Sanxan gum synthetic strain-<i>Sphingomonas </i>sp. with a molecular marker and application thereof in Sanxan gum preparation

Abstract

The present invention relates to Sanxan gum preparation, and more particularly to a Sanxan gum synthetic strain-Sphingomonas sp. with a molecular marker and application thereof in Sanxan gum preparation by inoculating the Sphingomonas sp. strain (CGMCC No. 19480) into a culture medium containing a carbon source and a nitrogen source after sterilization, aeration fermentation and extraction. The invention solves the problems of no rapid identification of a product containing Sanxan gum and synthetic strain, and low performance indexes of a prepared Sanxan gum. It can quickly identify whether a product contains Sanxan gum. The main technical indicators of the prepared Sanxan gum products are significantly better than the existing products.

Claims

1. A method for identifying a Sanxan gum producing-strain-Sphingomonas sp comprising a step of identifying the Sanxan gum producing strain-Sphingomonas sp. with a molecular marker; wherein the Sanxan gum producing strain-Sphingomonas sp. is Sphingomonas sp. strain NW20200301 deposited under CGMCC Accession Number: 19480 in the China General Microbiological Culture Collection Center, the molecular marker is a nucleotide having the nucleotide sequence shown in SEQ ID NO. 1.

2. The method according to claim 1, being characterized in that, it comprises the following steps of: A, inoculating the Sphingomonas sp. strain (CGMCC No. 19480) into a culture medium containing a carbon source and a nitrogen source after sterilization; B, performing aeration fermentation at 28-32° C. until fermentation broth viscosity is not less than 3000 cp, and residual sugar does not exceed 0.3%; C, performing extraction of the fermentation broth, solid-liquid separation, neutralization, drying and crushing to obtain the Sanxan gum.

3. The method according to claim 2, being characterized in that, the carbon source in the culture medium of the step A is selected from one or any combination of sucrose, glucose, corn powdered sugar, and starch hydrolyzed sugar; and the nitrogen source is selected from one or any combination of peptone, yeast extract, sodium nitrate, ammonium chloride, and ammonium sulfate.

4. The method according to claim 2, being characterized in that, in the step A, the Sphingomonas sp. strain (CGMCC No. 19480) is inoculated into the culture medium in a fermentation tank with an inoculation amount in which the volume percentage of the seed liquid and the culture medium is 10%-20%.

5. The method according to claim 2, being characterized in that, the culture medium in the step A is composed of the following components in mass percentage: carbon source 40%-60%; nitrogen source 3%-5%; magnesium sulfate 1%-2%; dipotassium hydrogen phosphate 3%-4%; soluble ferrous salt 3-5 ppm; calcium carbonate 1%-3%; GPe 0.3%-0.5%; and water as balance, pH=7.0-7.2.

6. The method according to claim 3, being characterized in that, the culture medium in the step A is composed of the following components in mass percentage: carbon source 40%-60%; nitrogen source 3%-5%; magnesium sulfate 1%-2%; dipotassium hydrogen phosphate 3%-4%; soluble ferrous salt 3-5 ppm; calcium carbonate 1%-3%; GPe 0.3%-0.5%; and water as balance, pH=7.0-7.2.

7. The method according to claim 4, being characterized in that, the culture medium in the step A is composed of the following components in mass percentage: carbon source 40%-60%; nitrogen source 3%-5%; magnesium sulfate 1%-2%; dipotassium hydrogen phosphate 3%-4%; soluble ferrous salt 3-5 ppm; calcium carbonate 1%-3%; GPe 0.3%-0.5%; and water as balance, pH=7.0-7.2.

8. The method according to claim 2, being characterized in that, in the step A, the Sphingomonas sp. strain (CGMCC No. 19480) after amplification culture is inoculated into the culture medium with an inoculation amount in which the volume percentage of the seed liquid and the culture medium is 10%-20%.

9. The method according to claim 8, being characterized in that, the amplification culture process comprising the steps of: (1) inoculating the Sphingomonas sp. strain (CGMCC No. 19480) into a first-class seed culture medium to obtain first-class seeds by aeration culture; (2) performing amplification culture of the first-class seeds to obtain second-class seeds; (3) inoculating the second-class seeds into the culture medium with an inoculation amount in which the volume percentage of the second-class seeds and the fermentation culture medium is 10%-20% to perform aeration fermentation.

10. The method according to claim 9, being characterized in that, the process conditions for obtaining the first-class seeds in the step 1) of the amplification culture process comprises: inoculating an agarslant strain into a sterile first-class seed culture medium according to an inoculation amount of 0.5%-0.8% mass ratio, performing aeration culture to obtain the first-class seeds under conditions of culture temperature of 28-32° C., ventilation volume of 0.4 vvm-0.6 vvm, and seed age of 20-24 hours, and the conditions for seed transmitting being bacillus strain, irregular arrangement and no pollution under microscopic examination; an agarslant strain culture medium per liter comprising the following components: 1.2 g sucrose; 0.25 g peptone; 0.25 g dipotassium hydrogen phosphate; 0.15 g yeast powder; 0.15 g diammonium hydrogen phosphate; 0.01 g magnesium sulfate; and 20 g agar; pH=7.0-7.2; the first-class seed culture medium per liter comprising the following components: 10-15 g carbon source; 5-8 g nitrogen source; 1-2 g magnesium sulfate; 3-4 g dipotassium hydrogen phosphate; 3-5 ppm soluble ferrous salt; and 0.3-0.5 g GPe; pH=7.0-7.2, wherein the carbon source is selected from one or any combination of sucrose, glucose, corn powdered sugar, and starch hydrolyzed sugar; and the nitrogen source is selected from one or any combination of peptone, yeast extract, sodium nitrate, ammonium chloride, and ammonium sulfate.

11. The method according to claim 9, being characterized in that, a second-class seed culture medium in the step 2) of the amplification culture process comprises the following components: 10-15 g carbon source; 5-8 g nitrogen source; 1-2 g magnesium sulfate; 3-4 g dipotassium hydrogen phosphate; 3-5 ppm soluble ferrous salt; and 0.3-0.5 g GPe; pH=7.0-7.2; wherein the carbon source is selected from one or any combination of sucrose, glucose, corn powdered sugar, and starch hydrolyzed sugar; and the nitrogen source is selected from one or any combination of peptone, yeast extract, sodium nitrate, ammonium chloride, and ammonium sulfate; the first-class seeds being inoculated into the sterile second-class seed culture solution with an inoculation amount in which the volume percentage of the first-class seeds and the second-class seed culture solution is 10%-20%, the first-class seeds being cultured in the sterile second-class seed culture solution to obtain the second-class seeds under conditions of culture temperature of 28-30° C., ventilation volume of 0.4 vvm-0.6 vvm, and seed age of 20-24 hours, and the conditions for seed transmitting being bacillus strain, irregular arrangement and no pollution under microscopic examination.

12. The method according to claim 11, being characterized in that, the second-class seed culture solution is composed of the following components in mass percentage: glucose 2.5%-2.8%; maltose 1.5%-2.0%; soy powder 0.8%-1.0%; ammonium sulfate 0.2%-0.3%; and sterile water as balance; pH=7.0-7.3; the first-class seeds being inoculated into the sterile second-class seed culture is solution with an inoculation amount in which the volume percentage of the first-class seeds and the second-class seed culture solution is 12%-18%, the first-class seeds being cultured to obtain the second-class seeds under conditions of culture temperature of 30-32° C., ventilation volume of 0.9 vvm-1.0 vvm, and culture period of 8-10 hours.

13. The method according to claim 2, being characterized in that, the ventilation volume in the step B is 0.6-1.0 vvm.

14. The method according to claim 3, being characterized in that, a test for determining the fermentation broth viscosity in the step B comprises: (1) taking about 50 mL of the fermentation broth, removing its surface and stirring with a glass rod for 2-3 turns; (2) correcting the leveling of a viscometer: adjusting a screw in its foot to make sure the viscometer is level; (3) installing a rotor: installing a No. 4 rotor by turning it slightly; (4) placing a beaker containing the fermentation broth on a lifting platform directly below the rotor, adjusting the lifting platform so that the liquid level of the fermentation broth reaches the scale of the rotor; (5) turning on the power switch of the viscometer, adjusting the speed of the viscometer to 60 rpm, and reading the value after stabilization, wherein the viscosity=value×100.

15. The method according to claim 2, being characterized in that, is the extraction step in the step C comprises adding acid to adjust pH of the fermentation broth to 1.5-2.0, rising the temperature to 60-80° C. and maintaining for 30-50 minutes; wherein the acid is one or any combination of hydrochloric acid, sulfuric acid, and chloroacetic acid with a volume percentage concentration of 10%.

16. The method according to claim 2, being characterized in that, the neutralization step in the step C comprises adding fibrous materials to one or a mixture of sodium carbonate, sodium hydroxide and potassium hydroxide so that the pH of the fibrous materials after neutralization is 6.5-7.5, and the fibrous materials after neutralization is uniform and agranular.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 is a comparison drawing of the polysaccharide structure of Sanxan gum, welan gum, and gellan gum, where Glc is glucose, Man is mannose, GlcA is glucuronic acid, Rha is rhamnose, Acetyl is acetyl group, and Glyceroyl is glyceryl group.

(2) FIG. 2 is comparison drawing of sequence (SEQ ID NO: 5) of obtained highest homologous species Bosea vaviloviae strain Vaf18 and sequence (SEQ ID NO: 4) of the molecular marker of the present invention when a BLASTN alignment is performed between nucleic acid sequences of Sphingomonas Sp. CGMCC No. 19480 with those of all species in GenBank database; the SEQ ID NO: 4 is a partial of sequence of SEQ ID NO: 1.

DETAILED DESCRIPTION OF EMBODIMENTS

(3) The present invention will be described in further detail with reference to the embodiments and the accompanying drawings below. However, the embodiments and the accompanying drawings are not intended to limit the present invention. The scope of protection of the present invention is based on the contents recited in the claims. Any replacement of equivalent technical means based on the description will not deviate from the protection scope of the present invention. The methods that do not indicate specific conditions in the embodiments of the present invention are performed according to the technical means commonly used in the art or the conditions recommended by the manufacturer.

Embodiment 1

(4) A Sanxan gum synthetic strain-Sphingomonas sp. with a molecular marker has a deposit number of CGMCC No. 19480, Latin name of Sphingomonas sp., and the molecular marker is a nucleotide sequence shown in SEQ ID NO:1.

(5) The application of the Sanxan gum synthetic strain-Sphingomonas sp. with a molecular marker in Sanxan gum preparation, includes the steps of:

(6) A, inoculating the Sphingomonas sp. strain (CGMCC No. 19480) into a culture medium containing a carbon source and a nitrogen source after sterilization;

(7) B, performing aeration fermentation at 28° C. until fermentation broth viscosity is not less than 3000 cp, and residual sugar does not exceed 0.3%;

(8) C, performing extraction of the fermentation broth, solid-liquid separation, neutralization, drying and crushing to obtain the Sanxan gum.

(9) In the step A, the carbon source in the culture medium is selected from sucrose, and the nitrogen source is selected from peptone.

(10) In the step A, the Sphingomonas sp. strain (CGMCC No. 19480) is inoculated into the culture medium in a fermentation tank with an inoculation amount in which the volume percentage of the seed liquid and the culture medium is 10%-20%.

(11) The culture medium in the step A is composed of the following components in mass percentage: carbon source 40%; nitrogen source 3%; magnesium sulfate 1%; dipotassium hydrogen phosphate 3%; soluble ferrous salt 3 ppm; calcium carbonate 1%; GPe 0.3%; and water as balance, pH=7.0-7.2.

(12) In the step A, the Sphingomonas sp. strain (CGMCC No. 19480) after amplification culture is inoculated into the culture medium with an inoculation amount in which the volume percentage of the seed liquid and the culture medium is 10%.

(13) The amplification culture process including the steps of:

(14) (1) inoculating the Sphingomonas sp. strain (CGMCC No. 19480) into a first-class seed culture medium to obtain first-class seeds by aeration culture;

(15) (2) performing amplification culture of the first-class seeds to obtain second-class seeds;

(16) (3) inoculating the second-class seeds into the culture medium with an inoculation amount in which the volume percentage of the second-class seeds and the fermentation culture medium is 10%-20% to perform aeration fermentation.

(17) The process conditions for obtaining the first-class seeds in the step (1) of the amplification culture process are as follows: inoculating an agarslant strain into the sterile first-class seed culture medium according to an inoculation amount of 0.5% mass ratio, performing aeration culture to obtain the first-class seeds under conditions of culture temperature of 28° C., aeration volume of 0.4 vvm, and seed age of 20 hours. The conditions for seed transmitting are bacillus strain, irregular arrangement and no pollution under microscopic examination.

(18) An agarslant strain culture medium per liter includes the following components: 1.2 g sucrose; 0.25 g peptone; 0.25 g dipotassium hydrogen phosphate; 0.15 g yeast powder; 0.15 g diammonium hydrogen phosphate; 0.01 g magnesium sulfate; and 20 g agar; pH=7.0-7.2.

(19) The first-class seed culture medium per liter includes the following components: 10 g carbon source; 5 g nitrogen source; 1 g magnesium sulfate; 3 g dipotassium hydrogen phosphate; 3 ppm soluble ferrous salt; and 0.3 g GPe; pH=7.0-7.2, where the carbon source is selected from sucrose, and the nitrogen source is selected from peptone.

(20) A second-class seed culture medium in the step (2) of the amplification culture process includes the following components: 10 g carbon source; 5 g nitrogen source; 1 g magnesium sulfate; 3 g dipotassium hydrogen phosphate; 3 ppm soluble ferrous salt; and 0.3-0.5 g GPe; pH=7.0-7.2, wherein the carbon source is selected from sucrose; and the nitrogen source is selected from peptone.

(21) The first-class seeds are inoculated into the sterile second-class seed culture solution with an inoculation amount in which the volume percentage of the first-class seeds and the second-class seed culture solution is 10%. The first-class seeds are cultured in the sterile second-class seed culture solution to obtain the second-class seeds under conditions of culture temperature of 28° C., aeration volume of 0.4 vvm, and seed age of 20 hours. The conditions for seed transmitting are bacillus strain, irregular arrangement and no pollution under microscopic examination.

(22) The second-class seed culture solution is composed of the following components in mass percentage: glucose 2.5%; maltose 1.5%; soy powder 0.8%; ammonium sulfate 0.2%; and sterile water as balance; pH=7.0-7.3.

(23) The first-class seeds are inoculated into the sterile second-class seed culture solution with an inoculation amount in which the volume percentage of the first-class seeds and the second-class seed culture solution is 12%-18%. The first-class seeds are cultured to obtain the second-class seeds under conditions of culture temperature of 30° C., aeration volume of 0.9 vvm, and culture period of 8 hours.

(24) The aeration volume in the step B is 0.60 vvm.

(25) The detection method of the fermentation broth viscosity in the step B includes:

(26) (1) taking about 50 mL of the fermentation broth, removing its surface and stirring with a glass rod for 2-3 turns;

(27) (2) correcting the leveling of a viscometer: adjusting a screw in its foot to make sure the viscometer is level;

(28) (3) installing a rotor: installing a No. 4 rotor by turning it slightly;

(29) (4) placing a beaker containing the fermentation broth on a lifting platform directly below the rotor, adjusting the lifting platform so that the liquid level of the fermentation broth reaches the scale of the rotor;

(30) (5) turning on the power switch of the viscometer, adjusting the speed of the viscometer to 60 rpm, and reading the value after stabilization, where the viscosity=value×100.

(31) The extraction step in the step C includes adding acid to adjust pH of the fermentation broth to 1.5, rising the temperature to 60° C. and maintaining for 30 minutes; where the acid is hydrochloric acid with a volume percentage concentration of 10%.

(32) The neutralization step in the step C includes adding fibrous materials to sodium carbonate so that the pH of the materials after neutralization is 6.5-7.5, and the materials after neutralization is uniform and no particles.

Embodiment 2

(33) The difference between the embodiment and the embodiment 1 is as follows.

(34) The application of the Sanxan gum synthetic strain-Sphingomonas sp. with a molecular marker in Sanxan gum preparation, includes the steps of:

(35) A, inoculating the Sphingomonas sp. strain (CGMCC No. 19480) into a culture medium containing a carbon source and a nitrogen source after sterilization;

(36) B, performing aeration fermentation at 32° C. until fermentation broth viscosity is not less than 3000 cp, and residual sugar does not exceed 0.3%;

(37) C, performing extraction of the fermentation broth, solid-liquid separation, neutralization, drying and crushing to obtain the Sanxan gum.

(38) In the step A, the carbon source in the culture medium is selected from glucose, and the nitrogen source is selected from yeast extract.

(39) In the step A, the Sphingomonas sp. strain (CGMCC No. 19480) is inoculated into the culture medium in a fermentation tank with an inoculation amount in which the volume percentage of the seed liquid and the culture medium is 20%.

(40) The culture medium in the step A is composed of the following components in mass percentage: carbon source 60%; nitrogen source 5%; magnesium sulfate 2%; dipotassium hydrogen phosphate 4%; soluble ferrous salt 5 ppm; calcium carbonate 3%; GPe 0.5%; and water as balance, pH=7.0-7.2.

(41) In the step A, the Sphingomonas sp. strain (CGMCC No. 19480) after amplification culture is inoculated into the culture medium with an inoculation amount in which the volume percentage of the seed liquid and the culture medium is 20%.

(42) The amplification culture process including the steps of:

(43) (1) inoculating the Sphingomonas sp. strain (CGMCC No. 19480) into a first-class seed culture medium to obtain first-class seeds by aeration culture;

(44) (2) performing amplification culture of the first-class seeds to obtain second-class seeds;

(45) (3) inoculating the second-class seeds into the culture medium with an inoculation amount in which the volume percentage of the second-class seeds and the fermentation culture medium is 20% to perform aeration fermentation.

(46) The process conditions for obtaining the first-class seeds in the step (1) of the amplification culture process are as follows: inoculating an agarslant strain into a sterile first-class seed culture medium according to an inoculation amount of 0.8% mass ratio, performing aeration culture to obtain the first-class seeds under conditions of culture temperature of 32° C., aeration volume of 0.6 vvm, and seed age of 24 hours. The conditions for seed transmitting are bacillus strain, irregular arrangement and no pollution under microscopic examination.

(47) The first-class seed culture medium per liter includes the following components: 15 g carbon source; 8 g nitrogen source; 2 g magnesium sulfate; 4 g dipotassium hydrogen phosphate; 5 ppm soluble ferrous salt; and 0.5 g GPe; pH=7.0-7.2, wherein the carbon source is selected from glucose, and the nitrogen source is selected from yeast extract.

(48) A second-class seed culture medium in the step (2) of the amplification culture process includes the following components: 15 g carbon source; 8 g nitrogen source; 2 g magnesium sulfate; 4 g dipotassium hydrogen phosphate; 5 ppm soluble ferrous salt; 0.5 g GPe; pH=7.0-7.2, wherein the carbon source is selected from glucose; and the nitrogen source is selected from yeast extract.

(49) The first-class seeds are inoculated into the sterile second-class seed culture solution with an inoculation amount in which the volume percentage of the first-class seeds and the second-class seed culture solution is 20%. The first-class seeds are cultured in the sterile second-class seed culture solution to obtain the second-class seeds under conditions of culture temperature of 30° C., aeration volume of 0.6 vvm, and seed age of 24 hours. The conditions for seed transmitting are bacillus strain, irregular arrangement and no pollution under microscopic examination.

(50) The second-class seed culture solution is composed of the following components in mass percentage: glucose 2.8%; maltose 2.0%; soy powder 1.0%; ammonium sulfate 0.3%; and sterile water as balance; pH=7.0-7.3.

(51) The first-class seeds are inoculated into the sterile second-class seed culture solution with an inoculation amount in which the volume percentage of the first-class seeds and the second-class seed culture solution is 18%. The first-class seeds are cultured in the sterile second-class seed culture solution to obtain the second-class seeds under conditions of culture temperature of 32° C., aeration volume of 1.0 vvm, and culture period of 10 hours.

(52) The aeration volume in the step B is 1.0 vvm.

(53) The extraction step in the step C includes adding acid to adjust pH of the fermentation broth to 2.0, rising the temperature to 80° C. and maintaining for 50 minutes; where the acid is sulfuric acid with a volume percentage concentration of 10%.

(54) The neutralization step in the step C includes adding fibrous materials to sodium hydroxide so that the pH of the materials after neutralization is 6.5-7.5, and the materials after neutralization is uniform and no particles.

(55) The rest is as mentioned above.

Embodiment 3

(56) The difference between the embodiment and the embodiment 1 is as follows.

(57) The application of the Sanxan gum synthetic strain-Sphingomonas sp. with a molecular marker in Sanxan gum preparation, includes the steps of:

(58) A, inoculating the Sphingomonas sp. strain (CGMCC No. 19480) into a culture medium containing a carbon source and a nitrogen source after sterilization;

(59) B, performing aeration fermentation at 30° C. until fermentation broth viscosity is not less than 3000 cp, and residual sugar does not exceed 0.3%;

(60) C, performing extraction of the fermentation broth, solid-liquid separation, neutralization, drying and crushing to obtain the Sanxan gum.

(61) In the step A, the carbon source in the culture medium is selected from corn powdered sugar, and the nitrogen source is selected from sodium nitrate.

(62) In the step A, the Sphingomonas sp. strain (CGMCC No. 19480) is inoculated into the culture medium in a fermentation tank with an inoculation amount in which the volume percentage of the seed liquid and the culture medium is 15%.

(63) The culture medium in the step A is composed of the following components in mass percentage: carbon source 50%; nitrogen source 4%; magnesium sulfate 1.5%; dipotassium hydrogen phosphate 3.5%; soluble ferrous salt 4 ppm; calcium carbonate 2%; GPe 0.4%; and water as balance, pH=7.0-7.2.

(64) In the step A, the Sphingomonas sp. strain (CGMCC No. 19480) after amplification culture is inoculated into the culture medium with an inoculation amount in which the volume percentage of the seed liquid and the culture medium is 15%.

(65) The amplification culture process including the steps of:

(66) (1) inoculating the Sphingomonas sp. strain (CGMCC No. 19480) into a first-class seed culture medium to obtain first-class seeds by aeration culture;

(67) (2) performing amplification culture of the first-class seeds to obtain second-class seeds;

(68) (3) inoculating the second-class seeds into the culture medium with an inoculation amount in which the volume percentage of the second-class seeds and the fermentation culture medium is 15% to perform aeration fermentation.

(69) The process conditions for obtaining the first-class seeds in the step (1) of the amplification culture process are as follows: inoculating an agarslant strain into the sterile first-class seed culture medium according to an inoculation amount of 0.65% mass ratio, performing aeration culture to obtain the first-class seeds under conditions of culture temperature of 30° C., aeration volume of 0.5 vvm, and seed age of 22 hours. The conditions for seed transmitting are bacillus strain, irregular arrangement and no pollution under microscopic examination.

(70) The first-class seed culture medium per liter includes the following components: 13 g carbon source; 6.5 g nitrogen source; 1.5 g magnesium sulfate; 3.5 g dipotassium hydrogen phosphate; 4 ppm soluble ferrous salt; and 0.4 g GPe; pH=7.0-7.2, where the carbon source is selected from corn powdered sugar, and the nitrogen source is selected from sodium nitrate.

(71) A second-class seed culture medium in the step (2) of the amplification culture process includes the following components: 13 g carbon source; 6.5 g nitrogen source; 1.5 g magnesium sulfate; 3.5 g dipotassium hydrogen phosphate; 4 ppm soluble ferrous salt; 0.4 g GPe; pH=7.0-7.2, where the carbon source is selected from corn powdered sugar; and the nitrogen source is selected from sodium nitrate.

(72) The first-class seeds are inoculated into the sterile second-class seed culture solution with an inoculation amount in which the volume percentage of the first-class seeds and the second-class seed culture solution is 15%. The first-class seeds are cultured in the sterile second-class seed culture solution to obtain the second-class seeds under conditions of culture temperature of 29° C., aeration volume of 0.5 vvm, and seed age of 22 hours. The conditions for seed transmitting are bacillus strain, irregular arrangement and no pollution under microscopic examination.

(73) The second-class seed culture solution is composed of the following components in mass percentage: glucose 2.7%; maltose 1.7%; soy powder 0.9%; ammonium sulfate 0.25%; and sterile water as balance; pH=7.0-7.3.

(74) The first-class seeds are inoculated into the sterile second-class seed culture solution with an inoculation amount in which the volume percentage of the first-class seeds and the second-class seed culture solution is 15%. The first-class seeds are cultured in the sterile second-class seed culture solution to obtain the second-class seeds under conditions of culture temperature of 31° C., aeration volume of 0.95 vvm, and culture period of 9 hours.

(75) The aeration volume in the step B is 0.8 vvm.

(76) The extraction step in the step C includes adding acid to adjust pH of the fermentation broth to 1.7, rising the temperature to 70° C. and maintaining for 40 minutes; where the acid is chloroacetic acid with a volume percentage concentration of 10%.

(77) The neutralization step in the step C includes adding fibrous materials to potassium hydroxide so that the pH of the materials after neutralization is 6.5-7.5, and the materials after neutralization is uniform and no particles.

(78) The rest is as mentioned above.

Embodiment 4

(79) The difference between the embodiment and the embodiment 1 is as follows.

(80) The application of the Sanxan gum synthetic strain-Sphingomonas sp. with a molecular marker in Sanxan gum preparation, includes the steps of:

(81) A, inoculating the Sphingomonas sp. strain (CGMCC No. 19480) into a culture medium containing a carbon source and a nitrogen source after sterilization;

(82) B, performing aeration fermentation at 29° C. until fermentation broth viscosity is not less than 3000 cp, and residual sugar does not exceed 0.3%;

(83) C, performing extraction of the fermentation broth, solid-liquid separation, neutralization, drying and crushing to obtain the Sanxan gum.

(84) In the step A, the carbon source in the culture medium is selected from corn starch hydrolyzed sugar, and the nitrogen source is selected from ammonium chloride.

(85) In the step A, the Sphingomonas sp. strain (CGMCC No. 19480) is inoculated into the culture medium in a fermentation tank with an inoculation amount in which the volume percentage of the seed liquid and the culture medium is 13%.

(86) The culture medium in the step A is composed of the following components in mass percentage: carbon source 45%; nitrogen source 3.5%; magnesium sulfate 1.2%; dipotassium hydrogen phosphate 3.2%; soluble ferrous salt 3.5 ppm; calcium carbonate 1.5%; GPe 0.35%; and water as balance, pH=7.0-7.2.

(87) In the step A, the Sphingomonas sp. strain (CGMCC No. 19480) after amplification culture is inoculated into the culture medium with an inoculation amount in which the volume percentage of the seed liquid and the culture medium is 13%.

(88) The amplification culture process including the steps of:

(89) (1) inoculating the Sphingomonas sp. strain (CGMCC No. 19480) into a first-class seed culture medium to obtain first-class seeds by aeration culture;

(90) (2) performing amplification culture of the first-class seeds to obtain second-class seeds;

(91) (3) inoculating the second-class seeds into the culture medium with an inoculation amount in which the volume percentage of the second-class seeds and the fermentation culture medium is 13% to perform aeration fermentation.

(92) The process conditions for obtaining the first-class seeds in the step (1) of the amplification culture process are as follows: inoculating an agarslant strain into the sterile first-class seed culture medium according to an inoculation amount of 0.55% mass ratio, performing aeration culture to obtain the first-class seeds under conditions of culture temperature of 29° C., aeration volume of 0.45 vvm, and seed age of 21 hours. The conditions for seed transmitting are bacillus strain, irregular arrangement and no pollution under microscopic examination.

(93) The first-class seed culture medium per liter includes the following components: 11 g carbon source; 5.5 g nitrogen source; 1.2 g magnesium sulfate; 3.2 g dipotassium hydrogen phosphate; 3.5 ppm soluble ferrous salt; and 0.35 g GPe; pH=7.0-7.2, where the carbon source is selected from starch hydrolyzed sugar, and the nitrogen source is selected from ammonium chloride.

(94) A second-class seed culture medium in the step (2) of the amplification culture process includes the following components: 15 g carbon source; 5.5 g nitrogen source; 1.2 g magnesium sulfate; 3.2 g dipotassium hydrogen phosphate; 3. ppm soluble ferrous salt; 0.35 g GPe; pH=7.0-7.2, where the carbon source is selected from starch hydrolyzed sugar; and the nitrogen source is selected from ammonium chloride.

(95) The first-class seeds are inoculated into the sterile second-class seed culture solution with an inoculation amount in which the volume percentage of the first-class seeds and the second-class seed culture solution is 12%. The first-class seeds are cultured in the sterile second-class seed culture solution to obtain the second-class seeds under conditions of culture temperature of 28° C., aeration volume of 0.45 vvm, and seed age of 21 hours. The conditions for seed transmitting are bacillus strain, irregular arrangement and no pollution under microscopic examination.

(96) The second-class seed culture solution is composed of the following components in mass percentage: glucose 2.55%; maltose 1.6%; soy powder 0.85%; ammonium sulfate 0.22%; and sterile water as balance; pH=7.0-7.3.

(97) The first-class seeds are inoculated into the sterile second-class seed culture solution with an inoculation amount in which the volume percentage of the first-class seeds and the second-class seed culture solution is 13%. The first-class seeds are cultured to obtain the second-class seeds under conditions of culture temperature of 30° C., aeration volume of 0.92 vvm, and culture period of 8.5 hours.

(98) The aeration volume in the step B is 0.7 vvm.

(99) The extraction step in the step C includes adding acid to adjust pH of the fermentation broth to 1.5-2.0, rising the temperature to 65° C. and maintaining for 35 minutes; where the acid is a mixture of hydrochloric acid and sulfuric acid with a volume percentage concentration of 10%.

(100) The neutralization step in the step C includes adding fibrous materials to a mixture of sodium carbonate and sodium hydroxide so that the pH of the materials after neutralization is 6.5-7.5, and the materials after neutralization is uniform and agranular.

(101) The rest is as mentioned above.

Embodiment 5

(102) The difference between the embodiment and the embodiment 1 is as follows:

(103) The application of the Sanxan gum synthetic strain-Sphingomonas sp. with a molecular marker in Sanxan gum preparation, includes the steps of:

(104) A, inoculating the Sphingomonas sp. strain (CGMCC No. 19480) into a culture medium containing a carbon source and a nitrogen source after sterilization;

(105) B, performing aeration fermentation at 31° C. until fermentation broth viscosity is not less than 3000 cp, and residual sugar does not exceed 0.3%;

(106) C, performing extraction of the fermentation broth, solid-liquid separation, neutralization, drying and crushing to obtain the Sanxan gum.

(107) In the step A, the carbon source in the culture medium is a mixture of sucrose and glucose, and the nitrogen source is a mixture of peptone and sodium nitrate.

(108) In the step A, the Sphingomonas sp. strain (CGMCC No. 19480) is inoculated into the culture medium in a fermentation tank with an inoculation amount in which the volume percentage of the seed liquid and the culture medium is 18%.

(109) The culture medium in the step A is composed of the following components in mass percentage: carbon source 55%; nitrogen source 4.5%; magnesium sulfate 1.8%; dipotassium hydrogen phosphate 3.8%; soluble ferrous salt 4.5 ppm; calcium carbonate 2.5%; GPe 0.45%; and water as balance, pH=7.0-7.2.

(110) In the step A, the Sphingomonas sp. strain (CGMCC No. 19480) after amplification culture is inoculated into the culture medium with an inoculation amount in which the volume percentage of the seed liquid and the culture medium is 18%.

(111) The amplification culture process including the steps of:

(112) (1) inoculating the Sphingomonas sp. strain (CGMCC No. 19480) into a first-class seed culture medium to obtain first-class seeds by aeration culture;

(113) (2) performing amplification culture of the first-class seeds to obtain second-class seeds;

(114) (3) inoculating the second-class seeds into the culture medium with an inoculation amount in which the volume percentage of the second-class seeds and the fermentation culture medium is 18% to perform aeration fermentation.

(115) The process conditions for obtaining the first-class seeds in the step (1) of the amplification culture process are as follows: inoculating an agarslant strain into the sterile first-class seed culture medium according to an inoculation amount of 0.7% mass ratio, performing aeration culture to obtain the first-class seeds under conditions of culture temperature of 31° C., aeration volume of 0.55 vvm, and seed age of 23 hours. The conditions for seed transmitting are bacillus strain, irregular arrangement and no pollution under microscopic examination.

(116) The first-class seed culture medium per liter includes the following components: 14 g carbon source; 7 g nitrogen source; 1.8 g magnesium sulfate; 3.8 g dipotassium hydrogen phosphate; 4.5 ppm soluble ferrous salt; and 0.45 g GPe; pH=7.0-7.2, where the carbon source is a mixture of sucrose and glucose, and the nitrogen source is a mixture of a mixture of peptone and sodium nitrate.

(117) A second-class seed culture medium in the step (2) of the amplification culture process includes the following components: 14 g carbon source; 7 g nitrogen source; 1.8 g magnesium sulfate; 3.8 g dipotassium hydrogen phosphate; 4.5 ppm soluble ferrous salt; 0.45 g GPe; pH=7.0-7.2, where the carbon source is a mixture of sucrose and glucose; and the nitrogen source is a mixture of peptone and sodium nitrate.

(118) The first-class seeds are inoculated into the sterile second-class seed culture solution with an inoculation amount in which the volume percentage of the first-class seeds and the second-class seed culture solution is 18%. The first-class seeds are cultured in the sterile second-class seed culture solution to obtain the second-class seeds under conditions of culture temperature of 30° C., aeration volume of 0.55 vvm, and seed age of 23 hours. The conditions for seed transmitting are bacillus strain, irregular arrangement and no pollution under microscopic examination.

(119) The second-class seed culture solution is composed of the following components in mass percentage: glucose 2.7%; maltose 1.9%; soy powder 0.95%; ammonium sulfate 0.28%; and sterile water as balance; pH=7.0-7.3.

(120) The first-class seeds are inoculated into the sterile second-class seed culture solution with an inoculation amount in which the volume percentage of the first-class seeds and the second-class seed culture solution is 17%. The first-class seeds are cultured to obtain the second-class seeds under conditions of culture temperature of 32° C., aeration volume of 0.98 vvm, and culture period of 9.5 hours.

(121) The aeration volume in the step B is 0.9 vvm.

(122) The extraction step in the step C includes adding acid to adjust pH of the fermentation broth to 1.5-2.0, rising the temperature to 75° C. and maintaining for 45 minutes; where the acid is a mixture of sulfuric acid and chloroacetic acid with a volume percentage concentration of 10%.

(123) The neutralization step in the step C includes adding fibrous materials to a mixture of sodium carbonate and potassium hydroxide so that the pH of the materials after neutralization is 6.5-7.5, and the materials after neutralization is uniform and agranular.

(124) The rest is as mentioned above.

Embodiment 6

(125) Fermentation broth of the Sphingomonas sp. strain (CGMCC No. 19480) is centrifuged at 10000 rpm for 15 minutes to collect strain cells, genomic DNA extraction is performed with a bacterial genomic DNA extraction kit from Tiangen Biotech (Beijing) Co., Ltd., and PCR amplification is performed using a primer 1 (5′-TCAGGCCGTGTGGGGAA-3′, SEQ ID NO: 2) and a primer 1 (5′-GATCCGATCCAGCTTTCG GG-3′, SEQ ID NO: 3) as primers. The PCR amplification system comprises 1 μL of 10-30 ng/μL template DNA, 0.5 μL upstream primer, 0.5 μL downstream primer, 1.0 μL of 10 mM dNTP, 2.5 μL of 10× buffer, 0.5 μL of 5 U/μL Platinum Taq DNA polymerase, with adding water up to 25 μL in sum. The PCR amplification conditions are as follow: pre-denaturation at 95° C. for 5 minutes; 94° C. for 45 seconds, 62° C. for 45 seconds, 72° C. for 1 minute, 30 cycles; 72° C. extension for 10 minutes. 5 μL of the PCR amplification product is mixed with 1 μL of loading buffer, sampled into a 1.5% agarose gel, subjected to electrophoresis, and stained with GoldView nucleic acid dye for 10 minutes. A PCR amplification band about 950 bp is observed. The PCR amplification product is subjected to DNA sequencing in Beijing Aoke Dingsheng Biotechnology Co., Ltd. to obtain the following sequence (SEQ ID NO: 1):

(126) TABLE-US-00001    ACGGCAGGACCTCGCCTTGCAGCAGCCGCGTCGCCTGGCG ACGGTCGAGCGCGCGCGAGAAGAGGAAGCCTTGGCCATATTTG CAGCCATAGCGCTGCAGCAGCCGGCACTGCGCCTCCGTCTCGA TTCCCTCGGCGACGACCCGCAGCTTGAGACCGTCGGCAATCGC GATCAGCCCCTGCACGATCGCAGCGCTGCCCGCATCGGTGCCG AGCTGCTGGACGAAGGAGCGGTCGATCTTGATGATGTCCACCG GCACCGAGAGCAGGTGCGTCAGCGAGGCATAGCCGGTACCGA AATCGTCGAGCGCGATGCGGAGCCCGCGCGCCTGCAATCCTTC GAGAACGCGGCGCACGGTATCGGCGCGCCGGTCCATATGGACC GTCTCGGTCACTTCGACGACCAGATGGCCGAGCGGCACGCGGG CATGCTCGAACGTGTCGGCCAGCGTGCGTTCGAGCAGGCCGCC GCCATGGATGTCGGCGGAGCCGACGTTGATCGAGATCTGCGGA TCGGCGATGCCCAGCCGCATCCAGTGCGCGATGTCGCCGGCGA CGATCCTCAGCATCCGTCGCGTGAGTTCCGGGGCGATGCGCGG GTGCGACATCGCTTGGTGGAAGGCGGCGGCCGGCAGCACTTCG CCCGTGGACGTCGTCAGGCGGCAGAGCGCCTCGAACGACGTTA CCGCCCATGTCTCCAGTTCGACGACCGGCTGATAATAGGCGTCG ATACGATCTTCGTGCAGTGCGCGCTCAAGATCGTGCAACGCGTC GGGATGGCTCGCCACCGCATTGCCCAGGCTCGCGGAATAAGCG AGGTGGCCGCCGCGGTGCGACTGCTTGGCGTGCTGCAGCGCAT TGGTGGCATGTTCGAACAGAATGTCGGACGTCTTCGCCGGATC GCTGATCGCAAAGCCGATG

(127) The product performances and the gum yields of products in Embodiments 1-5 are detected by the Applicant, and the results are as follows:

(128) TABLE-US-00002 Embodi- Embodi- Embodi- Embodi- Embodi- ment 1 ment 2 ment 3 ment 4 ment 5 Viscosity of 1% KCl 1650 1700 1650 1800 1650 solution (25° C.)/MPa .Math. s Viscosity of 0.25% 550 600 550 700 550 synthetic brine (25° C.)/ MPa .Math. s Viscosity of 1% aqueous 950 1000 950 1000 950 solution (25° C.)/MPa .Math. s Gel strength (g/cm.sup.2) 30 35 30 35 30 0.175 mm bore diameter 96 96 97 96 96 sieve particle size (%) Whiteness 47 47 51 50 48 Gum yield (%) 3.01 3.21 3.4 3.08 3.2

(129) It is not difficult to see from the above comparison that the viscosity of 1% KCl solution of the Sanxan gum, viscosity of 0.25% synthetic brine of the Sanxan gum, viscosity of 1% aqueous solution of the Sanxan gum, gel strength of the Sanxan gum, and gum yield of the Sanxan gum of any of Embodiments 1-5 of the present invention are much better than existing processes and products.