LANTANA CAMARA PLANT NAMED 'UF-1013-1'

20210185869 · 2021-06-17

    Inventors

    Cpc classification

    International classification

    Abstract

    A new and distinct cultivar of Lantana camara plant named ‘UF-1013-1’, characterized by its moderate vigor, mounding growth habit, dense branches, round plant form and canopy, free flowering, bright yellow and red flowers, no to little fruiting, no to few seeds, a very high level of female infertility, a very low level of pollen stainability and viability, a very high level of male infertility, lack of hybridization with Lantana depressa, triploidy and a unique combination of DNA marker alleles, is disclosed.

    Claims

    1. A new and distinct Lantana camara plant named ‘UF-1013-1’, as illustrated and described herein.

    Description

    DESCRIPTION OF THE FIGURES

    [0055] The accompanying photographs (as shown in FIGS. 1-7) illustrate the overall appearance of the new Lantana camara cultivar ‘UF-1013-1’. These photographs show the colors as true as can be reasonably obtained in colored reproductions of this type. Colors in the photographs may differ slightly from the color values cited in the detailed botanical description, which accurately describe the colors of the new lantana cultivar.

    [0056] FIG. 1 shows a side perspective view of a typical flowering plant of the new lantana cultivar ‘UF-1013-1’ to show its growth and branching habit, plant form, and flower color. The plant was grown in a gallon (16.5 cm in diameter and 16 cm tall) container and is shown at approximately 16 weeks old. The plant was propagated from cuttings and pinched once;

    [0057] FIG. 2 shows a top view of a typical flowering plant of the new lantana cultivar ‘UF-1013-1’ to show its growth and branching habit, plant form, and flower color. The plant was grown in a gallon (16.5 cm in diameter and 16 cm tall) container and is shown at approximately 16 weeks old. The plant was propagated from cuttings and pinched once;

    [0058] FIG. 3 shows a side perspective view of breeding line DROP-25 (left) (female parent) and the new lantana cultivar ‘UF-1013-1’ (right) when they were grown in gallon (16.5-cm diameter) containers. They were approximately 16 weeks old grown from rooted cuttings that were pinched once;

    [0059] FIG. 4 shows a side perspective view of cultivar ‘UF-1013A-2A’ (left) and the new cultivar ‘UF-1013-1’ (right) when they were grown in gallon (16.5-cm diameter) containers. They were approximately 16 weeks old and grown from rooted cuttings that were pinched once;

    [0060] FIG. 5 shows a top view of fully open flowers of cultivar ‘UF-1013A-2A’ (left) and the new cultivar ‘UF-1013-1’ (right). The flowers were taken from plants of these cultivars grown in the ground bed in full sun in Citra, Fla.;

    [0061] FIG. 6 shows a side perspective view of the new cultivar ‘UF-1013-1’ (left) and ‘Landscape Bandana Red Improved’ (commercial cultivar, not patented) (right) when they were grown in gallon (16.5-cm diameter) containers. They were approximately 16 weeks old and grown from rooted cuttings that were pinched once;

    [0062] FIG. 7 shows a side perspective view of ‘Luscious® Citrus Blend’ (left) and the new cultivar ‘UF-1013-1’ (right) when they were grown in gallon (16.5-cm diameter) containers. They were approximately 16 weeks old and grown from rooted cuttings that were pinched once.

    DETAILED BOTANICAL DESCRIPTION OF THE CULTIVAR

    [0063] In the following description, color references are made to The Royal Horticultural Society (R.H.S.) Colour Chart, 1986 Edition, except where general terms of ordinary dictionary significance are used.

    Description of Growing Conditions

    [0064] Plants used for the description were grown in the fall and winter of 2019 and early spring of 2020 in Balm, Fla. for 24 weeks from when terminal cuttings were made. Cuttings were dipped into a commercial rooting hormone solution (Dip & Grow®, Dip'N Grow, Inc., Clackamas, Oreg.) on 30 August 2019; rooted cuttings were potted up in gallon containers on 26 Sep. 2019. Plants in gallon containers were pinched on 10 Oct. 2019. Plants were grown in the greenhouse until 24 Feb. 2020. Plant data was taken and plant, foliage, and flower descriptions were made. During the production of the plants in the greenhouse, temperatures ranged from about 22.2° C. to about 35.5° C.

    Botanical Description

    [0065] Botanical classification: [0066] Family.—Verbenaceae. [0067] Botanical name.—Lantana camara (L. camara). [0068] Common name.—Lantana. [0069] Cultivar.—‘UF-1013-1’. [0070] Parentage: [0071] Female or seed parent.—DROP-25. [0072] Male or pollen parent.—‘Landmark Flame Improved’. [0073] Propagation: [0074] Type.—Terminal cutting. [0075] Time to initiate roots.—About nine days at 27° C. [0076] Time to produce rooted cuttings.—About 25 days at 27° C. [0077] Root description: [0078] Type.—Fine, fibrous; initially glaucous white in color. [0079] Color.—Close to white (RHS 155B). [0080] Rooting habit.—Freely branching. [0081] Plant description: [0082] Plant form.—Flowering subshrub. [0083] Growth habit.—Outwardly spreading and partially upright plant habit; mounded plant form and canopy; dense branching; two lateral branches potentially forming at every node; pinching enhances lateral branch development. [0084] Plant height.—About 25 cm. [0085] Plant diameter.—About 39 cm×about 34 cm. [0086] Lateral branches.—Length: About 13 cm. Diameter: About 1.6 mm. Internode length: About 1.6 cm. Strength: Strong, but flexible. Texture: Rough, pubescent. Color, young: Close to yellow-green (RHS 144B). Color, woody: Closed to greyed-brown (RHS 199A/B). [0087] Stem.—Quantity of main branches per plant: About four to five. Quantity of leaves per branch: About 12-13. Length of stem: About 10-13 cm. Diameter: About 0.8-2.2 mm. Length of internodes: About 1.0-2.4 cm. Texture: Pilose, and a few glandular hairs on upper surface. Color: Close to yellow green (RHS 144A and 144B). [0088] Foliage description: [0089] Arrangement.—Opposite; simple. [0090] Length.—About 5.2-8.4 cm. [0091] Width.—About 3.1-6.2 cm. [0092] Shape.—Ovate. Apex: Acute. Base: Obtuse with truncate tendencies. [0093] Margin.—Crenate to serrate. [0094] Teeth along margins of leaf.—Mostly 34 to 44. [0095] Texture, upper and lower surfaces.—Leathery, coarse, pubescent. [0096] Luster.—Upper surface: Slightly glossy with tiny hairs. Lower surface: Dull. [0097] Color, developing and fully expanded foliage.—Upper surface, developing: Close to green (RHS 147A). Upper surface, expanded: Close to green (RHS 147A). Lower surface, developing: Close to green (RHS 147B). Lower surface, expanded: Close to green (RHS 147B). [0098] Venation pattern.—Arcuate. [0099] Color of veins.—Upper surface: Close to green (RHS 146A). Blends in with leaf color. Lower surface: Close to green (RHS 146B/C). [0100] Petiole.—Length: About 1.1-2.7 cm. Diameter: About 0.9-1.6 mm. Texture, both surfaces: Slightly pubescent. Color: Upper surface: Close to yellow-green (RHS 146C). Lower surface: Close to yellow-green (RHS 146D). [0101] Inflorescence description: [0102] Flower type.—Umbel-like, flattened semi-sphere; flowers are sessile on ovate receptacle. [0103] Flowering habit.—Freely flowering, with potentially two inflorescences per node; typically about 22-30 flowers per umbel; flowering is continuous and consistent, spring until front in the autumn; flowers are self-cleaning. [0104] Flowering longevity on the plant.—About one week. [0105] Fragrance.—None detected. [0106] Inflorescence diameter.—About 4.5 cm. [0107] Inflorescence height.—About 2.4 cm. [0108] Number of flowers per inflorescence.—About 22-30. [0109] Quantity of inflorescences per plant.—About 15; more during the warm season. [0110] Flowers (fully open).—Flower form and appearance: Flared trumpet, corolla fused, four-parted; flowers roughly rectangular in shape. Flower horizontal diameter: About 1.3 cm×about 1.1 cm. Flower length: About 2.1 cm. [0111] Flower buds (before showing color).—Length: About 5.5 mm. Diameter (width): About 1.3 mm. Shape: Corolla tubes are roughly spherical to ovoid; Flower buds are nearly rectangular when viewed from the top. Color: Close to yellow-green (RHS 144D). [0112] Bract.—Length: About 5.5 mm. Diameter: About 1.1 mm. Color: Close to yellow-green (RHS 144B) near base and close to green (RHS 143A) near tip. Texture: Outer surface: Hirsute. Inner surface: Glandular hairs on inner surface. [0113] Corolla.—Arrangement/appearance: Single whorl of four petals fused into a flared trumpet. Tube length: About 1.4 cm. Throat and tube texture: Outer surface: Pubescent/slightly hirsute basally. Inner surface: Papillose. Tube color (mature): Outer surface: Close to greyed red (RHS 179C). Inner surface, throat: Close to greyed red (RHS 179D). [0114] Petal.—Length from throat: Upper and lower petals: About 6.3 mm. Lateral petals: About 2.7 mm. Width: Upper and lower petals: About 7.7 mm. Lateral petals: About 4.4 mm. Shape: Spatulate to somewhat orbicular. Apex: Rounded. Margin: Entire. Degree of lobation: Moderate. Petal lobe texture, upper and lower surfaces: Smooth, velvety. Color: Petal lobes, when opening (immature): Upper surface: Close to yellow (RHS 13A). Toward the apex: Close to yellow (RHS 13C). Lower surface: Close to yellow (RHS 9B/C). Petal lobes, fully opened (mature): Upper surface: Close to orange red (RHS 34A). Toward the apex: Close to orange red (RHS 34B). Lower surface: Close to orange red (RHS 31C). Throat: Close to yellow (RHS 9A). Tube: Close to orange (RHS 28D). [0115] Calyx.—Number of sepals: 4 sepals fused to form calyx. Length: About 2.5 mm. Width: About 1.7 mm. Shape: Lanceolate. Apex: Acute. Base: Truncate. Texture: Lower surface (inside): Pubescent. Color: Upper surface: Close to yellow-green (RHS 144A). Lower surface: Close to yellow-green (RHS 144A). [0116] Peduncles.—Length: About 1.9 cm. Diameter: About 1 mm. Angle: About 12 degrees from the stem. Strength: Flexible, but strong. Texture: Pubescent. Color: Close to yellow-green (RHS 144A). [0117] Pedicels.—Not observed, flowers not stalked. [0118] Stamens.—Quantity/arrangement: Four per flower, joined to a floral tube. Length of filament: About 1.2 mm. Color of filament: Close to yellow (RHS 13B). [0119] Anther.—Shape: Oblong. Length: About 1.2 mm. Color: Poorly developed. [0120] Pistils.—Quantity: One per flower. Length: About 4.4 mm. Stigma shape: Rounded. Stigma color: Close to yellow-green (RHS 144C). Style color: Close to yellow-green (RHS 150D). Ovary color: Close to yellow-green (RHS 144A). [0121] Pollen.—Amount: Most pollen grains are aborted. Approximately 98% of the observed pollen grains are not viable, and viable pollen grains are rarely observed. Color: Not able to document. [0122] Fruit.—None or rarely observed.

    Assessment of Female Fertility

    [0123] Table 1 shows fruit production of the new Lantana cultivar ‘UF-1013-1’ and two checks (‘UF-1013A-2A’ and ‘Pink Caprice’ (commercial cultivar, not patented)) in two replicated field trials in Florida.

    [0124] The two field trials were conducted at the University of Florida (UF)'s Gulf Coast Research and Education Center (GCREC) in Balm, Fla. (southwest Florida, USDA hardiness zone 9a, and AHS heat zone 10) and at UF's Indian River Research and Education Center (IRREC) in Ft. Pierce, Fla. (southeast Florida, USDA hardiness zone 9b, and AHS heat zone 9-10). The experimental design used in the Balm trial was a randomized complete block with three blocks and two plants per plot. Ground beds at the GCREC were raised about 20 cm, fumigated with Pic-Clor 60™ (Trical, Inc., Hollister, Calif.; active ingredients 1,3-dichloropropene and chloropicrin) at 448 kg per hectare in February 2015, and covered with white-on-black plastic. The experimental design used in the Ft. Pierce trial was a randomized complete block with four blocks and single-plant plots. Ground beds at the IRREC were not fumigated but treated with a pre-emergent herbicide (Sandea®, 75.0% ai (halosulfuron-methyl), Gowan Company, L.L.C., Yuma, Ariz.) at a rate of 0.1056 grams L.sup.−1 and a 2% solution of glyphosate (Roundup WeatherMAX®, 48.8% ai, Monsanto Technology LLC, Saint Louis, Mo.) and covered with black ground cover. Plants in the two trials were grown in full sun.

    [0125] At each site, ‘Pink Caprice’ and ‘UF-1013A-2A’ were included as controls. ‘Pink Caprice’ is very prolific in fruit (and seed) production (Czarnecki et al., 2012), while ‘UF-1013A-2A’ is highly infertile (Deng et al., 2017). In addition, 21 commercial cultivars with various levels of male and female fertility were randomly placed in each block at both sites.

    [0126] Fruit production data were collected from each plant in the Balm and Ft. Pierce trials. The four data collections in Balm were made on 17 Aug., 14 Sep., 16 Oct., and 18 Nov., 2015, respectively. The four data collections in Ft. Pierce were made on 12 Aug., 10 Sep., 14 Oct., and 11 Nov. 2015, respectively. In each collection, 20 peduncles were randomly sampled from each plant; thus, approximately 120 peduncles were sampled for each cultivar grown in Balm, and 80 peduncles were sampled for each cultivar grown in Ft. Pierce. Fruit on all harvested peduncles were counted, regardless of maturity. An analysis of variance and separation of mean fruit production values was conducted using JMP® Pro 13.2.0 (SAS Institute Inc., Cary, N.C.) to compare the fruit production of the new Lantana cultivar ‘UF-1013-1’ with that of ‘UF-1013A-2A’ and ‘Pink Caprice’. Mean values with the same letter within columns in Table 1 are not significantly different by the Tukey's HSD procedure at P<0.05.

    [0127] As shown in Table 1 and reported previously (Deng et al., 2017), ‘Pink Caprice’ produced the largest number of fruit (drupes) among all the cultivars in the two replicated trials. Each peduncle had an average of 7.941 drupes in Ft. Pierce and 10.313 drupes in Balm, averaged to 9.127 drupes per peduncle across the two sites and four harvests. The number of drupes per peduncle for the sterile cultivar ‘UF-1013A-2A’ ranged from 0 to 0.050 and averaged to 0.015 across the two sites over the 4 months. The number of drupes the new Lantana cultivar TF-1013-1′ produced per peduncle ranged from 0 to 0.038 and averaged to 0.009 across two experimental sites and over 4 months. This level of fruit production in the new cultivar ‘UF-1013-1’ represented greater than 99% reduction from the fruit production of ‘Pink Caprice’.

    [0128] Seed germination: Seeds were extracted from mature drupes collected from the above experiments. Seeds were cleaned, air-dried, and germinated. A subsample of seeds of ‘Pink Caprice’ were sent to Mid-West Seed Services in Brookings, S.Dak., a commercial seed testing laboratory, for seed viability tests. The new Lantana cultivar ‘UF-1013-1’ and ‘UF-1013A-2A’ produced few or no seeds at either site and were therefore not tested for viability. Seeds of ‘Pink Caprice’ showed an average of 65.0% viability, germinated readily, with an average germination percentage of 45.0% in 60 days. For ‘UF-1013A-2A’, no mature drupes were collected from Balm or Ft. Pierce. For the new Lantana cultivar ‘UF-1013-1’, three mature drupes were collected from the Ft. Pierce trial over four months. Three seeds were extracted, but all were abnormal when visually examined. Thus, there were no seeds from the new Lantana cultivar ‘UF-1013-1’ and ‘UF-1013A-2A’ for seed viability or germination tests.

    [0129] Female Fertility Index (FFI): Fruit (seed) production per peduncle and seed germination are the primary factors determining lantana' s female fertility. Female fertility index (FFI) was calculated by multiplying fruit production per peduncle and seed germination. The FFI for ‘Pink Caprice’ was 4.107. Because of the lack of seed germination data, it was not possible to calculate the FFI for the new Lantana cultivar ‘UF-1013-1’. However, based on its triploidy and extremely low fruit production, it was expected that the FFI for the new Lantana cultivar ‘UF-1013-1’ would be close to zero.

    TABLE-US-00001 TABLE 1 Fruit per peduncle 8 to 21 weeks post Total Total Total transplanting (WPT) peduncles fruit mature fruit Average Expt. 8 12 16 21 examined collected collected fruit per Site Cultivars Aug. 12 Sept. 9 Oct. 7 Nov. 11 (no.) (no.) (no.) peduncle Balm New cultivar  0.008 b 0.008 b    0 b    0 b 480 2 0  0.004 b (‘UF-1013-1’)  0.012 b 0.050 b  0.025 b    0 b 481 11 0  0.023 b ‘UF-1013A-2A’ Bloomify ™ Red; USPP 29,292) ‘Pink Caprice’ 14.258 a 8.850 a 10.117 a 8.025 a 480 4,950 1,416 10.313 a 8 12 17 21 Aug. 12 Sept. 10 Oct. 14 Nov. 11 Ft. New cultivar  0.013 b    0 b  0.038 b    0 b 320 4 3  0.013 b Pierce (‘UF-1013-1’) ‘UF-1013A-2A’    0 b    0 b    0 b    0 b 320 0 0    0 b (Bloomify ™ Red; USPP 29,292) ‘Pink Caprice’ 11.588 a 8.325 a  6.263 a 5.588 a 320 2,541 1,832  7.941 a

    Assessment of Pollen Stainability

    [0130] Table 2 shows pollen stainability of the new Lantana cultivar ‘UF-1013-1’ and two checks (‘UF-1013A-2A’ (Bloomify™ Red) and ‘Pink Caprice’) when their plants were grown in Balm and Ft. Pierce, Fla. in full sun in 2015. Two pollen staining experiments were conducted. In Experiment 1, newly opened flowers were collected from plants grown in Balm, Fla. in late July 2015, and anthers were extracted from the flowers and collected into 1.5-mL Eppendorf tubes. The collected anthers were stained with 10.sup.−6 M fluorescein diacetate (FDA) (Sigma-Aldrich, St. Louis, Mo.) in 0.22 M sucrose at room temperature in the dark for 1 hour (Czarnecki et al., 2014). Stained anthers were transferred onto a microscope slide and covered with a coverslip. Pollen grains in the anthers were released by gently tapping and pressing the coverslip and then examined under a fluorescent microscope. Plump, round pollen grains fluorescing bright yellowish green light were considered stainable, while misshaped, non-fluorescing, or unevenly, lightly fluorescing pollen grains were counted as non-stainable. In Experiment 2, flowers were collected from lantana plants grown in Ft. Pierce, Fla. in mid-August 2015. Anther staining and pollen examination were performed as described in Experiment 1. The number of pollen grains examined for each lantana cultivar in each staining experiment was between 1,094 and 2,122. Pollen stainability data (in percentage) were arcsine-transformed before analysis of variance was performed. Means with the same letter within the column of Table 2 are not significantly different by the LSD procedure at P<0.05. The analysis of variance and mean separation were conducted using the software JMP® Pro 13.2.0.

    [0131] As shown in Table 2, the average pollen stainability of the new Lantana cultivar ‘UF-1013-1’ was 2.2%, comparable to the average pollen stainability of sterile cultivar ‘UF-1013A-2A’. The average pollen stainability of ‘Pink Caprice’ was 73.1%. The pollen stainability (or male fertility) of the new Lantana cultivar ‘UF-1013-1’ was reduced substantially (95%) from that of ‘Pink Caprice’.

    TABLE-US-00002 TABLE 2 Pollen grains examined (no.) Pollen stainability (%) Cultivar Experiment 1 Experiment 2 Experiment 1 Experiment 2 Average ‘UF-1013-1’ 1464 1840  2.0 b  2.4 b  2.2 b ‘UF-1013A-2A’ 2122 1466  1.5 b  4.5 b  3.0 b (Bloomify ™ Red; USPP 29,292) ‘Pink Caprice’ 1271 1094 70.8 a 75.3 a 73.1 a
    Assessment of Hybridization Potential With Lantana depressa

    [0132] Table 3 shows the hybridization potential of the new Lantana cultivar ‘UF-1013-1’ with L. depressa as compared to ‘UF-1013A-2A’ and ‘Pink Caprice’.

    [0133] Hand pollination experiments were performed in a greenhouse at GCREC in Balm, Fla. in June and July 2015 to assess the hybridization potential of the new Lantana cultivar ‘UF-1013-1’, as a male or female parent, with L. depressa. ‘UF-1013A-2A’ and ‘Pink Caprice’ were included in the pollination experiments as an infertile and a fertile check, respectively. Stock plants of all lantana cultivars and L. depressa were grown in 1-gallon plastic containers and arranged into three blocks and in each block, they were randomly placed on the benches. The experimental unit consisted of two containerized plants. Air temperature inside the greenhouse was from 21° C. to 33° C. No supplemental lighting was provided. Plants were drip-irrigated twice per day. Fresh anthers were collected from mature unopened flowers of male parents and applied immediately to emasculated flowers of female parents. At maturity, fruit produced by the pollinated flowers were collected and counted, and seeds were extracted and sown to determine seedling emergence.

    [0134] Fruit set data (in percentage) were arcsine-transformed before analysis of variance was performed in JMP® Pro 13.2.0. Mean values with the same letter within the column are not significantly different by the LSD procedure at P<0.05.

    [0135] As shown in Table 3, ‘Pink Caprice’, as a male parent, caused an average of 8.6% fruit set on L. depressa. When pollinated with L. depressa, ‘Pink Caprice’ flowers showed 19.9% fruit set. Seeds from crosses between ‘Pink Caprice’ and L. depressa or vice versa showed 11.1% or 15.8% seedling emergence. As a male parent, ‘UF-1013A-2A’ did not cause any fruit set on L. depressa flowers, nor did it set any fruit after hand-pollination with L. depressa. A total of 389 L. depressa flowers were pollinated with the new cultivar, and none of the pollinated flowers set fruit, resulting in 0% fruit set (Table 3). When the new cultivar was used as the female parent, it did not set any fruit after it was hand-pollinated with L. depressa. Thus, the new cultivar did not hybridize with L. depressa (Table 3). These data confirm the high level of male and female infertility in the new cultivar.

    TABLE-US-00003 TABLE 3 L. depressa as the female parent L. depressa as the male parent Flowers Fruit set Seedling Flowers Fruit set Seedling Cultivar pollinated (no.) (%) emergence (%) pollinated (no.) (%) emergence (%) ‘UF-1013-1’ 389  0 b — 496   0 b — ‘UF-1013A-2A’ 353  0 b — 558   0 b — Deng et al. (2017) (Bloomify ™ Red; USPP 29,292) ‘Pink Caprice’ 388 8.6 a 11.1 452 19.9 a 15.8 Deng et al. (2017)

    Assessment of Nuclear DNA Contents

    [0136] As shown in Table 4, the new cultivar ‘UF-1013-1’ has an average nuclear DNA content of 4.82 pg/2C and is a triploid. The nuclear DNA content was determined using a CyFlow® Cube 6 flow cytometer (Sysmex Partec GmbH, Munster, Germany) and the procedure described by Dolz̆el et al. (Estimation of Nuclear DNA Content in Plants Using Flow Cytometry, Nat. Protoc. 2:2233-2244 (2007)) and modified by Cao et al. (2014). Pea cultivar ‘Ctirad’ (Pisum sativum) with a nuclear content of 9.09 pg/2C was used as the internal reference for this determination in this study. The new cultivar ‘UF-1013-1’ has 6.2% higher nuclear DNA content than ‘UF-1013A-2A’ does (4.82 pg/2C vs. 4.54 pg/2C). The ploidy level of ‘UF-1013-1’ was determined by comparing its nuclear DNA content with the DNA content of known diploid, triploid and tetraploid lantana cultivars.

    TABLE-US-00004 TABLE 4 Mean nuclear DNA Standard Cultivars content (pg/2C) deviation (SD) Ploidy level ‘UF-1013-1’ 4.82 0.11 3× ‘UF-1013A-2A’ 4.54 0.08 3× (Bloomify ™ Red; USPP 29,292) ‘Pink Caprice’ 6.25 0.17 4×

    DNA Fingerprints

    [0137] As shown in Table 5, the new cultivar ‘UF-1013-1’ carries two alleles (152 and 160 base pairs (bp)) at the Lantana11 SSR marker locus, three alleles (135, 143 and 147 bp) at the Lantana12 SSR marker locus, and one allele (93 bp) at the Lantana20 SSR marker locus.

    [0138] This DNA fingerprint analysis was performed using three pairs of lantana-specific SSR primers. Lantana genomic DNA was isolated from lantana leaves in Balm, Fla. Primers were developed as described by Gong and Deng (Development and Characterization of Microsatellite Markers for Caladiums (Caladium Vent.), Plant Breeding 130(5) (2011)) from SSR-enriched lantana genomic sequences (Gong and Deng, unpublished). Nucleotide sequences of the three pairs of primers are: Lantana11F: (M13 tail sequence)-TGCAATTGGAGGCTTTTTCT, and Lantana11R: AAAGCAGCTTCAAGTTTGTGC; Lantana12F: (M13 tail sequence)-GGATGAGATGATAAGGTAGGGTGT, and Lantana12R: TTGGTGGTGATGACTTTGATTC. Lantana20F: (M13 tail sequence)-AGAATCAGGGTTTGGGGTTG, and Lantana20R: TCGTAGCCACCACTCCTCAC. The M13 tail sequence was 5′-CCCAGTCACGACGTTG-3′. Polymerase chain reaction (PCR) amplification, capillary electrophoresis, and allele scoring were performed at the United State Department of Agriculture/Agricultural Research Services Fruit and Tree Nut Research Laboratory, Byron, Ga., using a procedure previously described by Chen et al. (Genome-wide Characterization and Selection of Expressed Sequence Tag Simple Sequence Repeat Primers for Optimized Marker Distribution and Reliability in Peach, Tree Genet. Genome 10:1271-1279 (2014)) with minor modifications.

    [0139] As shown in Table 5, the female parent of the new cultivar, breeding line DROP-25, carries three alleles (150, 152 and 160 bp) at the Lantana11 marker locus, four alleles (135, 143, 145 and 147 bp) at the Lantana12 marker locus, and two alleles (93 and 109 bp) at the Lantana20 marker locus.

    TABLE-US-00005 TABLE 5 Alleles amplified by SSR markers (size of alleles in base pairs) Lantana Marker Lantana11 Marker Lantana12 Lantana20 cultivars 150 152 156 160 135 143 145 147 150 152 93 109 New cultivar + + + + + + (‘UF-1013-1’) ‘UF-1013A-2A’ + + + + + + (Bloomify ™ Red; USPP 29,292) DROP-25 + + + + + + + + + ‘Pink Caprice’ + + + + + + + + + “+” indicates the presence of the respective alleles in the cultivars.