MULTIPLE ANALYSIS METHOD FOR AMPLICON BY USING FLUORESCENCE-BASED MULTIPLE MELTING ANALYSIS

20210180115 · 2021-06-17

Assignee

Inventors

Cpc classification

International classification

Abstract

A method for multiplex analysis of amplification products using fluorescence-based multiple melting analysis is capable of analyzing multiple target nucleic acid sequences simultaneously in real time. A kit for performing the multiplex analysis contains target-specific primer/probe sets. The method and the kit allow a detection of multiple target nucleic acid sequences by a single polymerase chain reaction using a single fluorescence channel, thereby significantly reducing time and cost for multiplex nucleic acid detection. Therefore, the method and kit may be widely used in the companion diagnostic field in which multiple target nucleic acid genes need to be analyzed, the agricultural and livestock field in which multiple alleles need to be analyzed, and the clinical pathology field in which multiple infectious agents need to be analyzed simultaneously.

Claims

1. A method for multiplex analysis of amplification products using multiple melting analysis, the method including steps of: a) preparing target-specific fluorescence-based multiple melting analysis (FMMA) probe/primer sets which each include an FMMA probe having a structure of 5′-R-T-Q-C-3′ and a non-labeled primer, wherein R is a fluorescent label, T is a melting temperature control sequence for inducing different temperatures of different amplification products, Q is a quencher, C is a sequence complementary to a target nucleic acid sequence, and each FMMA probe/primer is designed to produce each amplification product having a different melting temperature; b) amplifying multiple target nucleic acids in a sample containing one or more target nucleic acids by a nucleic acid polymerase chain reaction using the target-specific FMMA probe/primer sets obtained in the preceding step; and c) performing melting temperature analysis on amplification products.

2. The method of claim 1, wherein adjustment of the melting temperature of each FMMA probe/primer in the target-specific FMMA probe/primer sets is designed such that the melting point of the amplification product is distinguished by adjusting a length and a GC content of the amplification product and a length and a GC content of the melting temperature control sequence.

3. The method of claim 1, wherein the FMMA probes/primers are configured such that adjacent melting temperatures of the amplification products have a difference of 2° C. or higher.

4. The method of claim 3, wherein the FMMA probes/primers are configured such that the adjacent melting temperatures of the amplification products have a difference of 4° C. or higher.

5. The method of claim 1, wherein the melting temperature control sequence (T) is 10 to 30 bp in length, and the amplification product is 50 to 300 bp in length.

6. The method of claim 1, wherein the fluorescent label is selected from the group consisting of FAM™, TET™, JOE™, VIC™, HEX™, ROX™, TAMRA™, CY3™, CY3.5™, CY5™, CY5.5™, Oregon Green™, CAL Red™, Red 640®, and Texas Red®.

7. The method of claim 1, wherein the quencher is selected from the group consisting of TAMRA™, DABCYL™, ECLIPSE®, NFQ, Black Hole Quencher® (BHQ), Deep Dark Quencher (DDQ), QSY®, Blackberry™ Quencher, Qxl, Iowa black® FQ, Iowa black® RQ, and IRDye QC-1.

8. The method of claim 1, wherein the step of performing melting temperature analysis comprises steps of: obtaining a melting curve by measuring fluorescence generated by melting the amplification product while increasing the temperature thereof; and obtaining a melting peak curve from the melting curve.

9. The method of claim 1, wherein the nucleic acid polymerase is an RNA-dependent RNA-polymerase, an RNA-dependent DNA-polymerase, a DNA-polymerase, or an RNA-polymerase.

10. The method of claim 9, wherein the DNA polymerase is selected from the group consisting of Taq polymerase, Tth polymerase, Tli polymerase, VENT™ polymerase, Pfu polymerase, DEEPVENT™ polymerase, Pwo polymerase, Bst polymerase, Sac polymerase, Tac polymerase, Tfl/Tub polymerase, Tru polymerase, DYNAZYME™ polymerase, Tne polymerase, Tma polymerase, Tsp polymerase, Mth polymerase, Phi29 polymerase, Klenow polymerase, T7 polymerase, and KOD DNA polymerase.

11. The method of claim 1, wherein the amplification products have a melting temperature of 50° C. to 100° C.

12. The method of claim 11, wherein the amplification products have a melting temperature of 60° C. to 95° C.

13. A kit for multiplex detection of target nucleic acids, the kit being based on the method of claim 1 and comprising the target-specific FMMA probe/primer sets of claim 1.

14. A kit for identification of allele-specific rice varieties, the kit being based on the method of claim 1 and comprising the target-specific FMMA probe/primer sets of claim 1.

Description

DESCRIPTION OF DRAWINGS

[0030] FIGS. 1a and 1b are schematic views illustrating the principle of fluorescence-based multiple melting analysis (FMMA) of the present invention;

[0031] FIG. 2 is a schematic view illustrating allele-specific FMMA for rice variety identification, performed in an Example;

[0032] FIG. 3 shows the results of a rice variety identification experiment performed using allele-specific FMMA in an Example;

[0033] FIG. 4 shows the results of rice variety identification (set A) performed using allele-specific FMMA in an Example of the present invention;

[0034] FIG. 5 shows the results of rice variety identification (set B) performed using allele-specific FMMA in an Example of the present invention;

[0035] FIG. 6 shows the results of analyzing the melting temperature distribution of an amplification product depending on the length thereof in Example 4; and

[0036] FIG. 7 graphically shows the correlation between the GC content of a melting temperature control sequence (T) and the melting temperature of the entire PCR product.

BEST MODE

[0037] The present invention will be described in more detail below with reference to examples. These examples are intended for illustrative purposes only, but are not intended to limit the scope of the present invention.

[0038] As used herein, the term “target nucleic acid” or “target nucleic acid gene” refers to a nucleic acid sequence to be finally detected. The target nucleic acid gene may be a portion of a gene, a regulatory sequence, genomic DNA, cDNA, RNA including mRNA, microRNA and rRNA, or others. A nucleic acid molecule that is the target nucleic acid gene may be double-stranded or single-stranded. Where the nucleic acid as a starting material is double-stranded, it is preferred to render the two strands into a single-stranded or partially single-stranded form. Where an mRNA is used as a starting material, a reverse transcription step is necessary prior to amplification.

[0039] As used herein, the term “primer” refers to an oligonucleotide that may act as a point of initiation of DNA synthesis under conditions in which synthesis of a primer extension product complementary to the template nucleic acid strand is induced. The conditions include the presence of nucleotides and an inducing agent such as DNA polymerase at a suitable temperature and pH. The primer is preferably a single-stranded oligodeoxyribonucleotide. The primers that are used in the present invention may include naturally occurring dNMPs (i.e., dAMP, dGMP, dCMP and dTMP), modified nucleotides or non-naturally occurring nucleotides. The primers may also include ribonucleotides.

[0040] As used herein, the term “FMMA probe” refers to an oligonucleotide, its complements, or fragments thereof, which is used to detect identical, allelic or related nucleic acid sequences. FMMA probes may include oligonucleotides which have been attached to a detectable label or fluorescent molecule. FMMA probes are involved directly in nucleic acid amplification and used also for analysis of melting temperatures, unlike conventional probes that are not involved in the formation of amplification products.

[0041] As used herein, the term “melting temperature” is defined as the temperature at which 50% of the double-stranded DNAs in a population are dissociated into single-stranded DNAs. The melting temperature has various values depending on the GC content and length of DNA, thermodynamic factors, salt concentrations, etc., and is determined by melting analysis.

[0042] As used herein, the term “melting analysis” refers to a process of analyzing the change in fluorescence that appears when increasing temperature from low temperature after completion of PCR reaction. Through this process, the melting temperature is determined.

[0043] As used herein, the term “melting curve” or “melting peak curve” as used herein refers to a graph showing the change in fluorescence (RFU) depending on the temperature (T) obtained during melting analysis. The melting curve or the melting peak curve is plotted with temperature on the x-axis and fluorescence on the y-axis. The “melting peak curve” is a curve expressed as a negative value (−d(RFU)/dT) obtained by first-order differentiation of the obtained melting curve, and the temperature at the peak is the melting temperature.

[0044] The present inventors have developed a method of inducing various melting temperatures by adjusting the GC content of the melting temperature control sequence of the real-time PCR primer and the length of the amplification product.

[0045] In general, in order to detect a plurality of target nucleic acids simultaneously, a conventional amplification curve analysis method using real-time PCR uses fluorophores to detect the target nucleic acids in a sample, and thus only one fluorophore may be used as a label for each nucleic acid to be detected. In addition, in current systems for detecting fluorophores, the number of fluorescence channels that can be analyzed simultaneously is limited to 4 to 6 types, and thus multiplex detection is limited. However, the method for multiplex analysis of amplification products using fluorescence-based multiple melting analysis according to the present invention is characterized in that a primer complementary to a target nucleic acid is labeled with a fluorescent label and a quencher, and a melting temperature control sequence for inducing various melting temperatures is introduced to the primer, whereby multiple targets may be detected using a single fluorescence channel. The method of the present invention may be used to analyze multiple nucleic acids, alleles, or the presence or absence of a certain nucleotide sequence in a sample.

[0046] One aspect of the present invention is directed to a method for multiplex analysis of amplification products using fluorescence-based multiple melting analysis, the method including steps of:

[0047] a) preparing target-specific FMMA probe/primer sets which each include an FMMA probe (having a structure of 5′-R-T-Q-C-3′) and a non-labeled primer, wherein R is a fluorescent label, T is a melting temperature control sequence for inducing different temperatures of different amplification products, Q is a quencher, C is a sequence complementary to a target nucleic acid sequence, and each FMMA probe/primer is designed to produce each amplification product having a different melting temperature;

[0048] b) amplifying multiple target nucleic acids in a sample containing one or more target nucleic acids by a nucleic acid polymerase chain reaction using the target-specific FMMA probe/primer sets obtained in the preceding step; and

[0049] c) performing melting temperature analysis on amplification products.

[0050] FIGS. 1a and 1b are schematic views illustrating the principle of fluorescence-based multiple melting analysis (FMMA) of the present invention.

[0051] Each step of the method of the present invention will now be described in more detail with reference to FIGS. 1a and 1b.

[0052] a) Step of Designing FMMA Probe/Primer Sets that Induces Various Melting Temperatures

[0053] Referring to FIG. 1a, in order to perform multiplex analysis according to the method of the present invention, FMMA probe/primer sets are first prepared, which each include an FMMA probe (having a structure of 5′-R-T-Q-C-3′) and a non-labeled primer. In this case, R is a fluorescent label, T is a melting temperature control sequence for inducing different melting temperatures of different amplification products, Q is a quencher, C is a sequence complementary to a target nucleic acid sequence, and each FMMA probe/primer is designed to produce each amplification product having a different melting temperature.

[0054] Referring to FIG. 1b, the above-designed FMMA probe/primer set having the structure 5′-R-T-Q-C-3′ does not generate a fluorescent signal in the absence of a target nucleic acid, but generates fluorescence as shown in C of FIG. 1b when amplification occurs due to the presence of the target nucleic acid in the reaction solution. In a conventional real-time PCR process, this amplification curve is caused by a single target, but in the present invention, the amplification curves of all the targets labeled with the same fluorophore appear as a single amplification curve.

[0055] When the melting temperature analysis is performed to determine whether or not amplification of such multiple targets has occurred, it is possible to analyze a plurality of targets having different melting temperatures (T.sub.m) values as shown in D of FIG. 1b. In this case, the melting temperature of the amplification product has various values depending on the GC content of the melting temperature control sequence and the length of the amplification product.

[0056] Each melting temperature control sequence (T) in the target-specific FMMA probe/primer sets is designed such that the melting point of each amplification product is distinguished by adjusting the length and GC content of the amplification product and the length and GC content of the melting temperature control sequence. The target-specific FMMA probes-primers are preferably configured such that the difference between adjacent melting temperatures is 2° C. or higher, more preferably 4° C. or higher, in order to distinguish between amplification products. The target-specific FMMA probes/primers having the same fluorescent label may be configured such that the difference between adjacent temperatures of the amplification products is 2° C. or higher, 3° C. or higher, 4° C. or higher, 5° C. or higher, 6° C. or higher, 7° C. or higher, 8° C. or higher, 9° C. or higher, or 10° C. or higher.

[0057] In the present invention, the melting temperature control sequence (T) is 10 to 30 bp in length. The GC content of the target-specific FMMA probe/primer set including the melting temperature control sequence is 0 to 100%, more preferably 20 to 90%.

[0058] In the present invention, a fluorescent label (R) is used as a signal generating means for generating a signal indicating the presence of a target nucleic acid. A fluorescent label that may be used in the present invention may be selected from the group consisting of 5-carboxyfluorescein (FAM™), TET™, 2′7′-dimethoxy-4′5′-dichloro-6-carboxyfluorescein (JOE™), VIC™, HEX™, 6-carboxy-X-rhodamine (ROX™), N,N,N′,N′-tetramethyl-6-carboxyrhodamine (TAMRA™), CyDye™ (Cy2™, Cy3™, CY3.5™, Cy5™, and CY5.5™) Oregon Green (Oregon Green™ 488, Oregon Green™ 500, Oregon Green™ 514), CAL Red™, Red 640®, and Texas Red®, but is not necessarily limited thereto.

[0059] Additional non-limiting examples of the fluorescent label include, but are not limited to, quantum dots, Alexa Fluor™ dye, AMCA, BODIPY 630/650, BODIPY™ 650/665, BODIPY™-FL, BODIPY™-R6G, BODIPY™-TMR, BODIPY™-TRX, CascadeBlue™, fluorescein, 6-JOE, Oregon Green™ 488, Oregon Green™ 500, Oregon Green™ 514, Pacific Blue™, REG, phycobiliprotein, phycoerythrin, allophycocyanin, Rhodamine Green™, Rhodamine Red™, ROX™, TAMRA™, TET™, and tetramethylrhodamine. Fluorophores have different excitation and emission wavelengths depending on their type, and their usage is also different. The characteristics of the target fluorophores are summarized in Table 1 below.

TABLE-US-00001 TABLE 1 Excitation Emission Filter wavelength wavelength Fluorophore 1 490 520 FAM, SYBR Green 2 520 550 JOE, VIC, HEX, TET 3 550 580 NED, TAMRA, CY3 4 580 610 Taxas Red, ROX, RED610 5 640 670 CY5, RED670

[0060] As used herein, the term “quencher” refers to a substance that reduces fluorescence intensity by absorbing light generated by the fluorescent label. The quencher that is used in the present invention may be selected from the group consisting of N,N,N′,N′-tetramethyl-6-carboxyrhodamine (TAMRA™), 4-(4′-dimethylaminophenylazo) benzoic acid (DABCYL), ECLIPSE®, NFQ, Black Hole Quencher® (BHQ), Deep Dark Quencher (DDQ), QSY®, Blackberry™ Quencher, Qxl, Iowa black® FQ, Iowa black® RQ, and IRDye QC-1, but is necessarily limited thereto. The quencher may be selected in consideration of the fact that the range in which the fluorescence intensity is reduced by the quencher differs depending on the type of quencher. Suitable fluorescent label-quencher pairs are disclosed in various literatures as follows: Pesce et al., editors, Fluorescence Spectroscopy (Marcel Dekker, New York, 1971); White et al., Fluorescence Aalysis: A Practical Approach (Marcel Dekker, New York, 1970); Berlman, Handbook of Fluorescence Spectra of Aromatic Molecules, 2.sup.nd EDITION (Academic Press, New York, 1971); Griffiths, Color and Constitution of Organic Molecules (Academic Press, New York, 1976); Bishop, editor, Indicators (Pergamon Press, Oxford, 1972); Haugland, Handbook of Fluorescent Probes and Research Chemicals (Molecular Probes, Eugene, 1992); Pringsheim, Fluorescence and Phosphorescence (Interscience Publishers, New York, 1949); Haugland, R. P., Handbook of Fluorescent Probes and Research Chemicals, 6.sup.th Edition (Molecular Probes, Eugene, Oreg., 1996); U.S. Pat. Nos. 3,996,345 and 4,351,760.

[0061] b) PCR Amplification of Multiple Target Nucleic Acids

[0062] Multiple target nucleic acids in a sample containing one or more target nucleic acids are amplified by polymerase chain reaction using the target-specific FMMA probe-primer sets obtained in the preceding step.

[0063] In the present invention, the amplification reaction of the target nucleic acid/FMMA probe complex may be performed using reagents necessary for amplification, for example, suitable amounts of DNA polymerase, DNA polymerase cofactor (Mg.sup.2+), buffer solution, dNTPs (dATP, dCTP, dGTP and dTTP) and water (dH.sub.2O), in addition to the primer set of the present invention. The buffer solution may further contain, but is not limited to, suitable amounts of Triton X-100, dimethyl sulfoxide (DMSO), Tween20, nonidet P40, PEG 6000, formamide and bovine serum albumin (BSA).

[0064] When the polymerization reaction is performed, excessive amounts of components necessary for the reaction are preferably provided to a reactor. “The excessive amounts of components necessary for the amplification reaction” means such amounts that the amplification reaction is not substantially limited by concentrations of the components. Cofactors such as Mg.sup.2+, and dATP, dCTP, dGTP and dTTP are preferably provided to the reaction mixture such that a desired degree of amplification may be achieved.

[0065] Nucleic acid polymerase that may be used in the present invention may be an RNA-dependent RNA-polymerase, an RNA-dependent DNA-polymerase, a DNA-polymerase, or an RNA-polymerase.

[0066] Non-limiting examples of the nucleic acid polymerase include Thermus aquaticus (Taq) polymerase, Thermus thermophilus (Tth) polymerase, Thermococcus litoralis (Tli or VENT™) polymerase, Pyrococcus furiosus (Pfu) polymerase, DEEPVENT™ polymerase, Pyrococcus woosii (Pwo) polymerase, Bacillus sterothermophilus (Bst) polymerase, Sulfolobus acidocaldarius (Sac) polymerase, Tac polymerase, Thermus flavus (Tfl/Tub) polymerase, Thermus ruber (Tru) polymerase, Thermus brockianus (DYNAZYME™) polymerase, Thermotoga neapolitana (Tne) polymerase, Thermotoga maritima (Tma) polymerase, Tsp polymerase, Methanobacterium thermoautotrophicum (Mth) polymerase, Phi29 polymerase, Klenow polymerase, T7 polymerase, or KOD DNA polymerase. A preferred example of the nucleic acid polymerase is Taq polymerase.

[0067] One PCR reaction may consist of 10 to 100 “cycles” of denaturation and synthesis of a DNA molecule. In a preferred embodiment, the temperature at which denaturation is done in a thermocycling amplification reaction is about 90° C. to more than 95° C., more preferably 92° C. to 94° C. Preferred thermocycling amplification methods include polymerase chain reactions involving from about 10 to about 100 cycles, more preferably from about 25 to about 50 cycles, and peak temperatures from about 90° C. to more than 95° C., more preferably 92° C. to 94° C.

[0068] In the annealing step of the process of amplifying the target DNA using the target-specific FMMA probe/primer set, the target-specific FMMA probe-primer set is annealed to the complementary strand of the target nucleic acid, and when the target DNA is amplified during the amplification process, an amplification curve signal (fluorescence) is generated. Unlike conventional probes, the FMMA probe of the present invention is a probe that is involved directly in nucleic acid amplification, and thus the mechanism of action thereof is different from those of other types of probes that show fluorescence by binding to the target DNA. That is, the FMMA probe of the present invention displays fluorescence by forming a portion of the amplification product. In the melting temperature analysis process, when the double strands are separated into single strands, fluorescence decreases, making melting temperature analysis possible. Thus, unlike a conventional method in which a probe alone is separated from a target nucleic acid and the melting temperature thereof, the FMMA probe of the present invention forms a portion of the amplification product.

[0069] c) Analysis of Melting Temperature of Each Amplification Product

[0070] Melting temperature analysis is performed on the amplification products. The step of analyzing the melting temperature includes a step of obtaining a melting curve by measuring fluorescence generated by melting each amplification product while increasing the temperature thereof, and then obtaining a melting peak curve from the melting curve.

[0071] Each target-specific FMMA probe is specific to the target nucleic acid sequence, and two or more probes having the same label are present in each set. The amplification products of the target-specific FMMA probe/primer sets having the same label are distinguished from each other because they have a melting temperature (T.sub.m) that differ from each other by a melting temperature of 2° C. or higher, more preferably 2° C. or higher. Therefore, through melting temperature analysis, products amplified by different target-specific FMMA probes/primers having the same label may be distinguished from each other.

[0072] Another aspect of the present invention is directed to a method for genotyping using fluorescence-based multiple melting analysis. The method of the present invention includes steps of: a) preparing a plurality of allele-specific probe/primer sets, which each have a structure of 5′-R-T-Q-C-3′ and each include an FMMA probe-primer, wherein R is a fluorescent label capable of detecting whether or not the allele is amplified, T is a melting temperature control sequence for inducing different temperatures of different amplification products, Q is a quencher, C is a sequence complementary to a target nucleic acid sequence, and each FMMA probe/primer is designed to produce each amplification product having a different melting temperature; and b) amplifying multiple target nucleic acids in a sample containing one or more target nucleic acids by a nucleic acid polymerase chain reaction using the target-specific FMMA probe/primer set obtained in the preceding step. After completion of the amplification, the allele in the sample is detected by performing melting temperature analysis on the amplification products.

[0073] In this case, in a real-time PCR system such as Biorad CFX96, a graph showing the temperature on the x-axis and fluorescence signal intensity on the y-axis is plotted using the built-in analysis software. Thereafter, the analysis software differentiates the fluorescence signal intensity on the y-axis with respect to temperature to facilitate visual identification, and then plots a graph with negative values on the y-axis, that is, a graph with temperature on the x-axis and −d(RFU)/dT values on the y-axis. After a differential curve of the change in the fluorescence level with the change in the melting temperature (T.sub.m) is obtained as described above, genotyping is performed according to the presence or absence of a peak representing each genotype.

[0074] FIG. 2 is a schematic view illustrating allele-specific FMMA for rice variety identification. In the present invention, an allele-specific SNP marker is used, and the SNP marker is a marker whose 3′ end nucleotides exactly match any one allele, but are substituted with a nucleotide that mismatches other specific alleles. In the present invention, in order to be able to simultaneously analyze multiple target allele-specific SNP markers using a single fluorescent label, the amplification product length and the melting temperature control sequence are designed such that the amplification products have 2 or 3 different melting temperatures.

[0075] Referring to FIG. 2, the target-specific FMMA probe/primer set according to a marker for rice variety identification according to the present invention coincides with a specific allele representing SNP. Thus, the FMMA probe hybridizes specifically to the template DNA for the alleles that match complementarily, but the FMMA probe does not hybridize to a non-specific allele. In this case, since the FMMA probe is labeled with a detectable means such as a fluorescent label, the SNP type of the product amplified by PCR can be identified. The presence or absence of a product amplified by PCR using the allele-specific marker for rice variety identification can be easily analyzed using melting curve analysis.

[0076] The measured melting temperature (T.sub.m) on the melting curve shows a melting peak when the FMMA probe of each of the target-specific FMMA probe-primer sets is consistent with the nucleotide at the SNP position of each target gene and thus amplification occurs. Therefore, comparison of the T.sub.m value makes it possible to detect nucleotide variation at the SNP position.

[0077] As used herein, the term “nucleotide variation” refers to various alleles appearing in the same gene. In other words, the term “nucleotide variation” encompasses both wild-types and mutants. Therefore, detection of nucleotide variation may be expressed by genotyping or detection of an allele.

[0078] As used herein, the term “genetic variation” refers to a phenomenon occurring due to an allele, single nucleotide polymorphism (SNP), mutation, or a combination thereof. In this case, the allele refers to genes that exhibit different characters while existing at the same locus on a chromosome, or genes having different nucleotide sequences located at the same locus on homologous chromosomes.

[0079] Still another aspect of the present invention is directed to a kit for multiplex detection of target nucleic acids using fluorescence-based multiple melting analysis, the kit including the target-specific FMMA probe/primer sets of the present invention.

[0080] The kit of the present invention includes a) target-specific FMMA probe/primer sets, which each include an FMMA probe (having a structure of 5′-R-T-Q-C-3′) and a non-labeled primer, wherein R is a fluorescent label, T is a melting temperature control sequence for inducing different temperatures of different amplification products, Q is a quencher, C is a sequence complementary to a target nucleic acid sequence, and each FMMA probe/primer is designed to produce each amplification product having a different melting temperature.

[0081] According to another preferred embodiment of the present invention, the kit may optionally include reagents necessary for nucleic acid amplification, for example, buffer, DNA polymerase (e.g., thermostable DNA polymerase isolated from Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermus filiformis, Thermis flavus or Thermococcus literalis), a DNA polymerase cofactor, and dNTPs.

[0082] The kit of the present invention may consist of a number of separate configurations including the above-described reagent components. In addition, the kit of the present invention may further include a user's guide describing conditions under which the optimum reaction is performed.

[0083] The present invention provides a kit for identification of allele-specific rice varieties, the kit including the allele-specific FMMA probe-primer sets of the present invention as described above. The kit for identification of allele-specific rice varieties according to the present invention can identify rice varieties using multiplex allele-specific multiplex polymerase chain reaction.

[0084] The kit for identification of allele-specific rice varieties according to the present invention establishes a real-time PCR method that uses at least 15 marker sets for rice variety identification at the same time, and is highly advantageous in that it can minimize necessary testing time and labor by significantly simplifying the PCR process.

[0085] Hereinafter, the present invention will be described in more detail with reference to examples. However, the following examples serve merely to illustrate the present invention, and the scope of the present invention is not limited to the following examples.

EXAMPLE 1

Rice Variety Identification Using Allele-Specific FMMA

[0086] 1-1. Design for Primers for FMMA

[0087] For multiple-target analysis, which is a characteristic of the present invention, SNPs (single nucleotide polymorphisms) on several alleles were applied for the identification of rice varieties to be analyzed. For the identification of rice varieties, the presence or absence of about 20 SNP markers was examined, and the varieties were determined according to the patterns thereof.

[0088] As shown in FIG. 2, an FMMA primer specific to the SNP site of each type of marker gene was designed to show a melting peak at a certain temperature when the amplification product has the genotype of interest.

[0089] Primers used for rice variety analysis were designed based on the information on genetic markers for rice variety identification and nucleotide sequences thereof, provided by the National Agricultural Products Quality Management Service. That is, the primers were designed such that whether the presence or absence of the SNP corresponding to each genetic marker could be determined based on whether amplification occurred. The primers were designed such that the length of each amplification product and the melting temperature control sequence changed so that the amplification products had 2 or 3 different melting temperatures, making it possible to analyze multiple markers using a single fluorescent label. The sequences of the primers used in this Example and the sizes, GC contents and melting temperatures of amplification products are shown in Table 2 below.

TABLE-US-00002 TABLE 2 PCR PCR product PCR product GC product Fluorescent size content T.sub.m label Allele Name Nucleotide sequence (bp) (%) (° C.) FAM BR09 BRa09-F3(T- [FAM]TAGCGTAAAATAGAGGAGG  52 36.5 72.5 In)-3[FAM] [BHQ1]ACATGAtAAG (SEQ ID NO: 1) BR09-(T)R2 GAGGAAAAAACATAGCATGTTTC (SEQ ID NO: 2) FAM BR06 BR06- [FAM]GCGCTGGATACCCTGGACG 239 33.5 80.0 F(FAM) AG[BHQ1]ATCTTACATTTGGTTTCA CTGTTA (SEQ ID NO: 3) BRq06-R CAGTATGCTAATAACTCACTAATT (SEQ ID NO: 4) FAM BR01 BR01- [FAM]CGCGCCGCGCCCCGGCCGC 308 42.2 87.0 F(FAM) GC[BHQ1]AAGCAGCCTCATGGAGG TAG (SEQ ID NO: 5) BRq01-R CAACTTGATTTCCTGCTGCTAT (SEQ ID NO: 6) HEX BR02 BRc02-F GTAGTTATAATTATTGGGTTCACC 134 31.3 78.5 (SEQ ID NO: 7) BRa02- [HEX]CGTCAGGTAAGCGTGACGA RL1(HEX) CT[BHQ1]CACTCCTAAGATGCCAC ATAtCG (SEQ ID NO: 8) HEX BR04 BRq04-F GAACTCTCACATTAGCTAGAAAT 305 32.5 84.0 (SEQ ID NO: 9) BRa04- [HEX]CGCCCGGCGGGCGCGGCGC RL1(HEX) AG[BHQ1]TGTTGGTTGTGAGTTGA TACTG (SEQ ID NO: 10) BRa07-R3 [Cy5]CCGCGGGGCCCGCCCGGCGA (Cy5) C[BHQ2]AGCCGATCAGATAGATCC CT (SEQ ID NO: 11)

[0090] 1-2. Real-Time PCR Reaction

[0091] Using the designed primers, real-time PCR reaction was performed using the genomic DNA of each rice variety as a template.

[0092] Each genomic fragment including a target nucleic acid SNP to be identified was subjected to PCR amplification using 10 to 50 ng of genomic DNA as a template. A reaction mix having a total volume of 15 μl was prepared, including 7.5 μl of 2× PCR for rice variety identification, 1 μl of template DNA (5 to 10 ng/μl), 1 μl of FMMA probe (0.1 to 1.0 pmole/μl) for rice variety identification, 1 μl of primer (0.5-4.0 pmole/μl), and 4 μl of sterile water.

[0093] The reaction mix was activated at 95° C. for 15 minutes, and then subjected to 5 cycles, each consisting of 95° C. for 20 sec, 65° C. for 10 sec and 61° C. for 30 sec, followed by 30 cycles, each consisting of 95° C. for 20 sec and 63° C. for 30 sec.

[0094] As real-time PCR systems, CFX96™ (Biorad) and a MIC qPCR cycler (Bio Molecular System) were used. Fluorescence was measured in real time. Melting curve analysis was performed by measuring fluorescence while performing PCR under the following conditions: initial denaturation at 95° C. for 20 sec, and then hybridization at 45° C. for 30 sec, followed by heating from 65° C. to 99° C. at a rate of 0.4° C./sec.

[0095] 1-3. Analysis of PCR Product Using Real-Time PCR and Final Determination

[0096] As a result of performing allele-specific FMMA on rice varieties such as Gan-Cheok, Nam-Gang, Dae-Ya and Shin-Woong-Bong, the presence of five genetic markers (BR01, BR02, BR04, BR06, and BR09) was identified by a single reaction using two fluorescent labels (FAM and HEX). As a result, as shown in FIG. 3, it was possible to obtain a genotyping result corresponding to each rice variety. It was confirmed that it is possible to analyze multiple alleles in a single reaction using two or three different amplification product melting temperatures for each fluorescence channel.

EXAMPLE 2

Rice Variety Identification Using Allele-Specific FMMA

[0097] Allele-specific FMMA for 20 gene markers used for rice variety identification was designed, and identification tests for 4 rice varieties were performed. Four fluorescence channels (FAM, HEX, Texas Red, and Cy5) were used to enable analysis of 10 markers per test set, and the melting temperature was distributed to enable analysis of 2 or 3 markers for each fluorescence channel. Twenty genetic markers were analyzed using two sets capable of analyzing 10 genetic markers, respectively, and the results are shown in FIGS. 4 and 5.

[0098] As can be seen from the results in FIGS. 4 and 5, it was confirmed that the DNA extracted from the sample rice was specifically amplified in the marker set for rice variety identification, indicating that the sample rice was correctly identified to meet variety identification requirements. From this result, it was confirmed that multiple alleles can be analyzed in a single reaction by using two or three different amplification product melting temperatures for each fluorescence channel.

[0099] In conclusion, it was confirmed that the use of the FMMA method according to the present invention can simultaneously analyze 10 or more samples in a single reaction. This method can be applied not only for the determination of the presence or absence of allelic markers as performed in the Example above, but also for the determination of the presence or absence of multiple target nucleic acid genes, and there is no significant difference between the methods for determination. Thus, the method of the present invention can be applied to multiplex detection methods such as simultaneous diagnosis of infection with various pathogens.

EXAMPLE 3

Analysis of Melting Temperature Distribution Depending on Length of Nucleic Acid Amplification Product

[0100] In order to analyze multiple markers in a single fluorescence channel as in Example 1, it is necessary to distribute the melting temperature appropriately between the markers. In order to understand factors that influence the determination of the melting temperature, the correlation between the length of the amplification product and the melting temperature thereof was examined. The fluorescently labeled primer was fixed, and the length of the product was adjusted by changing the position of the reverse primer, and the melting temperature was analyzed. That is, as the 5′ end fluorescent primer, the same primer was used, and as the 3′ end primer, a primer having an adjusted length was used so that the length of the amplification product would vary between 50 bp and 350 bp. The primers used are shown in Table 3 below.

TABLE-US-00003 TABLE 3 PCR PCR product product T.sub.m Name Nucleotide sequence size (bp) (° C.) BR05 BRq05-F2 CAATGTGGATTGTGAAGGTGA 102 79 (SEQ ID NO: 12) BRq05-F1 GTTCAAGAATTTGGAGAATCAAT 121 79.5 (SEQ ID NO: 13) BRq05-F GCAACATCGGACTGAAAGGT 170 81 (SEQ ID NO: 14) BRm05-F(200) CTGTAAAGATTGAACTGCCAAAT 220 77/82 (SEQ ID NO: 15) BRc05-F GGAACCACCACCGTTTAAATAA 278 82 (SEQ ID NO: 16) BRm05-F(341) TGGTATGTCACATTCTGTACGA 362 82 (SEQ ID NO: 17) BRa05-R(Cy5) [Cy5]GGAGACATCAGATACAGAGTG[BHQ2] TCGGTTATTGCAGGTGATaTTT (SEQ ID NO: 18) BR13 BRa13-F(Texas red) [TexasRed]CCGTACCTTAGAGACAGCGTG [BHQ2]GATGCTTGCAAGAGGGGATaTT (SEQ ID NO: 19) BRm13-R(70) TCTTGATATGGCACCCATCCA  91 83.5 (SEQ ID NO: 20) BRm13-R(122) CAGTCATTGGGGTCAATGCCA 143 85 (SEQ ID NO: 21) BRq13-R GCAAGAACCAGGACCATGTGCT 208 85.5 (SEQ ID NO: 22) BRm13-R(247) TGTCAGTCATGATAATCCAAGG 268 85.5 (SEQ ID NO: 23) BRm13-R(309) CATGTTTAGAAACTGCAATGGC 330 85.5 (SEQ ID NO: 24) BR15 BRa15-F2-1 (HEX) [HEX]CGTCAGGTAAGCGTGACGACT[BHQ1] GACGTCATAGCAACAACtaCG (SEQ ID NO: 25) BRm15-R(51) CACCAACTCATCTTACCTTTAAC  72 80.5 (SEQ ID NO: 26) BRm15-R(102) CAGAAGGTGCCCATCCATGTT 123 84.5 (SEQ ID NO: 27) BRm15-R(151) CTACACCTACTTTCTTCGTCAA 172 84 (SEQ ID NO: 28) BRm15-R(204) TAAGGGACATGACGGGTCAG 225 85.5 (SEQ ID NO: 29) BRq15-R TGTCTGCACTGACTTCTTCATC 275 85.5 (SEQ ID NO: 30) BRm15-R(302) ATCCATCATCCGAAGGATGTG 324 85.5 (SEQ ID NO: 31) BR20 BRa20-F (Cy5) [Cy5]GGAGACATCAGATACAGAGTG[BHQ2] ACTAGAATATGGAACCCTaGAG (SEQ ID NO: 32) BRm20-R(52) TGCTAGTACAGATGAGGAGGT  73 77.5 (SEQ ID NO: 33) BRq20-R1 TTCAACATGCATGATGCAAAGC 144 80 (SEQ ID NO: 34) BRm20-R(183) CGACATTCTTGTTTGATATTTCTT 204 80.5 (SEQ ID NO: 35) BRq20-R GATGAAGGATCTTGGTGTTGCT 260 81 (SEQ ID NO: 36) BRm20-R(313) GATGATATGCTGATTGCTGCC 334 81 (SEQ ID NO: 37)

[0101] For four rice variety genetic markers (BR05, BR13, BR15 and BR20), changes in the melting temperatures of amplification products depending on the lengths thereof were tested, and the results are shown in FIG. 6. Referring to FIG. 6, it was observed that the melting temperature of the PCR amplification product increased as the length of the PCR amplification product increased. However, it could be seen that, when the length of the amplification product exceeded 200 or 250 bp, the effect thereof on the increase in the melting temperature was negligible. In conclusion, it was confirmed that the change in the melting temperature of the amplification product could be induced by controlling the length of the amplification product between 50 bp and 250 bp.

EXAMPLE 4

Analysis of Melting Temperature Distribution on Length of Nucleic Acid Amplification Product and GC Content

[0102] Among factors that influence melting temperature, the correlation between the GC content of the melting temperature control sequence used and the melting temperature of the entire amplification product was analyzed.

[0103] For three rice variety genetic markers (BR12, BR16, and BR20), the positions of the 5′ and 3′ end primers on the target nucleic acid gene were fixed, and the GC content of the melting temperature control sequence of the 5′ end primer was set to two types (high and low GC %). The primers used are shown in Table 4 below. Under these conditions, analysis was performed, and the results are shown in FIG. 7.

TABLE-US-00004 TABLE 4 GC% of Tm Marker Primer Nucleotide sequence control sequence BR12 BRa12- [TexasRed]GCGGGCCGCGGGCGCCGCCAC[BHQ2] 95.238 F2_Hi(Texasred) TCGACGGCGACCTGACTTGT (SEQ ID NO: 38) BRa12- [TexasRed]GGAGACATCAGATACAGAGTG[BHQ2] 47.619 F2_Lo(Texasred) TCGACGGCGACCTGACTTGT (SEQ ID NO: 39) BR12-R GCATTGGAGACGAACTGACG (SEQ ID NO: 40) BR16 BR16-F TGGCGGGCGGGAGACGTTC (SEQ ID NO: 41) BRa16-R3_Lo [HEX]GGAGACATTAGATATAGAGTG[BHQ1]ACT 38.095 [HEX] GGCTTGCTGCCGTATCCA (SEQ ID NO: 42) BRa16-R3_Hi [HEX]CGCCCGGCGGGCGCGGCGCAG[BHQ1]ACT 92.238 [HEX] GGCTTGCTGCCGTATCCA (SEQ ID NO: 43) BR20 BRa20-F_Hi [Cy5]GCGGGCCGCGGGCGCCGCCAC[BHQ2]ACT 47.619 (Cy5) AGAATATGGAACCCTAGAG (SEQ ID NO: 44) BRa20-F_Lo [Cy5]GGAGACATCAGATACAGAGTG[BHQ2]ACT 95.238 (Cy5) AGAATATGGAACCCTAGAG (SEQ ID NO: 32) BRm20-R TGCTAGTACAGATGAGGAGGT (SEQ ID NO: 33)

[0104] Referring to FIG. 7, it was confirmed that, when the GC content of the melting temperature control sequence was high, the melting temperature (T.sub.m) of the amplification product increased compared to when the GC content of the melting temperature control sequence was low, even if the same primer was used. That is, it could be confirmed that, as the GC content of the melting temperature control sequence increased, the melting temperature of the entire amplification product increased.

[0105] Taking the results of Examples 3 and 4 together, it was confirmed that the melting temperature of the entire amplification product was influenced by a combination of the length of the amplification product and the GC content of the melting temperature control sequence used.

INDUSTRIAL APPLICABILITY

[0106] The use of the FMMA method of the present invention makes it possible to detect multiple targets simultaneously in a single reaction. Therefore, the method of the present invention may be widely used in the companion diagnostic field in which multiple target nucleic acid genes need to be analyzed, the agricultural and livestock field in which multiple alleles need to be analyzed, and the clinical pathology field in which multiple infectious agents need to be analyzed simultaneously.

[0107] Although the present invention has been described in detail with reference to embodiments, these embodiments are for illustrative purposes only and the scope of the present invention is not limited to these embodiments. Those skilled in the art will appreciate that various modifications and changes are possible without departing from the spirit and scope of the present invention, and such modifications and changes also fall within the scope of the present invention. Therefore, the true scope of the present invention should be defined by the appended claims and equivalents thereto.