Mutagenesis method using polyethylene glycol mediated introduction of mutagenic nucleobases into plant protoplasts
11008579 · 2021-05-18
Assignee
Inventors
- Paul Bundock (Amsterdam, NL)
- Michiel Theodoor Jan De Both (Wageningen, NL)
- Frank LHUISSIER (Wageningen, NL)
Cpc classification
C12N15/8206
CHEMISTRY; METALLURGY
International classification
Abstract
Method for targeted alteration of a duplex acceptor DNA sequence in a plant cell protoplast, comprising combining the duplex acceptor DNA sequence with a donor mutagenic nucleobase, wherein the duplex acceptor DNA sequence contains a first DNA sequence and a second DNA sequence which is the complement of the first DNA sequence and wherein the donor mutagenic nucleobase comprises at least one mismatch with respect to the duplex acceptor DNA sequence to be altered, preferably with respect to the first DNA sequence, wherein the method further comprises a step of introducing the donor mutagenic nucleobase into the cell protoplasts using polyethylene glycol (PEG) mediated transformation and the use of PEG protoplast transformation for enhancing the rate of targeted mutagenesis.
Claims
1. A method for the production of a plant callus, plant shoot, or plant comprising an alteration in a genomic DNA sequence, wherein the method comprises the steps of: a) transforming plant cell protoplasts by treating the plant cell protoplasts with polyethylene glycol (PEG) and a donor single-stranded (ss) mutagenic nucleobase that comprises at least one mismatch with respect to the genomic DNA sequence to be altered, wherein the ss mutagenic nucleobase has a length of between 10-60 nucleotides; b) cultivating the treated protoplasts of step a); and c) regenerating the plant callus, plant shoot, or plant comprising the alteration in a genomic DNA sequence from the treated protoplasts, wherein the PEG transformation of step a) results in a significantly higher protoplast survival rate and targeted mutagenesis efficiency compared to electroporation and biolistics.
2. The method according to claim 1, wherein the ss mutagenic nucleobase comprises Locked Nucleic Acid (LNA) substitutions that are at least one nucleotide removed from the mismatch.
3. The method according to claim 2, wherein the ss mutagenic nucleobase comprises two LNAs located at least one nucleotide removed from either side of the mismatch.
4. The method according to claim 2, wherein the LNA substitutions are at least 3 nucleotides removed from the 5′ and 3′ ends of the ss mutagenic nucleobase.
5. The method according to claim 2, wherein the LNA substitutions are at least 4 nucleotides removed from the 5′ and 3′ ends of the ss mutagenic nucleobase.
6. The method according to claim 2, wherein the LNA substitutions are at least 5 nucleotides removed from the 5′ and 3′ ends of the ss mutagenic nucleobase.
7. The method according to claim 1, wherein the ss mutagenic nucleobase comprises propyne substitutions.
8. The method according to claim 1, wherein the ss mutagenic nucleobase is conjugated to a nuclear localization signal.
9. The method according to claim 1, wherein the donor ss mutagenic nucleobase comprises one mismatch with respect to the genomic DNA sequence to be altered.
10. The method according to claim 1, wherein the survival efficiency of the plant cell protoplast is greater than 90%.
Description
EXAMPLES
(1) Comparison of Targeted Mutagenesis Frequencies Using Either PEG Mediated Transformation or Electroporation
(2) Protoplast Isolation
(3) In vitro shoot cultures of Nicotiana tabacum cv Petit Havana line SR1 are maintained on MS20 medium with 0.8% Difco agar in high glass jars at 16/8 h photoperiod of 2000 lux at 25° C. and 60-70% RH. MS20 medium is basic Murashige and Skoog's medium (Murashige, T. and Skoog, F., Physiologia Plantarum, 15: 473-497, 1962) containing 2% (w/v) sucrose, no added hormones and 0.8% Difco agar. Fully expanded leaves of 3-6 week old shoot cultures are harvested. The leaves are sliced into 1 mm thin strips, which are then transferred to large (100 mm×100 mm) Petri dishes containing 45 ml MDE basal medium for a preplasmolysis treatment of 30 min. MDE basal medium contained 0.25 g KCl, 1.0 g MgSO.sub.4.7H.sub.2O, 0.136 g of KH.sub.2PO.sub.4, 2.5 g polyvinylpyrrolidone (MW 10,000), 6 mg naphthalene acetic acid and 2 mg 6-benzylaminopurine in a total volume of 900 ml. The osmolality of the solution is adjusted to 600 mOsm.Math.kg.sup.−1 with sorbitol, the pH to 5.7. 5 mL of enzyme stock SR1 are then added. The enzyme stock consists of 750 mg Cellulase Onozuka R10, 500 mg driselase and 250 mg macerozyme R10 per 100 ml, filtered over Whatman paper and filter-sterilized. Digestion is allowed to proceed overnight in the dark at 25° C. The digested leaves are filtered through 50 μm nylon sieves into a sterile beaker. An equal volume of cold KCl wash medium is used to wash the sieve and pooled with the protoplast suspension. KCl wash medium consisted of 2.0 g CaCl.sub.2.2H.sub.2O per liter and a sufficient quantity of KCl to bring the osmolality to 540 mOsm.Math.kg.sup.−1. The suspension is transferred to 10 mL tubes and protoplasts are pelleted for 10 min at 85×g at 4° C. The supernatant is discarded and the protoplast pellets carefully resuspended into 5 mL cold MLm wash medium, which is the macro-nutrients of MS medium (Murashige, T. and Skoog, F., Physiologia Plantarum, 15: 473-497, 1962) at half the normal concentration, 2.2 g of CaCl.sub.2.2H.sub.2O per liter and a quantity of mannitol to bring the osmolality to 540 mOsm.Math.kg.sup.−1. The content of 2 tubes is combined and centrifuged for 10 min at 85×g at 4° C. The supernatant is discarded and the protoplast pellets carefully resuspended into 5 mL cold MLs wash medium which is MLm medium with mannitol replaced by sucrose.
(4) The content of 2 tubes is pooled and 1 mL of KCl wash medium added above the sucrose solution care being taken not to disturb the lower phase. Protoplasts are centrifuged for 10 min at 85×g at 4° C. The interphase between the sucrose and the KCl solutions containing the live protoplasts is carefully collected. An equal volume of KCl wash medium is added and carefully mixed. The protoplast density is measured with a haemocytometer.
(5) PEG Transformation
(6) The protoplast suspension is centrifuged at 85×g for 10 minutes at 5° C. The supernatant is discarded and the protoplast pellet resuspended to a final concentration of 10.sup.6.ml.sup.−1 in KCl wash medium. In a 10 mL tube, 250 μL of protoplast suspension, 1.6 nmoles of ss mutagenic nucleobase and 250 μl of PEG solution are gently but thoroughly mixed. After 20 min. incubation at room temperature, 5 mL cold 0.275 M Ca(NO.sub.3).sub.2 are added dropwise. The protoplast suspension is centrifuged for 10 min at 85×g at 4° C. The supernatant is discarded and the protoplast pellet carefully resuspended in 1.25 mL T.sub.0 culture medium supplemented with 50 μg.Math.mL.sup.−1 cefotaxime and 50 μg.Math.mL.sup.−1 vancomycin. ss mutagenic nucleobase culture medium contained (per liter, pH 5.7) 950 mg KNO.sub.3, 825 mg NH.sub.4NO.sub.3, 220 mg CaCl.sub.2.2H.sub.2O, 185 mg MgSO.sub.4.7H.sub.2O, 85 mg KH.sub.2PO.sub.4, 27.85 mg FeSO.sub.4.7H.sub.2O, 37.25 mg Na.sub.2EDTA.2H.sub.2O, the micro-nutrients according to Heller's medium (Heller, R., Ann Sci Nat Bot Biol Veg 14: 1-223, 1953), vitamins according to Morel and Wetmore's medium (Morel, G. and R. H. Wetmore, Amer. J. Bot. 38: 138-40, 1951), 2% (w/v) sucrose, 3 mg naphthalene acetic acid, 1 mg 6-benzylaminopurine and a quantity of mannitol to bring the osmolality to 540 mOsm.Math.kg.sup.−1.
(7) The suspension is transferred to a 35 mm Petri dish. An equal volume of T.sub.0 agarose medium is added and gently mixed. Samples are incubated at 25° C. in the dark and further cultivated as described below.
(8) Electroporation
(9) The protoplasts are centrifuged at 85×g for 10 minutes at 5° C. The supernatant is discarded and the pellet resuspended in ice-cold electroporation buffer consisting of 10 mM HEPES, 80 mM NaCl, 0.04 mM CaCl.sub.2, 0.4M mannitol, pH 5.7 adjusted to 540 mOsm.Math.Kg.sup.−1 with mannitol to a final concentration of 10.sup.6 mL.sup.−1. Protoplasts are kept on ice throughout the entire procedure. To a 0.4 cm wide electroporation cuvette, 4.5 nmoles ss mutagenic nucleobase and 700 μL of protoplast suspension are added. A single exponential decay pulse is delivered to the cell suspension using a Biorad GenePulser XCell electroporation system equipped with a PC and CE module according to the following parameters:
(10) TABLE-US-00001 Field strength 500 V .Math. cm−1 Capacitance 950 μF
(11) Under these conditions, the sample resistance is approximately 30 ohms and the resulting time constant approximately 30 ms. These parameters were selected as the parameters giving the highest level of transient expression of GFP in tobacco protoplasts, 24 hrs after electroporation. After pulsing, protoplasts are allowed to recover in the cuvette at room temperature for 30 min. The protoplasts are then recovered in 1 mL T.sub.0 culture medium and transferred to a 10 mL tube. The cuvette is washed with an additional 5 mL T.sub.0 culture medium which is pooled with the protoplast suspension. After thorough but gentle mixing, 50 μg.Math.mL.sup.−1 cefotaxime and 50 μg.Math.mL.sup.−1 vancomycin are added, and 1.25 mL of the protoplast suspension is transferred to a 35 mm Petri dish. An equal volume of T.sub.0 agarose medium is added and the mixture is gently homogenized. Samples are incubated at 25° C. in the dark and further cultivated as described below.
(12) Protoplast Cultivation
(13) After 10 days of cultivation, the agarose slab is cut into 6 equal parts and transferred to a Petri dish containing 22.5 mL MAP1AO medium supplemented with 20 nM chlorsulfuron. This medium consisted of (per liter, pH 5.7) 950 mg KNO.sub.3, 825 mg NH.sub.4NO.sub.3, 220 mg CaCl.sub.2.2H.sub.2O, 185 mg MgSO.sub.4.7H.sub.2O, 85 mg KH.sub.2PO.sub.4, 27.85 mg FeSO.sub.4.7H.sub.2O, 37.25 mg Na.sub.2EDTA.2H.sub.2O, the micro-nutrients according to Murashige and Skoog's medium (Murashige, T. and Skoog, F., Physiologia Plantarum, 15: 473-497, 1962) at one tenth of the original concentration, vitamins according to Morel and Wetmore's medium (Morel, G. and R. H. Wetmore, Amer. J. Bot. 38: 138-40, 1951), 6 mg pyruvate, 12 mg each of malic acid, fumaric acid and citric acid, 3% (w/v) sucrose, 6% (w/v) mannitol, 0.03 mg naphthalene acetic acid and 0.1 mg 6-benzylaminopurine. Samples are incubated at 25° C. in low light for 6-8 weeks. Growing calli are then transferred to MAP1 medium and allowed to develop for another 2-3 weeks. MAP.sub.1 medium has the same composition as MAP.sub.1AO medium, with however 3% (w/v) mannitol instead of 6%, and 46.2 mg.Math.l.sup.−1 histidine (pH 5.7). It was solidified with 0.8% (w/v) Difco agar. Calli are then transferred to RP medium using sterile forceps. RP medium consisted of (per liter, pH 5.7) 273 mg KNO.sub.3, 416 mg Ca(NO.sub.3).sub.2.4H.sub.2O, 392 mg Mg(NO.sub.3).sub.2.6H.sub.2O, 57 mg MgSO.sub.4.7H.sub.2O, 233 mg (NH.sub.4).sub.2SO.sub.4, 271 mg KH.sub.2PO.sub.4, 27.85 mg FeSO.sub.4.7H.sub.2O, 37.25 mg Na.sub.2EDTA.2H.sub.2O, the micro-nutrients according to Murashige and Skoog's medium at one fifth of the published concentration, vitamins according to Morel and Wetmore's medium (Morel, G. and R. H. Wetmore, Amer. J. Bot. 38: 138-40, 1951), 0.05% (w/v) sucrose, 1.8% (w/v) mannitol, 0.25 mg zeatin and 41 nM chlorsulfuron, and is solidified with 0.8% (w/v) Difco agar. Mature shoots are transferred to rooting medium after 2-3 weeks.
(14) Ss Mutagenic Nucleobases
(15) All ss mutagenic nucleobase were synthesized by Eurogentec (Seraing, Belgium), purified by reverse phase HPLC and resuspended into sterile milliQ water. Prior to use, ss mutagenic nucleobase were heated up to 95° C. for 5 min. ss mutagenic nucleobase 06Q262 was designed to introduce a single mismatch (nucleotide underlined) in the tobacco ALS gene (accession number X07644) at codon position P194 which would result in a CCA to CAA (P194Q) conversion. The 06Q261 ss mutagenic nucleobase is the exact match to the tobacco ALS gene sequence and serves as negative control. The 06Q263 ss mutagenic nucleobase consists of a random combination of 40 nucleotides and serves as negative control.
(16) TABLE-US-00002 [SEQ ID 1] 06Q261 5′ TCAGTACCTATCATCCTACGTTGCACTTGACCTGTTATAG [SEQ ID 2] 06Q262 5′ TCAGTACCTATCATCCTACGTTGCACTTGACCTGTTATAG [SEQ ID 3] 06Q263 5′ ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
(17) Protoplast Survival Per Treatment
(18) Protoplast survival after both PEG transformation and electroporation is assessed by esterase activity using the fluorescent vital dye fluorescein diacetate (FDA), 24 hrs after transformation. Two μL of a 5 mg.Math.mL.sup.−1 stock FDA in acetone are added to 1 mL of transformed protoplasts. The proportion of fluorescing protoplasts in the entire population is counted with a haemocytometer. Observations are carried out with a Nikon Eclipse E600 upright epifluorescence microscope equipped with a GFP LP (EX480/40, DM505, BA510) filter set. Excitation is provided by a 100 W super high pressure mercury lamp. Images are acquired using a DS-2MBWc CCD camera connected to a DS-U1 controller attached to a PC running the NIS Element image acquisition/analysis software.
(19) Results
(20) A summary of the transformation results using both PEG transformation and electroporation is presented in table 1. Using PEG transformation the protoplast survival rate is significantly higher compared to electroporation. The nature of electroporation itself is more detrimental to protoplasts survival than PEG transformation, resulting in a much higher recovery/survival rate as well as a higher targeted mutagenesis efficiency. The targeted mutagenesis efficiency is scored after incubation of the protoplasts in the presence of chlorsulfuron.
(21) TABLE-US-00003 TABLE 1 Comparison of PEG transformation and electroporation with respect to protoplast survival rates. Mutagenic PEG treatment Electroporation nucleobase Survival** (%) Survival** (%) 06Q261 83.5 ± 1.8 65.9 ± 2.2 06Q262 82.6 ± 2.1 66.3 ± 2.6 06Q263 83.8 ± 2.6 64.7 ± 3.1 *expressed as the percentage of fluorescing protoplasts after FDA staining in the recovered population of protoplasts. Results are the average of 3 independent replicates ± SD.
(22) PCR Amplification of ALS and Sequencing
(23) DNA is isolated from chlorsulfuron resistant tobacco microcolonies using the DNeasy kit (Qiagen), and used as a template in a PCR reaction. Conversions of the targeted codons in the tobacco ALS gene are detected using the primers 5′GGTCAAGTGCCACGTAGGAT [SEQ ID 4] & 5′GGGTGCTTCACTTTCTGCTC [SEQ ID 5] that amplify a 776 bp fragment of this gene, including codon 194. Nucleotide conversion in the herbicide resistant tobacco callus is confirmed by cloning the PCR products into pCR2.1::TOPO (Invitrogen) and sequencing individual plasmids. Tobacco contains 2 alleles of ALS (SurA and SurB). Nucleotide conversion at the P194 codon of either of these loci is sufficient to confer resistance to chlorsulfuron. As tobacco is an allotetraploid species, there are eight possible targets in tobacco at which TNE may have occurred. In line with this, it was necessary to sequence >10 plasmid clones containing the PCR product to detect one with a CCA to CAA conversion. This suggests that in each resistant callus only 1 out of the 8 ALS alleles had undergone a targeted mutagenesis mediated nucleotide conversion. For all the calli produced in this study, we observed the expected CCA to CAA nucleotide conversion.