2-ISOPROPYLMALATE SYNTHETASE AND ENGINEERING BACTERIA AND APPLICATION THEREOF

Abstract

The invention relates to a 2-isopropyl malate synthase, a genetically engineered bacterium for producing L-leucine and application thereof and belongs to the field of metabolic engineering. The genetically engineered bacterium is obtained by overexpressing an isopropyl malate synthase coding gene leuA.sup.M for relieving feedback inhibition by L-leucine, an acetohydroxy acid synthase coding gene ilvBN.sup.M for relieving feedback inhibition by L-isoleucine, a 3-isopropyl malate dehydrogenase coding gene leuB and a 3-isopropyl malate dehydratase coding gene leuCD in host cells. The genetically engineered bacterium for producing the L-leucine is free from nutritional deficiency, rapid in growth, short in fermentation period, high in yield and high in conversion rate.

Claims

1. A 2-isopropyl malate synthase, having an amino acid sequence shown as SEQ ID NO. 1.

2. A genetically engineered bacterium for producing L-leucine, the genetically engineered bacterium is obtained by overexpressing a coding gene leuA.sup.M of the 2-isopropyl malate synthase in claim 1, an acetohydroxy acid synthase coding gene ilvBN.sup.M for relieving feedback inhibition by L-isoleucine, a 3-isopropyl malate dehydrogenase coding gene leuB and a 3-isopropyl malate dehydratase coding gene leuCD in host cell, wherein the nucleotide sequence of the gene leuA.sup.M is shown as SEQ ID NO. 2.

3. The genetically engineered bacterium for producing the L-leucine according to claim 2, characterized in that, the host cell is selected from the group of Escherichia coli, Corynebacterium glutamicum, Bacillus subtilis, Bacillus megaterium, Bacillus amyloliquefaciens, Vibrio natriegens and Saccharomyces cerevisiae.

4. The genetically engineered bacterium for producing the L-leucine according to claim 2, characterized in that, an acetohydroxy acid synthase encoded by the gene ilvBN.sup.M relieves the feedback inhibition by the L-isoleucine and has a nucleotide sequence shown as SEQ ID NO. 5.

5. The genetically engineered bacterium for producing the L-leucine according to claim 2, characterized in that, the gene leuB is selected from those with Genbank accession numbers of b0073, JW5807, NCg11237, BSU28270 and BAMF_2634; the gene leuCD is selected from those with Genbank accession numbers of b0071, b0072, JW0070, JW0071, NCg11262, NCg11263, BSU28250, BSU28260, BAMF_2632 and BAMF_2633.

6. The genetically engineered bacterium for producing the L-leucine according to claim 2, characterized in that, the genetically engineered bacterium is obtained by taking Escherichia coli W3110 as the host cell to overexpress the gene leuA as shown in SEQ ID NO. 2, the gene ilvBN.sup.M as shown in SEQ ID NO. 5 and the gene leuBCD as shown in SEQ ID NO.6.

7. The genetically engineered bacterium for producing the L-leucine according to claim 2, characterized in that , constructed by the following syeps: (1) separately amplifying the genes leuA.sup.M, leuB, leuCD and ilvBN.sup.M, and constructing genome integration fragments; (2) sequentially expressing the genome integration fragments constructed in step (1) and a recombinant plasmid in the host cell by the CRISPR/Cas9 gene editing technology.

8. The genetically engineered bacterium for producing the L-leucine according to claim 2, used in the production of L-leucine.

9. The genetically engineered bacterium for producing the L-leucine according to claim 8, characterized in that, a method for synthesizing the L-leucine with the genetically engineered bacterium through fermentation includes: inoculating a seed culture at an inoculum size of 5-10% onto a fermentation culture medium for fermentation culture, wherein the content of dissolved oxygen is maintained at 20-40%, the pH is maintained at 6.5-7.5, the culture temperature is 30-35 ° C., the fermentation period is 40-48 h, and the residual sugar concentration is maintained at 0-0.4% W/V during the fermentation; the fermentation culture medium is composed of 25 g/L glucose, 12 g/L peptone, 4 g/L yeast powder, 3.5 g/L KH.sub.2PO.sub.4, 1.5 g/L MgSO.sub.4, 15 mg/L FeSO.sub.4, 15 mg/L MnSO.sub.4 and 0.01 mg/L VB1; the pH of the fermentation culture medium is 7.0, the pressure is 0.075 MPa, and the fermentation culture medium is subjected to high-pressure steam sterilization for 15 min.

10. The genetically engineered bacterium for producing the L-leucine according to claim 3, characterized in that, the host cell is Escherichia coli.

11. The genetically engineered bacterium for producing the L-leucine according to claim 3, characterized in that, the gene leuB is the gene with Genbank accession number of b0073.

12. The genetically engineered bacterium for producing the L-leucine according to claim 3, characterized in that, the gene leuCD is the gene with Genbank accession number of b0072.

13. The genetically engineered bacterium for producing the L-leucine according to claim 3, characterized in that, the gene leuBCD has a nucleotide sequence as shown in SEQ ID NO.6.

14. A leuA.sup.M gene encoding the 2-isopropyl malate synthase of claim 1 comprising a nucleotide sequence as shown in SEQ ID NO. 2.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0041] FIG. 1: Influence of L-leucine on the activity of the 2-isopropyl malate synthase encoded by the genes leuA and leuA.sup.M.

[0042] FIG. 2: Comparison of the activity of the 2-isopropyl malate synthases encoded by leuA.sup.M and leuA.

[0043] FIG. 3: Influence of L-isoleucine on the activity of the acetohydroxy acid synthases encoded by the genes ilvBN and ilvBN.sup.M.

[0044] FIG. 4: Comparison of the activity of the acetohydroxy acid synthases(AHAS) encoded by ilvBN.sup.M and ilvBN.

[0045] FIG. 5: The process curve of fermentation of the L-leucine genetically engineered bacterium strain TE03.

[0046] FIG. 6: Influence of overexpression of leuA.sup.M on L-leucine synthesis.

DETAILED DESCRIPTION OF THE INVENTION

[0047] In order to make the objects, technical solutions and advantages of the present invention clearer and more apparent, the present invention is further described in detail with reference to the following embodiments. It should be understood that the embodiments described herein are only intended to illustrate of the present invention but not to limit the present invention.

[0048] The present embodiment provides a genetically engineered bacterium for producing L-leucine, which is constructed by overexpressing an isopropyl malate synthase coding gene leuA.sup.M for relieving the feedback inhibition by L-leucine, an acetohydroxy acid synthase coding gene ilvBN.sup.M for relieving the feedback inhibition by L-isoleucine, a 3-isopropyl malate dehydrogenase coding gene leuB and a 3-isopropyl malate dehydratase coding gene leuCD in host cells.

[0049] In some embodiments, the host cells can be Escherichia coli, Corynebacterium glutamicum, Bacillus subtilis, Bacillus megaterium, Bacillus amyloliquefaciens, Vibrio natriegens, Saccharomyces cerevisiae and the like.

[0050] In some embodiments, the gene ilvB1Vm is derived from Corynebacterium glutamicum which is resistant to such L-isoleucine-structured analogues as α-aminobutyric acid and thioisoleucine.

[0051] In some embodiments, the gene leuB is selected from those with Genbank accession numbers of b0073, JW5807, NCg11237, BSU28270 or BAMF_2634.

[0052] In some embodiments, the gene leuCD is selected from those with Genbank accession numbers of b0071, b0072, JW0070, JW0071, NCg11262, NCg11263, BSU28250, BSU28260, BAMF_2632 or BAMF_2633.

[0053] The host cells, the gene ilvBN.sup.M, the gene leuB and the gene leuCD from the above sources can all achieve the effects of the present invention. In the following embodiments, Escherichia coli W3110 is taken as the host cells to overexpress the gene leuA.sup.M shown in SEQ ID NO. 2, the gene ilvBN.sup.M shown in SEQ ID NO. 5 and leuBCD (an operon composed of the leuB and the leuCD in the Escherichia coli) shown in SEQ ID NO. 6 to construct the genetically engineered bacterium strain TE03 for producing L-leucine to illustrate the present invention in an exemplary manner.

[0054] Sequence table of primers applied in the following embodiments:

TABLE-US-00002 SEQ ID Names Sequences NO. LEUA-1 GTGAAACCAGTAACGTTATACG 11 LEUA-2 CCACACATTATACGAGCCGGATGATTAATTGTCAA 12 CCGTCTTCATGGGAGAA LEUA-3 CCGGCTCGTATAATGTGTGGAATTGTGAGCGGATA 13 ACAATTTCACACAAGGAGATATACATGTCTCCTAA CGATGCATT LEUA-4 CAAACAACAGATAAAACGAAAGGCCCAGTCTTTCG 14 ACTGAGCCTTTCGTTTTATTTGCTTAAACGCCGCC AGC LEUA-5 TTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTC 15 CTGAGTAGGACAAATGCTGTTAGCGGGC LEUA-6 TCACTGCCCGCTTTCCAG 16 leuA-1′ ATGTCTCCTAACGATGCATT 17 leuA-2′ TTAAACGCCGCCAGC 18 IlvB-1 ATGACCATGATTACGGATTCAC 19 IlvB-2 CCACACATTATACGAGCCGGATGATTAATTGTCAA 20 CGGGTTTTCGACGTTCAGACGTA IlvB-3 CCGGCTCGTATAATGTGTGGAATTGTGAGCGGATA 21 ACAATTTCACACAAGGAGATATACCATGAATGTGG CAGCTTCTC IlvB-4 CAAACAACAGATAAAACGAAAGGCCCAGTCTTTCG 22 ACTGAGCCTTTCGTTTTATTTGTTAGATCTTGGCC GGAGCCATGGTC IlvB-5 GACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGT 23 GAACGCTCTCCTGAGTAGGACAAATTTGATGGTAG TGGTCAAATGG IlvB-6 TTATTTTTGACACCAGACCAA 24 LA-1 ATCATCACAGCAGCGGCCTGGTGCCGCGCATGTCT 25 CCTAACGATGCATT LA-2 TGATGATGTTAGCTAGCGCTGAATTCTGCTTAAAC 26 GCCGCCAGC leuBCD-1 GACCATGGAATTCGAGCTCGGTACCCGGATGTCGA 27 AGAATTACCATATTGCC leuBCD-2 CTTGCATGCCTGCAGGTCGACTCTAGAATAATTCA 28 TAAACGCAGGTTGTTTTG PG-1 AGTCCTAGGTATAATACTAGTTTCTCCCATGAAGA 29 CGGGTTTTAGAGCTAGAA PG-2 TTCTAGCTCTAAAACCCGTCTTCATGGGAGAAACT 30 AGTATTATACCTAGGACT PG-3 AGTCCTAGGTATAATACTAGTAAACTGTGGAGCGC 31 CGAAATCCGTTTTAGAGCTAGAA PG-4 TTCTAGCTCTAAAACGGATTTCGGCGCTCCACAGT 32 TTACTAGTATTATACCTAGGACT IV-1 ATCATCACAGCAGCGGCCTGGTGCCGCGCATGACC 33 ATGATTACGGATTCAC IV-2 TGATGATGTTAGCTAGCGCTGAATTCTGCTTAGAT 34 CTTGGCCGGAGCCATGG ilvBN-1 ATGACCATGATTACGGATTCAC 35 ilvBN-2 TTAGATCTTGGCCGGAGCCATGG 36

[0055] Embodiment 1: Acquisition of the isopropyl malate synthase coding gene leuA.sup.M for relieving the feedback inhibition by L-leucine [0056] (4) Screening of mutant strains resistant to structural analogues of L-leucine [0057] 1.1 Preparation of a suspension of a Corynebacterium glutamicum ATCC13032 The Corynebacterium glutamicum ATCC13032 is inoculated into an LB (Luria broth) liquid medium for culture at 32 DEG C and 200 rpm for 12 h, centrifugation is performed for collecting bacterial cells, which are then washed with sterile normal saline for 3 times and then resuspended until OD.sub.600 is 0.6-0.8, and 10 uL of the suspension is applied onto a slide glass. [0058] 1.2 Plasma mutagenesis at room pressure and temperature Applied mutagenesis parameters include that the slide is arranged 2 mm away from an air flow port, the power is 120 W, the air flow velocity is 10 SLM (standard liter per minute), and the action period is 20 s. [0059] 1.3 Screening of the mutant strains resistant to the L-leucine-structured analogue-α-aminobutyric acid [0060] The suspension subjected to mutagenesis in the step 1.2 is spread onto a minimal medium containing 50 mg/L leucine hydroxamate for culture at 35 DEG C for 48 h, and then the strains with a large bacterial colony are selected. [0061] 1.4 Determination of L-leucine producing capacity of the strains The strains screened in the step 1.3 are subjected to 96-well plate culture through a seed culture medium and then inoculated at an inoculum size of 5% into a 96-well plate containing a fermentation culture medium for a fermentation experiment, according to which the strain LEU262 is the highest in the yield of L-leucine. [0062] 1.5 Screening of the mutant strains resistant to the L-leucine-structured analogue-thioisoleucine and determination of L-leucine producing capacity of the strains The LEU262 is taken as a mutagenesis object. The steps 1.1 and 1.2 are repeated. The mutagenized suspension is applied onto a minimal medium containing 50 mg/L (3-hydroxy leucine for culture at 35 DEG C for 48 hours, then the strains with a large bacterial colony are selected, and the step 4) is repeated to determine that the strain LEU741 is the highest in the yield of L-leucine. [0063] 1.6 Culture mediums [0064] The seed culture medium is composed of 20 g/L glucose, 5 g/L yeast powder, 4 g/L (NH.sub.4).sub.2SO.sub.4, 2.5 g/L KH.sub.2PO.sub.4, 0.5 g/L MnSO.sub.4 and 30 mL/L corn steep liquor, the pH is 6.5-7.0, and the seed culture medium is subjected to high-pressure steam sterilization at 115 DEG C for 15 min. [0065] The fermentation culture medium is composed of 70 g/L glucose, 4 g/L (NH.sub.4).sub.2SO.sub.4, 1 g/L KH.sub.2PO.sub.4, 0.6 g/L MgSO.sub.4.7H.sub.2O, 0.02 g/L MnSO.sub.4, 0.002 g/L VB1 and 30 mL/L corn steep liquor, the pH is 6.5-7.0, and the fermentation culture medium is subjected to high-pressure steam sterilization at 115 DEG C for 15 min. [0066] 1.7 Determination method [0067] 8000 g of the fermentation liquor is centrifuged for 5 min, then the supernatant is extracted and subjected to derivatization reaction with 0.8% (V/V) 2, 4-dinitrofluorobenzene, and the content of L-leucine is detected by high performance liquid chromatography under the conditions that Agilent C18 (15 mm*4.6 mm, 5 mum) is subjected to acetonitrile/sodium acetate binary gradient elution, the column temperature is 33 DEG C and the detection wavelength is 360 nm. According to the detection result of the high performance liquid chromatography and comparison with the peak appearance time and the peak area of a standard product, the yield of L-leucine can be determined. [0068] (5) Acquisition of the mutant of the isopropyl malate synthase coding gene leuA.sup.M for relieving the feedback inhibition of L-leucine [0069] The genome of the strain LEU741 is extracted, primers leuA-1′ and leuA-2′ are applied to perform PCR amplification under the conditions: 94 DEG C, 5 min, 1 cycle; 94 DEG C, 30 s, 50 DEG C, 30 s, 72 DEG C, 2 min, 30 cycles; 72 DEG C,10 min,1 cycle. The volume of the reaction system is 100 uL. 10 uL of the PCR products is detected through 1.5% agarose gel electrophoresis. A target fragment amplified by PCR is recovered and connected to a pMD™18-T Vector and is then transformed into Escherichia coli (E. coli DH5a) competent cells, the cells are applied onto an LB solid culture medium containing ampicillin (100 ug/mL) for inverted culture at 37 DEG C for 24 h. 3 single colonies are picked, and recombinant plasmids are extracted and sequenced. [0070] Sequencing results show that, compared with the wild type leuA, the 2-isopropyl malate synthase encoded by the mutated gene has mutations of F7L, I14F, I51S, G127D, I197V, F370L, K380M, R529H, G561D and V596A, the mutant is named as LEUA.sup.M, and the coding gene is named as leuA.sup.M [0071] (6) Comparison of the enzymatic characteristics of the isopropyl malate synthase mutant LEUA.sup.M and the wild type isopropyl malate synthase LEUA [0072] The genomes of the Corynebacterium glutamicum ATCC13032 and the strain LEU741 are taken as templates respectively, primers LA-1 and LA-2 are applied to perform PCR amplification. The products are recovered and connected to pET-His plasmids digested by BamH I and are then transformed into Escherichia coli BL21 (DE3) to obtain strains E. coli-leuA and E. coli-leuA.sup.M, which are induced by IPTG (isopropyl-beta-thiogalactoside) to express recombinant proteins LEUA and LEUA.sup.M, bacteria are collected, resuspended in 50 mmol/L Tris-HCl buffer solution (pH=7.5), subjected to ultrasonic disruption and centrifuged, and then the supernatant is collected. [0073] The enzymatic activities of the LEUA.sup.M and the LEUA are determined by the following method: [0074] adding 10 uL of the above-described supernatant into 990 uL of Tris-HCl buffer solution (50 mmol/L, pH=7.5 and composed of 400 mmol/L potassium glutamate, 20 uL of 5, 5′-dithiobis (2-nitrobenzoic acid), 3 mmol/L acetyl-CoA and 4 mmol/L ketoisovaleric acid) for reaction at 30 DEG C for 1 h, and then adding 100 uL of sulfuric acid (3 mol/L) for treatment at 65 DEG C for 15 min to terminate the reaction, wherein, during the reaction, the 2-isopropyl malate synthase can catalyze the acetyl-CoA to produce coenzyme A, which has the maximum absorbance at OD.sub.412. Therefore, according to the principle, the change value per minute of OD412 can be measured through spectrophotometry to calculate the production of the coenzyme A and accordingly calculate the enzymatic activity. As results shown in FIG. 2, the activities of the LEUA.sup.M and the LEUA are 12.1 and 13.5 nmol/(min*mg*total protein), respectively, presenting no significant difference between them. [0075] The influence of the L-leucine on the enzymatic activity of LEUA.sup.M and LEUA is determined by the following method: [0076] 0, 2, 4, 6, 8, 10, 12 and 15 mmol/L of L-leucine are respectively added into the above reaction solution, and then the amount of the produced coenzyme A is measured to study the performance of the LEUA.sup.M on relieving the feedback inhibition by the L-leucine. The enzymatic activity when the addition concentration of the L-leucine is 0 is defined as 100%. Compared with which the enzymatic activity of the LEUA.sup.M or the LEUA under other L-leucine concentration conditions is the relative enzymatic activity. As shown in FIG. 1, the relative activity of the LEUA decreases rapidly with increasing L-leucine concentration, and almost decreases to 0 when the L-leucine concentration is higher than 6 mmol/L. This indicates that the LEUA is subjected to the feedback inhibition by the L-leucine. While the relative enzymatic activity of the mutant LEUA.sup.M has no significant change with increasing L-leucine concentration, indicating that the LEUA.sup.M can relieve the feedback inhibition by the L-leucine. [0077] It can be seen from the above results, the 2-isopropyl malate synthase mutant LEUA.sup.M relieves the feedback inhibition by the L-leucine and has no significant decrease in the activity compared with the wild type LEUA.

[0078] Embodiment 2: Acquisition of the acetohydroxy acid synthase coding gene ilvBN.sup.Mfor relieving the feedback inhibition by L-isoleucine [0079] (4) Screening of mutant strains resistant to L-isoleucine-structured analogues [0080] 1.1 Preparation of a suspension of a Corynebacterium glutamicum ATCC13032 [0081] The Corynebacterium glutamicum ATCC13032 is inoculated into an LB (Luria-Bertani) liquid medium for culture at 32 DEG C and 200 rpm for 12 h, centrifugation is performed for collecting bacterial cells, which are then washed with sterile normal saline for 3 times and then resuspended until OD600 is 0.6-0.8, and 10 uL of the suspension is applied onto a slide. [0082] 1.2 Plasma mutagenesis at room pressure and temperature Applied mutagenesis parameters include that the slide is arranged 2 mm away from an air flow port, the power is 120 W, the air flow velocity is 10 SLM, and the action period is 25 s. [0083] 1.3 Screening of the mutant strains resistant to the L-isoleucine-structured analogue of α-aminobutyric acid [0084] The suspension subjected to mutagenesis in the step 1.2 is applied onto a minimal medium containing 50 mg/L a-aminobutyric acid for culture at 35 DEG C for 48 h, and then the strains with a large bacterial colony are selected. [0085] 1.5 Determination of L-isoleucine producing capacity of the strains [0086] The strains screened in the step 1.3 are subjected to 96-well plate culture through a seed culture medium and then inoculated at an inoculum size of 10% into a 96-well plate containing a fermentation culture medium for a fermentation experiment, according to which the strain ILE396 is the highest in the yield of L-isoleucine. [0087] 1.5 Screening of the mutant strains resistant to the L-isoleucine-structured analogue of thioisoleucine and determination of L-leucine producing capacity of the strains The ILE396 is taken as a mutagenesis object, the steps 1.1 and 1.2 are repeated, the mutagenized suspension is applied onto a minimal medium containing 50 mg/L thioisoleucine for culture at 35 DEG C for 48 hours, then the strains with a large bacterial colony are selected, and the step 4) is repeated to determine that the strain ILE693 is the highest in the yield of L-isoleucine. [0088] 1.6 Culture mediums [0089] The seed culture medium is composed of 25 g/L glucose, 5 g/L yeast powder, 5 g/L (NH.sub.4).sub.2SO.sub.4, 2 g/L KH.sub.2PO.sub.4, 0.6 g/L MnSO.sub.4 and 40 mL/L corn steep liquor, the pH is 6.8-7.2, and the seed culture medium is subjected to high-pressure steam sterilization at 115 DEG C for 15 min. [0090] The fermentation culture medium is composed of 80 g/L glucose, 3 g/L (NH4)2504, 1.5 g/L KH.sub.2PO.sub.4, 0.6 g/L MgSO.sub.4.7H.sub.2O, 0.015 g/L MnSO.sub.4, 0.001 g/L VB1 and 30 mL/L corn steep liquor, the pH is 6.8-7.2, and the fermentation culture medium is subjected to high-pressure steam sterilization at 115 DEG C for 15 min. [0091] 1.7 Determination method [0092] 8000 g of the fermentation liquor is centrifuged for 5 min, then the supernatant is extracted and subjected to derivatization reaction with 0.8% (V/V) 2, 4-dinitrofluorobenzene, and the content of L-isoleucine is detected by high performance liquid chromatography under the conditions that Agilent C18 (15 mm*4.6 mm, 5 mum) is subjected to acetonitrile/sodium acetate binary gradient elution, the column temperature is 33 DEG C and the detection wavelength is 360 nm. According to the detection result of the high performance liquid chromatography and comparison with the peak appearance time and the peak area of a standard product, the yield of L-isoleucine can be determined. [0093] (5) Acquisition of the mutant of the acetohydroxy acid synthase coding gene ilvBN.sup.M for relieving the feedback inhibition by L-isoleucine [0094] The genome of the strain ILE693 is extracted, primers ilvBN-1 and ilvBN-2 are applied to PCR amplification under the conditions that treatment at 94 DEG C is performed for 5 min and 1 cycle, treatment at 94 DEG C is performed for 30 s, treatment at 56 DEG C is performed for 30 s, treatment at 72 DEG C is performed for 1 min and 30 cycles and treatment at 72 DEG C is performed for 10 min and 1 cycle, and the volume of the reaction system is 100 uL. 10 uL of the PCR products is detected through 1.5% agarose gel electrophoresis, a target fragment amplified by PCR is recovered and connected to a pMD™18-T Vector and is then transformed into E. coli DH5 a competent cells, the cells are applied onto an LB solid culture medium containing ampicillin (100 ug/mL) for inverted culture at 37 DEG C for 24 h, 3 single colonies are picked, and recombinant plasmids are extracted and sequenced. [0095] Sequencing results show that, compared with the wild type ilvBN, the acetohydroxy acid synthase encoded by the mutated gene has mutations of K30Q, A84T, G128S, A226S, K227R, Y252H, T362S and H674L, the mutant is named as ILVBN.sup.M, and the coding gene is named as ilvBN.sup.M (as shown in SEQ ID NO. 5). [0096] (6) Comparison of the enzymatic characteristics of the acetohydroxy acid synthase mutant ILVBN.sup.M and the wild type acetohydroxy acid synthase ILVBN [0097] The genomes of the Corynebacterium glutamicum ATCC13032 and the strain ILE693 are taken as templates respectively, primers IV-1 and IV-2 are applied to PCR amplification, the products are recovered and connected to pET-His plasmids digested by BamH I and are then transformed into Escherichia coli BL21 (DE3) to obtain strains E. coli-ilvBN and E. coli-ilvBN.sup.M, which are induced by IPTG to express recombinant proteins ILVBN and ILVBN.sup.M, bacteria are collected, resuspended in 100 mmol/L potassium phosphate buffer solution (pH=7.8), subjected to ultrasonic disruption and centrifuged, and then the supernatant is collected. [0098] The enzymatic activities of the ILVBN.sup.M and the ILVBN are determined by the following method: adding 100 uL of the above-described supernatant into 1 mL of potassium phosphate buffer solution (100 mmol/L, pH=7.8 and composed of 100 mmol/L sodium pyruvate, 100 mmol/L L2-ketobutyric acid, 10 mmol/L MgCl.sub.2 and 0.2 mmol/L thiamine pyrophosphate) for reaction at 37 DEG C for 1 h, adding in 100 uL of sulfuric acid (3 mol/L) for treatment at 65 DEG C for 15 min to terminate the reaction, mixing the reaction solution with 1 mL of 0.5% creatine and 1 mL of a-naphthol solution (containing 2.5 mol/L NaOH) for treatment at 65 DEG C for 20 min, cooling down to room temperature, and measuring the amount of 2-keto-2-hydroxybutyric acid produced (OD.sub.525) through spectrophotometry. and accordingly calculate the enzymatic activity. As results shown in FIG. 4, the activities of the ILVBN.sup.M and the ILVBN are 16.7 and 16.9 nmol/(min*mg*total protein), respectively, presenting no significant difference. [0099] The influence of the L-isoleucine on the enzymatic activity of the ILVBN.sup.M and the ILVBN is determined by the following method: adding 0, 2, 4, 6, 8, 10 and 12 mmol/L L-isoleucine respectively into the above reaction solution, and then measuring the amount of the produced 2-keto-2-hydroxybutyric acid to study the performance of the ILVBN.sup.M on relieving the feedback inhibition by the L-isoleucine. [0100] The enzymatic activity when the concentration of the added L-isoleucine is 0 is defined as 100%, compared with which the enzymatic activity of the ILVBN.sup.M or the ILVBN under other L-leucine concentration conditions is the relative enzymatic activity. As shown in FIG. 3, the relative activity of the ILVBN decreases rapidly with increasing L-isoleucine concentration, and when the L-isoleucine concentration is higher than 8 mmol/L, the ILVBN almost presents no activity, indicating that the ILVBN is subject to the feedback inhibition by the L-isoleucine, while the relative enzymatic activity of the mutant ILVBN.sup.M has no significant change with increasing L-leucine concentration, indicating that the ILVBN.sup.M can relieve the feedback inhibition by the L-isoleucine. [0101] It can be seen from the above results, the acetohydroxy acid synthase mutant ILVBN.sup.M relieves the feedback inhibition by the L-leucine and has no significant decrease in the activity compared with the wild type ILVBN.

[0102] Embodiment 3: Construction of the L-leucine producing bacterium TE03 [0103] (5) Construction of a recombinant fragment UHF-leuA.sup.M-DHF [0104] An artificially synthesized plasmid containing the gene leuA.sup.M is taken as a template and LEUA-3 and LEUA-4 as primers to perform PCR amplification to obtain the leuA.sup.M; The genome of the Escherichia coli W3110 is taken as a template and LEUA-1 and LEUA-2 as well as LEUA-5 and LEUA-6 as primers to perform amplification to obtain fragments UHF and DHF, which are the upstream homologous arm and the downstream homologous arm of a gene lad, respectively; UHF, DHF and the leuA.sup.M are taken as templates and LEUA-1 and LEUA-6 as primers to perform PCR amplification, and then recovering is performed to obtain the recombinant fragment UHF-leuA.sup.M-DHF. [0105] (6) Construction of a recombinant fragment UHFA-ilvBN.sup.M DHFB [0106] A artificially synthesized plasmid containing the gene ilvBN.sup.M is taken as a template and IlvB-3 and IlvB-4 as primers to perform PCR amplification to obtain the ilvBN.sup.M; the genome of the Escherichia coli W3110 is taken as a template and IlvB-1 and IlvB-2 as well as IlvB-5 and IlvB-6 as primers to perform amplification to obtain fragments UHFA and DHFB, which are the upstream homologous arm and the downstream homologous arm of a gene lacZ, respectively; UHFA, DHFB and the ilvBN.sup.M are taken as templates and IlvBN-1 and IlvBN-6 as primers to perform PCR amplification, and then recovering is performed to obtain the recombinant fragment UHFA-ilvBN.sup.M-DHFB. [0107] (7) Construction of a recombinant plasmid pTR-leuBCD [0108] The genome of the Escherichia coli W3110 is taken as a template and leuBCD-1 and leuBCD-2 as primers to perform PCR amplification to obtain leuBCD (an operon composed of leuB and leuCD in the Escherichia coli), and a plasmid pTrc99a is subjected to digestion by BamH I, electrophoresis and gel extraction and is then connected to the leuBCD to obtain the recombinant plasmid pTR-leuBCD. [0109] (8) Construction of the L-leucine genetically engineered bacterium TE03 [0110] PG-1 and PG-2, PG-3 and PG-4 are respectively annealed at 52 DEG C and then connected to plasmids pGRB to obtain pGRB1 and pGRB2, wherein PG-1 and PG-2 as well as PG-3 and PG-4 are single-stranded DNAs of guide sequences for Cas9 to identify the lacI and lacZ gene sequences of the genome of the W3110, and the single-stranded DNAs are annealed to double-stranded DNAs which can be connected with the pGRB. The pREDCas9 plasmids are transformed into the Escherichia coli W3110, and positive clones are selected to obtain a W3110-pREDCas9 strain. The pGRB1 and the UHF-leuA.sup.M-DHF are respectively transformed into the W3110-pREDCas9, positive clones are selected and subjected to elimination of pGRB-gRNA and the pREDCas9 plasmids to obtain a TE01 strain. In the same way, the pGRB2 and the UHFA-ilvBN.sup.M-DHFB are transformed into the TE01 containing the pREDCas9 to obtain a TE02 strain. The pTR-leuBCD is transformed into the TE02 to obtain the TE03.

[0111] Embodiment 4: Fermentation experiment of the L-leucine producing bacterium TE03 in a fermentation tank [0112] (4) Seed culture [0113] 3-5 tubes of fresh slant activated TE03 are inoculated by an inoculating loop into a 5 L fermentation tank filled with 1 L of a seed culture medium, the pH of the fermentation liquid is regulated to 6.5-7.5 by batch-feeding 25% (W/V) ammonia liquor, the content of dissolved oxygen is maintained to be 20-50%, the ventilating rate is 3-5 m3/h, the stirring velocity is 400-500 rpm, and culture is performed at 32 DEG C for 6-8 h. [0114] (5) Fermentation in the fermentation tank [0115] The seed culture obtained in the step (1) is inoculated at an inoculum size of 5% to a 5 L fermentation tank filled with 3 L of a fermentation culture medium for tank fermentation, the fermentation temperature is 35 DEG C, the ventilating rate is 3-5 m3/h, the stirring velocity is 600 rpm, the content of dissolved oxygen is maintained to be 20-40%, an 80% (W/V) glucose solution is batch-fed to maintain the residual sugar concentration to be 0.1-0.5% (W/V), the pH of the fermentation liquid is regulated to 6.5-7.5 by batch-feeding 25% (W/V) ammonia water and the fermentation is performed for 48h (the process curve of fermentation is shown as FIG. 5). [0116] (6) Detection of L-leucine in the fermentation liquid

[0117] The detection method is the same as that in the step 1.7 of (1) of the embodiment 1, and according to the detection, after the fermentation is performed for 44 h, the yield of L-leucine reaches the highest 69.6g/L at 69.6 g/L with a conversion rate of 19.1%.

[0118] The seed culture medium is composed of:

[0119] 14 g/L glucose, 5 g/L peptone, 3 g/L yeast powder, 2 g/L KH.sub.2PO.sub.4, 1 g/L MgSO.sub.4, 10 mg/L FeSO.sub.4 and 10 mg/L MnSO.sub.4, the pH is 7.0, and the seed culture medium is subjected to high-pressure steam sterilization at 0.075 MPa for 15 min.

[0120] The fermentation culture medium is composed of:

[0121] 25 g/L glucose, 12 g/L peptone, 4 g/L yeast powder, 3.5 g/L KH.sub.2PO.sub.4, 1.5 g/L MgSO.sub.4, 15 mg/L FeSO.sub.4, 15 mg/L MnSO.sub.4 and 0.01 mg/L VB1, the pH is 7.0, and the fermentation culture medium is subjected to high-pressure steam sterilization at 0.075 MPa for 15 min.

[0122] Embodiment 5: Influence of overexpression of leuA.sup.M on L-leucine synthesis

[0123] A method identical to that in the embodiment 1 is applied to respectively constructing strains: 1) an ilvBN.sup.M and leuBCD overexpressing strain TE04, 2) an ilvBN, leuA and leuBCD overexpressing strain TE05, 3) an ilvBN.sup.m, leuA and leuBCD overexpressing strain TE06 and 4) an ilvBN, leuA.sup.M and leuBCD overexpressing strain TE07. A method identical to that in the embodiment 4 is applied to performing fermentation experiments. Detection results show that, after 44 h of fermentation, the strain TE03 has the highest yield of L-leucine (69.2 g/L), followed by strain TE07 (35.37 g/L) and strain TE06 (18.16 g/L), and strain TE04 and strain TE05 are the lowest(0.12 and 2.15 g/L, respectively) (as shown in FIG. 6).

[0124] Above-described are merely several embodiments of the present invention, which are described specifically in detail but cannot be construed as limitation to the scope of the patent. It should be noted that, for those skilled in the art, modifications, combinations and improvements can be made on the described embodiments without departing from the concept of the patent and all fall into the scope of protection of the patent. Therefore, the scope of protection of the patent should be subject to the claims.