general to describe items to that serve to carry foreign genetic material into another cell, such as, but not limited to, a transformed cell or a nanoparticle.
[0086] By “pharmaceutically acceptable” it is meant a material that is not toxic or otherwise undesirable, i.e., the material may be administered to a subject without causing any undesirable biological effects.
[0087] As used herein, the term “polynucleotide target cassette” refers to a nucleotide sequence and/or nucleotide cassette comprising one or more predetermined seed matches and 5′ and 3′ flanking sequences neighboring each seed match. The polynucleotide target cassette may be designed by appropriate selection of seed matches to protect against overexpression phenotypes shared by multiple disorders with distinct genetic etiologies, but common target tissues, when the cassette is inserted to a target gene. The polynucleotide target cassette can comprise any number of seed matches and 5′ and 3′ flanking sequences.
[0088] By the terms “treat,” “treating,” and “treatment of” (or grammatically equivalent terms) it is meant that the severity of the subject's condition is reduced or at least partially improved or ameliorated and/or that some alleviation, mitigation or decrease in at least one clinical symptom is achieved and/or there is a delay in the progression of the condition and/or prevention or delay of the onset of a disease or disorder.
[0089] As used herein, the terms “prevent,” “prevents,” and “prevention” (and grammatical equivalents thereof) refer to a delay in the onset of a disease or disorder or the lessening of symptoms upon onset of the disease or disorder. The terms are not meant to imply complete abolition of disease and encompass any type of prophylactic treatment that reduces the incidence of the condition or delays the onset and/or progression of the condition.
[0090] A “treatment effective” amount as used herein is an amount that is sufficient to provide some improvement or benefit to the subject. Alternatively stated, a “treatment effective” amount is an amount that will provide some alleviation, mitigation, decrease or stabilization in at least one clinical symptom in the subject. Those skilled in the art will appreciate that the therapeutic effects need not be complete or curative, as long as some benefit is provided to the subject.
[0091] A “prevention effective” amount as used herein is an amount that is sufficient to prevent and/or delay the onset of a disease, disorder and/or clinical symptoms in a subject and/or to reduce and/or delay the severity of the onset of a disease, disorder and/or clinical symptoms in a subject relative to what would occur in the absence of the methods of the invention. Those skilled in the art will appreciate that the level of prevention need not be complete, as long as some benefit is provided to the subject.
[0092] The terms “administering” and “administration” of a synthetic gene, expression cassette, vector, plasmid, viral vector, transformed cell, nanoparticle, or pharmaceutical composition to a subject include any route of introducing or delivering to a subject a compound to perform its intended function. Administration can be carried out by any suitable route, including orally, intranasally, parenterally (intravenously, intramuscularly, intraperitoneally, intracisternally, intrathecally, intraventricularly, or subcutaneously), or topically. Administration includes self-administration and administration by another.
Synthetic Genes
[0093] This invention relates to feedback-enabled synthetic genes, polynucleotide target cassettes, vectors, and pharmaceutical compositions for the purpose of providing transgene expression in target tissues that is capable of endogenous regulation, for treating disorders such as dose-sensitive intellectual ability disorders.
[0094] Thus, one aspect of the invention relates to a synthetic gene comprising a polynucleotide comprising a coding region encoding a protein or nucleic acid of interest and one or more regulatory regions, wherein the polynucleotide further comprises one or more nucleic acid segments each comprising a seed match identified as a binding site for an endogenous miRNA and a 5′ flanking sequence and a 3′ flanking sequence neighboring said seed match, wherein said one or more nucleic acid segments are inserted into a regulatory region of said polynucleotide such that expression of said protein or nucleic acid of interest when said synthetic gene is delivered to a cell expressing the endogenous miRNA is reduced relative to expression of a protein or nucleic acid of interest when a synthetic gene that does not comprise the one or more nucleic acid segments is delivered to a cell expressing the endogenous miRNA.
[0095] In some embodiments, the coding region encoding a nucleic acid or protein of interest comprises the coding region of a gene or an active fragment of a gene, e.g., a gene associated with intellectual ability gene-dose sensitive disorders. Genes associated with intellectual ability gene-dose sensitive disorders include but are not limited to TCF4, UBE3A, DYRK1A, MEF2C, NSD1, ZEB2, MBD5, RPS6KA3, ATRX, MECP2, FOXG1, AKT3, SLC6A1, or an active fragment thereof. In some embodiments, the coding region encoding a protein or nucleic acid of interest comprises the coding region of the gene MECP2 or an active fragment thereof.
[0096] The seed match may be of any nucleotide sequence length, generally of about 3 to about 10 nucleotides, e.g., 3, 4, 5, 6, 7, 8, 9, 10 or any range therein. In some embodiments, the seed match of the present invention is about 5 to about 10 nucleotides in length. In some embodiments, the seed match of the present invention is about 6 to about 8 nucleotides in length.
[0097] The synthetic gene of the present invention may contain one or more seed matches and 5′ and 3′ flanking sequences. In some embodiments, the synthetic gene comprises at least two seed matches, e.g., at least 2, 3, 4, 5, 6, 7, 8, 9, 10 or more or any range therein. In some embodiments, the synthetic gene comprises three or more seed matches. In some embodiments, the synthetic gene comprises three or more seed matches. In some embodiments, the synthetic gene comprises 3 to 8 seed matches. In some embodiments, some or all seed matches are in the 3′ UTR.
[0098] The 5′ and/or 3′ flanking nucleotide sequence may be of any length, generally of about 1 to about 30 nucleotides on each 5′ and/or 3′ end of the specified sequence (e.g., the seed match). In some embodiments, the flanking nucleotide sequences of the present invention are about 9 to about 13 nucleotides on each 5′ and/or 3′ end of the specified sequence (e.g., the seed match). In some embodiments, the flanking nucleotide sequences are about 11 nucleotides on each 5′ and/or 3′ end of the specified sequence (e.g., the seed match). Thus, in some embodiments of the present invention, the total number of nucleotides of the 5′ and 3′ flanking sequences of the specified sequence (e.g., the seed match), is about 7 to about 40 nucleotides, e.g., 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleotides or any range therein. In some embodiments, the total number of nucleotides of the 5′ and 3′ flanking sequences of the specified sequence (e.g., the seed match), is about 20 to about 25 nucleotides. In some embodiments, the total number of nucleotides of the 5′ and 3′ flanking sequences of the specified sequence (e.g., the seed match), is about 22 nucleotides. In some embodiments, each seed match is separated from the next most proximate seed match by the 3′ and 5′ flanking sequences between them. Thus, in some embodiments of the present invention, the at least two seed matches are separated by about 7 to about 40 nucleotides. In some embodiments, the at least two seed matches are separated by about 20 to about 25 nucleotides. In some embodiments, the at least two seed matches are separated by about 22 nucleotides.
[0099] The seed matches and 5′ and 3′ flanking sequences of the present invention may bind to one or more miRNAs. In some embodiments, the seed matches and 5′ and 3′ flanking sequences bind to one or more miRNAs including miR-690, miR-124-3p, miR-451a, miR-9-5p, miR-26-5p, miR-23-3p, miR-218-5p, miR-27-3p, let-7-5p/98-5p, miR-29-3p, miR-338-3p, miR-98-5p, miR-7-5p, miR-494-3p, or any combination thereof. In addition, while not wishing to be bound to theory, it is conceptually possible that miRNAs yet to be identified could contribute to the MeCP2 feedback loop. Any miRNA containing a seed sequence permitting Watson-Crick (WC) base-pairing between a particular miRNA seed and the miRNA seed matches in a target panel may help mediate endogenous regulation of the exogenous target nucleic acid or protein of interest, i.e., the product of the coding region encoding a nucleic acid or protein of interest. Thus, in some embodiments, the seed matches and 5′ and 3′ flanking sequences bind to one or more miRNAs comprising a seed sequence permitting WC base-pairing between the miRNA seed sequence and the seed matches of the present invention. In some embodiments, the seed matches and 5′ and 3′ flanking sequences bind to the miRNAs miR-9-5p, miR-26-5p, miR-23-3p, miR-218-5p, miR-27-3p, and let-7-5p. In some embodiments, the seed matches and 5′ and 3′ flanking sequences bind to the miRNAs miR-690, miR-451a, and let-7-5p. In some embodiments, the seed matches and 5′ and 3′ flanking sequences do not bind to the miRNAs miR-22, miR-19, miR-132, and/or miR-124. In some embodiments, the seed matches and flanking 5′ and 3′ sequences neighboring the seed matches comprise, consist essentially of, or consist of the nucleotide sequence of SEQ ID NO:1 or a nucleotide at least 70% identical thereto, e.g., at least about 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% identical thereto, which contains seed matches for miR-9-5p, miR-26-5p miR-23-3p, miR-218-5p, miR-27-3p, and let-7-5p. Seed matches are underlined.
TABLE-US-00001 “Reg2” target seed matches and 5′ and 3′ flanking sequences SEQ ID NO: l. 5 ′CTGTTCTAGCCCCCAAAGAGTTTTCTGTGCTTGCTTTTGAAACTTGA AGTCTTGAAAACCAAAGACATAGATGTGAAAATTTTAGGCAGTGTAAGCT GATAGCACAAGTTCTGGCGACTCACAATTATGCTGTGAATTTTACAAAAA GAAGCAGTAATCTACCTCAGCCGATAAC-3′
[0100] In some embodiments, the seed matches and flanking 5′ and 3′ sequences neighboring the seed matches comprise, consist essentially of, or consist of the nucleotide sequence of SEQ ID NO:2 or a nucleotide at least 70% identical thereto, e.g., at least about 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% identical thereto, which contains seed matches for miR-451a, let-7-5p, and miR-690. Seed matches are underlined.
TABLE-US-00002 “Reg1” target seed matches and 5′ and 3′ flanking sequences SEQ ID NO: 2. 5′ATAAGGGCAGAAACGGTTCACATTCCATTCTGCCCCGGACCTACCTCC CTCCCTCTCCTTATCAAACCCTAGCCTTGCTTGTTAAAT-3′
[0101] In some embodiments, the present invention comprises a vector comprising a synthetic gene. A vector can be any suitable means for delivering a polynucleotide to a cell. In some embodiments, the vector is a plasmid, a viral vector, an expression cassette, a transformed cell, or a nanoparticle.
[0102] In particular embodiments, the present invention provides a pharmaceutical composition comprising a synthetic gene or vector of the invention in a pharmaceutically acceptable carrier. In some embodiments, the present invention provides a pharmaceutical composition comprising a synthetic gene or vector of the invention in a pharmaceutically acceptable carrier and, optionally, other medicinal agents, pharmaceutical agents, stabilizing agents, buffers, carriers, adjuvants, diluents, etc. For injection, the carrier will typically be a liquid. For other methods of administration, the carrier may be either solid or liquid. For inhalation administration, the carrier will be respirable, and will preferably be in solid or liquid particulate form.
[0103] In particular embodiments, the present invention provides a polynucleotide target cassette for providing dose dependent inhibitory feedback to a synthetic gene, the cassette comprising one or more nucleic acid segments each comprising a seed match identified as a binding site for an endogenous miRNA and 5′ and 3′ flanking sequences neighboring said seed match. Polynucleotide target cassettes can be used to generate a synthetic gene via insertion of the cassette into a regulatory region of a polynucleotide of the synthetic gene, thereby providing the capability of dose dependent inhibitory feedback to the synthetic gene wherein miRNAs capable of binding to the provided seed matches within the polynucleotide target cassette can regulate expression of the synthetic gene.
[0104] The polynucleotide target cassette can comprise any number of seed matches and 5′ and 3′ flanking sequences. In some embodiments, the polynucleotide comprises at least two seed matches and 5′ and 3′ flanking sequences, e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10 or more or any range therein. In some embodiments, the polynucleotide target cassette comprises three or more seed matches and 5′ and 3′ flanking sequences. In some embodiments, the polynucleotide target cassette comprises 3 to 8 seed matches and 5′ and 3′ flanking sequences. In some embodiments, the polynucleotide target cassette comprises seed matches and 5′ and 3′ flanking sequences that bind to one or more miRNAs which may help mediate exogenous regulation of the target nucleic acid or protein of interest, i.e., the product of the coding region encoding a nucleic acid or protein of interest, wherein said one or more miRNAs comprise a seed sequence permitting WC base-pairing between the miRNA seed sequence and the seed matches. In some embodiments, the polynucleotide target cassette comprises seed matches and 5′ and 3′ flanking sequences that bind to one or more miRNAs selected from miR-690, miR-9-5p, miR-26-5p miR-23-3p, miR-218-5p, miR-27-3p, let-7-5p, or any combination thereof. In some embodiments, the polynucleotide target cassette comprises seed matches and 5′ and 3′ flanking sequences that bind to the miRNAs miR-9-5p, miR-26-5p miR-23-3p, miR-218-5p, miR-27-3p, and let-7-5p. In some embodiments, the polynucleotide target cassette comprises seed matches and 5′ and 3′ flanking sequences that bind to the miRNAs miR-690, miR-451a, and let-7-5p. In some embodiments, the polynucleotide target cassette comprises seed matches wherein the seed match is about 5 to about 10 nucleotides in length. In some embodiments, the polynucleotide target cassette comprises seed matches wherein the seed match is about 6 to about 8 nucleotides in length. In some embodiments, the polynucleotide target cassette comprises 5′ and 3′ flanking sequences neighboring the seed matches that are each about 9 to about 13 nucleotides in length. In some embodiments, the polynucleotide target cassette comprises 5′ and 3′ flanking sequences neighboring the seed matches that are each about 11 nucleotides in length. In some embodiments, the polynucleotide target cassette comprises seed matches and 5′ and 3′ flanking sequences neighboring the seed matches that comprise, consist essentially of, or consist of the nucleotide sequence SEQ ID NO:1 or a nucleotide at least 70% identical thereto, e.g., at least about 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% identical thereto. In some embodiments, the polynucleotide target cassette comprises seed matches and 5′ and 3′ flanking sequences neighboring the seed matches that comprise, consist essentially of, or consist of the nucleotide sequence SEQ ID NO:2 or a nucleotide at least 70% identical thereto, e.g., at least about 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% identical thereto.
Methods of Making a Synthetic Gene
[0105] The present invention further provides methods of making synthetic genes, wherein the synthetic genes exhibit dose dependent inhibitory feedback. In one embodiment, the present invention provides a method of preparing a synthetic gene comprising a polynucleotide comprising a coding region encoding a protein or nucleic acid of interest and one or more regulatory regions, comprising the step of inserting a polynucleotide target cassette of the invention into a regulatory region of the synthetic gene.
[0106] In some embodiments, the present invention provides a method of inserting a nucleic acid segment into a regulatory region of the synthetic gene. In some embodiments, the present invention provides a method of inserting a seed match known or newly identified to bind to a miRNA of interest into a regulatory region of a polynucleotide of a synthetic gene. In some embodiments, the present invention provides a method of preparing a synthetic gene by inserting a polynucleotide target cassette into a regulatory region of a polynucleotide of the synthetic gene, thereby providing the capability of dose dependent inhibitory feedback to the synthetic gene wherein miRNAs capable of binding to the provided seed matches within the polynucleotide target cassette can regulate expression of the synthetic gene. In some embodiments, the present invention provides a method of making a synthetic gene comprising the step of inserting one or more nucleic acid segments comprising a seed match and 5′ and 3′ flanking sequences into a regulatory region of a polynucleotide of the synthetic gene. In some embodiments, the methods may include removing one or more endogenous seed matches found within a regulatory region of a polynucleotide of a synthetic gene.
[0107] In some embodiments, seed matches and 5′ and 3′ flanking sequences inserted in a synthetic gene can bind to miRNAs expressed in target tissues and/or off-target tissues, thereby providing feedback enablement to the synthetic gene that inhibits expression of the synthetic gene in off-target tissues and provides endogenous regulation of the synthetic gene in target tissues. In some embodiments, the synthetic gene of the present invention excludes seed matches and 5′ and 3′ flanking sequences from miRNAs expressed in off-target tissues. In some embodiments, the synthetic gene of the present invention excludes seed matches and 5′ and 3′ flanking sequences for the miRNAs miR-22, miR-19, miR-132, and/or miR124.
[0108] In another embodiment, the present invention provides a method of making a synthetic gene, comprising the steps of: screening for miRNAs with increased expression when a protein or nucleic acid of interest is expressed in a cell relative to when the protein or nucleic acid of interest is not expressed; identifying a seed match and flanking regions for one or more miRNAs having increased expression; preparing a nucleic acid segment comprising said seed match and flanking regions to be inserted into a regulatory region of said polynucleotide, inserting one or more of the nucleic acid segments comprising a seed match identified as a binding site for an endogenous miRNA and 5′ and 3′ flanking sequences neighboring said seed match into a regulatory region of a polynucleotide comprising a coding region encoding a protein or nucleic acid of interest and one or more regulatory regions.
[0109] In some embodiments of a method of making a synthetic gene, the coding region encoding a protein or nucleic acid of interest comprises a coding region of a gene selected from TCF4, UBE3A, DYRK1A, MEF2C, NSD1, ZEB2, MBD5, RPS6KA3, ATRX, MECP2, SLC6A1, FOXG1, AKT3, or an active fragment thereof. Active fragments may include, but are not limited to, active fragments of MeCP2, such as the ΔN, ΔNC, and/or ΔNC active MeCP2 fragments which account for 88%, 52% and 32% respectively of full-length MeCP2, but retain conserved functionality of methyl-CpG binding and nuclear receptor co-repressor/silencing mediator of retinoic acid and thyroid hormone receptors (NCoR/SMRT) interaction to allow for physical connection of DNA with the NCoR/SMRT complex. These active fragments are truncations of full-length MeCP2 protein, wherein ΔN contains a deletion of residues 13-71 N-terminal to the methyl-CpG binding domain (MBD), residues 72-173) of full-length MeCP2 isoform e2, ΔNC contains an additional deletion of residues 313-484 C-terminal of the NCoR-SMRT interaction domain (NID, residues 272-312), and ΔNIC additionally replaces the intervening amino acids between the MBD and NID domains with a nuclear localization signal from SV40 virus connected by a short flexible linker, as described in Tillotson et al. (Tillotson et al. 2017 Nature 550(7676):398-401), which disclosure is fully incorporated herein by reference. Active fragments of MeCP2 used for the treatment of RTT are derived from the e1 isoform of MeCP2. The amino acid numbering described herein is based on the MeCP2 e2 isoform amino acid sequence, by convention.
[0110] In some embodiments, the coding region encoding a protein or nucleic acid of interest comprises the coding region of a gene MECP2 or an active fragment thereof. In some embodiments, the one or more nucleic acid segments bind to one or more miRNAs selected from the group consisting of miR-690, miR-124-3p, miR-451a, miR-9-5p, miR-26-5p, miR-23-3p, miR-218-5p, miR-27-3p, let-7-5p/98-5p, and miR-494-3p. In some embodiments, the seed matches and 5′ and 3′ flanking sequences bind to the miRNAs miR-9-5p, miR-26-5p miR-23-3p, miR-218-5p, miR-27-3p, and let-7-5p. In some embodiments, the seed matches and 5′ and 3′ flanking sequences bind to the miRNAs miR-690, miR-451a, and let-7-5p.
[0111] In another aspect, the present invention provides for a method of identifying one or more seed matches and 5′ and 3′ flanking sequences to be inserted in a synthetic gene, comprising the steps of: identifying a seed match and 5′ and 3′ flanking sequences for one or more miRNAs having increased expression when a protein or nucleic acid of interest is expressed in a cell relative to when the protein or nucleic acid of interest is not expressed in the cell; and inserting said seed match and 5′ and 3′ flanking sequences into a regulatory region of a synthetic gene comprising a polynucleotide comprising a coding region encoding the protein or nucleic acid of interest and one or more regulatory regions. In some embodiments, a method of identifying one or more seed matches and 5′ and 3′ flanking sequences to be inserted into a synthetic gene additionally comprises the steps of: expressing the protein or nucleic acid of interest in a cell; collecting miRNA from the cell; and calculating expression levels of said miRNAs when said protein or nucleic acid of interest is expressed in the cell relative to when said protein or nucleic acid of interest is not expressed in the cell, thereby creating a nucleic acid dataset of said miRNAs. In some embodiments, the method of identifying can comprise screening a nucleic acid dataset (e.g., a preexisting dataset) for miRNAs with increased expression when a protein or nucleic acid of interest is expressed in a cell relative to when the protein or nucleic acid of interest is not expressed in the cell, and/or identifying miRNAs with increased expression when a protein or nucleic acid of interest is expressed in a cell relative to when the protein or nucleic acid of interest is not expressed in the cell, and/or screening a nucleic acid dataset for a validated or putative seed match and 5′ and 3′ flanking sequences.
[0112] As used herein, the term “dataset” refers to a collection of related sets of information, i.e., data, attained from experimental or computational analyses, comprising any type of data, including but not limited to nucleic acid sequences or amino acid sequences. The dataset may be screened and/or otherwise searched for particular data of interest depending on variable parameters as defined by each particular dataset. In some embodiments, the dataset is a nucleic acid dataset, i.e., a dataset comprising nucleic acid sequences. In some embodiments, the dataset is a 3′ UTR dataset.
[0113] In some embodiments, the protein or nucleic acid of interest is a transcription or translation product of a gene selected from TCF4, UBE3A, DYRK1A, MEF2C, NSD1, ZEB2, MBD5, RPS6KA3, ATRX, SLC6A1, FOXG1, AKT3, MECP2, or an active fragment thereof. In some embodiments, the protein or nucleic acid of interest is a transcription or translation product of a gene MECP2 or an active fragment thereof.
[0114] Methods of Using a Synthetic Gene
[0115] In another aspect of the present invention, a method of delivering a synthetic gene is provided, the method comprising administering to the subject a synthetic gene, a vector, and/or a pharmaceutical composition of the invention, thereby delivering the synthetic gene to the subject.
[0116] In an additional aspect of the present invention, a method of treating a disease associated with abnormal expression of an endogenous gene in a target tissue or expression of a mutant protein encoded by an endogenous gene in a target tissue is provided, the method comprising administering a synthetic gene, a vector, and/or a pharmaceutical composition of the present invention encoding a protein or nucleic acid of interest encoded by the endogenous gene, thereby treating the disease. In some embodiments, the present invention can be administered to target tissues. In some embodiments, the present invention can be administered to target and off-target tissues, thereby inhibiting expression of the synthetic gene in off-target tissues and endogenously regulating expression of the synthetic gene in target tissues.
[0117] In some embodiments, the method of treating a disease may further comprise the step of genetically knocking down and/or knocking out an endogenous gene encoding the protein or nucleic acid of interest in the subject. In some embodiments, the endogenous gene encoding the protein or nucleic acid of interest is MECP2. Genetically knocking down or “knock down of,” or knocking out or “knock out of” an endogenous gene can be performed with any technique or method known currently or later identified in the art, including but not limited to using RNAi, Transcription Activator-like Effectors and Nucleases (TALE and TALEN), or Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR-cas9) methods to introduce a matching shRNA, TALE or TALEN, or CRISPR/cas9 expression vector into the subject, tissue, and/or cell expressing the endogenous gene, thereby removing or reducing the expression of the endogenous nucleic acid or protein of interest relative to the expression of the endogenous nucleic acid or protein without the treatment of RNAi, TALE, TALEN, or CRISPR/cas9. These techniques and others are reviewed in Boettcher and McManus 2015 Mol. Cell 58(4):575-585, and U.S. Pat. No. 7,195,916 to Qin et al., U.S. Pat. No. 8,440,431 to Voytas et al., U.S. Pat. No. 8,889,356 to Zhang, U.S. Pat. No. 8,871,445 to Cong et al., and 10,000,772 to Doudna et al, each incorporated herein by reference in its entirety.
[0118] In an additional embodiment of the present invention, a method of treating a disease associated with abnormal expression of an endogenous gene or expression of a mutant protein encoded by an endogenous gene in a subject is provided, the method comprising the steps of genetically knocking down the endogenous gene in a cell of the subject, and administering the synthetic gene, vector, pharmaceutical composition of the present invention encoding a protein or nucleic acid of interest encoded by the endogenous gene, thereby treating the disease.
[0119] The terms “patient,” “subject,” “individual,” and the like are used interchangeably herein, and refer to any animal, or cells thereof whether in vitro or in situ, amenable to the methods described herein. In a preferred embodiment, the patient, subject, or individual is a mammal. In some embodiments, the mammal is a mouse, a rat, a guinea pig, a non-human primate, a dog, a cat, or a domesticated animal (e.g. horse, cow, pig, goat, sheep). In some embodiments, the patient, subject or individual is a human. In some embodiments, the patient, subject or individual is at risk for an intellectual ability gene-dose sensitive disorder. In some embodiments, the patient, subject, or individual is at risk for Rett syndrome. As a further option, the subject can be a laboratory animal and/or an animal model of disease.
[0120] A further aspect of the invention relates to a method of treating a disorder associated with aberrant expression of a nucleic acid or protein of interest in a subject in need thereof, comprising delivering to the subject a therapeutically effective amount of the synthetic gene, vector, and/or pharmaceutical composition of the invention, thereby treating the disorder associated with aberrant expression of the nucleic acid or protein of interest in the subject. In some embodiments, the nucleic acids or proteins of interest are associated with intellectual ability gene-dose sensitive disorders. Nucleic acids or proteins of interest associated with intellectual ability gene-dose sensitive disorders include but are not limited to TCF4, UBE3A, DYRK1A, MEF2C, NSD1, ZEB2, MBD5, RPS6KA3, ATRX, FOXG1, AKT3, SLC6A1, MECP2 or any active fragment thereof.
[0121] Intellectual ability gene-dose sensitive disorders include, but are not limited to Rett syndrome, MeCP2 duplication syndrome, Angelman syndrome, dup15Q, DYRK1A haploinsufficiency, Down syndrome, MEF2C haploinsufficiency syndrome, dup5Q14.3, Sotos syndrome, Reverse Sotos syndrome, Alpha-thalassemia X-linked intellectual disability syndrome, Xq13.2q21.1 duplication, Coffin-Lowry syndrome, Xp22.12 duplication, Pitt Hopkins syndrome, Mowat-Wilson Syndrome, 2q22.3 triplication, 2q23.1 duplication, 2q23.1 microdeletion, FOXG1 syndrome, West Syndrome, megalencephaly-polymicrogyria-polydactyly-hydrocephalus syndrome, AKT3 duplication, Doose syndrome, SLC6A1 duplication, and Trisomy 18. In some embodiments, the nucleic acid or protein of interest is MECP2 or any active fragment thereof, and the intellectual ability gene-dose sensitive disorders associated with MECP2 are Rett Syndrome and/or MeCP2 duplication syndrome.
[0122] In certain embodiments, the synthetic gene, vector, and/or pharmaceutical composition is delivered to the subject, e.g., systemically (e.g., intravenously) or directly to the central nervous system (e.g., to the cerebrospinal fluid by intrathecal, intracisternal, or intraventricular injection) of the subject. In some embodiments, the synthetic gene, vector, and/or pharmaceutical composition is delivered by a delivery route selected from enteral, parenteral, intrathecal, intracisternal, intracerebral, intraventricular, intranasal, intra-aural, intra-ocular, peri-ocular, intrarectal, intramuscular, intraperitoneal, intravenous, oral, sublingual, subcutaneous and transdermal. In some embodiments, the synthetic gene, vector, and/or pharmaceutical composition is delivered intravenously. In some embodiments, the synthetic gene, vector, and/or pharmaceutical composition is delivered intravenously, intracisternally, intrathecally, and/or intraventricularly to be delivered directly to the cerebrospinal fluid (“intraCSF”).
[0123] One aspect of the present invention is a method of transferring a synthetic gene to a cell in vitro. The synthetic gene and/or vector of the invention may be introduced to the cells in the appropriate amount. In embodiments of a virus vector, the virus vector may be introduced to the cells at the appropriate multiplicity of infection according to standard transduction methods appropriate for the particular target cells. Titers of the virus vector or capsid to administer can vary, depending upon the target cell type and number, and the particular virus vector or capsid, and can be determined by those of skill in the art without undue experimentation. In particular embodiments, at least about 10.sup.2 infectious units, more preferably at least about 10.sup.2, 10.sup.3, 10.sup.4, 10.sup.5, 10.sup.6, 10.sup.7, 10.sup.8, 10.sup.9, 10.sup.10, 10.sup.11, 10.sup.12, or 10.sup.13 infectious units are introduced to the cell.
[0124] The cell(s) into which the synthetic gene and/or vector of the invention, e.g., virus vector, can be introduced may be of any type, including but not limited to neural cells (including cells of the peripheral and central nervous systems, in particular, brain cells such as neurons, oligodendrocytes, glial cells, astrocytes), lung cells, cells of the eye (including retinal cells, retinal pigment epithelium, and corneal cells), epithelial cells (e.g., gut and respiratory epithelial cells), skeletal muscle cells (including myoblasts, myotubes and myofibers), diaphragm muscle cells, dendritic cells, pancreatic cells (including islet cells), hepatic cells, a cell of the gastrointestinal tract (including smooth muscle cells, epithelial cells), heart cells (including cardiomyocytes), bone cells (e.g., bone marrow stem cells), hematopoietic stem cells, spleen cells, keratinocytes, fibroblasts, endothelial cells, prostate cells, joint cells (including, e.g., cartilage, meniscus, synovium and bone marrow), germ cells, and the like. Alternatively, the cell may be any progenitor cell. As a further alternative, the cell can be a stem cell (e.g., neural stem cell, liver stem cell). Moreover, the cells can be from any species of origin, as indicated above.
[0125] The synthetic gene or vector of the invention, e.g., virus vector, may be introduced to cells in vitro for the purpose of administering the modified cell to a subject. In particular embodiments, the cells have been removed from a subject, the synthetic gene and/or vector of the invention, e.g., virus vector, is introduced therein, and the cells are then replaced back into the subject. Methods of removing cells from subject for treatment ex vivo, followed by introduction back into the subject are known in the art (see, e.g., U.S. Pat. No. 5,399,346). Alternatively, synthetic gene and/or vector of the invention, e.g., virus vector, is introduced into cells from another subject, into cultured cells, or into cells from any other suitable source, and the cells are administered to a subject in need thereof.
[0126] Suitable cells for ex vivo gene therapy are as described above. Dosages of the cells to administer to a subject will vary upon the age, condition and species of the subject, the type of cell, the nucleic acid being expressed by the cell, the mode of administration, and the like. Typically, at least about 10.sup.2 to about 10.sup.8 or about 10.sup.3 to about 10.sup.6 cells will be administered per dose in a pharmaceutically acceptable carrier. In particular embodiments, the cells transduced with the vector are administered to the subject in an effective amount in combination with a pharmaceutical carrier.
[0127] Human subjects include neonates, infants, juveniles, and adults. Optionally, the subject is “in need of” the methods of the present invention, e.g., because the subject has or is believed at risk for a disorder including those described herein or that would benefit from the delivery of a synthetic gene including those described herein.
[0128] In certain embodiments, the synthetic gene of the invention is administered to a subject in need thereof as early as possible in the life of the subject, e.g., as soon as the subject is diagnosed with aberrant expression or activity of a nucleic acid or protein of interest. In some embodiments, the synthetic gene is administered to a newborn subject, e.g., after newborn screening has identified aberrant expression or activity of a nucleic acid or protein of interest. In some embodiments, the synthetic gene is administered to a fetus in utero, e.g., after prenatal screening has identified aberrant expression or activity. In some embodiments, the synthetic gene is administered to a subject as soon as the subject develops symptoms associated with aberrant expression or activity of a nucleic acid or protein of interest, or is suspected or diagnosed as having aberrant expression or activity of a nucleic acid or protein of interest. In some embodiments, the synthetic gene is administered to a subject before the subject develops symptoms associated with aberrant expression or activity of a nucleic acid or protein of interest, e.g., a subject that is suspected or diagnosed as having aberrant expression or activity but has not started to exhibit symptoms.
[0129] A further aspect of the invention is a method of delivering the synthetic gene, vector, and/or pharmaceutical composition of the invention, e.g., the synthetic gene of the invention, to a subject. In particular embodiments, the method comprises a method of delivering a synthetic gene to an animal subject, the method comprising: administering an effective amount of a synthetic gene according to the invention to an animal subject. Administration of the synthetic gene of the present invention to a human subject or an animal in need thereof can be by any means known in the art. Optionally, the synthetic gene and/or vector are delivered in an effective dose in a pharmaceutically acceptable carrier.
[0130] Dosages of vectors to be administered to a subject will depend upon the mode of administration, the disease or condition to be treated, the individual subject's condition, the particular viral vector, and the nucleic acid to be delivered, and can be determined in a routine manner. In embodiments of a viral vector, exemplary doses for achieving therapeutic effects are virus titers of at least about 10.sup.2, 10.sup.3, 10.sup.4, 10.sup.5, 10.sup.6, 10.sup.7 10.sup.8, 10.sup.9, 10.sup.10, 10.sup.11, 10.sup.12, 10.sup.3, 10.sup.14, 10.sup.15, 10.sup.16 transducing units or more. Doses and virus titer transducing units may be calculated as vector or viral genomes (vg).
[0131] In particular embodiments, more than one administration (e.g., two, three, four or more administrations) may be employed to achieve the desired level of gene expression over a period of various intervals, e.g., daily, weekly, monthly, yearly, etc.
[0132] Exemplary modes of administration include oral, rectal, transmucosal, topical, intranasal, inhalation (e.g., via an aerosol), buccal (e.g., sublingual), vaginal, intrathecal, intraocular, transdermal, in utero (or in ovo), parenteral (e.g., intravenous, subcutaneous, intradermal, intramuscular [including administration to skeletal, diaphragm and/or cardiac muscle], intradermal, intrapleural, intracerebral, and intraarticular), topical (e.g., to both skin and mucosal surfaces, including airway surfaces, and transdermal administration), intro-lymphatic, and the like, as well as direct tissue or organ injection (e.g., to liver, skeletal muscle, cardiac muscle, diaphragm muscle or brain). Administration can also be to a tumor (e.g., in or a near a tumor or a lymph node). The most suitable route in any given case will depend on the nature and severity of the condition being treated and on the nature of the particular vector that is being used.
[0133] In some embodiments, the vector is administered to the CNS, the peripheral nervous system, or both.
[0134] In some embodiments, the vector is administered directly to the CNS, e.g., the brain or the spinal cord. Direct administration can result in high specificity of transduction of CNS cells, e.g., wherein at least 80%, 85%, 90%, 95% or more of the transduced cells are CNS cells. Any method known in the art to administer vectors directly to the CNS can be used. The vector may be introduced into the spinal cord, brainstem (medulla oblongata, pons), midbrain (hypothalamus, thalamus, epithalamus, pituitary gland, substantia nigra, pineal gland), cerebellum, telencephalon (corpus striatum, cerebrum including the occipital, temporal, parietal and frontal lobes, cortex, basal ganglia, hippocampus and amygdala), limbic system, neocortex, corpus striatum, cerebrum, and inferior colliculus. The vector may also be administered to different regions of the eye such as the retina, cornea or optic nerve. The vector may be delivered into the cerebrospinal fluid (e.g., by lumbar puncture) for more disperse administration of the vector.
[0135] The delivery vector may be administered to the desired region(s) of the CNS by any route known in the art, including but not limited to, intrathecal, intracerebral, intraventricular, intranasal, intra-aural, intra-ocular (e.g., intra-vitreous, sub-retinal, anterior chamber) and peri-ocular (e.g., sub-Tenon's region) delivery or any combination thereof.
[0136] The delivery vector may be administered in a manner that produces a more widespread, diffuse transduction of tissues, including the CNS, the peripheral nervous system, and/or other tissues.
[0137] Typically, the vector will be administered in a liquid formulation by direct injection (e.g., stereotactic injection) to the desired region or compartment in the CNS and/or other tissues. In some embodiments, the vector can be delivered via a reservoir and/or pump. In other embodiments, the vector may be provided by topical application to the desired region or by intra-nasal administration of an aerosol formulation. Administration to the eye or into the ear, may be by topical application of liquid droplets. As a further alternative, the vector may be administered as a solid, slow-release formulation. For example, controlled release of parvovirus and AAV vectors is described by international patent publication WO 01/91803.
[0138] Injectables can be prepared in conventional forms, either as liquid solutions or suspensions, solid forms suitable for solution or suspension in liquid prior to injection, or as emulsions. Alternatively, one may administer the vector in a local rather than systemic manner, for example, in a depot or sustained-release formulation. Further, the viral vector can be delivered dried to a surgically implantable matrix such as a bone graft substitute, a suture, a stent, and the like (e.g., as described in U.S. Pat. No. 7,201,898).
[0139] Pharmaceutical compositions suitable for oral administration can be presented in discrete units, such as capsules, cachets, lozenges, or tablets, each containing a predetermined amount of the composition of this invention; as a powder or granules; as a solution or a suspension in an aqueous or non-aqueous liquid; or as an oil-in-water or water-in-oil emulsion. Oral delivery can be performed by complexing a virus vector of the present invention to a carrier capable of withstanding degradation by digestive enzymes in the gut of an animal. Examples of such carriers include plastic capsules or tablets, as known in the art. Such formulations are prepared by any suitable method of pharmacy, which includes the step of bringing into association the composition and a suitable carrier (which may contain one or more accessory ingredients as noted above). In general, the pharmaceutical compositions according to embodiments of the present invention are prepared by uniformly and intimately admixing the composition with a liquid or finely divided solid carrier, or both, and then, if necessary, shaping the resulting mixture. For example, a tablet can be prepared by compressing or molding a powder or granules containing the composition, optionally with one or more accessory ingredients. Compressed tablets are prepared by compressing, in a suitable machine, the composition in a free-flowing form, such as a powder or granules optionally mixed with a binder, lubricant, inert diluent, and/or surface active/dispersing agent(s). Molded tablets are made by molding, in a suitable machine, the powdered compound moistened with an inert liquid binder.
[0140] Pharmaceutical compositions suitable for buccal (sub-lingual) administration include lozenges comprising the composition of this invention in a flavored base, usually sucrose and acacia or tragacanth; and pastilles comprising the composition in an inert base such as gelatin and glycerin or sucrose and acacia.
[0141] Pharmaceutical compositions suitable for parenteral administration can comprise sterile aqueous and non-aqueous injection solutions of the composition of this invention, which preparations are optionally isotonic with the blood of the intended recipient. These preparations can contain anti-oxidants, buffers, bacteriostats and solutes, which render the composition isotonic with the blood of the intended recipient. Aqueous and non-aqueous sterile suspensions, solutions and emulsions can include suspending agents and thickening agents. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Aqueous carriers include water, alcoholic/aqueous solutions, emulsions or suspensions, including saline and buffered media. Parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's, or fixed oils. Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers (such as those based on Ringer's dextrose), and the like. Preservatives and other additives may also be present such as, for example, antimicrobials, anti-oxidants, chelating agents, and inert gases and the like.
[0142] The compositions can be presented in unit/dose or multi-dose containers, for example, in sealed ampoules and vials, and can be stored in a freeze-dried (lyophilized) condition requiring only the addition of the sterile liquid carrier, for example, saline or water-for-injection immediately prior to use.
[0143] Extemporaneous injection solutions and suspensions can be prepared from sterile powders, granules and tablets of the kind previously described. For example, an injectable, stable, sterile composition of this invention in a unit dosage form in a sealed container can be provided. The composition can be provided in the form of a lyophilizate, which can be reconstituted with a suitable pharmaceutically acceptable carrier to form a liquid composition suitable for injection into a subject. The unit dosage form can be from about 1 μg to about 10 grams of the composition of this invention. When the composition is substantially water-insoluble, a sufficient amount of emulsifying agent, which is physiologically acceptable, can be included in sufficient quantity to emulsify the composition in an aqueous carrier. One such useful emulsifying agent is phosphatidyl choline.
[0144] Pharmaceutical compositions suitable for rectal administration can be presented as unit dose suppositories. These can be prepared by admixing the composition with one or more conventional solid carriers, such as for example, cocoa butter and then shaping the resulting mixture.
[0145] Pharmaceutical compositions of this invention suitable for topical application to the skin can take the form of an ointment, cream, lotion, paste, gel, spray, aerosol, or oil. Carriers that can be used include, but are not limited to, petroleum jelly, lanoline, polyethylene glycols, alcohols, transdermal enhancers, and combinations of two or more thereof. In some embodiments, for example, topical delivery can be performed by mixing a pharmaceutical composition of the present invention with a lipophilic reagent (e.g., DMSO) that is capable of passing into the skin.
[0146] Pharmaceutical compositions suitable for transdermal administration can be in the form of discrete patches adapted to remain in intimate contact with the epidermis of the subject for a prolonged period of time. Compositions suitable for transdermal administration can also be delivered by iontophoresis (see, e.g., Pharm. Res. 3:318 (1986)) and typically take the form of an optionally buffered aqueous solution of the composition of this invention. Suitable formulations can comprise citrate or bis\tris buffer (pH 6) or ethanol/water.
[0147] The vectors disclosed herein may be administered to the lungs of a subject by any suitable means, for example, by administering an aerosol suspension of respirable particles comprised of the vectors, which the subject inhales. The respirable particles may be liquid or solid. Aerosols of liquid particles comprising the virus vectors may be produced by any suitable means, such as with a pressure-driven aerosol nebulizer or an ultrasonic nebulizer, as is known to those of skill in the art. See, e.g., U.S. Pat. No. 4,501,729. Aerosols of solid particles comprising the vectors may likewise be produced with any solid particulate medicament aerosol generator, by techniques known in the pharmaceutical art.
[0148] Having described the present invention, the same will be explained in greater detail in the following examples, which are included herein for illustration purposes only, and which are not intended to be limiting to the invention.
EXAMPLES
Example 1: Identification of miRNAs Upregulated by MECP2 Expression
[0149] To identify endogenous miRNAs upregulated by supraphysiological MeCP2 expression, cerebellar and medullar RNA from mice treated with a toxic dose of MECP2 vector were screened. Mecp2+/y and Mecp2−/y mice were injected intracisternally with either saline or 1×10.sup.12 vector genomes (vg) of AAV9/MeP426-hMECP2-myc-RDH1 pA (postnatal day 28 [PND28]; 10 μL, injection volume; n=2 mice per treatment). Two weeks after treatment, mice were euthanized with a lethal dose of tribromoethanol. The cerebellum and brain stem were dissected, frozen on dry ice, and immediately transferred to −80° C. for storage. A Qiagen miRNeasy Mini Kit was used to purify total RNA from thawed cerebellum and brainstem (combined). Purified RNA was stored at −80° C. and later shipped on dry ice to LC Sciences for screening (microarray part number MRA-1002; miRBase version 21).
[0150] Raw data was processed by LC Sciences according to their technical bulletin (Sciences, L. microRNA Microarray Data Analysis). The small sample sizes used in the pilot study precluded the identification of positive hits based solely on statistically significant differences between treatment groups. Thus, to improve statistical power, data was aggregated for all 3 MECP2(+) groups (i.e., virus-treated Mecp2−/y mice as well as saline- and virus-treated Mecp2+/y mice) prior to calculating statistical significance. Among 10 moderately to highly expressed miRNAs with elevated levels among MECP2(+) mice, one miRNA (miR-494-3p) has targets within the endogenous MECP2 3′UTR (targetscan.org; Agarwal et al. 2015 Elife (4); mouse and human), suggesting that a negative feedback loop mediated by MeCP2 and miR-494-3p may exist in vivo. Furthermore, the normalized signal intensities demonstrated a compelling trend between increased miR-494-3p expression and exogenous MeCP2 expression in both Mecp2+/y and Mecp2−/y mice.
Example 2: Identification of Additional miRNAs Upregulated by MeCP2 Expression
[0151] Three miRNA targets in the MeP426-hMECP2-myc-RDH1 pA viral genome (i.e., miR-22-3p, miR-19-3p, and miR-132-3p) were replaced with a target sequence for miR-494-3p (Sinnett et al. 2017 Mol. Ther. Methods Clin. Dev. (5):106-115; Gadalla et al. 2017 Mol. Ther. Methods Clin. Dev. (5):180-190). The modified viral genome was then packaged into AAV9 and injected intracisternally into mosaic MECP2-EGFP-fusion/null females.
[0152] Transgene expression was slightly decreased in response to MeCP2-EGFP expression compared to that observed in neighboring null cells (
Example 3: Large-Scale Screening of Upregulated miRNAs
[0153] A large-scale screen was completed to address the limitations of the pilot study described above. More specifically, additional control groups were added, more mice were treated, and brain regions were finely dissected (not combined) prior to RNA purification. Mecp2+/y and Mecp2−/y mice were injected intracisternally with either saline, 1×10.sup.12 vg AAV9/MeP426-hMECP2-myc-RDH1 Pa, or 1×10.sup.12 vg AAV9/CBH-EGFP (PND P28-P35; 10 μL injection volume; n=3 mice per treatment). 2-3 weeks after treatment, mice were euthanized with a lethal dose of tribromoethanol. Cervical spinal cord, cerebellum, and brain stem were dissected, frozen on dry ice, and immediately transferred to −80° C. for storage. A Qiagen miRNeasy Mini Kit was then used to purify total RNA from thawed tissue. Brain regions were not combined prior to RNA purification. RNA was stored at −80° C. and later shipped on dry ice to LC Sciences for screening (microarray part number MRA-1002; miRBase version 21).
[0154] Raw data was processed by LC Sciences according to their technical bulletin. miRNAs that were significantly upregulated in correlation with endogenous MeCP2, AAV9/MECP2, or AAV9/EGFP treatment were identified (
[0155] Analysis of aggregated treatment groups (MECP2(−) vs. MECP2(+)) revealed additional miRNAs that were significantly upregulated by MeCP2 expression in at least 1 tissue type (
[0156] Data from the screens were used to design 2 types of miRNA target panels. The first panel binds miRNAs whose expression levels increase in correlation with MeCP2 expression in vivo, as further described in Example 4. The second panel design is described below.
[0157] RNA samples from saline- and virus-treated mice were screened to identify MeCP2-driven miRNAs expressed in the central nervous system (CNS) were screened. Insertion of targets for these miRNAs into the 3′UTR of a MECP2 viral genome allows for use of endogenous RNA interference mechanisms to attenuate toxic overexpression of exogenous MeCP2 in vivo (
[0158] The complete panel sequence is listed below. Seed matches are underlined; every other seed match and flanking sequences section is italicized. Binding site key (in order 5′-3′): miR-9-5p; miR-26-5p; miR-23-3p; miR-218-5p; miR-27-3p; let-7-5p:
TABLE-US-00003 (SEQ ID NO: 1) 5′CTGTTCTAGCCCCCAAAGAGTTTTCTGTGCTTGCTTTTGAAACTTGAA GTCTTGAAAACCAAAGACATAGATGTGAAAATTTTAGGCAGTGTAAGCTG ATAGCACAAGTTCTGGCGACTCACAATTATGCTGTGAATTTTACAAAAAG AAGCAGTAATCTACCTCAGCCGATAAC-3′
[0159] A number of neurodevelopmental disorders characterized by intellectual disability are mediated by mutations in genes that must be tightly regulated (see Table 1). Similarities among the 3′ UTRs of these genes suggests that there may be an in vivo inhibitory mechanism to help protect the brain from overexpression-induced intellectual disability, regardless of genetic etiology (see Table 2).
TABLE-US-00004 TABLE 1 Selected dose-sensitive genes mediating disorders characterized by intellectual disability. Overexpression syndrome (mediated either wholly or in Loss-of-function syndrome Gene part by the genes listed) Rett Syndrome MECP2 MeCP2 Duplication Syndrome Angelman Syndrome UBE3A dup15Q DYRK1A haploinsufficiency DYRK1A Down Syndrome MEF2C haploinsufficiency MEF2C dup5Q14.3 syndrome Sotos syndrome NSD1 ″reverse″ Sotos syndrome Alpha-thalassemia X-linked intel- ATRX Xq13.2q21.1 duplication lectual disability syndrome Coffin-Lowry Syndrome RPS6KA3 Xp22.12 duplication Pitt Hopkins Syndrome TCF4 Trisomy 18 2q23.1 Microdeletion Syndrome MBD5 2q23.1 duplication Mowat-Wilson Syndrome ZEB2 2q22.3 triplication
[0160] Deletion and reciprocal duplication disorders mediating similar phenotypes (e.g., intellectual disability, speech abnormalities, seizures, microcephaly, and/or stereotypy) include but are not limited to those listed in Table 1. The severe phenotypes of these duplication disorders justify the need for a broadly applicable miRNA target panel for regulating transgene expression after gene therapy.
[0161] References describing human and animal models of deletion or mutation disorders in Table 1: TCF4 (Agarwal 2015; Dean L. 2012 Medical Genetics Summaries, Bethesda Md.; Sweetser et al. 1993 GeneReviews®, Seattle Wash.; de Winter et al. 2016 Orphanet J. Rare Dis. 11:37); MECP2 (Leonard et al. 2017 Nat. Rev. Neurol. 13(1):37-51; Chahil and Bollu 2018 StatPearls: Treasure Island FL; Seltzer and Paciorkowski 2014 Am. J. Med. Genet. C. Semin. Med. Genet. 166C(2):140-155; Fuertes-Gonzales et al. 2011 Med. Oral Patol. Oral Cir. Bucal. 16(1):e37-41); UBE3A (Dagli et al. 1993 GeneReviews®: Seattle Wash.; Pelc et al. 2008 Neuropsychiatr. Dis. Treat. 4(3):577-584; Pelc et al. 2008 Sleep Med. 9(4):434-441); DYRK1A (Luco et al. 2016 BMC Med. Genet. 17:15); MEF2C (Vrecar et al. 2017 J. Pediatr. Genet. 6(3):129-141); NSD1 (Tatton-Brown et al. 1993 GeneReviews®: Seattle Wash.); ATRX (Stevenson R. E. 1993 GeneReviews®: Seattle Wash.; Bouazzi et al. 2016 Indian J. Med. Res. 143(1):43-48); RPS6KA3 (Miyata et al. 2018 Brain Dev. 40(7):566-569; Morino et al. 2016 Medicine (Baltimore) 95(31):e4468; Touraine et al. 2002 Eur. J. Pediatr. 161(4):179-187; Tos et al. 2015 Genet. Couns. 26(1):47-52); MBD5 (Talkowski et al. 2011 Am. J. Hum. Genet. 89(4):551-563); ZEB2 (Hegarty et al. 2015 Prog. Neurobiol. 132:81-95).
[0162] References describing human and animal models of overexpression (monogenic or polygenic) in Table 1: Trisomy 18 (Roberts et al. 2016 Clin. Anat. 29(5):628-632; de Queiroz et al. 2007 J. Dent. Child (Chic) 74(1):67-72); MeCP2 duplication syndrome (Miguet et al. 2018 J. Med. Genet. 55(6):359-371); Dup15Q (Finucane et al. 1993 GeneReviews®: Seattle Wash.; Copping et al. 2017 Hum. Mol. Genet. 26(20):3995-4010; Wegiel et al. 2012 J. Neuropathol. Exp. Neurol. 71(5):382-397); Down Syndrome (Duchon and Herault 2016 Front. Behay. Neurosci. 10:104; Kent and Vorperian 2013 J. Speech Lang. Hear. Res. 56(1):178-210; Araujo et al. 2015 Epilepsy Behay. 53:120-125; Guedj et al. 2012 Neurobiol. Dis. 46(1):190-203; Carter et al. 2008 Neuroreport 19(6):653-656); dup5Q14.3 (Cesaretti et al. 2016 Am. J. Med. Genet. A 170A(5):1352-1357); reverse Sotos syndrome (Rosenfeld et al. 2013 Mol. Syndromol. 3(6):247-254); Xq13.2q21.1 (Lugtenberg et al. 2009 Am. J. Med. Genet. A 149A(4):760-766; Berube et al. 2002 Hum. Mol. Genet. 11(3):253-261); Xp22.12 (Matsumoto et al. 2013 J. Hum. Genet. 58(11):755-757; Tejada et al. 2011 Pediatrics 128(4):e1029-1033); 2q23.1 duplication (Mullegama et al. 2014 Eur. J. Hum. Genet. 22(1):57-63); 2q22.3 triplication (Yuan et al. 2015 Mol. Cytogenet. 8:99).
TABLE-US-00005 TABLE 2 Selected list of common miRNA targets among 3′ UTRs of selected genes mediating intellectual ability. Targets in 3′ UTR in vivo TCF4 MECP2 UBE3A DYRK1A MEF2C NSD1 MBD5 ATRX ZEB2 RPS6KA3 miR- 90/87 79/76 86/85 75/— X X X X X X 124- # # # 3p.1 miR- 31/— 87/82 X 68/— 57/— X X 77/74 58/45 X 124- # β # 3p.2 miR- 36/25 27/27 60/— 81/— 66/— 15/15 64/— —/15 76/79 X 30-5p # # β # miR- —/62 X X X X X X X X X 451a miR-9- 5p 75/41 β 55/—
[0163] A complete list of targets in endogenous 3′UTRs can be found at targetscan.org. In each cell of Table 2, the context++percentile score is listed for two species (human/mouse). High scores indicate targets with favorable genomic context. The synthetic panel includes targets for miRNAs predicted to bind many of the endogenous 3′ UTRs listed above. Of the 6 selected targets, 4 targets should bind miRNAs (miR-9-5p, miR-26b-5p, miR-27-3p, and let-7-5p) that demonstrated increased expression in correlation with MeCP2 expression (see HTS data in
TABLE-US-00006 TABLE 3 Assessment of miRNA targets and their human genomic context. miR-9-5p GENE 5′ flanking sequence target 3′ flanking sequence MECP2 CUCCUGGCACU- (SEQ ID NO: 3) ACCAAAG- GACACUUAUCCA (SEQ ID NO: 4) (36% AU) (58% AU) UBE3A CUGUUCUAGCCC (SEQ ID NO: 5) -CCAAAGA -GUUUUCUGUGC (SEQ ID NO: 6) (42% AU; WC M12-M15) (55% AU) DYRK1A UAAUUUAUUGU- (SEQ ID NO: 7) ACCAAAG- CUGUUUUUAUAG (SEQ ID NO: 8) (91% AU) (75% AU) MEF2C AAUAUGUUUUA- (SEQ ID NO: 9) ACCAAAGA -UGUGGAGCAAU (SEQ ID NO: 10) (91% AU) (55% AU) MBD5 CAUUUGCAUUAG (SEQ ID NO: 11) -CCAAAGA -GAUAAGAACAU (SEQ ID NO: 12) (67% AU) (73% AU) ZEB2 GGGGAAAAAAC- (SEQ ID NO: 13) ACCAAAGA -AUUCACAUGGG (SEQ ID NO: 14) (55% AU) (55% AU) TCF4 UUUAUGAAAUUU (SEQ ID NO: 15) -CCAAAGA -UUUUGGUUGAU (SEQ ID NO: 16) (92% AU) (73% AU) vg CTGTTCTAGCCC (SEQ ID NO: 17) -CCAAAGA -GTTTTCTGTGC (SEQ ID NO: 18) (42% AT; WC M12-M15) (55% AT) miR-26-5p GENE 5′ flanking sequence target 3′ flanking sequence MECP2 -AGGCUUGCAGA (SEQ ID NO: 19) -ACUUGAA GCCUGCUCCUU (SEQ ID NO: 20) (45% AU) (36% AU) UBE3A -UUGCUUUUGAA (SEQ ID NO: 21) -ACUUGAA GUCUUGAAAAC (SEQ ID NO: 22) (73% AU) (64% AU) DYRKL4 -UUUUUUUUUUA (SEQ ID NO: 23) -ACUUGAA AAGAUUGCAAA (SEQ ID NO: 24) (100% AU) (73% AU) MEF2C -AAGAAGAAGCC (SEQ ID NO: 25) -ACUUGAA CCCUCAAUAAA (SEQ ID NO: 26) (55% AU) (64% AU) NSD1 -GAGGUUGAGAC (SEQ ID NO: 27) -ACUUGAA CUCAGGCAGAG (SEQ ID NO: 28) (45% AU) (36% AU) ATRX ACAAUUUUGGU- (SEQ ID NO: 29) UACUUGAA UUGUUAAAGAA (SEQ ID NO: 30) (73% AU) (82% AU) MBD5 -AAAAGAAAACA (SEQ ID NO: 31) -ACUUGAA CAUUUUCAAUA (SEQ ID NO: 32) (82% AU) (82% AU) ZEB2 -UCUGUGAAGGA (SEQ ID NO: 33) -ACUUGAA GUGAUGCAUGU (SEQ ID NO: 34) (55% AU) (55% AU) TCF4 -UUUCUCAUGGG (SEQ ID NO: 35) -ACUUGAA GUGGACUCAUC (SEQ ID NO: 36) (55% AU) (45% AU) vg -TTGCTTTTGAA (SEQ ID NO: 37) -ACTTGAA GTCTTGAAAAC (SEQ ID NO: 38) (73% AT) (64% AT) miR-23-3p GENE 5′ flanking sequence target 3′ flanking sequence MECP2 -UUUUUUAAUAC (SEQ ID NO: 39) -AUGUGAA -AGCAAAGAAUA (SEQ ID NO: 40) (91% AU) (73% AU) UBE3A -AAACAAAAAGC (SEQ ID NO: 41) -AUGUGAA -AGUGCACUUAA (SEQ ID NO: 42) (73% AU) (64% AU) DYRK1A AACACUAUGUA- (SEQ ID NO: 43) AAUGUGAA -UGGAAACUUGG (SEQ ID NO: 44) (73% AU) (55% AU) MEF2C CCUUCUCUUGG- (SEQ ID NO: 45) AAUGUGAA -GAUCUGUCGAU (SEQ ID NO: 46) (45% AU) (55% AU) NSD1 -UUUCCAAAGGG (SEQ ID NO: 47) -AUGUGAA -UUGGAGUGAAA (SEQ ID NO: 48) (55% AU; WC M14-M16) (64% AU) ATRX -CAAAGACAUAG (SEQ ID NO: 49) -AUGUGAA -AAUUUUAGGCA (SEQ ID NO: 50) (64% AU) (73% AU) RPS6K43 CAGCUGGUUCC- (SEQ ID NO: 51) AAUGUGA- CUGAGUGUUCUC (SEQ ID NO: 52) (36% AU) (50% AU) MBD5 AAGUAAGAAAA- (SEQ ID NO: 53) AAUGUGAA -ACAAAUGUAGA (SEQ ID NO: 54) (82% AU) (73% AU) ZEB2 -UUAUGACAUAU (SEQ ID NO: 55) -AUGUGAA -CACAUCACAAA (SEQ ID NO: 56) (82% AU) (64% AU) TCF4 -AUUUGGUUCAC (SEQ ID NO: 57) -AUGUGAA -GUGCCCUCCAU (SEQ ID NO: 58) (64% AU) (36% AU) vg -CAAAGACATAG (SEQ ID NO: 59) -ATGTGAA -AATTTTAGGCA (SEQ ID NO: 60) (64% AT) (73% AT) miR-218-5p GENE 5′ flanking sequence target 3′ flanking sequence MECP2 UUCUUACCGAC- (SEQ ID NO: 61) AAGCACA- GUCAGGUUGAAG (SEQ ID NO: 62) (55% AU; WC M12-M14) (50% AU) UBE3A AACUUUAGUAAC (SEQ ID NO: 63) -AGCACAA -CAAAUUAAAAA (SEQ ID NO: 64) (75% AU; WC M12-M15) (91% AU) MEF2C UUAAUGAGAAG- (SEQ ID NO: 65) AAGCACAA -UUUUGAUUUUG (SEQ ID NO: 66) (73% AU) (82% AU) ATRX GCACGAAUAUA- (SEQ ID NO: 67) AAGCACA- UCUCUUAACUGC (SEQ ID NO: 68) (64% AU) (58% AU) RPS6KA3 GUGUAAGCUGAU (SEQ ID NO: 69) -AGCACAA -GUUCUGGCGAC (SEQ ID NO: 70) (58% AU; WC M15-M19) (36% AU) MBD5 AAUAAGAAAUGU (SEQ ID NO: 71) -AGCACAA -CAUAAUUUUCC (SEQ ID NO: 72) (83% AU) (73% AU) ZEB2 AUUUAUACUUU- (SEQ ID NO: 73) AAGCACAA -CUAGAAAAUUG (SEQ ID NO: 74) (91% AU; WC M15-M17) (73% AU) TCF4 UCAGCAUAAAC- (SEQ ID NO: 75) AAGCACAA -AAAUUUAGUCU (SEQ ID NO: 76) (64% AU) (82% AU) vg GTGTAAGCTGAT (SEQ ID NO: 77) -AGCACAA -GTTCTGGCGAC (SEQ ID NO: 78) (58% AT; WC M15-M19) (36% AT) miR-27a-3p GENE 5′ flanking sequence target 3′ flanking sequence MECP2 -GAUAAAUCUCU (SEQ ID NO: 79) -CUGUGAA -AGUGA (60% AU) (73% AU) DYRK1A -UCACAAUUAUG (SEQ ID NO: 80) -CUGUGAA -UUUUACAAAAA (SEQ ID NO: 81) (73% AU) (91% AU) MEF2C -UUUAAAAAAAU (SEQ ID NO: 82) -CUGUGAA -AUUAACAUGCU (SEQ ID NO: 83) (100% AU) (73% AU) NSD1 UCAUGAAAUAA- (SEQ ID NO: 84) ACUGUGAA -UUUGGGGGGGG (SEQ ID NO: 85) (82% AU) (27% AU) ATRX -AAAUCAUACAG (SEQ ID NO: 86) -CUGUGAA -GACUUGCCUUU (SEQ ID NO: 87) (73% AU) (55% AU) MBD5 ACAAACCUAAA- (SEQ ID NO: 88) ACUGUGA- GCCAUUGUAAA- (SEQ ID NO: 89) (73% AU) (64% AU) ZEB2 -UUUUUUUUUUU (SEQ ID NO: 90) -CUGUGAA -GGAACUUGAAG (SEQ ID NO: 91) (100% AU) (55% AU) TCF4 -UUGGGGCUUUC (SEQ ID NO: 92) -CUGUGAA -AUGUAUGAACA (SEQ ID NO: 93) (45% AU) (73% AU) vg -TCACAATTATG (SEQ ID NO: 94) -CTGTGAA -TTTTACAAAAA (SEQ ID NO: 95) (73% AT) (91% AT) let-7e/98-5p GENE 5′ flanking sequence target 3′ flanking sequence MECP2 GUUGUUAGUUA- (SEQ ID NO: 96) CUACCUC- CUCUCCUGACA- (SEQ ID NO: 97) (73% AU) (45% AU) DYRK1A GAAGCAGUAAU- (SEQ ID NO: 98) CUACCUC- UGCCGAUAACC- (SEQ ID NO: 99) (64% AU) (45% AU) MEF2C CAAAUUGAUUCA (SEQ ID NO: 100 -UACCUCA- GUUUAAUUCAG (SEQ ID NO: 101) (75% AU) (73% AU) NSD1 UCUGCCCCUCU- (SEQ ID NO: 102) CUACCUC- UUCCACUCAUG- (SEQ ID NO: 103) (36% AU) (55% AU) MBD5 CACUGUGUGUG- (SEQ ID NO: 104) -UACCUCA -GUGACCUUUUA (SEQ ID NO: 105) (45% AU) (64% AU) RPS6KA3 GAGCCUACUUC- (SEQ ID NO: 106) CUACCUC- UUAAGGCACUU- (SEQ ID NO: 107) (45% AU) (64% AU) vg GAAGCAGTAAT- (SEQ ID NO: 108) CTACCTC- AGCCGATAACC- (SEQ ID NO: 109) (64% AT) (45% AT)
[0164] Targets and their flanking sequences, as they appear in human 3′ UTRs, are shown next to each gene in Table 3. The sequence selected for the synthetic panel is listed next to “vg” (viral genome). If 2 or more targets for a given miRNA were present in the human 3′ UTR, then the target sequence that was conserved across species was selected and listed in the table above. The following parameters were considered when selecting a 5′ flanking sequence for the synthetic panel: (1) consequential Watson-Crick (WC) base-pairing (as predicted by Targetscan) with preferential pairing at messenger RNA (mRNA) nucleotides 13-16 (M13-M16) (Grimson et al. 2007 Mol. Cell 27(1):91-105); (2) conservation of the 5′ flanking sequence across species (see Table 2); (3) the context++ percentile score listed on Targetscan; and (4) sequence complexity (commercial gene synthesis requires a % GC content no less than 35% for the entire synthetic panel). For each 5′ flanking sequence selected, a 3′ flanking sequence from the same UTR was selected for insertion into the target panel. (3) One mutation (highlighted and bolded) was introduced to create a T1A anchor to promote mRNA-Argonaute interactions (Schirle et al. 2015 Elife (4); Schirle et al. 2014 Science 346(6209):608-613). Due to similarity in miRNA sequences, the target for let-7e-5p may also bind other let-7 miRNAs. Let-7a-5p, let-7b-5p, and let-7g-5p showed increased expression in MECP2(+) cervical cord tissue in aggregated data analyses; let-7c-5p, let-7d-5p, and let-7g-5p showed increased expression in Mecp2.sup.−/y mice after treatment with MECP2 virus. In addition, the let-7e-5p target may bind miR-98-5p, whose expression level increased in aggregated data analyses for cervical cord tissue. T1A anchors are underlined in the target column. T9A/Us, which are believed optimize to the conformation of Argonaute interactions, are underlined in the 5′ flanking sequence column (Lewis et al. 2005 Cell 120(1):15-20).
[0165] Compare to Table 2. The 3′ UTRs of housekeeping genes have few of the targets examined, as shown in Table 4. Table 4 labeling follows as described for Table 2. Thus, the conservation of targets across genes mediating intellectual ability may be physiologically significant. A complete list of targets in endogenous 3′UTRs can be found at targetscan.org. In each cell of Table 4, the context++ percentile score is listed for two species (human/mouse). High scores indicate targets with favorable genomic context. ACTB, beta-actin; ATF1, activating transcription factor 1; DAD1, defender against cell death 1; DARS, aspartyl-tRNA synthetase; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; HSPA4, heat shock protein family A (Hsp70) member 4; MRPL9, mitochondrial ribosomal protein L9; POLR1C, RNA polymerase I and III subunit C; PRKAG1, protein kinase AMP-activated non-catalytic subunit gamma 1; RPL5, ribosomal protein L5.
TABLE-US-00007 TABLE 4 Selected list of miRNA targets among 3′ UTRs of housekeeping genes. Targets in 3′ UTR in vivo GAPDH POLR1C ATF1 DAD1 DARS PRKAG1 RPL5 HSPA4 MRPL9 ACTB miR- X X X X X X X —/41 X X 124- 3p.1 miR- X X X X X X 58/— —/46 X 90/88 124- # 3p.2 miR- X X 91/88 X 15/— X 79/— X X X 30-5p # miR- X X X X X X X X X X 451a miR-9- X X 97/89 X X X X 71/— X X 5p # miR- X X 84/— X 88/98 89/— 60/83 88/88 X X 26-5p β β # miR- X X X X X 82/— —/88 X X X 23-3p miR- X X X X X 90/— X X X X 218-5p miR- X 83/— 84/80 X X X X 33/— X X 27-3p β let-7-5p/ X X X X X X X X X X 98-5p miR- X 95/— —/98 X 94/— —/87 X X X X 494-3p
Example 4: Development of a RTT-Specific Construct
[0166] An additional construct was developed to be specific for RTT, referred to herein as “reg1.” The targets in this sequence correspond to miRNAs shown to be upregulated in correlation with MeCP2 expression in a high-throughput screen of brain and spinal cord RNA.
[0167] The sequence of reg1 is as follows. Seed matches are underlined; every other seed matches and flanking sequences section are italicized. Binding site key (in order 5′-3′): miR-451a; let-7-5p; miR-690.
TABLE-US-00008 (SEQ ID NO: 2) 5′ATAAGGGCAGAAACGGTTCACATTCCATTCTGCCCCGGACCTACCTCC CTCCCTCTCCTTATCAAACCCTAGCCTTGCTTGTTAAAT-3′
[0168] Reg1 was tested in WT mice and showed tightly regulated total MeCP2 expression in WT Purkinje cells, as shown in
Example 5: Generalized Panel Design Strategy and Experimental Studies
[0169]
TABLE-US-00009 TABLE 5 MECP2-driven miRNAs and their corresponding targets in Reg1 and Reg2. Aggregated Endogenous Exogenous MECP2(+) Corresponding Panel miRNA MeCP2 MeCP2 treatment groups target Design miR-690 Medulla — Cervical cord miR-690 Reg1 miR-451a Cervical cord — Medulla miR-451a let-7e-5p Cervical cord — Cervical cord let-7-5p Reg1 and let-7a-5p — — Cervical cord Reg2 let-7b-5p — — Cervical cord let-7c-5p — Cervical cord — let-7d-5p — Cervical cord — let-7g-5p — Cervical cord Cervical cord miR-98-5p Cervical cord — Cervical cord miR-9-5p — — Cervical cord miR-9-5p Reg2 miR-218-5p — — — miR-218-5p miR-26b-5p Cervical cord — Cervical cord miR-26-5p miR-23a-3p — Cervical cord — miR-23-3p miR-27a-3p — — Cervical cord miR-27-3p
[0170] Correlations between miRNA expression vs. endogenous MeCP2 expression, exogenous MeCP2 expression, and/or aggregated (endogenous and exogenous) MeCP2 expression are identified. In addition, it is conceptually possible that there are miRNAs yet to be identified that could contribute to the MeCP2 feedback loop. Any miRNA containing a seed sequence permitting Watson-Crick (WC) base-pairing between the miRNA seed and the miRNA target panel may help mediate exogenous MeCP2 regulation.
[0171] Further experimentation was pursued with both the reg1 RTT-specific construct and the reg2 broadly-applicable construct.
[0172]
[0173] Preliminary survival studies were performed in saline- and virus-treated KO mice, as shown in
TABLE-US-00010 TABLE 6 Treated KO mice retaining normal hindlimbs during survival study. Treatment % (n) Saline ICM 38% (5/13) PHP.B/mini, 1E10-1E11 vg ICM 18% (4/22) PHP.B/mini-reg2, 1E10-1E11 vg ICM 43% (10/23) AAV9/full-length MECP2 (published 12% (3/24) (unpublished data standard), 1E10-1E11 vg ICM for mice used in studies published by Sinnett et al., 2017, MTMCD)
[0174] The foregoing examples are illustrative of the present invention, and are not to be construed as limiting thereof. Although the invention has been described in detail with reference to preferred embodiments, variations and modifications exist within the scope and spirit of the invention as described and defined in the following claims.