3D STIMULATED TISSUE CONSTRUCTS AND METHODS OF MAKING THEREOF
20210189327 · 2021-06-24
Inventors
Cpc classification
C12N5/0062
CHEMISTRY; METALLURGY
C12N2533/90
CHEMISTRY; METALLURGY
International classification
Abstract
This application discloses a method for preparing a construct comprising preparing a mixture of an extracellular matrix and a plurality of cells suspended in a first cell culture medium, applying a crosslinking or gelation agent to the mixture, depositing the mixture into a mold of a defined shape, allowing the extracellular matrix in the mixture to crosslink or gel for a duration of about 1 hour to about 4 hours, applying a second cell culture medium to the mixture containing crosslinked or gelled extracellular matrix, and allowing cell directed self-assembly of the mixture for a duration of about 2 hours to about 10 hours to form a construct, wherein the construct is a three-dimensional structure formed within the mold of the defined shape. Optionally, the method further comprises applying at least one stimuli to the mixture or the construct. Also provided are constructs prepared according to the methods disclosed herein.
Claims
1. A method for preparing a construct comprising: a) preparing a mixture of an extracellular matrix and a plurality of cells suspended in a first cell culture medium, b) applying a crosslinking or gelation agent to the mixture, c) depositing the mixture from b) into a mold of a defined shape, d) allowing the extracellular matrix in the mixture in c) to crosslink or gel for a duration of about 1 hour to about 4 hours, e) applying an additional cell culture medium to the mixture containing crosslinked or gelled extracellular matrix from d), and f) allowing cell directed self-assembly of the mixture from e) for a duration of about 2 hours to about 10 hours to form a construct, wherein the construct is a three-dimensional structure formed within the mold of the defined shape.
2. The method of claim 1, further comprising removing the construct from the mold.
3. The method of claim 1, wherein the construct retains the defined shape after removal from the mold.
4. The method of claim 1, wherein the extracellular matrix comprises a hydrogel, collagen, fibrin, laminin, elastin, alginate, gelatin, fibrinogen, chitosan, hyaluronan acid, polyethylene glycol, lactic acid, N-isopropyl acrylamide, glycoproteins, proteoglycans, basement membrane proteins, Matrigel™, Geltrex™, or combinations thereof.
5. The method of claim 1, wherein the ratio of the volume of the extracellular matrix to the volume of the first cell culture medium is between 1:1 and 1:10, optionally 1:1 to 1:6.
6. The method of claim 1, wherein the gelation agent is an alkaline substance.
7. The method of claim 1, wherein 10.sup.5 to 10.sup.10 cells/mL are suspended in the first cell culture medium.
8. The method of claim 1, wherein the extracellular matrix has a concentration of about 4 mg/mL to about 20 mg/mL.
9. The method of claim 1, wherein the plurality of cells comprise mammalian cells.
10. The method of claim 1, wherein the construct comprises about 10.sup.6 cells/mL to about 10.sup.10 cells/mL.
11. The method of claim 1, further comprising preparing at least one additional mixture of a second extracellular matrix and a second plurality of cells suspended in a second cell culture medium, wherein the second plurality of cells comprise at least one different cell type from the plurality of cells, applying a crosslinking or gelation agent to the additional mixture and depositing the additional mixture into the mold such that different cell types are spatially separated within the construct.
12. The method of claim 1, wherein the cell culture medium comprises a basal medium and optionally at least one supplement selected from the group consisting of plasma, serum, lymph, amniotic fluid, pleural fluid, growth factors, hormones, crude protein fractions, recombinant proteins, protein hydrolysates, synthetic polypeptide mixtures, tissue extracts and combinations thereof.
13. The method of claim 1, wherein the first cell culture medium and the additional cell culture medium are the same.
14. The method of claim 1, wherein the mold or parts of the mold comprise a material that is removed from the construct after the three-dimensional structure is formed, optionally wherein the material is extracted, dissolved or melted from the three-dimensional structure of the construct.
15. The method of claim 1, wherein the mold comprises a cell non-adhesive material, optionally polydimethylsiloxane.
16. The method of claim 1, wherein the mold defines the shape of a sphere, rod, tube, dumbbell, cuboid or combination thereof.
17. The method of claim 1, wherein the mold comprises a wire or rod that when removed from the construct after the three-dimensional structure is formed, results in a construct comprising a hollow interior space.
18. The method of claim 1, wherein at least one stimuli is applied to the mixture or the construct, optionally wherein the stimuli is a biophysical stimuli.
19. The method of claim 1, wherein the mold defines the shape of a tube and at least one elongated metal material is inserted into the mold.
20. The method of claim 19, wherein at least one stimuli is applied to the mixture or the construct via the at least one elongated metal material.
21. A construct prepared by the method of claim 1.
Description
DRAWINGS
[0037] The embodiments of the application will now be described in greater detail with reference to the attached drawings in which:
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
[0062]
DETAILED DESCRIPTION
I. Definitions
[0063] Unless otherwise indicated, the definitions and embodiments described in this and other sections are intended to be applicable to all embodiments and aspects of the present application herein described for which they are suitable as would be understood by a person skilled in the art.
[0064] In understanding the scope of the present application, the term “comprising” and its derivatives, as used herein, are intended to be open ended terms that specify the presence of the stated features, elements, components, groups, integers, and/or steps, but do not exclude the presence of other unstated features, elements, components, groups, integers and/or steps. The foregoing also applies to words having similar meanings such as the terms, “including”, “having” and their derivatives. The term “consisting” and its derivatives, as used herein, are intended to be closed terms that specify the presence of the stated features, elements, components, groups, integers, and/or steps, but exclude the presence of other unstated features, elements, components, groups, integers and/or steps. The term “consisting essentially of”, as used herein, is intended to specify the presence of the stated features, elements, components, groups, integers, and/or steps as well as those that do not materially affect the basic and novel characteristic(s) of features, elements, components, groups, integers, and/or steps.
[0065] Terms of degree such as “substantially”, “about” and “approximately” as used herein mean a reasonable amount of deviation of the modified term such that the end result is not significantly changed. These terms of degree should be construed as including a deviation of at least ±5% of the modified term if this deviation would not negate the meaning of the word it modifies.
[0066] As used in this application, the singular forms “a”, “an” and “the” include plural references unless the content clearly dictates otherwise.
[0067] The term “and/or” as used herein means that the listed items are present, or used, individually or in combination. In effect, this term means that “at least one of” or “one or more” of the listed items is used or present.
II. Methods and Compositions of the Application
[0068] In the present application, a rapid fabrication method has been developed to form spatially-controlled multicellular tissue constructs through self-assembly. The process is applicable using different cell types to form complex shapes with predefined distribution of cells and highly controlled interfaces. The self-assembly of extracellular matrix, such as collagen, that forms the scaffold attaching cells and addition of a follow-up dose of growth medium were found to be important for this rapid fabrication method. Spherical and non-spherical constructs, which are robust and retain their shape even after removal from the mold, can be formed. Both homogeneous and heterogeneous multicellular constructs can be constructed, which is useful as a realistic in vitro model for bioassays that investigate the interaction between different cell types. The heterogeneous constructs not only provide precise spatial positioning but also sharp interfaces which can be important in quantification of migration, or gene and protein expression in these bioassays. Such heterogeneous constructs provide physiologically relevant cell densities, 3D structure as well as close positioning of multiple types of cells that are not possible using other fabrication approaches. Low to very high cell numbers can be used in small or larger structures to appropriately tune cell density to be physiologically relevant for different applications such as tissue development or drug screening. Although these constructs can be immediately applied as 3D in vitro models for drug discovery, the method can also be adapted for use in regenerative medicine, for example, as tissue grafts for implantation.
[0069] In one aspect of the application, provided is a method for preparing a construct (for example, a cell or tissue construct) comprising preparing a mixture of an extracellular matrix and a plurality of cells suspended in a first cell culture medium, applying a crosslinking or gelation agent to the mixture, depositing the mixture into a mold of a defined shape, allowing the extracellular matrix in the mixture to crosslink or gel for a duration of about 1 hour to about 4 hours, applying an additional cell culture medium to the mixture containing crosslinked or gelled extracellular matrix, allowing cell directed self-assembly of the mixture for a duration of about 2 hours to about 10 hours to form a construct, wherein the construct is a three-dimensional structure formed within the mold of the defined shape.
[0070] As used herein, the term “extracellular matrix” or “ECM” refers to a non-cellular support material. In one embodiment, the extracellular matrix comprises a hydrogel. In another embodiment, the extracellular matrix gel comprises collagen, fibrin, laminin, elastin, alginate, gelatin, fibrinogen, chitosan, hyaluronan acid, polyethylene glycol, lactic acid, N-isopropyl acrylamide, glycoproteins, proteoglycans, basement membrane proteins, Matrigel™, Geltrex™, or combinations thereof. In some embodiments, the extracellular matrix has a concentration of about 4 mg/mL to about 20 mg/mL, optionally 5 to 10 mg/mL.
[0071] In one embodiment of the method, 10.sup.5 to about 10.sup.10 cells/mL, optionally 10.sup.6 to 10.sup.7 cells/mL, are suspended in the first cell culture medium. Using a high number of cells at the beginning of the process rather than allowing the cells to reach the required cell number shortens the process and can result in a more homogenous cell population. In one embodiment, the final construct has a concentration of 10.sup.7 to 10.sup.10 cells/mL.
[0072] In one embodiment, the plurality of cells comprise mammalian cells. In another embodiment, the plurality of cells include cells selected from the group consisting of hepatocytes, pancreatic Islet cells, fibroblasts, chondrocytes, osteoblasts, endothelial cells, exocrine cells, smooth or skeletal muscle cells, myocytes, adipocytes, ectodermal cells, ductile cells, kidney cells, intestinal cells, parathyroid and thyroid cells, nerve cells, ocular cells, integumentary cells, immune cells, vascular cells, pluripotent cells and stem cells, cancer cells and tumor cells, or combinations thereof.
[0073] The plurality of cells may comprise cells of the same cell type, or cells of different cell, tissue and/or organ type. This technique can be used with primary cell lines or differentiated stem cells including induced pluripotent stem cells, embryonic stem cells and adult stem cells, as well as different immortalized cell lines from different tissue types and phenotypes.
[0074] In one embodiment, the ratio of the volume of the extracellular matrix to the volume of the first cell culture medium is between 1:1 and 1:10, optionally 1:1 to 1:6 or 1:1 to 1:3. In another embodiment, the ratio of the volume of the volume of the extracellular matrix to the volume of the first cell culture medium is 1:n with n>=1.
[0075] The term “bioink” as used herein refers to a mixture comprising cells, extracellular matrix and cell culture medium. A “bioink” may further comprise a crosslinking and/or a gelation agent.
[0076] As used herein, the term “cell culture medium” refers to a liquid or semi-solid designed to support the growth of cells. A cell culture medium that is suitable for the specific cell type(s) of the plurality of cells may be used. In one embodiment, the cell culture medium comprises natural biological substances selected from the group consisting of plasma, serum, lymph, amniotic fluid, pleural fluid, growth factors, hormones, crude protein fractions, recombinant proteins, protein hydrolysates, tissue extracts or combinations thereof. In another embodiment, the cell culture medium comprises a basal medium and supplements selected from the group consisting of plasma, serum, lymph, amniotic fluid, pleural fluid, growth factors, hormones, crude protein fractions, recombinant proteins, protein hydrolysates, tissue extracts or a combination thereof. Examples of cell culture media useful in the present methods include, but are not limited to, Dulbecco's Modified Eagle Medium (DMEM), supplemented for example with 10% V/V fetal bovine serum (FBS) and 1% Penicillin-Streptomycin, EBM-2 medium, and McCoy's medium supplemented for example with 15% V/V fetal bovine serum (FBS) and 1% Penicillin-Streptomycin.
[0077] In addition to the initial cell-containing cell culture medium (also referred to here as a “first cell culture medium”) which is mixed with the extracellular matrix, a second volume of cell culture medium (also referred to herein as an “additional cell culture medium”) may be added after the extracellular matrix has been crosslinked or gelled. This additional volume of cell culture medium can help to provide the cells with additional nutrients for the remainder of the assembly process.
[0078] In one embodiment, the first and the additional cell culture medium are the same. In another embodiment, the additional medium is different from the first medium and may be used, for example, to induce differentiation of cells in the construct.
[0079] In one embodiment, a crosslinking or gelation agent is applied to the mixture of the extracellular matrix and the plurality of cells suspended in the first cell culture medium.
[0080] The term “gelation agent” as used herein refers to any substance, molecule, atom, or ion that is capable of creating proper environment so that different polymer chains can bind to each other directly or using an external molecule. In one embodiment the gelation agent is an alkaline substance, such as sodium hydroxide (NaOH). In one embodiment, the gelation agent is a solution of sodium hydroxide (0.1-0.5 M) in deionized water. The alkaline substance may be used to adjust the pH of the mixture may be adjusted to at 7.2-7.4, optionally 7.4 or about 7.4. Adjusting the pH to 7.2-7.4 may help to initiate collagen self-assembly.
[0081] The term “crosslinking agent” as used herein includes any substance, molecule, atom, or ion that is capable of forming one or more crosslinks between polymer chains. The term “crosslink(s)” or “crosslinking” refers to a comparatively short connecting unit (as in a chemical bond or chemically bonded group), in relation to a monomer, oligomer, or polymer, between neighboring chains of atoms in one or more complex chemical molecule, e.g., a polymers.
[0082] Following application of the crosslinking or gelation agent to the mixture, the mixture may be deposited, or filled, into a mold of a defined shape. The mold is not limited to any specific shape or design. It may, for example, define the shape of a sphere, oval, rod, tube, dumbbell, cuboid, cross or variations or combinations thereof. The mold may also define a hollow space, such as a hollow tube. For example, the mold may include a wire or rod shaped material which, when removed from the construct, leaves a hollow space or channel.
[0083] The mold is optionally fabricated from a cell non-adhesive material, for example polydimethylsiloxane. In one embodiment, the mold is silicone, for example a silicone tube. The mold may be prepared by any method known in the art, including, for example microfabrication and 3D printing.
[0084] The mixture (also referred to herein as a “bioink”) may be deposited, or filled, into the mold by any means known in the art. In one embodiment, a pipette is used to deposit the mixture. In another embodiment, a syringe is used, for example a syringe with a proper gauge needle, such as 18-22. The bioink may be deposited uniformly or in a specific pattern. For example, the bioink may be selectively positioned within the mold in a defined manner. Further, different bioinks comprising different cell types may be selectively positioned in the mold such that they are spatially separated within the resulting construct. This can allow for multiple cell types in a construct in predefined patterns with sub millimeter accuracies and very clear cell-cell interfaces. These interfaces can be preserved for very long times.
[0085] Accordingly, in one embodiment, the method comprises preparing at least one additional mixture of a second extracellular matrix and a second plurality of cells suspended in a second cell culture medium, wherein the second plurality of cells comprise at least one different cell type from the plurality of cells, applying a crosslinking or gelation agent to the additional mixture and depositing the additional mixture into the mold such that different cell types are positioned in the mold such that they are spatially separated within the resulting construct. The same extracellular matrix may be used for the original mixture and the additional mixture, or different extracellular matrices may be used. Likewise, the same cell culture medium and/or the same crosslinking or gelation agent may be used for the original mixture and the additional mixture or different cell culture medium and/or crosslinking or gelation agents may be used. The same method may be used to deposit at least 3, 4, 5, or more different cell types in the mold.
[0086] Alternatively, different cell types may exist as a homogenous mixture within the construct for example by preparing a bioink comprising different cell types before the bioink is deposited in the mold.
[0087] After the mixture is deposited into the mold, it is allowed to crosslink or gel for a duration of about 1 hour to about 4 hours, optionally about 1.5 to about 3 hours or about 2 hours. In one embodiment, the mixture is incubated at 37° C. with 5% CO.sub.2.
[0088] In one embodiment, a second volume of cell culture medium is added to the crosslinked or gelled extracellular matrix to provide additional nutrients to the cells. After the additional volume of cell culture medium is added, cell directed self-assembly of the mixture for a duration of about 2 hours to about 12 hours, optionally about 3 hours to about 5 hours or about 4 hours is allowed to occur. In one embodiment, the mixture is incubated at 37° C. with 5% CO.sub.2. During this time, consolidation of the construct occurs to its final state while retaining the 3D shape fixed due to the initial collagen crosslinking or gelation.
[0089] The term “consolidation” or “consolidated” as used herein refers to the binding of cells, cell aggregates, multicellular aggregates, multicellular bodies, and/or layers thereof as an integrated structure though to cell-cell and/or cell-ECM attachments. In some embodiments, consolidation involves reduction in volume and/or physical shrinking of the integrated structure.
[0090] In some embodiments, the method further comprises removing the construct from the mold, wherein the construct retains a defined shape after removal from the mold. In some embodiments, the mold comprises a material that is removed from the construct after the three-dimensional structure is formed. In some embodiments, the material is extracted, dissolved or melted from the three-dimensional structure of the construct to form hollow constructs.
[0091] In some embodiments, the method is capable of forming constructs in a variety of shapes such as spheres, rods, tubes, dumbbells, cuboids or variations or combinations thereof, and can be easily parallelized to produce large numbers at the same time. In some embodiments, the method further comprises forming layered constructs comprising layers made of different compositions (i.e. cell type, extracellular matrix). In some embodiments, the method further comprises forming layered co-axial tubular constructs comprising a plurality of tubular/sheath structures.
[0092] In some embodiments, the construct comprises about 10.sup.6 to about 10.sup.10 cells/mL.
[0093] In some embodiments, the method is capable of forming constructs which define a hollow interior space by extracting a wire or rod-shaped mold from the construct to create a hollow space or a channel.
[0094] On one embodiment, the method further comprises applying a stimuli to the bioink or the construct. Such a stimuli can be useful to provide a physiological-like cue required to properly recreate the in vivo microenvironment of tissue and organs. The stimuli may for example be a biophysical stimuli such as electrical stimulation. The stimuli may alternatively, or additionally be fluid flow (for example, perfusion of medium, that generate shear force of fluid flow on the cells), or deformation of the mold (for example, mechanical stretching, bending, torsion and/or compression).
[0095] In one embodiment, at least one elongated metal material such as a pin (for example a stainless steel pin) or wire, is inserted in to the mold, allowing a stimuli such as mechanical or electrical stimulation to be applied through the elongated metal material. Then, when the bioink gels, the construct may be formed and hang between them and then mechanical or electrical stimulation may be applied through the metallic pin or wire. In one embodiment, two elongated metal materials are inserted into the mold so that when the bioink gels, the construct may be formed and hang between them and then mechanical or electrical stimulation is applied through the elongated metal material. In one embodiment, the stimulation is applied to the mixture after the steps of gelation and consolidation are performed. In another embodiment, the stimulation is applied to the resulting construct.
[0096] A stimuli may be applied one or multiple times. A stimuli may also be applied continuously over a period of time. Stimuli may be applied separately or different stimuli (for example, electrical and mechanical stimulation) may be applied at the same time. Electrical and/or mechanical stimulation may also be applied at the same time as perfusion/fluid flow.
[0097] In one example, an electrical stimuli with a peak to peak voltage of up to about 10 V and a frequency of up to about 50 Hz is applied to a construct.
[0098] After removal from the mold, the construct may maintain its shape for at least one day, two days, 5 days, 7 days, 10 days or two weeks independent of any anchorage.
[0099] In one particular embodiment, the mold is tubing such as gas permeable silicone tubing. The tubing optionally has an inner diameter of 0.1 to 10 mm, optionally 1 to 7 mm and/or a length of 0.5 cm to 5 cm, optionally 1 to 3 cm. Elongated metal material such as stainless steel wire 304 “pins” with a 0.5 mm diameter is optionally inserted into the tubing. For example, two pins perpendicular to each other may be inserted into the tubing at two point approximately 1 to 7 cm or optionally 2 to 4 cm apart. A bioink may be deposited in the tubular mold using methods as described herein to form a construct.
[0100] Stimuli is optionally applied to the construct during or after its formation. For example, mechanical deformation of the tube such as stretching, bending or torsion may be applied. In another embodiment, the pins are connected to a microcontroller to allow application of electrical stimulation to the construct.
[0101] In one embodiment, the method further comprises incubating the construct with an appropriate growth media. In one embodiment, the construct is placed in a container such as a petri dish and immersed in a growth media. In another embodiment, media is added to a channel/hollow space in the construct.
[0102] In another aspect of the application, provided are constructs prepared according to the method disclosed herein.
[0103] In some embodiments, the construct is used in vitro for research and development, such as for modeling cellular interactions in understanding disease and drug discovery. In some embodiments, the construct is used in vivo for cell therapy, such as tissue grafts and artificial organs for implantation.
[0104] The constructs described herein can be used for drug screening. Accordingly, also provided herein is a method for screening for activity of a compound of interest comprising treating a construct as described herein with a compound of interest and observing the effect of the compound on the plurality of cells. For example, a compound of interest may be screened for its effect on the growth rate of the cells, the viability of the cells and/or protein expression in the cells. In one embodiment, different doses of the compound of interest may be studied. The compound of interest is optionally a drug candidate, including for example, a small molecule or a biologics.
[0105] The constructs described herein can also be used as in vivo or in vitro bioreactors where cells producing specific biomaterials for example, a protein (for example, an antibody), peptide, hormone (for example, insulin), nucleic acid or lipid are included in the biocompatible gel. Accordingly, in such an embodiment, the methods described herein further comprise culturing the construct and isolating a biomaterial of interest.
[0106] The constructs described herein can be further used in regenerative medicine. Accordingly, in such an embodiment, the methods described herein further comprise administering the construct to a subject in need thereof.
[0107] Also provided herein are methods of using the constructs of the disclosure as in vitro experimental models.
EXAMPLES
[0108] The following non-limiting examples are illustrative of the present application:
Example 1. Materials and Methods
[0109] Fabrication process of the 3D Tissue Construct. A two-step fabrication process was devised so that the process of self-assembly associated with the ECM and the cells occurs at different stages. The process begins with the fabrication of molds of appropriate shapes that are representative of the final shapes of the tissue constructs. The molds are made of polydimethylsiloxane (PDMS) that is cast onto 3D printed features that represent the final shape. 3D printing was used for this purpose rather than other replication techniques such as soft-lithography because they are labor intensive and costly and require specific facilities. PDMS provides the low adhesion surface that is important for formation of the tissue construct. Next, the bioink which is composed of a 1:1 mixture of cell loaded (5×10.sup.4-1×10.sup.6 cells) culture medium and collagen (5 mg/mL) is filled into the PDMS mold (
[0110] Rapid Formation of Spheroidal Tissue Constructs. In order to form spheroidal tissue constructs, PDMS molds in the form of circular wells with spherical bottom were used. These molds were prepared by mixing PDMS and its curing agent with the ratio of 10:1 and casting it on the Poly lactic acid (PLA) master mold with negative of the required patterns. Master molds were designed using software Solidworks© and 3D printed using a Stereolithography (SLA) based 3D printer (Objet 24 Desktop 3D printer). A large and small well size were created with diameters of 4 and 2.5 mm respectively. MCF-7 (Michigan Cancer Foundation-7, a breast cancer cell line) cells were cultured in Dulbecco's Modified Eagle Medium (DMEM) (Thermofisher, high glucose) supplemented with 10% V/V fetal bovine serum (FBS) (Thermofisher, US origin) and 1% Penicillin-Streptomycin (Thermofisher, 10000 U/mL) until 70% confluent. Cells were trypsinized and detached from tissue culture flasks. Required number of cells (10.sup.5 or 10.sup.6) were aliquoted, precipitated using centrifugation, and resuspended in proper amount of medium (5 μL for small wells, 15 μL for large wells). The cell solution then was added to the equal amount of bovine collagen type I (Thermofisher, 5 mg/mL) and mixed to get a uniform distribution of cells. Finally, pH of the solution was adjusted to 7.4 by adding sufficient amount of 0.1 M NaOH solution and the mold was incubated at 37° C. with 5% CO.sub.2. Two hrs later, after the collagen was gelled, some DMEM growth medium (25 μL for large wells and 10 μL for small wells) was added to provide the cells with enough nutrients for the remainder of the assembly process. Bright field images of each well were taken using a stereo microscope immediately after filling the wells and after 1, 2, 4, and 6 hrs to measure the shrinkage using ImageJ software. After 6 hrs spheroids were moved to 96 well plates for further applications or observations. The same process was performed with 5×10.sup.4 cells in small and large wells with 1:1 ratio of collagen to culture medium, as well as 5×10.sup.4 cells in large wells with 1:3 ratio of the solutions but the same total volume in order to investigate possibility of using this technique with lower cell number or lower ECM to cell ratios.
[0111] Viability and Distribution of the Cells in the Final Spheroids. Effect of cell number and well size on cell viability at the end of the process (after 6 hrs) was studied by staining the spheroids (formed in large well with 10.sup.5 cells and small well with 10.sup.6 cells) with calcein-AM (Thermofisher). Five μL of calcein-AM solution was dissolved in 5 mL PBS and 100 μL of this solution was added to each spheroid. Spheroids were kept with this solution for 1 hr and then washed with PBS. Images were taken using an upright fluorescent microscope using green fluorescent filter with 4× magnification.
[0112] Microstructure of the spheroids was compared by studying two set of spheroids created with different cell densities. The high-density spheroid was fabricated in small wells loaded with 10.sup.6 cells, while the low-density spheroids were fabricated in large wells with 10′ cells. For histological staining, at the end of 6 hr process, spheroids were fixed in 4% wt/V formaldehyde in DI water for 1 hr, dehydrated step wise in 40, 60, 80% ethanol in water and after embedding in 1 wt % agarose, paraffin embedding, and sectioning, staining with Hematoxylin and Eosin (H&E) was performed and images were taken using inverted microscope with 10 and 20× magnifications.
[0113] Total Protein Content and Metabolic Activity of the Spheroids. The total amount of protein in the spheroids was measured using Pierce™ BCA Protein Assay Kit (Thermofisher). Crosslinked collagen in each spheroid was broken using 100 μL of collagenase/dispase (Sigma-Aldrich) solution (10 μL of 100 mg/mL collagenase/dispase as the stock solution in DI water, 10 μL of 10 mM CaCl.sub.2) as enzyme activator, and 80 μL of DPBS). Half an hour later contents of each well were pipetted vigorously to break the spheroids. To deactivate the enzyme, 25 μL of 10 mM EDTA was added and incubated for 5 min. Eventually 50 μL of this solution was transferred to a new well plate and the same amount of 0.1% V/V Triton X-100 in PBS solution was added to lyse the cells with 10 min incubation in incubator. The difference between each condition and the control was reported as the total protein content of each spheroid. The same solution of enzyme and its deactivator was used as control. The same process was performed on acellular spheroids (the same collagen and medium solution in small and large wells without cells) to measure protein content of each spheroid from ECM content and eventually cell protein content of each spheroid was defined as BCA reading of spheroid with cells minus BCA reading of acellular constructs.
[0114] To measure the mass transfer in and out of each spheroids, Alamar blue assay (ABA) kit (Thermofisher) was used. Spheroids were transferred to 96 well plates and 200 μL of DMEM supplemented with 10% V/V Alamar blue solution was added to each well and incubated for 1 hr. After that, 100 μL aliquots of the medium were transferred to a black 96 well plate and reading was performed at excitation and emissions of 560 and 590 nm.
[0115] To study the reasons for the shrinkage in the spheroids, the influence of cells, transmembrane proteins and cytoskeleton were assessed. PCR was performed to study expression of cell-cell and cell-ECM junctions. For this purpose, spheroids formed in small wells with 10.sup.6 cells (highest cell density, S-10.sup.6 group) and the ones formed in large wells with 10.sup.5 cells (lowest density, L-10.sup.5 group) were chosen. Spheroids were digested the same as before and the solutions were transferred to 0.5 mL DNase free PCR tubes. Then, 250 μL PBS was added for dilution followed by centrifugal concentration of the cells and the removal of the supernatant by aspiration. To study gene expression, a one-step qRT-PCR kit (Cells-to-CT™ 1-Step Power SYBR™ Green, ThermoFisher) was used. Primers for E-cadherin (as cell-cell adhesion marker), 31-Integrin (as cell-ECM marker), and β-Actin (as housekeeping gene) were used according to Table 1. The ΔΔCt values for each primer set were calibrated to the average of housekeeping Ct values and then to the Ct values of the L-10.sup.5 group. For each group 4 biological replicates and 2 technical replicates for each sample was used.
TABLE-US-00001 TABLE 1 Sequence of the used primers for qPCR (5′ to 3′) Target Gene Forward Reverse E-Cadherin TGCCCAGAAAATGAAAAA GTGTATGTGGCAATGCGTTC GG (SEQ ID NO: 1) (SEQ ID NO: 2) β1-Integrin CATCTGCGAGTGTGGTGT GGGGTAATTTGTCCCGACTT CT (SEQ ID NO: 3) (SEQ ID NO: 4) β-Actin CATGGAGTCCTGGCATCC ATCTCCTTCTGCATCCTGTC ACGAAACT GGCATA (SEQ ID NO: 5) (SEQ ID NO: 6)
[0116] Effect of cytoskeleton on the consolidation process was studied by impairing the actin network of the cells. MCF-7 cells were cultured up to 70% confluent and pretreated with medium supplemented with 100 nM Latrunculin A (LAT-A, Abcam) for one hour. Then cells were trypsinized and spheroids were formed with 5×10.sup.5 cells in large wells once without LAT-A in the medium used for spheroid formation and another time with medium containing the same concentration that was used for pretreatment. The same spheroids were formed without LAT-A treatment as the control.
[0117] Spheroid Formation Using Other Cell lines. To determine whether the same technique can be used with other cell lines, large wells (4 mm in diameter) and 5×10.sup.5 cells in 30 μL of 1:1 collagen and DMEM solution was used with other cell lines including MDA-MB-231 and Hs-578T (two other breast cancer cell lines), SaOS-2 (osteosarcoma cell line), human umbilical cord endothelial cells (HUVEC), 3T3, L929, and Chinese Hamster ovary (CHO) cell lines (three fibroblastic cell lines), and C2C12 (myoblast cell line). All of the cells were grown in their specified culture media until 80% confluent (HUVECs were grown in EBM-2, CHO cells were grown in F12K supplemented with 10% FBS, SaOS-2 cell were grown in McKoy's media supplemented with 15% FBS, and C2C12s were grown in DMEM with 10% heat inactivated FBS. All of the other cells were grown in DMEM supplemented with 10% FBS) and trypsinized to prepare the cell suspension that were used to form spheroids. The same procedure as described previously was used to form spheroids. In all cases DMEM supplemented with 10% FBS was used for spheroid fabrication to eliminate effect of medium composition on collagen crosslinking/gelation and shrinkage pattern. All of the cell lines were acquired from ATCC©, HUVECs were used under passage number 10, and as for the rest of the cells, passage numbers below 30 were used.
[0118] Effect of cell type on mechanical properties of the spheroids was studied using a microscale mechanical test system (MicroSquisher, Cell Scale). A 3×3 mm stainless steel platen connected to a 0.4 mm diameter cantilever was pressed on the spheroids at the rate of 10% strain per minute in a displacement-controlled setup. Location of platen was tracked using a camera and a load cell connected to the other end of cantilever measured the force exerted by the spheroids. The force-displacement data were then used to measure stiffness of the spheroids. Eight spheroids (5×10.sup.5 cells in Large wells) were tested for each condition.
[0119] Heterogenous Multi-cellular Spheroid Formation. To determine whether this method is capable of forming heterogeneous spheroids with more than one cell type, spheroids were fabricated using bioinks consisting of MCF-7 cells along with either green fluorescent protein (gfp) tagged 3T3 fibroblasts or red fluorescent protein (rfp) tagged HUVECs in large wells. The total cell population was kept at 5×10.sup.5 with 90% of the cells being MCF-7 and 10% of the second cell type. Bright field images as well as fluorescent ones were taken the same as before to study effect of second cell type on spheroids shrinkage and distribution of different cell types. These results were compared to spheroids formed in the same condition but just with MCF-7 cells.
[0120] Effect of Extracellular Matrix on Spheroid Formation. Effect of the ECM type on the construct formation process and that of the concentration of the ECM was studied in large wells using collagen or Geltrex™ (ThermoFisher) as ECM. Two concentrations of bioinks were prepared by adding either 15 or 30 μL of the ECM, with 15 μL DMEM or without it, respectively, loaded with 5×10.sup.5 MCF-7 cells. The rest of the fabrication process was the same as that described previously.
[0121] Homogeneous Non-spherical Structures Using MCF-7. Versatility of the technique to form non-spheroidal tissue like constructs was shown using molds with different shapes. Molds in the shape of a cross (2(L)×2(W)×2(H) mm), a dumbbell (1.5 mm in radius with 3 mm distance between wells, 2 mm deep), and a series of cuboids (2(L)×2(W)×2(H) and 4(L)×2(W)×2(H) mm) were made in PDMS. Bioink was deposited into the molds and the construct allowed to assemble using the same procedure as described previously. In case of the cross structure, 10.sup.6 cells with total solution of 50 μL were deposited into the mold. Similarly, in the case of the dumbbell, 60 μL of the bioink containing 10.sup.6 cells was deposited while for the cuboid shapes 8 and 16 μL of bioink containing 5×10.sup.5 and 10.sup.6 cells were used. The ratio of collagen to DMEM was 1:1, which was the same as previous experiments. Six hours later, the constructs formed in the shape of cross were transferred to 48 well plates and images were taken 24 hrs, 3 and 7 days later to confirm their ability in maintaining their predefined shape. To show whether constructs will be able to maintain this predefined shape independent of the mold, constructs with the shape of cross were kept in 48 well plates and images were taken after 1, 3, and 7 days in each condition.
[0122] Heterogeneous Multi-cellular Non-Spherical Structure Formation. To demonstrate the capabilities of this method to fabricate heterogeneous tissue constructs molds in the shape of a dumbbell was used. Three different bioinks were loaded into different locations on the mold. Specifically, 25 μL of the bioink with 5×10.sup.5 of gfp-3T3 cells was added to the left well and a similar volume with the same concentration of rfp-HUVECs was added to the right well. The high viscosity of the bioink prevented its spread and spatially confined it to the round chambers into which they were deposited. Finally, 10 μL of bioink with 2×10.sup.5 MCF-7 cells dyed with blue cell tracker (CMF.sub.2HC Dye, ThermoFisher) was added to the connecting channel region. Bright field and fluorescent images of the 3D tissue construct that self-assembled were taken using a stereo microscope and a ChemiDoc™ MP imaging system (Bio-Rad), respectively. After 4 hrs, close-up images of the interface regions between the different cell types were taken using an upright fluorescent microscope, in order to determine cell distribution and the shape of the tissue structure formed in these regions.
[0123] Data Analysis. Data is reported as Mean Standard Deviation (SD), statistical analysis is performed using the two-way student's t-test with an accepted statistical significance of P-value<0.05.
Example 2. Characterization of Tissue Constructs
[0124] Rapid Formation of Spheroidal Tissue Constructs. In order to determine the speed with which tissue constructs are formed, bioinks were loaded into molds with circular wells and spheroidal bottom. Bioinks with various population of cells (10.sup.5 and 10.sup.6) were loaded into wells of different sizes (2.5 and 4 mm in diameter) and imaged periodically over 6 hrs (
[0125] The distribution of live cells within the spheroid formed was determined using live cell staining with calcein-AM (
[0126] The spheroid fabrication process can also be used to control the primary type of interaction of the cells. A high density of cells in the spheroid will promote a greater cell to cell interaction while a lower density will provide more cell ECM interactions. In order to demonstrate this, the same spheroids for live staining were used and histological staining was performed using H&E to show the distribution of the cells in each condition (
[0127] Total protein content of each of the spheroids was measured and compared to each other and acellular spheroids using Pierce BCA kit (
[0128] The microstructure of the spheroids was also studied. Considering the final sizes of the spheroids and cell numbers in each of them, it was expected that spheroids with 10.sup.6 cells formed in small wells had higher densities. As it is shown in
[0129] To study whether cell-cell and cell-ECM adhesions or contraction caused by cytoskeleton are dominant in spheroid formation, MCF-7 cells were treated with actin cytoskeleton influencing drug latrunculin A (Lat-A) that is known to bind to actin monomers and prevent their subsequent reorganization of cytoskeleton in MCF-7 cells. Spheroids were formed with 5×10.sup.5 cells in large wells without pre- or post-treatment (nT-nT), pre-treated cells with 100 nM for 1 hr without post-treatment during spheroid formation (T-nT), and pretreated cells with post-treatment using the same concentration as pretreatment step (T-T). Spheroids were formed in all cases and there was no meaningful difference between their radii after 6 hrs (P-value>0.05) which combined with increased expression of integrins shows the importance of cell-cell and cell-ECM interactions over cytoskeleton remodeling and reorganization during the first few hours of the shrinkage process (
Example 3. Multicellular Spheroidal Tissue Constructs
[0130] Homogeneous Multi-cellular Spheroid Formation. The ability of different cell types to rapidly form spheroids was evaluated by using eight other cell lines (in large wells with 5×10.sup.5 cells). Some of the cell types such as HUVEC and HS578T demonstrated a higher propensity for rapid consolidation as compared with MCF-7 cells while others such as SaOS-2 and MDA demonstrated a lower propensity as shown in
[0131] Multicellular spheroids and other self-assembled constructs have been used for different applications such as modeling naturally occurring processes, as a model for cancer research and drug discovery, as well as building blocks in tissue engineering. One of the limitations of using these as building blocks for large tissue constructs is diffusion limitations and the need for vascularizing the structure.
[0132] Using MicroSquisher testing machine (setup shown in
[0133] Heterogeneous Multi-cellular Spheroid Formation. Ability of the method to form homogeneous multi-cellular spheroids was demonstrated by using a bioink that consisted of 90% MCF-7 cells along with 10% of 3T3s or HUVECs. These specific cell types were chosen as interaction of stromal cells such as fibroblasts and endothelial cells with cancer cells is an active area of study and developing 3D models that can recapitulate these interactions is important.
[0134] The total cell population was fixed as 5×10.sup.5 cells and spheroid formation occurred in large wells. All of these bioinks were found to result in spheroid formation as shown in
[0135] Effect of Extracellular Matrix on Spheroid Formation. Previously, it was determined that cells were essential for rapid formation of the tissue constructs. In order to determine other essential conditions, the method was tested with different ECM. Apart from collagen many other natural ECMs such as laminin, elastin, glycoproteins and proteoglycans are also looked upon as important for 3D culture and to recreate the tissue microenvironment. Matrigel™ and its reduced growth factor version, Geltrex™ are some of the most widely used examples of such ECMs. The use of Geltrex™ was evaluated with this method and also investigated the impact of the second addition of DMEM in the consolidation process.
Example 4. Homogenous and Heterogeneous Non-Spherical Constructs
[0136] Homogeneous Non-spherical Structures Using MCF-7. Multicellular spheroids are widely used because of their ability in resembling structure of real tissues and conditions such as initial avascular state of tumors, but the formation of a necrotic core is not preferable in the study of tissue types and biological systems where non-spherical constructs can be used. To this end, molds with different shapes were used with the same process as before in order to determine whether initial shape at which collagen crosslinks/gels defines the final shape or the forces exerted by the cells during the shrinkage process.
[0137] Heterogeneous Multi-cellular Non-Spherical Structure Formation. In natural tissues different cell types are positioned adjacent to each other in close proximity. The signaling from one cell then affects the behaviour of the neighboring one and helps to recreate an in vivo-like microenvironment. The ability of this method to form multicellular structures with predefined positioning of cells was shown by formation of multi-cellular dumbbells.
Example 5. Tubular Constructs and Physical Stimuli
[0138] Current 3D models lack either the rich multicellular environment or fail to provide appropriate biophysical stimuli both of which are required to properly recapitulate the dynamic in vivo microenvironment of tissues and organs. This is because many of the current techniques used for making these constructs are limited in the cell density, fabrication speed, control over positioning of different cell types, and creation of tissue/organ interfaces. More importantly, formation of necrotic cores and the inability to grow them beyond a certain size due to mass transport limitations is one of the key limitations of multicellular spheroid models, especially for applications other than modeling avascular stage of the cancerous tissues. Finally, it is also difficult to incorporate biophysical cues such as electrical and mechanical stimulation that is increasingly being considered important to recreate the in vivo environments, due to their form factor.
[0139] In summary, existing methods do not combine all the required features including rapid self-assembly of 3D tissue constructs, ability to precisely position different cell types and pattern them, ability to scale sizes of the constructs, and the ability to incorporate all the three important biophysical stimuli, stretch, shear, and electric. More importantly, they also involve customized molds, tools and equipment that make it difficult to implement without appropriate engineering expertise.
[0140] In this example, the rapid construction of multicellular, tubular tissue constructs termed “Tissue-in-a-Tube” using self-assembly process in tubular molds with the ability to incorporate a variety of biophysical stimuli such as electrical field, mechanical deformation, and shear force of the fluid flow is described. Unlike other approaches, this method is simple, requires only oxygen permeable silicone tubing that molds the tissue construct and thin stainless-steel pins inserted in it to anchor the construct and could be used to provide electrical and mechanical stimuli, simultaneously. The annular region between the tissue construct and the tubing is used for perfusion. Highly stable, macroscale, and robust constructs anchored to the pins form as a result of self-assembly of the ECM and cells in the bioink that is filled into the tubing. Patterning of grafts containing cell types in the constructs in axial and radial modes with clear interface and continuity between the layers is demonstrated. Different environmental factors affecting cell behavior such as compactness of the structure and size of the constructs can be controlled through parameters such as initial cell density, ECM content, tubing size, as well as the distance between anchor pins. Using connectors, network of tubing can be assembled to create complex macrostructured tissues (e.g. centimeters length) such as fibers that are bifurcated or columns with different axial thicknesses which can then be used as building blocks for biomimetic constructs or tissue regeneration. This technique is simple (no microfabrication steps required) and fast (only a few hours culture time before stable tissue constructs are formed) without the need for specific fabrication equipment, has the ability to control positioning of multiple cell types/ECM materials with uni- or multi-directional crosstalk between them. The method is also versatile and compatible with various cell types including endothelial, epithelial, skeletal muscle cells, osteoblast cells, and neuronal cells. As an example, long mature skeletal muscle and neuronal fibers as well as bone constructs were fabricated with cellular alignment dictated by the applied electrical field. The versatility, speed, and low cost of this method is suited for widespread application in tissue engineering and regenerative medicine.
[0141] Thus, large constructs with cylindrical shape, and uniform and well-defined mass transport properties without necrotic cores are created with high cell density, with multiple cell types positioned in predefined patterns and with clear interfaces, combined with multitude of electrical/mechanical stimulation to create a dynamic environment. The cylindrical format enables scalability and construction of various sizes (e.g. mm to cm). The format inherently is suited for perfusion of media to support metabolic needs of cells and create biomimetic shear conditions resulting in a physiologically relevant model that very closely mimics the in vivo conditions. Macrostructures with different shapes can also be used as cell vehicles for implantation or as in vitro models for applications such as drug screening.
Materials and Methods
[0142] Collagenous constructs of cells inside a silicone tubing and anchored to the metallic pins were formed using a process of self-assembly that has been used previously for spheroidal and non-spheroidal structures. Replacing PDMS molds with silicone tubing enables production of solid tube-like constructs which are anchored on the stainless-steel pins (
[0143] Once the self-assembly process is complete an annular gap forms between the construct and the tubing that can be used for perfusion purposes and to apply shear forces on the construct. The inserted pins can be connected to a microcontroller to apply electrical stimulation to the construct, and the tubing itself can be stretched, bent, or torqued to create different types of mechanical deformation in the construct. This setup allows formation of collagenous constructs in a very short process (4-6 hrs) that can be kept and monitored in a true 3D and dynamic environment with different types of stimuli.
[0144] Cell Culture. Different types of cells were used in the current study for different purposes. Michigan Cancer Foundation-7 (MCF-7) breast cancer cells were cultured in Dulbecco's Modified Eagle Medium (DMEM) (with L-glutamine and high glucose, Gibco), supplemented with 10% V/V fetal bovine serum (FBS) (Canada origin, Thermofisher) and 1% V/V Penicillin-Streptomycin (10,000 U/mL, Thermofisher) until 70% confluent. C2C12 myoblast cells were grown in the same DMEM, supplemented with 10% V/V heat inactivated FBS (HI-FBS) (Canadian origin) and 1% V/V Penicillin-Streptomycin. For differentiation purposes, these cells were cultured in DMEM supplemented with 2% V/V of horse serum (Thermofisher) and 1% V/V Penicillin-Streptomycin and 0.1% Insulin (Insulin-Transferrin-Selenium, 100×, Thermofisher, Catalogue number 41400045). SH-SY5Y neuroblastoma cells were cultured in DMEM/F-12 (Thermofisher, with L-glutamine) medium supplemented with 10% HI-FBS and 1% Penicillin-Streptomycin. For differentiation of these cells DMEM/F12 was supplemented with 1% heat inactivated FBS, 1% N2 supplement, and 1 M retinoic acid. Red fluorescent protein (rfp)-tagged human umbilical vein endothelial cells (HUVEC) were grown in EBM-2 medium. Osteoblast-like cells from Saos-2 osteosarcoma cell line were cultured in McCoy's medium (Thermofisher, with L-glutamine) supplemented with 15% FBS and 1% Penicillin-Streptomycin.
[0145] Tissue-in-a-Tube: Fabrication and Optimization. MCF-7 cells were used for characterization purposes to study effect of collagen to medium ratio (CMR), cell density, tubing size, and distance between the stainless-steel pins. 1:1, 1:3, and 1:5 ratios were used while other parameters were kept constant at 2×10.sup.6 cells/mL, tubing with 3 mm inner diameter (ID), and pins being 2 cm apart. The 1:1, 1:3 and 1:5 ratios corresponded to 2.5 mg/ml, 1.25 mg/ml and 1 mg/ml of effective collagen concentration in the final solution. Effect of cell density was studied by using bioinks containing 1, 2, and 3×10.sup.6 cells/mL of the bioink with 1:3 CMR and 2 cm wide pins in 3 mm ID tubing. Effect of Tubing size was studied by using tubing with 1, 3, and 7 mm ID, termed as thin, medium, and thick, respectively, while 1:3 CMR, 2×10.sup.6 cells/mL bioink, and 2 cm wide pins were used. In order to study the ability to form constructs with different lengths, tubing with 3 mm ID was used with a bioink with 1:3 CMR and 2×10.sup.6 cells/mL density but pins were kept 2 and 4 cm apart. After filling the tubing with the bioink in each case, incubation at 37° C. was performed for 4 more hours until shrinkage of the stable constructs was done. Images of the samples were taken using a dissecting microscope (Infinity Optical Systems). Bioink was prepared by dispersing cells in the required volume of the medium and then addition of neutralized bovine collagen I (Thermofisher, 5 mg/mL). Collagen was neutralized by addition of 0.1 M sodium hydroxide in DI water. Stainless steel 304 wire (McMASTER-CARR) with 0.5 mm diameter were used as pins and at each point two pins perpendicular to each other were inserted in the tubing to provide proper anchorage for the constructs.
[0146] Live/dead staining was performed using the kit (ThermoFisher) following the provided protocol. Briefly, calcein-AM and ethidium homodimer-1 were diluted in the medium and added to the samples (formed with 1:3 CMR and 2×10.sup.6 cells/mL density in tubing with medium thickness and with 2 cm apart pins) 4 hrs after process was started followed by 1 hr of incubation. Images of the samples were taken using an inverted fluorescent microscope with 4× magnification and proper filters.
[0147] Controlled Cellular Interfaces. Formation of clear and continuous interface between regions containing different cell types in a contiguous tissue construct was shown in both axial and radial configurations. MCF-7 cells were stained with either green DiO or red DiI fluorescent cell trackers (Thermofisher). For the axial configuration, half of the tubing was filled with the bioink containing green stained cells (1:3 CMR, 2×10.sup.6 cells/mL solution). After half hour incubation when the collagen had gelled but the cells had not attached to the ECM to apply significant traction forces, the other half of the tubing was filled with the same bioink but with red stained cells. For radial configuration, the whole tubing was filled with green stained cells' bioink (1:3 CMR, 2×10.sup.6 cells/mL solution). After 2 hrs of incubation that shrinkage was performed, extra medium was extracted and a 1:3 CMR bioink with 1×10.sup.6 cells/mL was added followed by further incubation. Fluorescent images were taken before and after addition of each bioink using a ChemiDoc™ MP imaging system (Bio-Rad).
[0148] Complex Macrostructures. Macrostructures with different patterns including bifurcated patterns and columns with varying axial thicknesses were formed using HUVECs. For bifurcated patterns, three 3 mm ID tubing, each 2 cm in length were connected to each other using a Y-shaped connector. At the end of each tubing two perpendicular pins were inserted as anchor pins and the entire connection was filled with 1:3 CMR and 2×10.sup.6 cells/mL solution of HUVECs. After 1 hr of incubation that collagen had gelled, and some shrinkage was observed, pins were removed and bifurcated macrostructure was retrieved from the tubing. Columns with descending thicknesses were formed by connecting 2 cm long tubing with 7, 3, and 1 mm IDs using proper connectors, respectively. Perpendicular pins were inserted in the middle of each tubing and the same bioink as before was added. Macrostructure was retrieved after 1 hr of incubation. Fluorescent images were taken using the same ChemiDoc™ MP imaging system, before and after samples were taken out of the connected tubing.
[0149] Dynamic Environment. C2C12 constructs were formed with 1:3 CMR and 2×10.sup.6 cells/mL bioink in tubing with 3 mm ID and 2 cm apart pins in the cells' growth medium. After 24 hrs, the medium was switched to the cells' differentiation medium and at the same time a step electrical signal with peak to peak voltage of 10 V (5 V/cm) and frequency of 50 Hz was applied (5 samples in parallel). An open source microcontroller, Arduino Uno R3, was used to create this signal and to control a motor that was used for perfusion (flow rate of 0.1 mL/min for 1 min every 12 hrs). The code used for programming the microcontroller that controls the bioreactor is included in Table 1. This group of samples were named “Dynamic”. Samples were kept in this condition for 3 more days. As control groups, samples formed in the tubing for 24 hrs but retrieved from it and kept in 6 well plates in 2 mL differentiation medium (“In Well” group), and samples kept in tubing with differentiation medium but without electrical stimulation (“In Tube” group) were considered. At day 4, samples were taken out of the tubing and images were taken using the dissecting microscope used previously. ImageJ software was used to measure thickness of the constructs before and after releasing them from the anchor pins and were compared to the “In Well” samples.
[0150] Three samples for each condition (n=4) were digested using a 0.5 mL of 2 V/V % collagenase/dispase (Sigma-Aldrich) solution in PBS (stock solution was 100 mg/mL collagenase/dispase in DI water). After digestion was done another 0.5 mL of 0.5% Triton X-100 in PBS was added to lyse the samples. Pierce BCA (Thermofisher) kit was used to measure the protein content of each sample by using two 25 μL aliquots of lysate solution in 96 well plates where 200 μL of kit solution (50:1 ratio mixture of parts A and B of the kit) was added to each well. Absorbance was measured at 562 nm after 30 min incubation at 37° C. in duplicate reading for each sample. Mixture of Collagenase/dispase and Triton X-100 solutions was used as control and its value was subtracted from the samples.
[0151] Three more samples for each condition were fixed in 2% formaldehyde solution in DI water for 1 hr. After fixation was done, samples were washed with warm PBS two times and 1 mL of PBS containing 25 μL of Alexa Fluor™ 488 Phalloidin (Thermofisher) stock solution (300 units dissolved in 1.5 mL methanol) and 0.2% Tween-20 as permeabilizing agent was added with 1 hr incubation at room temperature. After washing with PBS, samples were counterstained with 1 mL PBS containing 1 μL of DAPI (4′,6-Diamidino-2-Phenylindole, Dihydrochloride, Thermofisher) stock solution (10 mg/mL in DI water) for 30 min. Imaging was performed using an inverted fluorescent microscope (Olympus, USA) with DAPI and FITC filters with Ex/Em of 381-392/417-477 and 475-495/512-536, respectively. Live/dead staining and imaging was performed as before on the “Dynamic” and “In Tube” groups after samples were taken out of the tubing at day 4.
[0152] Constructs were also formed with SH-SY5Y and Saos-2 cells in 3 mm ID tubing with 1:3 CMR and 2 cm apart pins while cell density was 4×10.sup.6 cells/mL for SH-SY5Y cells and 2×10.sup.6 cells/mL for Saos-2 cells. Differentiation of SH-SY5Y was started at day 1 by switching to their differentiation medium and in both cases electrical stimulation was started after 1 day and continued for 5 days with 10 V peak to peak and 50 Hz frequency.
[0153] Statistical Analysis. Data are reported as Mean Standard Deviation (SD) and statistical analysis was performed using one-way ANOVA test in GraphPad Prism with an accepted statistical significance (p-value) less than 0.05. Significant outlier data points were detected using Grubbs' test.
Results and Discussion
[0154] Tissue-in-a-Tube: Fabrication and Optimization. A biofabrication approach termed as Tissue-in-a-Tube has been developed to form highly dense multicellular cylindrical constructs, rapidly with the ability to incorporate electrical and/or mechanical stimuli to cells in a 3D environment along with continuous medium perfusion (
[0155] Different parameters such as cell density, initial collagen to medium ratio (CMR), and tubing size (inner diameter (ID)) can affect the dimensions of the formed construct as well as its compactness which was characterized using MCF-7 cells with the epithelial phenotype characteristic. Increasing the cell density and CMR, or decreasing the tubing ID, decreased the thickness of the construct (
[0156] Increase in cell density leads to increase in cell-cell and cell-ECM interactions that facilitate higher traction forces and increased consolidation of the construct. Longer constructs were formed by increasing the distance between the anchor pins while maintaining the diameter of the tubular structure (
[0157] Bioinks with CMR of 1:3 and cell density 2×10.sup.6 cells/mL seeded into tubing with anchor pin spacing of 2 cm and 4 cm produced correspondingly long constructs with minimal change in their diameter (1375±41 vs. 1320±89 m for 2 and 4 cm apart pins, respectively). Since construct formation process is fast (4 hrs), the cells were viable and only a small number of dead cells can be observed with uniform distribution rather than formation of necrotic regions (
[0158] Controlled Cellular Interfaces/Complex Macrostructures. Multilayered and multi-material tissue engineered constructs better mimic function and architecture of natural tissues. Such constructs can be used to study the interaction between different cells in a tissue that happens through paracrine or contact-dependent cell signaling which significantly influences their individual function. The rapid self-assembly process used in this method enables formation of constructs that can be axially or radially patterned with different cell types (demonstrated here with MCF-7 cells stained with different colors) while maintaining its structural continuity and integrity (
[0159] Spherical constructs have been widely used, for example in the case of spheroids, mostly due to ease of fabrication for applications such as modeling the initial avascular state of cancerous tissues, but this format can lead to formation of necrotic core that is not favorable for other applications including modeling physiological conditions of different tissues. An alternative and elegant tissue structure would be cylindrical or tubular structures that can be extended along their axial dimension to have a larger volume without increase in the radial direction in order to avoid formation of necrotic cores. Control over the radial dimensions of such structures affect the mass transport fluxes within the construct and could be used to create unique biochemical environments. Here such long tubular macrostructures with different thicknesses in different regions were fabricated (
[0160] The branching structures shown here (
[0161] Dynamic Environment. In addition to 3D cell-cell and cell-ECM interactions and paracrine activities, biophysical signals such as mechanical or electrical stimulation play an important role in recreating the in vivo-like microenvironments that determine the functioning of tissues. The use of metal pins as anchors provided the ability to apply electrical stimulus to the tissue construct during different assembly and development phases. In addition, due to the self assembly and the contraction of the forming tissue construct that are constrained by the rigid pins, a time varying and auto-regulating mechanical stimuli is also applied on the construct. Similarly, the flexibility of the silicone tubing as well as the ability to perfuse the annular region between the tube and the tissue provided the ability to introduce active and dynamic mechanical stimulus and perfusion of fluids. A bioreactor (
[0162] Importance of dynamic environment on cell function was studied by studying effect of electric field on differentiation and maturation of myoblast cells as well as their ECM deposition. For this purpose, muscle tissue constructs (formed using C2C12 cells, 1:3 CMR, 2×10.sup.6 cells/mL, and 2 cm apart pins) that were formed in their growth medium and subsequently their differentiation into mature skeletal muscle cells in the form of multinucleated myofibers, in three different conditions were compared. Cellular behavior in samples formed in the tubular constructs without subsequent confinement to the anchor pins was studied by transferring the formed tubular constructs to 6 well plates containing differentiation medium (“In Well” group), 24 hrs after the process started. Effect of being confined to anchor pins on cell behavior was studied by keeping the formed tissue samples in the tubing (“In Tube” group) and switching to differentiation medium. Effect of electrical stimulation on this process was studied by applying electric field to the anchored samples in the tubing while they were exposed to differentiation medium (“Dynamic” group). Grafts in these conditions were compared 3 days later (4 days in culture in total) (
[0163] Other tissue constructs including neural (formed using SH-SY5Y neuroblastoma cells) and osseous (formed from Saos-2 osteosarcoma cells) also demonstrated cellular alignment with the electrical stimulus in our tissue formation method (
[0164] In addition to electrical stimulation, additional biophysical stimulation can also be applied in this system. For instance, other types of stimuli including the perfusion of medium that generates shear force of the fluid flow on the cells on the outer layer of the tubular construct and the mechanical bending of the tubing that translates to the mechanical deformation of the constructs including stretching or compression can be shown using the method described herein. Wave-like mechanical deformation can be created through induction of in the tissue graft by controlling the flow rate of the medium as well. Effect of this mechanical deformation on maturation of skeletal muscle cells was studied by forming the C2C12 constructs and creating the dynamic environment by applying mechanical stimulation by bending the tubing for 2 hr every day for 3 days. Mechanical deformation was started one day after grafts were formed and transferred to differentiation medium. The tubing and graft inside it can be treated as a beam that is fixed on one side and is deflected using a concentrated force on the other end. There is a uniform shear force applied to all cross-sections of the sample across the length of the graft and while there is a cubic relation between deformation and position. In order to create more uniform deformation in the graft, in
[0165] This technique is also compatible with high throughput screening applications. For example, a large number of constructs can be formed in the same tubing by inserting more than just two anchor pins or by connecting different construct containing tubing to each other in series. This could increase the nutrient consumption and by-product accumulation rate and adjustments to the flow rate of the medium or size of the tubing needs to be done to properly support cellular behavior. Alternatively, connections in parallel can be also used in case perfusion is not desired. This will isolate the metabolic impact of one tissue type on the other. A combination of series and parallel connections can be introduced to replicate the ratio of metabolic outputs of different tissue types in the body.
CONCLUSION
[0166] A new and simple biofabrication technique for rapid formation of collagenous, tubular, macroscale tissue constructs has been developed. The method allows for formation of complex tubular shapes and branching networks while providing the flexibility to control positioning of different cell types in predefined patterns, at high densities and with clear interfaces that can mimic in vivo like environments. The fabrication process is low cost, simple, and easy to adapt to create various tissue geometries and allosteric scaling. It can also be used to apply various biophysical stimuli such as mechanical deformation, fluid shear, and electric field separately or in conjunction to create a dynamic environment as well. A variety of cell types including endothelial, epithelial, skeletal muscle cells, bone cells, and neuronal cells are amenable to this method, and multicellular structures can be created by radial or axial patterning. To demonstrate the efficacy of this method, aligned muscle, neural, and bone tissues were constructed. Macrostructures (several centimeters in length) with complex patterns such as the columns with different thicknesses in different regions and bifurcated constructs which can be used as cellular constructs or in vitro models were rapidly constructed. By providing both the biochemical and the biophysical environment and the ability to direct complex paracrine interactions between different segments using fluid flow, these systems can serve as a versatile tool for biomedical researchers understanding disease mechanisms and discovering new drugs.
[0167] While the present application has been described with reference to examples, it is to be understood that the scope of the claims should not be limited by the embodiments set forth in the examples, but should be given the broadest interpretation consistent with the description as a whole.
[0168] All publications, patents and patent applications are herein incorporated by reference in their entirety to the same extent as if each individual publication, patent or patent application was specifically and individually indicated to be incorporated by reference in its entirety. Where a term in the present application is found to be defined differently in a document incorporated herein by reference, the definition provided herein is to serve as the definition for the term.
Tables
[0169]
TABLE-US-00002 TABLE 1 Code used for programming the microcontroller that controls the bioreactor. //define pins for the peristaltic pumps int EnA=10; //yellow wire int in1=9; //orange wire int in2=8; //red wire int EnB=11; int in4=12; int in3=13; //output voltage for 1st pump int potValue1=0 ; long pwmOutput1=0; int VoltOutput1=0; int potValue2=0; long pwmOutput2=0; int VoltOutput2=0; //using potentiometers to define speed of peristaltic pumps int pot1=A1; int p0t2=A2; // a step wave between pins 6 and 7 (−5 to +5V) with a frequency of 50Hz int PinP = 6; // int PinN = 7; // int counter=0; void setup( ) { //controling 1st pump pinMode(EnA, OUTPUT); pinMode(in1, OUTPUT); pinMode(in2, OUTPUT); //controling 2nd pump pinMode(EnB, OUTPUT); pinMode(in3, OUTPUT); pinMode(in4, OUTPUT); pinMode(pot1, INPUT); pinMode(pot2, INPUT); //defining outputs for the Sin wave pinMode(PinP1, OUTPUT); pinMode(PinN1, OUTPUT); pinMode(PinP2, OUTPUT); pinMode(PinN2, OUTPUT); } void loop( ) { //reading the potentiometer and defining the speed of 1st peristaltic pump potValue1 = analogRead(pot1); // Read potentiometer value pwmOutput1 = map(potValue1, 0, 1023, 0 , 255); // Map the potentiometer value from 0 to 255 analogWrite(EnA, pwmOutput1); // Send PWM signal to L298N Enable pin digitalWrite(in1, LOW); digitalWrite(in2, HIGH); potValue2 = analogRead(pot2); // Read potentiometer value pwmOutput2 = map(potValue2, 0, 1023, 0 , 255); // Map the potentiometer value from 0 to 255 analogWrite(EnB, pwmOutput2); // Send PWM signal to L298N Enable pin digitalWrite(in3, LOW); digitalWrite(in4, HIGH); //creating AC signal switcher( ); } void switcher( ){ counter=counter+1; if (counter%2==0){ digitalWrite(PinP, HIGH); digitalWrite(PinN,LOW); delay (10); }else{ digitalWrite(PinN, HIGH); digitalWrite(PinP,LOW); delay (10); } }
FULL CITATIONS FOR DOCUMENTS REFERRED TO IN THE APPLICATION
[0170] 1. McGuigan, A. P., et al., Cell Encapsulation in Sub-mm Sized Gel Modules Using Replica Molding. PloS one, 2008. 3(7). [0171] 2. Legant, W. R., et al., Microfabricated tissue gauges to measure and manipulateforcesfrom 3D microtissues. Proc Natl Acad Sci USA, 2009. 106(25): p. 10097-102. [0172] 3. Sakar, M. S., et al., Cellular forces and matrix assembly coordinate fibrous tissue repair. Nature Communications, 2016. 7: p. 11036. [0173] 4. Turnbull, I. C., et al., Advancing functional engineered cardiac tissues toward a preclinical model ofhuman myocardium. FASEB J, 2014. 28(2): p. 644-54. [0174] 5. Osaki, T., S. G. M. Uzel, and R. D. Kamm, Microphysiological 3D model of amyotrophic lateral sclerosis (ALS) from human iPS-derived muscle cells and optogenetic motor neurons. Sci Adv, 2018. 4(10): p. eaat5847.