ANTI-TUMOR COMPOSITION COMPRISING GM-CSF GENE, Flt3L-TRAIL FUSION GENE, shRNA INHIBITING TGF-ß EXPRESSION, AND shRNA INHIBITING HSP EXPRESSION
20210154329 · 2021-05-27
Assignee
Inventors
- Jae Jin SONG (Seoul, KR)
- Zhe Zhu Han (Seoul, KR)
- Dong Xu Kang (Seoul, KR)
- Rong Xu (Seoul, KR)
- Hye Jin CHOI (Seoul, KR)
Cpc classification
A61K31/7105
HUMAN NECESSITIES
C07K14/535
CHEMISTRY; METALLURGY
A61K48/0066
HUMAN NECESSITIES
A61K48/00
HUMAN NECESSITIES
C12N15/113
CHEMISTRY; METALLURGY
International classification
A61K48/00
HUMAN NECESSITIES
A61K31/7105
HUMAN NECESSITIES
A61K39/00
HUMAN NECESSITIES
A61P35/00
HUMAN NECESSITIES
C07K14/535
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
Abstract
The present invention relates to an anti-tumor composition which includes a GM-CSF gene; an Flt3L-TRAIL fusion gene; shRNA inhibiting TGF-β expression; and shRNA inhibiting HSP expression.
Claims
1. A method for treating a tumor, comprising: administering a therapeutically effective amount of a gene delivery system which comprises a GM-CSF gene; a Flt3L-TRAIL fusion gene; shRNA inhibiting TGF-β expression (shTGF-β) and shRNA inhibiting HSP expression (shHSP) to coexpress GM-CSF, Flt3L-TRAIL, shTGF-β and shHSP.
2. The method of claim 1, wherein the GM-CSF gene has base sequences set forth in SEQ ID NO: 1 or SEQ ID NO: 2.
3. The method of claim 1, wherein the Flt3L-TRAIL fusion gene has base sequences set forth in SEQ ID NO: 3.
4. The method of claim 1, wherein the shTGF-β is shTGF-β1 or shTGF-β32.
5. The method of claim 4, wherein the shTGF-β1 has base sequences set forth in SEQ ID NO: 4 or SEQ ID NO: 5.
6. The method of claim 4, wherein the shTGF-β32 has base sequences set forth in SEQ ID NO: 6 or SEQ ID NO: 7.
7. The method of claim 1, wherein the shHSP is shHSP25 or shHSP27.
8. The method of claim 7, wherein the shHSP25 has base sequences set forth in SEQ ID NO: 8.
9. The method of claim 7, wherein the shHSP27 has base sequences set forth in SEQ ID NO: 9.
Description
BRIEF DESCRIPTION OF THE SEVERAL VIEWS OF THE DRAWINGS
[0017] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawings will be provided by the Office upon request and payment of the necessary fee.
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
[0062]
[0063]
[0064]
[0065]
[0066]
[0067]
[0068]
[0069]
[0070]
[0071]
[0072]
[0073]
[0074]
[0075]
[0076]
[0077]
[0078]
[0079]
[0080]
[0081]
[0082]
[0083]
[0084]
[0085]
[0086]
[0087]
[0088]
[0089]
[0090]
[0091]
[0092]
[0093]
[0094]
[0095]
[0096]
[0097]
[0098]
[0099]
[0100]
[0101]
[0102]
[0103]
[0104]
[0105]
[0106]
[0107]
[0108]
[0109]
[0110]
[0111]
[0112]
DESCRIPTION OF SPECIFIC EMBODIMENTS OF THE INVENTION
[0113] The present invention relates to a gene delivery system for coexpressing hTGF-β and shHSP (hereinafter, a two-type gene delivery system), which includes shRNA inhibiting TGF-β expression (shTGF-β) and shRNA inhibiting HSP expression (shHSP).
[0114] In addition, the present invention relates to a gene delivery system for coexpressing GM-CSF, Flt3L-TRAIL, shTGF-β and shHSP (hereinafter, a four-type gene delivery system), which includes a GM-CSF gene, a Flt3L-TRAIL gene, shRNA inhibiting TGF-β expression (shTGF-β) and shRNA inhibiting HSP expression (shHSP).
[0115] When being introduced into target cells using a gene delivery system coexpressing shRNA inhibiting TGF-β expression (shTGF-β) and shRNA inhibiting HSP expression (shHSP), compared to when each gene is expressed or even when GM-CSF and Flt3L-TRAIL are expressed, it was confirmed that an antitumor effect is further improved.
[0116] When being introduced into target cells using a gene delivery system for coexpressing a GM-CSF gene, a Flt3L-TRAIL fusion gene, shTGF-β and shHSP, it was confirmed that an antitumor effect is superior to that when each gene is expressed, and particularly, when shTGF-β and shHSP are expressed.
[0117] Particularly, the inventors confirmed that a GM-CSF gene, a Flt3L-TRAIL fusion gene, shRNA inhibiting TGF-β expression (shTGF-β) and shRNA inhibiting HSP27 expression (shHSP27) are very closely related to apoptosis and survival factors and immunological factors, combined in a manner effectively regulating these factors to overcome barriers in current cancer treatment, for example, cross-talk between different signaling networks in a cell, cross-talk between tumor cells and immune cells and intratumor heterogeneity, resulting in very effective and ultimate regulation of cancer cells within a wide range of cancer types.
[0118] The term “GM-CSF” used herein includes all homologues of GM-CSF inducing an immune reinforcing response as well as GM-CSF exemplified in an example.
[0119] A murine GM-CSF gene was obtained from Dr. Gerald C. O′Sullivan (Cork Cancer Research Centre, Mercy University Hospital and Leslie C. Quick Jnr. Laboratory, University College Cork, Cork, Ireland), and a base sequence is the same as disclosed in Cancer Gene Therapy (2006) 13, 1061-10710, and represented by SEQ ID NO: 1.
TABLE-US-00001 [SEQ ID NO: 1] atgtacagga tgcaactcct gtcttgcatt gcactaagtc ttgcacttgt cacgaattcg 60 cccacccgct cacccatcac tgtcacccgg ccttggaagc atgtagaggc catcaaagaa 120 gccctgaacc tcctggatga catgcctgtc acgttgaatg aagaggtaga agtcgtctct 180 aacgagttct ccttcaagaa gctaacatgt gtgcagaccc gcctgaagat attcgagcag 240 ggtctacggg gcaatttcac caaactcaag ggcgccttga acatgacagc cagctactac 300 cagacatact gccccccaac tccggaaacg gactgtgaaa cacaagttac cacctatgcg 360 gatttcatag acagccttaa aacctttctg actgatatcc cctttgaatg caaaaaacca 420 ggccaaaaat ga 432
[0120] A human GM-CSF gene was obtained from InvivoGen, its base sequence is the same as disclosed in Gene Bank M11220 and represented by SEQ ID NO: 2.
TABLE-US-00002 [SEQ ID NO: 2] atgtggctgc agagcctgct gctcttgggc actgtggcct gcagcatctc tgcacccgcc 60 cgctcgccca gccccagcac gcagccctgg gagcatgtga atgccatcca ggaggcccgg 120 cgtctcctga acctgagtag agacactgct gctgagatga atgaaacagt agaagtcatc 180 tcagaaatgt ttgacctcca ggagccgacc tgcctacaga cccgcctgga gctgtacaag 240 cagggcctgc ggggcagcct caccaagctc aagggcccct tgaccatgat ggccagccac 300 tacaagcagc actgccctcc aaccccggaa acttcctgtg caacccagat tatcaccttt 360 gaaagtttca aagagaacct gaaggacttt ctgcttgtca tcccctttga ctgctgggag 420 ccagtccagg agtga 435
[0121] A human Flt3L-TRAIL gene is prepared by fusing a gene encoding amino acids 1 to 181 of an FMS-like tyrosine kinase 3 ligand (Flt3L) and a gene encoding amino acids 95 to 281 of a tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) with a leucine zipper, and represented by SEQ ID NO: 3 as shown in Gene Bank U03858 (Flt3L) and Gene Bank B032722 or U57059 (TRAIL).
TABLE-US-00003 [SEQ ID NO: 3] atgacagtgc tggcgccagc ctggagccca acaacctatc tcctcctgct gctgctgctg 60 agctcgggac tcagtgggac ccaggactgc tccttccaac acagccccat ctcctccgac 120 ttcgctgtca aaatccgtga gctgtctgac tacctgcttc aagattaccc agtcaccgtg 180 gcctccaacc tgcaggacga ggagctctgc gggggcctct ggcggctggt cctggcacag 240 cgctggatgg agcggctcaa gactgtcgct gggtccaaga tgcaaggctt gctggagcgc 300 gtgaacacgg agatacactt tgtcaccaaa tgtgcctttc agcccccccc cagctgtctt 360 cgcttcgtcc agaccaacat ctcccgcctc ctgcaggaga cctccgagca gctggtggcg 420 ctgaagccct ggatcactcg ccagaacttc tcccggtgcc tggagctgca gtgtcagccc 480 gactcctcaa ccctgccacc cccatggagt ccccggcccc tggaggccac agccccgaca 540 gccccggcta gcagaatgaa gcagatcgag gacaaaattg aggaaatcct gtccaaaatt 600 taccacatcg agaacgagat cgcccggatt aagaaactca ttggcgagag ggaattcacc 660 tctgaggaaa ccatttctac agttcaagaa aagcaacaaa atatttctcc cctagtgaga 720 gaaagaggtc ctcagagagt agcagctcac ataactggga ccagaggaag aagcaacaca 780 ttgtcttctc caaactccaa gaatgaaaag gctctgggcc gcaaaataaa ctcctgggaa 840 tcatcaagga gtgggcattc attcctgagc aacttgcact tgaggaatgg tgaactggtc 900 atccatgaaa aagggtttta ctacatctat tcccaaacat actttcgatt tcaggaggaa 960 ataaaagaaa acacaaagaa cgacaaacaa atggtccaat atatttacaa atacacaagt 1020 tatcctgacc ctatattgtt gatgaaaagt gctagaaata gttgttggtc taaagatgca 1080 gaatatggac tctattccat ctatcaaggg ggaatatttg agcttaagga aaatgacaga 1140 atttttgttt ctgtaacaaa tgagcacttg atagacatgg accatgaagc cagttttttc 1200 ggggcctttt tagttggcta a 1221
[0122] In the case of the Flt3L-TRAIL fusion gene, since such a human-type gene has an activity even in a mouse, the human Flt3L-TRAIL fusion gene was used without separately manufacturing a mouse Flt3L-TRAIL fusion gene.
[0123] The term “shRNA inhibiting TGF-β expression (shTGF-β)” used herein refers to shRNA inhibiting TGF-β1 expression (shTGF-β1) or shRNA inhibiting TGF-β2 expression (shTGF-β2).
[0124] The “shRNA inhibiting TGF-β1 expression (shTGF-β1)” was disclosed in Korean Unexamined Patent Application No. 2013-0012095 (the sequence disclosed in Korean Unexamined Patent Application No. 2013-0012095 is represented by an RNA sequence. If the shTGF-β1 is represented as DNA, since U of the RNA sequence is substituted with T, the shTGF-β1 represented by an RNA sequence is the same as that represented by a DNA sequence). In the case of murine shRNA, shTGF-β1 is represented by SEQ ID NO: 4, and in the case of human shRNA, shTGF-β1 is represented by SEQ ID NO: 5.
TABLE-US-00004 [SEQ ID NO: 4] ccctctacaa ccaacacaac ccgggtctcc ccgggttgtg ttggttgtag aggg 54 [SEQ ID NO: 5] accagaaata cagcaacaat tcctguctct ccaggaattg ttgctggtat ttctggttt 59
[0125] The “shRNA inhibiting TGF-β2 expression (shTGF-β2)” is disclosed in Korean Unexamined Patent Application No. 2013-0088792. In the case of murine shRNA, the shTGF-β2 is represented by SEQ ID NO: 6, and in the case of human shRNA, the shTGF-β2 is represented by SEQ ID NO: 7 (when the shTGF-β2 is represented as RNA, T of the DNA sequence is substituted with U).
TABLE-US-00005 [SEQ ID NO: 6] ggattgaact gtatcagatc cttaatctct taaggatctg atacagttca atcc 54 [SEQ ID NO: 7] ggattgagct atatcagatt ctcaatctct tgagaatctg atatagctca atcc 54
[0126] The term “shRNA inhibiting HSP expression (shHSP)” used herein may include shHSP25 corresponding to murine shRNA or shHSP27 corresponding to human shRNA, in which the shHSP25 is represented by SEQ ID NO: 8, and the shHSP27 is disclosed in Korean Unexamined Patent Application No. 2013-0123244 and represented by SEQ ID NO: 9 (when the hHSP is represented as RNA, T of the DNA sequence is substituted with U).
TABLE-US-00006 [SEQ ID NO: 8] gctac atctc tcggt gcttc a tctc t gaagc accga gagat gtagc [SEQ ID NO: 9] gatccgacga gcatggctac atctcccggt tctcaccggg agatgtagcc atgctcgtct
[0127] To prepare a gene delivery system of the present invention, shTGF-β and shHSP; or a GM-CSF gene; an Flt3L-TRAIL fusion gene, shTGF-β and shHSP may be present in a suitable expression construct. In the expression construct, the genes may be operably linked to a promoter. The term “operatively linked” used herein refers to functional binding between a gene expression regulatory sequence (e.g., a promoter, a signal sequence, or an array of transcription regulatory factor-binding sites) and a different nucleic acid sequence, and therefore, the regulatory sequence regulates the transcription and/or translation of the other nucleic acid sequence. In the present invention, a promoter binding to the target genes of the present invention is preferably functional in an animal cell, and more preferably in a mammalian cell to regulate the transcription of a decorin gene, and includes a promoter derived from a mammalian virus and a promoter derived from the genome of a mammalian cell, for example, a cytomegalo virus (CMV) promoter, an adenovirus late promoter, a vaccinia virus 7.5K promoter, a SV40 promoter, a HSV tk promoter, a RSV promoter, an EF1 alpha promoter, a metallothionein promoter, a β-actin promoter, a human IL-2 gene promoter, a human IFN gene promoter, a human IL-4 gene promoter, a human lymphotoxin gene promoter and a human GM-CSF gene promoter, but the present invention is not limited thereto.
[0128] Preferably, the expression construct used in the present invention includes a polyadenylation sequence (e.g., a bovine growth hormone terminator and a SV40-derived polyadenylation sequence).
[0129] The gene delivery system of the present invention may be constructed in various forms, for example, (i) a naked recombinant DNA molecule, (ii) a plasmid, (iii) a viral vector, and (iv) a liposome or niosome containing the naked recombinant DNA molecule or plasmid.
[0130] A GM-CSF gene; an Flt3L-TRAIL fusion gene, shTGF-β (shTGF-β1 or shTGF-β2) and/or shHSP may be applied to all gene delivery systems which are used in conventional gene treatment, and preferably, to a plasmid, an adenovirus (Lockett L J, et al., Clin. Cancer Res. 3:2075-2080(1997)), an adeno-associated virus (AAV, Lashford L S., et al., Gene Therapy Technologies, Applications and Regulations Ed. A. Meager, 1999), a retrovirus (Gunzburg W H, et al., Retroviral vectors. Gene Therapy Technologies, Applications and Regulations Ed. A. Meager, 1999), a lentivirus (Wang G. et al., J. Clin. Invest. 104(11):R55-62(1999)), a herpes simplex virus (Chamber R., et al., Proc. Natl. Acad. Sci USA 92:1411-1415(1995)), a vaccinia virus (Puhlmann M. et al., Human Gene Therapy 10:649-657(1999)), a liposome (Methods in Molecular Biology, Vol 199, S.C. Basu and M. Basu (Eds.), Human Press 2002) or a niosome. Most preferably, the gene delivery system of the present invention is constructed by applying a GM-CSF gene; an Flt3L-TRAIL fusion gene; shTGF-β; and/or shHSP to an adenovirus.
[0131] i. Adenovirus
[0132] An adenovirus has been widely used as a gene delivery vector due to a medium-sized genome, easy manipulation, a high titer, a wide range of target cells and excellent infectibility. Both ends of the genome include an inverted terminal repeat (ITR) of 100 to 200 bp, which is a cis element essential for DNA replication and packaging. The E1 regions (E1A and E1B) of the genome encode proteins regulating transcription and the transcription of a host cell gene. The E2 regions (E2A and E2B) encode proteins involved in viral DNA replication. Among currently-developed adenovirus vectors, E1 region-deleted replication-deficient adenoviruses are widely used. However, the E3 region is removed from a conventional adenovirus vector to provide a foreign gene insertion site (Thimmappaya, B. et al., Cell, 31:543-551(1982); and Riordan, J. R. et al., Science, 245:1066-1073(1989)).
[0133] Therefore, shTGF-β (shTGF-β1 or shTGF-β2) and shHSP; or a GM-CSF gene, an Flt3L-TRAIL fusion gene, shTGF-β (shTGF-β1 or shTGF-β2) and shHSP according to the present invention may be inserted into the deleted E1 regions (the E1A region and/or the E1B region, and preferably the E1B region) or E3 region. In the specification, the term “deletion” used in terms of a viral genome sequence includes partial deletion of the corresponding sequence, as well as complete deletion of the corresponding sequence.
[0134] In addition, since the adenovirus may package approximately 105% of a wild-type genome, approximately 2 kb of genetic information may be additionally packaged (Ghosh-Choudhury et al., EMBO J., 6:1733-1739(1987)). Therefore, the above-mentioned foreign sequence inserted into the adenovirus may be additionally bound to the adenovirus genome. Adenoviruses have 42 different serotypes and A to F subgroups. Among these, adenovirus type 5 included in subgroup C is the most suitable starting material to obtain an adenovirus vector of the present invention. Biochemical and genetic information on the adenovirus type 5 is well known. The foreign gene delivered by the adenovirus is replicated in the same manner as an episome and has very low genetic toxicity with respect to a host cell. Accordingly, a gene therapy using the adenovirus gene delivery system of the present invention is considered to be very safe.
[0135] ii. Retrovirus
[0136] A retrovirus is widely used as a gene delivery vector because it inserts its own genes into a host genome, being capable of delivering a great amount of foreign genetic substances, and having a wide spectrum of cells that can be infected.
[0137] To construct a retroviral vector, a replication-deficient virus is produced by inserting a target nucleotide sequence to be delivered, instead of a retrovirus sequence, into a retroviral genome. To produce a virion, a packaging cell line which includes gag, pol and env genes, but not including a long terminal repeat (LTR) and a Ψ sequence, is constructed (Mann et al., Cell, 33:153-159(1983)). When a recombinant plasmid including a target nucleotide sequence to be delivered, an LTR and a Ψ sequence is introduced into the cell line, the Ψ sequence facilitates production of an RNA transcript of the recombinant plasmid. This transcript is packaged into a virus, and the virus is released into a medium (Nicolas Flt3L-TRAIL fusion and Rubinstein “retroviral vectors,” In: Vectors: A survey of molecular cloning vectors and their uses, Rodriguez and Denhardt(eds.), Stoneham: Butterworth, 494-513(1988)). The medium containing the recombinant retroviruses is collected and concentrated, and thus the recombinant retroviruses are used as a gene delivery system.
[0138] Gene delivery using a second generation retroviral vector was reported. According to Kasahara et al. (Science, 266:1373-1376 (1994)), a chimeric protein having a new binding characteristic was produced by preparing a Moloney murine leukemia virus (MMLV) mutant and inserting an erythropoietin (EPO) sequence into an envelope site. The gene delivery system of the present invention may also be prepared according to a strategy of constructing such a second generation retroviral vector.
[0139] iii. AAV Vector
[0140] An adeno-associated virus (AAV) can infect non-dividing cells and has an ability to infect various types of cells, and thus is suitable as a gene delivery system of the present invention. Detailed descriptions on the construction and use of an AAV vector are disclosed in U.S. Pat. Nos. 5,139,941 and 4,797,368.
[0141] As a gene delivery system, a study on AAVs is disclosed in LaFace et al, Virology, 162:483486(1988), Zhou et al., Exp. Hematol. (NY), 21:928-933(1993), Walsh et al, J. Clin. Invest., 94:1440-1448(1994) and Flotte et al., Gene Therapy, 2:29-37(1995). Recently, an AAV vector has been implemented in a phase I clinical trial as a therapeutic agent for cystic fibrosis.
[0142] Typically, an AAV virus is prepared by simultaneously transforming a plasmid including a target gene sequence located beside two AAV terminal repeats (McLaughlin et al., J. Virol., 62:1963-1973(1988); Samulski et al., J. Virol., 63:3822-3828(1989)) and an expression plasmid (McCarty et al., J. Virol., 65:2936-2945 (1991)) including a wild type AAV coding sequence without a terminal repeat.
[0143] iv. Other Viral Vectors
[0144] Other viral vectors may also be used as the gene delivery system of the present invention. Vectors derived from vaccinia viruses (Puhlmann M. et al., Human Gene Therapy 10:649-657(1999); Ridgeway, “Mammalian expression vectors,” In: Vectors: A survey of molecular cloning vectors and their uses. Rodriguez and Denhardt, eds. Stoneham: Butterworth, 467-492(1988); Baichwal and Sugden, “Vectors for gene transfer derived from animal DNA viruses: Transient and stable expression of transferred genes,” In: Kucherlapati R, ed. Gene transfer. New York: Plenum Press, 117-148 (1986) and Coupar et al., Gene, 68:1-10(1988)), lentiviruses (Wang G. et al., J. Clin. Invest. 104(11):R55-62(1999)) or herpes simplex viruses (Chamber R., et al., Proc. Natl. Acad. Sci USA 92:1411-1415(1995)) may also be used as a delivery system capable of delivering a target nucleotide sequence to be delivered into a cell.
[0145] v. Liposome
[0146] Liposomes are automatically formed by phospholipids dispersed in an aqueous phase. Examples of successful delivery of a foreign DNA molecule into cells by a liposome are disclosed in Nicolau and Sene, Biochim. Biophys. Acta, 721:185-190(1982) and Nicolau et al., Methods Enzymol., 149:157-176(1987). Meanwhile, as a reagent that is most widely used in transformation of animal cells using a liposome, there is Lipofectamine (Gibco BRL). Liposomes containing a target nucleotide sequence to be delivered interact with cells through a mechanism such as endocytosis, adsorption to a cell surface or fusion with a plasma cell membrane to deliver a target nucleotide sequence to be delivered into the cells.
[0147] According to an exemplary embodiment of the present invention, the gene delivery system of the present invention is a recombinant adenovirus vector.
[0148] According to a more exemplary embodiment of the present invention, the recombinant adenovirus vector of the present invention does not have E1B and E3 regions, and the shTGF-β1 or shTGF-β2 is inserted into a site from which the E3 region is deleted, and the shHSP is inserted into a site from which the E3 region is deleted. In addition, in a four genes-introduced recombinant adenovirus vector, the GM-CSF encoding nucleotide and the Flt3L-TRAIL encoding nucleotide are inserted into the site from which the E1B region is deleted, and the shTGF-β1 or shTGF-β2 and shHSP are inserted into the site from which the E3 region is deleted.
[0149] The recombinant adenovirus including an active E1A gene may have replicable properties, and cell apoptosis potential may be enhanced when the E1B region is deleted. The “deletion” used in terms of viral genome sequence herein includes partial deletion of a corresponding sequence, as well as complete deletion of the corresponding sequence. The recombinant adenovirus of the present invention may include a non-mutated E1A gene or an active E1A gene which is mutated.
[0150] Most preferably, the recombinant adenovirus vector of the present invention includes shTGF-β1 or shTGF-β2 at the site from which the E3 region is deleted in a 5′ to 3′ direction, and shHSP27 at the site from which the E3 region is deleted in a 5′ to 3′ direction (
[0151] The recombinant adenovirus vector of the present invention, into which four types of genes are introduced, includes a GM-CSF gene, an internal ribosome entry site (IRES) and Flt3L-TRAIL at the site from which the E1 region is deleted in a 3′ to 5′ direction, and shTGF-β2, shHSP27 or shHSP27 and shTGF-β31 at the site from which the E3 region is deleted in a 5′ to 3′ direction (
[0152] In addition, the present invention provides an antitumor composition including a gene delivery system for expressing the shTGF-β and the shHSP; or a gene delivery system for expressing the GM-CSF, Flt3L-TRAIL, shTGF-β and shHSP.
[0153] The term “antitumor composition” used herein refers to a pharmaceutical composition to be used in tumor treatment.
[0154] Since the gene delivery system included in the antitumor composition of the present invention as an active ingredient is the same as the above-described gene delivery system of the present invention, the detailed description on the gene delivery system is also applied to the composition of the present invention. Therefore, in order to avoid excessive complexity due to unnecessary repetition in the specification, the common description will be omitted.
[0155] Since the recombinant adenovirus included in the composition of the present invention exhibits cytolytic efficacy against various tumor cells as described above, the pharmaceutical composition of the present invention may be used in treatment of tumor-related various diseases or disorders, for example, gastric cancer, lung cancer, breast cancer, ovarian cancer, liver cancer, bronchial cancer, nasopharyngeal cancer, laryngeal cancer, pancreatic cancer, bladder cancer, colon cancer, cervical cancer and melanoma. The term “treatment” used herein means (i) prevention of tumor cell formation; (ii) inhibition of tumor-related diseases or disorders according to removal of tumor cells; and (iii) alleviation of tumor-related diseases or disorders according to removal of tumor cells. Accordingly, the term “therapeutically effective amount” used herein refers to an amount sufficient for achieving a pharmaceutical effect.
[0156] A pharmaceutically acceptable carrier included in the composition of the present invention is conventionally used in formulation, and may be, but is not limited to, lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia gum, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate or mineral oil.
[0157] The pharmaceutical composition of the present invention may further include a lubricant, a wetting agent, a sweetening agent, a flavoring agent, an emulsifier, a suspension and a preservative in addition to the above-mentioned components.
[0158] The pharmaceutical composition of the present invention may be administered parenterally, for example, intravenously, intraperitoneally, intramuscularly, subcutaneously or locally. The pharmaceutical composition of the present invention may be administered intraperitoneally to treat ovarian cancer, and administered into a portal vein to treat liver cancer through injection, and may be directly injected into a tumor mass to treat breast cancer, directly injected through an enema to treat colon cancer, and directly injected into a catheter to treat bladder cancer.
[0159] A suitable dose of the pharmaceutical composition of the present invention may vary depending on factors such as a preparation method, an administration method, a patient's age, weight and sex, severity of disease symptoms, diet, administration time, an administration route, an excretion rate, and response sensitivity, and an effective dose for desired treatment may be easily determined and prescribed by an ordinarily skilled doctor. Generally, the pharmaceutical composition of the present invention includes 1×10.sup.5 to 1×10.sup.15 pfu/ml of recombinant adenoviruses, and is typically injected at, 1×10.sup.8 to 1×10.sup.13 pfu every two days for two weeks.
[0160] The pharmaceutical composition of the present invention may be prepared by unit-dose packaging or multi-dose packaging after being formulated using a pharmaceutically acceptable carrier and/or excipient according to a method that can be easily implemented by those of ordinary skill in the art. Here, a dosage form of the pharmaceutical composition of the present invention may be a solution in an oil or aqueous medium, a suspension or an emulsion, an extract, a powder, a granule, a tablet or a capsule, and the pharmaceutical composition of the present invention may further include a dispersant or a stabilizer.
[0161] The pharmaceutical composition of the present invention may be used independently or in combination with other conventional chemical or radiation therapies, and such combination therapy may be used more effectively in cancer treatment. Chemical therapeutics that can be used together with the composition of the present invention include gemcitabine, sorafenib, cisplatin, carboplatin, procarbazine, mechlorethamine, cyclophosphamide, ifosfamide, melphalan, chlorambucil, bisulfan, nitrosourea, dactinomycin, daunorubicin, doxorubicin, bleomycin, plicomycin, mitomycin, etoposide, tamoxifen, taxol, transplatinum, 5-fluorouracil, vincristin, vinblastin and methotrexate. Radiation therapies that can be used together with the composition of the present invention include X-ray radiation and γ-ray radiation.
[0162] According to another exemplary embodiment of the present invention, the composition of the present invention improves tumor apoptosis, immune activity and immunogenicity.
[0163] In addition, the present invention provides an antitumor composition including shRNA inhibiting TGF-β expression (shTGF-β) and shRNA inhibiting HSP expression (shHSP).
[0164] All descriptions regarding the antitumor composition may also be applied or applied mutatis mutandis to a gene community and/or antitumor composition of the present invention
[0165] Particularly, the composition of the present invention is prepared to coexpress shRNA inhibiting TGF-β expression (shTGF-β) and/or shRNA inhibiting HSP expression (shHSP) by introducing the shTGF-β and/or shHSP into one or more gene delivery systems.
[0166] In addition, the present invention provides an antitumor composition including a GM-CSF gene; an Flt3L-TRAIL gene, shRNA inhibiting TGF-β expression (shTGF-β) and shRNA inhibiting HSP expression (shHSP).
[0167] All descriptions regarding the antitumor composition may also be applied or applied mutatis mutandis to a gene community and/or antitumor composition of the present invention.
[0168] Particularly, the composition of the present invention is prepared to coexpress a GM-CSF gene; an Flt3L-TRAIL gene, shRNA inhibiting TGF-β expression (shTGF-β) and/or shRNA inhibiting HSP expression (shHSP) by introducing the GM-CSF gene; the Flt3L-TRAIL gene, shTGF-β and/or shHSP into one or more gene delivery systems.
[0169] In addition, the present invention provides an adenovirus into which the gene delivery system is introduced.
[0170] In the present invention, as a virus useful for transferring a nucleic acid molecule for RNAi (viral vector), there are an adenovirus, a retrovirus, a lentivirus and an AAV, and among these, an adenovirus is preferable because of the need for temporary induction of expression like in tumors.
[0171] In addition, the present invention includes a method for treating a tumor, which includes administering a therapeutically effective amount of gene delivery systems (2 or 4 types) including shRNA inhibiting TGF-β expression (shTGF-β) and shRNA inhibiting HSP expression (shHSP), or a GM-CSF gene; a Flt3L-TRAIL fusion gene; shRNA inhibiting TGF-β expression (shTGF-β) and shRNA inhibiting HSP expression (shHSP) to a subject.
[0172] In addition, the present invention includes a method for treating a tumor, which includes administering therapeutically effective amounts of shRNA inhibiting TGF-β expression (shTGF-β) and shRNA inhibiting HSP expression (shHSP) to a subject.
[0173] In addition, the present invention includes a method for treating a tumor, which includes administering therapeutically effective amounts of a GM-CSF gene; an Flt3L-TRAIL fusion gene; shRNA inhibiting TGF-β expression (shTGF-β) and shRNA inhibiting HSP expression (shHSP) to a subject.
[0174] All descriptions regarding the method for treating a tumor may also be applied or applied mutatis mutandis to a gene community and/or antitumor composition of the present invention.
[0175] The term “subject” used herein refers to a mammal which is a target for treatment, observation or experiment, and preferably a human.
[0176] The term “therapeutically effective amount” used herein is an amount of an active ingredient or pharmaceutical composition that induces a biological or medical response in a tissue system, animal or human that is considered by a researcher, a veterinarian, a doctor or other clinicians, and includes an amount for inducing the alleviation of symptoms of a disease or disorder to be treated. It will be apparent to those of ordinary skill in the art that the therapeutically effective amount and administration frequency of the active ingredient of the present invention will vary depending on a desired effect. Therefore, the optimal dosage to be administered may be easily determined by those of ordinary skill in the art, and the range of the optimal dosage varies depending on the type of a disease, the severity of a disease, the contents of an active ingredient and other ingredients, which are contained in the composition, the type of a dosage form, a patient's body weight, age, sex and health condition, diet, an administration time, an administration method, and an excretion rate. In the treatment method of the present invention, the composition includes 1×10.sup.5 to 1×10.sup.15 pfu/ml of recombinant adenoviruses, and typically, 1×10.sup.8 to 1×10.sup.13 pfu is administered every two days for two weeks.
[0177] In the treatment method of the present invention, the antitumor composition of the present invention may be administered orally or parenterally (e.g., intravenously, subcutaneously, intraperitoneally or locally) according to a desired method.
[0178] Hereinafter, the present invention will be described in further detail with reference to examples of the present invention, but the scope of the present invention is not limited to the following examples.
EXAMPLES
Reference Example 1
Preparation of GM-CSF Gene
[0179] A murine GM-CSF gene was obtained from Dr. Gerald C. O'Sullivan (Cork Cancer Research Centre, Mercy University Hospital and Leslie C. Quick Jnr. Laboratory, University College Cork, Cork, Ireland), and its base sequence is disclosed in Cancer Gene Therapy ((2006) 13, 1061-10710) and represented by SEQ ID NO: 1.
[0180] A human GM-CSF gene was obtained from InvivoGen, and its base sequence, as shown in Gene Bank M11220, is represented by SEQ ID NO: 2.
[0181] The gene sequence used in Korean Patent Application No. 2015-0044507 refers to the base sequence set forth in SEQ ID NO: 2 corresponding to 33 to 467 bp of the 789 bp base sequence actually shown in Gene Bank M11220.
Preparation Example 1
Construction of Adenovirus for Expressing GM-CSF (Replication-Deficient: d1324-GM-CSF, Replication-Competent: d1324-3484-CMVp-ΔE1B-GM-CSF)
[0182] An adenovirus for expressing GM-CSF was constructed in the same manner as in Preparation Example 1 disclosed in Korean Patent No. 2015-0044507 by using the same gene disclosed in Korean Patent No. 2015-0044507.
Reference Example 2
Preparation of Flt3L-TRAIL Fusion Gene
[0183] A human Flt3L-TRAIL gene was prepared by fusing a gene encoding amino acids 1-181 of FMS-like tyrosine kinase 3 ligand (Flt3L) and a gene encoding amino acids 95-281 of tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) using a leucine zipper, and is represented by SEQ ID NO: 3, as shown in Gene Bank U03858 (Flt3L) and Gene Bank B032722 or U57059 (TRAIL).
[0184] In the case of the Flt3L-TRAIL fusion gene, since a human-type gene also has an activity in a mouse, the human Flt3L-TRAIL fusion gene was used without separately constructing a mouse Flt3L-TRAIL fusion gene.
Preparation Example 2
Construction of Flt3L-TRAIL Fusion Gene (Flt3L-TRAIL)-Loaded Oncolytic Adenovirus (d1324-3484-CMVp-ΔE1B-Flt3L-TRAIL)
[0185] Adlox-FETZ (Flt3L-TRAIL) was prepared by transferring FETZ (Flt3L-TRAIL fusion gene; Flt3L is only formed in a soluble form, and TRAIL only consists of an extracellular domain such as a 95-281 region, both being linked with an isoleucine zipper) prepared by treating pFETZ (Flt3L-TRAIL; Regression of human mammary adenocarcinoma by systemic administration of a recombinant gene encoding the hFlex-TRAIL fusion protein by Xiaofeng Wu et al., Molecular Therapy vol. 3 368-374, 2001) with Sal/BamHI to an Adlox vector cleaved with SalI/BamHI (
[0186] Adlox-Flt3L-TRAIL was cleaved with BamHI, and pIRES was cleaved with NotI, resulting in blunting.
[0187] Subsequently, each end was cleaved with SalI and then linked. Flt3L-TRAIL insertion was confirmed by cleaving the previously-obtained product with XbaI and MfeI to identify an insert (
[0188] To produce a virus, a viral backbone d1324-BstBI was cleaved with Bsp1191, the constructed pVAX1-3484-CMVp-ΔE1B-Flt3L-TRAIL was linearized using PmeI and used to transform E. coli BJ5183, thereby producing homologous recombination DNA. As a result, recombination was confirmed using a Hindill pattern and PacI cleavage (
[0189] An adenovirus d1324-3484-CMVp-ΔE1B-Flt3L-TRAIL was constructed through the homologous recombination described above.
Reference Example 3
Preparation of Gene of shRNA that Inhibits TGF-β1 Expression (shTGFβ1)
[0190] As disclosed in Korean Unexamined Patent Application Publication No. 2013-0012095, shRNA inhibiting TGF-β1 expression represented by SEQ ID NO: 4 or 5 (hereinafter, referred to as shTGF-β1) was prepared.
[0191] In the case of murine shRNA, the shTGF-β1 is represented by SEQ ID NO: 4, and in the case of human shRNA, the shTGF-β1 is represented by SEQ ID NO: 5.
Reference Example 4
Preparation of Gene of shRNA that Inhibits TGF-β2 Expression (shTGFβ2)
[0192] As shown in Korean Unexamined Patent Application Publication No. 2013-0088792, shRNA inhibiting TGF-β2 expression (hereinafter, referred to as shTGF-β2) represented by SEQ ID NO: 6 or 7 was prepared.
[0193] In the case of murine shRNA, the shTGF-β2 is represented by SEQ ID NO: 6, and in the case of human shRNA, the shTGF-β2 is represented by SEQ ID NO: 7.
Preparation Example 3
Construction of shTGF-β-Loaded Oncolytic Adenovirus (d1324-3484-CMVp-ΔE1B-U6-shTGFβ1, d1324-3484-CMVp-ΔE1B-U6-shTGFβ2)
[0194] Based on Korean Unexamined Patent Application Publication Nos. 2013-0088792 and 2013-0012095, to produce a virus, a viral backbone d1324-BstBI-U6-shTGF-β (β1 or β2) was cleaved with Bsp1191, pVAX1-3484-CMVp-ΔE1B was linearized with PmeI and used to transform E. coli BJ5183, thereby producing homologous recombination DNA. As a result, recombination was confirmed using a HindIII pattern and PacI cleavage (
[0195] An adenovirus d1324-3484-CMVp-ΔE1B-U6-shTGFβ1 or d1324-3484-CMVp-ΔE1B-U6-shTGFβ2 was constructed through the homologous recombination described above.
Reference Example 5
Preparation of Gene of shRNA that Inhibits HSP27 Expression (shHSP27)
[0196] As disclosed in Korean Unexamined Patent Application Publication No. 2013-0123244, shRNA inhibiting HSP27 expression (hereinafter, referred to as shHSP27) represented by SEQ ID NO: 9 was prepared.
Preparation Example 4
Construction of shHSP27-Loaded Oncolytic Adenovirus (d1324-3484-CMVp-ΔE1B-H1-shHSP27)
[0197] Based on Korean Unexamined Patent Application Publication No. 2013-0123244, to produce a virus, a viral backbone d1324-BstBI-H1-shHSP27 was cleaved with Bsp1191, pVAX1-3484-CMVp-ΔE1B was linearized with PmeI and used to transform E. coli BJ5183, thereby producing homologous recombination DNA. As a result, recombination was confirmed using a HindIII pattern and PacI cleavage (
[0198] An adenovirus d1324-3484-CMVp-ΔE1B-H1-shHSP27 was constructed through the homologous recombination described above.
Reference Example 6
Preparation of Gene of shRNA that Inhibits HSP25 Expression (shHSP25)
[0199] shRNA inhibiting HSP25 expression (shHSP25) represented by SEQ ID NO: 8 was prepared.
[0200] To prepare effective shHSP25 inhibiting murine HSP25 expression, three base sequences for targeting a shRNA candidate were prepared.
TABLE-US-00007 Murine target sequence: (SEQ ID NO: 10) 5′-gctac atctc tcggt gcttc a-3′ 1. Sense (SEQ ID NO: 11) 5′-GATCC gcctc ttcga tcaag ctttc g TCTC c gaaag cttga tcgaa gaggc TTTT A-3′ Antisense (SEQ ID NO: 12) 5′-AGCTT AAAA gcctc ttcga tcaag ctttc g GAGA c gaaag cttga tcgaa gaggc G-3′ 2. Sense (SEQ ID NO: 13) 5′-GATCC gctac atctc tcggt gcttc a TCTC t gaagc accga gagat gtagc TTTT A-3′ Antisense (SEQ ID NO: 14) 5′-AGCTT AAAA gctac atctc tcggt gcttc a GAGA t gaagc accga gagat gtagc G-3′ 3. Sense (SEQ ID NO: 15) 5′-GATCC ggaga tcacc attcc ggtta c TCTC g taacc ggaat ggtga tctcc TTTT A-3′ Antisense (SEQ ID NO: 16) 5′-AGCTT AAAA ggaga tcacc attcc ggtta c GAGA g taacc ggaat ggtga tctcc G-3′
[0201] For pSP72ΔE3-H1-shHSP25 subcloning, pSP72ΔE3-H1-hshTGFβ2 (refer to Preparation Example 5 disclosed in Korean Patent No. 2015-0044507) was cleaved with BamHI/HindIII, and then linked with three types of annealed shHSP25. To confirm an HSP25 shRNA effect from the pSP72ΔE3-H1-mshHSP25-1, 2 or 3 obtained as described above, a BNL-HSP25 cell line obtained through stable transfection of HSP25 into a BNL murine hepatocellular carcinoma cell line (BNL 1ME A.7R.1) was transfected with the three types of shHSP25 to confirm an effect of reducing HSP25 expression (
Preparation Example 5
Construction of shHSP25-Loaded Oncolytic Adenovirus (d1324-3484-CMVp-ΔE1B-H1-shHSP25)
[0202] Homologous recombination of the pSP72ΔE3-H1-shHSP25-2 or 3, which exhibits a reducing effect as shown in Reference Example 5, and d1324-IX was performed. For homologous recombination to d1324-IX-shHSP25-2, a pSP72-shHSP25-2 shuttle vector was cleaved with DrdI, backbone DNA d1324-IX was cleaved with SpeI for linearization, and then colonies obtained by transformation of BJ5183 with the resulting fragment were selected using a HindIII pattern and PacI cleavage (
Preparation Example 6
Construction of GM-CSF and Flt3L-TRAIL-Replicable Adenovirus (d1324-3484-CMVp-ΔE1B-GM-CSF-IRES-Flt3L-TRAIL)
[0203] A tumor-selective replication-competent adenovirus which simultaneously expresses GM-CSF and Flt3L-TRAIL was constructed.
[0204] 1) Construction of Vector Simultaneously Expressing GM-CSF and Flt3L-TRAIL
[0205] {circle around (1)} Human
[0206] A GM-CSF gene was inserted into multi cloning site (MCS) A of pIRES (Clontech), and an Flt3L-TRAILgene was inserted into MCS B.
[0207] To subclone a human GM-CSF gene into the MCS A site of pIRES, a primer for PCR was prepared. As a sense strand, 5′-CCG CTCGAG ATGTGGCTGC AGAGCCTGCT G-3′ (SEQ ID NO: 17) having an XhoI site at the 5′ end was prepared, and as an antisense strand, 5′-CCGACGCGTTCACTCCTGGACTGGCTCCCA-3′ (SEQ ID NO: 18) having MluI at the 5′ end was prepared. pORF-GMCSF was used as a PCR template to perform PCR for 30 cycles under the following conditions: 2 min at 95° C. (initial denaturation); 1 min at 95° C. (denaturation); 1 min at 55° C. (annealing); and 1 min at 72° C. (elongation). In addition, final elongation was performed for 5 minutes at 72° C.
[0208] To subclone a human Flt3L-TRAIL gene into the MCS B site of pIRES, pIRES-hGM-CSF was cleaved with SalI/Small, Adlox-Flt3L-TRAIL was also cleaved with SalI/SmaI, and then the cleaved Flt3L-TRAIL was inserted into and ligated with pIRES-GM-CSF, resulting in obtaining pIRES-GMCSF-Flt3L-TRAIL.
[0209] Adlox-Flt3L-TRAIL was prepared by transferring hFlex-TRAIL (Flt3L-TRAIL fusion gene: SEQ ID NO: 3) obtained by cleaving pFETZ (Flt3L-TRAIL; Regression of human mammary adenocarcinoma by systemic administration of a recombinant gene encoding the hFlex-TRAIL fusion protein, Molecular Therapy vol. 3 368-374, 2001) with SalI/BamHI to an Adlox vector cleaved with Sal/BamHI.
[0210] The inserted Flt3L-TRAIL was cleaved with SalI/HpaI, and the resulting fragment was inserted into Lane 2 and Lane 3 as follows (
[0211] {circle around (2)} Mouse
[0212] To subclone a murine GM-CSF gene into the MCS A site of pIRES, a primer for PCR was prepared. As a sense strand, 5′-CCG CTCGAG ATGTACAGGATGCAACTCCTGTCT-3′ (SEQ ID NO: 19) having an XhoI site at the 5′ end was prepared, and as an antisense strand, 5′-CCGACGCGT TCATTTTTGGCCTGGTTTTTTGCA-3′ (SEQ ID NO: 20) having MluI at the 5′ end was prepared. pCA14-mGM-CSF was used as a PCR template to perform PCR for 30 cycles under the following conditions: 2 min at 95° C. (initial denaturation); 1 min at 95° C. (denaturation); 1 min at 55° C. (annealing); and 1 min at 72° C. (elongation). In addition, final elongation was performed for 5 minutes at 72° C.
[0213] An experimental procedure is the same as described in process {circle around (1)}, except that a human GM-CSF gene is replaced with a murine GM-CSF gene, and a human Flt3L-TRAIL fusion gene is used since it can be applied to a mouse.
[0214] 2) Construction of GM-CSF and Flt3L-TRAIL-Inserted Shuttle Vector
[0215] Cloning into an oncolytic shuttle vector was performed as follows.
[0216] Both vectors for a human and a mouse were constructed by the same method.
[0217] pIRES-GM-CSF-Flt3L-TRAIL was cleaved with FspI (blunting), and then with BglII, thereby obtaining hGM-CSF (or mGM-CSF) and Flt3L-TRAIL. pVAX1-3484-CMVp-ΔE1B-E1R was treated with SalI for blunting, and then with BglII, followed by ligation with the BgIII and FspI fragments.
[0218] A subcloned product was cleaved with PmeI to confirm DNA fragments with two different sizes, and finally pVAX1-3484-CMVp-ΔE1B-GMCSF (human or mouse)-IRES-F1t3L-TRAIL was obtained (
[0219] 3) Construction of Tumor-Selective Replication-Competent Adenovirus which Expresses GM-CSF and Flt3L-TRAIL (the Same for Both a Human and a Mouse)
[0220] To produce a virus, a viral backbone DNA d1324-BstBI was cleaved with Bsp1191, and pVAX1-3484-CMVp-ΔE1B-GMCSF-IRES-Flt3L-TRAIL was linearized with PmeI and then inserted into E. coli BJ5183 for transformation, thereby producing homologous recombinant DNA. As a result, successful recombination was confirmed with a HindIII pattern and PacI cleavage (
[0221] To confirm that human GM-CSF and Flt3L-TRAIL proteins were expressed, GM-CSF and TRAIL which were released into a medium were measured by infecting DU-145 human prostatic cancer cells with a virus at different MOIs, and after 24 hours, culturing the cells in a fresh serum-free medium for a day after changing the medium. As a result, ELISA was performed to confirm that GM-CSF and TRAIL are normally expressed (
[0222] Likewise, to confirm that murine GM-CSF and Flt3L-TRAIL proteins were expressed, GM-CSF and TRAIL which were released into a medium were measured by infecting murine hepatocellular carcinoma cell (BNL)-derived BNL-CAR-E1B55-HSP25 cells with a virus at different MOIs, and after 24 hours, culturing the cells in a fresh serum-free medium for a day after changing the medium. As a result, ELISA was performed to confirm that GM-CSF and TRAIL are normally expressed (
[0223] Afterward, western blotting was performed on DU-145 to confirm whether TRAIL of Flt3L-TRAIL present in the virus maintains an apoptotic function. As a result, it can be seen that the apoptotic function is properly exhibited since PARP cleavage is highly shown at an increased MOI (50 MOI) (
[0224] DNA obtained from a bacterial clone in which homologous recombination had been confirmed was cleaved with PacI, and introduced into a 293A (a subclone of the 293 human embryonic kidney cell line) cell line for transfection, thereby producing an adenovirus. The purified adenovirus obtained by proliferation in the 293 cell line, isolation according to a CsCl concentration gradient by ultracentrifugation and dialysis was analyzed using a standard plaque assay kit developed by Qbiogene (Carlsbad, Calif., USA) to estimate a titer. The final virus titer was 1×10.sup.12 to 5×10.sup.12.
Preparation Example 7
Construction of Replication-Deficient Adenoviruses that Simultaneously Express shTGFβ and shHSP27 (Human)(d1324-H1-shHSP27-U6-shTGFβ1 and d1324-U6-shTGFβ2-H1-shHSP27)
[0225] 1) Construction of pSP72ΔE3-U6-shTGFβ1
[0226] BamHI and HindIII cleavage was performed between an U6 promoter and poly A of pSP72ΔE3-U6-sh-negative (the same as the pSP72/ΔE3/si-negative vector described in Example 2 disclosed in Korean Unexamined Patent Application Publication No. 2013-0012095), and then
[0227] a top strand (5′-gatcc GCCAGAAATACAGCAACAATTCCTG tctctc CAGGAATTGTTGCTGTATTTCTGGT tttttt a-3′, SEQ ID NO: 21) and
[0228] a bottom strand (5′-agctt aaaaaa ACCAGAAATACAGCAACAATTCCTG gagaga CAGGAATTGTTGCTGTATTTCTGGT g-3′, SEQ ID NO: 22) were ligated through annealing, thereby constructing pSP72ΔE3-U6-shTGFβ1 (refer to Examples 1 and 2 disclosed in Korean Unexamined Patent Application Publication No. 2013-0012095).
[0229] 2) Construction of pSP72ΔE3-U6-shTGFβ2
[0230] BamHI and HindIII cleavage was performed between a U6 promoter and poly A of pSP72ΔE3-U6-sh-negative, and then
[0231] a top strand (5′-gatcc GGATTGAGCTATATCAGATTCTCAA tctc TTGAGAATCTGATATAGCTCAATCC tttt a-3′, SEQ ID NO: 23) and
[0232] a bottom strand (5′-agctt aaaa GGATTGAGCTATATCAGATTCTCAA gaga TTGAGAATCTGATATAGCTCAATCC g-3′, SEQ ID NO: 24) were ligated through annealing, thereby constructing pSP72ΔE3-U6-shTGF2 (refer to Example 2 and
[0233] 3) Construction of pSP72ΔE3-H1-shHSP27
[0234] pSP72ΔE3-H1-shTGFβ2 of Preparation Example 5 disclosed in Korean Patent Application No. 2015-0044507 was cleaved with BamH/HindIII, and then
[0235] a top strand (5′-gatcc gacgagcatggctacatctcccggt tctc accgggagatgtagccatgctcgtc tttttt a-3′, SEQ ID NO: 25) and
[0236] a bottom strand (5′-agctt aaaa gacgagcatggctacatctcccggt gaga accgggagatgtagccatgctcgtc g-3′, SEQ ID NO: 26) were ligated through annealing, thereby constructing pSP72ΔE3-H1-shHSP27 (refer to Examples 1 and 2 disclosed in Korean Unexamined Patent Application Publication No. 2013-0123244).
[0237] 4) Construction of pSP72ΔE3-U6-shTGFβ2-H1-shHSP27 and pSP72ΔE3-H1-shHSP27-U6-shTGFβ1 shuttle vectors
[0238] A pSP72ΔE3-U6-shTGFβ2-H1-shHSP27 shuttle vector was constructed by blunting the pSP72ΔE3-U6-shTGFβ2 with HindIII, removing an SV40 poly A site with KpnI treatment, blunting the pSP72ΔE3-H1-shHSP27 with SphI, removing H1 promoter-shHSP27-SV40 poly A by KpnI treatment, and ligating the H1 promoter-shHSP27-SV40 poly A with pSP72ΔE3-U6-shTGFβ2 treated with HindIII (blunt)/KpnI.
[0239] On the other hand, a pSP72ΔE3-H1-shHSP27-U6-shTGFβ1 shuttle vector was constructed by blunting pSP72ΔE3-H1-shHSP27 with HindIII, removing a SV40 poly A site by KpnI treatment, blunting the pSP72ΔE3-U6-shTGFβ1 with SphI, removing U6 promoter-shTGF-β1-SV40 poly A by KpnI treatment, and ligating the U6 promoter-shTGF-β1-SV40 poly A with HindIII (blunt)/KpnI-treated pSP72ΔE3-H1-shHSP27.
[0240] A process of constructing the pSP72ΔE3-U6-shTGFβ2-H1-shHSP27 or pSP72ΔE3-H1-shHSP27-U6-shTGFβ1 shuttle vector is illustrated in
[0241] Homologous recombination of the completed pSP72-ΔE3-U6-shTGFβ2-H1-shHSP27 and the d1324-IX backbone was performed. Here, homologous recombination was performed by cleaving pSP72-ΔE3-U6-shTGFβ2-H1-shHSP27 as a shuttle vector with XmnI and cleaving the backbone d1324-IX with SpeI (
[0242] DNA obtained from a bacterial clone in which homologous recombination had been identified was cleaved with PacI, and introduced into a 293A (a subclone of the 293 human embryonic kidney cell line) cell line for transfection, thereby producing an adenovirus. The purified adenovirus obtained by proliferation in the 293 cell line, isolation according to a CsCl concentration gradient by ultracentrifugation and dialysis was analyzed using a standard plaque assay kit developed by Qbiogene (Carlsbad, Calif., USA) to estimate a titer. The final viral titer was 1×10.sup.10 to 1×10.sup.11.
Preparation Example 8
Construction of Replication-Deficient Adenoviruses that Simultaneously Express shTGFβ and shHSP25 (mouse)(d1324-H1-shHSP25-U6-mshTGFβ1 and d1324-U6-mshTGFβ2-H1-shHSP25)
[0243] 1) Construction of pSP72ΔE3-U6-Murine shTGFβ1
[0244] A vector was constructed by the same method described in Preparation Example 7 1), except that murine shTGFβ1, instead of human shTGFβ1, was used.
[0245] 2) Construction of pSP72ΔE3-U6-Murine shTGFβ2
[0246] A vector was constructed by the same method described in Preparation Example 7 2), except that murine shTGFβ2, instead of human shTGFβ2, was used.
[0247] 3) Construction of pSP72ΔE3-H1-shHSP25
[0248] A vector was constructed by the same method described in Preparation Example 7 3), except that murine HSP25, instead of human shHSP27, was used.
[0249] 4) pSP72ΔE3-H1-shHSP25-U6-mshTGFβ1 Subcloning
[0250] Blunting was performed by cleaving pSP72ΔE3-U6-murine shTGFβ1 with HindIII and cleaving pSP72ΔE3-H1-shHSP25 with SphI. In addition, pSP72ΔE3-H1-mshHSP25-U6-mshTGFβ1 was obtained by cleaving the resulting products with KpnI and ligating the cleaved products (
[0251] Homologous recombination of the completed pSP72-ΔE3-H1-shHSP25-U6-mshTGFβ1 and the d1324-IX backbone was performed. Here, homologous recombination was performed by cleaving pSP72-ΔE3-H1-mshHSP25-U6-mshTGFβ1 as a shuttle vector with XmnI and cleaving the backbone d1324-IX with SpeI (
[0252] Through the homologous recombination described above, d1324-H1-shHSP25-U6-mshTGFβ1 was constructed.
[0253] By the same method as described above, homologous recombination of pSP72-ΔE3-U6-mTGFβ2-H1-mHSP25 and the d1324-IX backbone was performed. Here, homologous recombination was performed by cleaving pSP72-ΔE3-U6-TGFβ2-H1-HSP25 as a shuttle vector with XmnI and cleaving the backbone d1324-IX with SpeI.
[0254] Through the homologous recombination described above, d1324-U6-mshTGFβ2-H1-shHSP25 was constructed.
Preparation Example 9
Construction of Oncolytic Adenoviruses that Simultaneously Express shTGFβ and shHSP27 (human) (d1324-3484-CMVp-ΔE1B-H1-shHSP27-U6-shTGFβ1 and d1324-3484-CMVp-ΔE1B-U6-shTGFΔ2-H1-shHSP27)
[0255] An oncolytic adenovirus was constructed as follows.
[0256] First, homologous recombination of d1324-BstBI and pSP72ΔE3-H1-shHSP27-U6-shTGFβ1 (
[0257] Second, homologous recombination was performed again between d1324-BstBI-H1-shHSP27-U6-shTGFβ1 (
[0258] Through the homologous recombination described above, d1324-3484-CMVp-ΔE1B -H1-shHSP27-U6-shTGFβ1 or d1324-3484-CMVp-ΔE1B -U6-shTGFβ2-H1-shHSP27 was constructed.
Preparation Example 10
Construction of Oncolytic Adenovirus that Simultaneously Expresses shTGFβ1 and shHSP25 (mouse) (d1324-3484-CMVp-ΔE1B-H1-shHSP25-U6-mshTGFβ1)
[0259] A process of homologous recombination of d1324-3484-CMVp-ΔE1B-H1-shHSP25-U6-mshTGFβ1 to construct a tumor-selective adenovirus that expresses mouse type shRNA is as follows.
[0260] Homologous recombination was performed by cleaving the pSP72ΔE3-H1-shHSP25-U6-mshTGFβ1 obtained in Preparation Example 8 as a shuttle vector with XmnI and cleaving the backbone d1324-BstBI with SpeI, thereby constructing d1324-BstBI-H1-shHSP25-U6-mshTGFβ1 (
Preparation Example 11
Construction of GM-CSF, Flt3L-TRAIL and shTGF-β1-Loaded Oncolytic Adenovirus (Human) (d1324-3484-CMVp-ΔE1B-GMCSF-IRES-Flt3L-TRAIL-U6-shTGF-β1)
[0261] For viral production, a viral backbone d1324-BstBI-U6-shTGF-β1 was obtained through homologous recombination of the pSP72ΔE3-U6-shTGFβ1 described in Preparation Example 7 and d1324-BstBI. The homologous recombination was induced through transformation of E. coli BJ5183 by cleaving the d1324-BstBI-U6-shTGF-β1 with Bsp1191 and linearizing the pVAX1-3484-CMVp-ΔE1B-GMCSF-IRES-Flt3L-TRAIL obtained in Preparation Example 6 with PmeI. As a result, the recombination was confirmed with a HindIII pattern and PacI cleavage (
[0262] Through the homologous recombination described above, d1324-3484-CMVp-ΔE1B-GMCSF-IRES-Flt3L-TRAIL-U6-shTGF-β1 was constructed.
Preparation Example 12
Construction of mGM-CSF, Flt3L-TRAIL and mshTGF-β1-Loaded Oncolytic Adenovirus (Mouse) (d1324-3484-CMVp-ΔE1B-mGMCSF-IRES -Flt3L-TRAIL-U6-mshTGF-β1)
[0263] For viral production, a viral backbone d1324-BstBI-U6-mshTGF-β1 was obtained through homologous recombination of the pSP72ΔE3-U6-mshTGFβ1 described in Preparation Example 8 and d1324-BstBI. For homologous recombination of the d1324-BstBI-U6-mshTGF-β1 obtained thereby and the pVAX1-3484-CMVp-ΔE1B-mGMCSF-IRES-Flt3L-TRAIL obtained in Preparation Example 6, the pVAX1-3484-CMVp-ΔE1B-mGMCSF-IRES-Flt3L-TRAIL (
[0264] Through the homologous recombination described above, d1324-3484-CMVp-ΔE1B-mGMCSF-IRES-Flt3L-TRAIL-U6-mshTGF-β1 was constructed.
Preparation Example 13
Construction of mGM-CSF, Flt3L-TRAIL and shHSP27-Loaded Oncolytic Adenovirus (Human) (d1324-3484-CMVp-ΔE1B-GMCSF-IRES-Flt3L-TRAIL-H1-shHSP27)
[0265] For viral production, a viral backbone d1324-BstBI-H1-shHSP27 was obtained through homologous recombination of the pSP72ΔE3-H1-shHSP27 described in Preparation Example 7 and d1324-BstBI. The homologous recombination was induced through transformation of E. coli BJ5183 by cleaving the d1324-BstBI-H1-shHSP27 obtained thereby with Bsp1191 and linearizing the pVAX1-3484-CMVp-ΔE1B-GMCSF-IRES-Flt3L-TRAIL obtained in Preparation Example 6 with PmeI. As a result, successful recombination in Lanes 1, 2 and 3 were confirmed with a HindIII pattern and PacI cleavage (
[0266] Through the homologous recombination described above, d1324-3484-CMVp-ΔE1B-GMCSF-IRES-Flt3L-TRAIL-H1-shHSP27 was constructed.
Preparation Example 14
Construction of GM-CSF, Flt3L-TRAIL and shHSP25-Loaded Oncolytic Adenovirus (Mouse) (d1324-3484-CMVp-ΔE1B-GMCSF-IRES-Flt3L-TRAIL-H1-shHSP25)
[0267] For viral production, a viral backbone d1324-BstBI-H1-shHSP25 was obtained through homologous recombination of the pSP72ΔE3-H1-shHSP25 described in Preparation Example 8 and d1324-BstBI. The d1324-BstBI-H1-shHSP25 obtained thereby was cleaved with Bsp1191, and for homologous recombination with the pVAX1-3484-CMVp-ΔE1B-mGMCSF-IRES-Flt3L-TRAIL obtained in Preparation Example 6, pVAX1-3484-CMVp-ΔE1B-mGMCSF-IRES-Flt3L-TRAIL as a shuttle vector was cleaved with PmeI, and the backbone d1324-BstBI-shHSP25 was cleaved with Bsp1191 (
[0268] Through the homologous recombination described above, d1324-3484-CMVp-ΔE1B-GMCSF-IRES-Flt3L-TRAIL-H1-shHSP25 was constructed.
Preparation Example 15
Construction of GM-CSF, shHSP27 and shTGF-β-Loaded Oncolytic Adenoviruses (Human) (d1324-3484-CMVp-ΔE1B-GMCSF-H1-shHSP27-U6-shTGFβ1 and d1324-3484-CMVp-ΔE1B-GMCSF-U6-shTGFβ2-H1-shHSP27)
[0269] A pVAX1-3484-CMVp-ΔE1B-GMCSF shuttle vector was constructed by subcloning an insert prepared by blunting pCA14-GMCSF with BglII and performing cleavage with SalI into pVAX1-3484-CMVp-ΔE1B which was blunted by cleavage with EcoRI and performing cleavage with SalI (refer to Preparation Example 1 disclosed in Korean Patent No. 2015-0044507).
[0270] Homologous recombination to d1324-3484-CMVp-ΔE1B-GMCSF-H1-shHSP27-U6-shTGFβ1 was identified by selecting colonies obtained through transformation of BJ5183 after the pVAX1-3484-CMVp-ΔE1B-GMCSF as an E1 shuttle vector was linearized by cleavage with PmeI, and the d1324-BstBI-H1-shHSP27-U6-shTGFβ1 obtained in Preparation Example 9 as backbone DNA was linearized by cleavage with Bsp1191 using a HindIII pattern and PacI cleavage (
[0271] Homologous recombination to d1324-3484-CMVp-ΔE1B-GMCSF-U6-shTGFβ2-H1-shHSP27 was identified by selecting colonies obtained through transformation of BJ5183 after the pVAX1-3484-CMVp-ΔE1B-hGMCSF as an E1 shuttle vector was linearized by cleavage with PmeI, and the d1324-BstBI-U6-shTGFβ2-H1-shHSP27 obtained in Preparation Example 9 as backbone DNA was linearized by cleavage with Bsp1191 using a HindIII pattern and PacI cleavage (
Preparation Example 16
Construction of GM-CSF, shHSP25 and shTGF-β1-Loaded Oncolytic Adenovirus (Mouse) (d1324-3484-CMVp-ΔE1B-GMCSF-H1-shHSP25-U6-mshTGFβ1)
[0272] Homologous recombination to d1324-3484-CMVp-ΔE1B-mGMCSF-shHSP25-mshTGFβ1 was identified by selecting colonies obtained through transformation of BJ5183 after the pVAX1-3484-CMVp-ΔE1B-mGMCSF (refer to Korean Patent No. 2015-0044507 based on Preparation Example 1) as an E1 shuttle vector was linearized by cleavage with PmeI, and the backbone DNA d1324-BstBI-H1-shHSP25-U6-mshTGFβ1 obtained through homologous recombination of the pSP72-ΔE3-H1-shHSP25-U6-mshTGFβ1 obtained in Preparation Example 8 and d1324-BstBI was linearized by cleavage with Bsp1191 using a HindIII pattern and PacI cleavage (
[0273] Through the homologous recombination described above, d1324-3484-CMVp-ΔE1B-GMCSF-H1-shHSP25-U6-mshTGFβ1 was constructed.
Preparation Example 17
Construction of Flt3L-TRAIL, shTGF-β and shHSP27-Loaded Oncolytic Adenoviruses (Human) (d1324-3484-CMVp-ΔE1B-Flt3L-TRAIL-H1-shHSP27-U6-shTGFβ1, and d1324-3484-CMVp-ΔE1B-Flt3L-TRAIL-U6-shTGFβ2-H1-shHSP27)
[0274] Homologous recombination of the shuttle vector (pVAX1-3484-CMVp-ΔE1B-Flt3L-TRAIL) obtained in Preparation Example 2, and the backbone d1324-BstB1-H1-shHSP27-U6-shTGFβ1 or d1324-BstB1-U6-shTGFβ2-H1-shHSP27, obtained in Preparation Example 9 was performed (
[0275] DNA obtained from a bacterial clone in which homologous recombination had been identified was cleaved with PacI, and then introduced into a 293A (a subclone of the 293 human embryonic kidney cell line) cell line for transfection, thereby producing an adenovirus. The purified adenovirus obtained by proliferation in the 293 cell line, isolation according to a CsCl concentration gradient by ultracentrifugation and dialysis was analyzed using a standard plaque assay kit developed by Qbiogene (Carlsbad, Calif., USA) to estimate a titer. The final virus titer was 1×10.sup.12 to 5×10.sup.12.
Preparation Example 18
Construction of Flt3L-TRAIL, shHSP25 and shTGF-β1-Loaded Oncolytic Adenovirus (Mouse) (d1324-3484-CMVp-ΔE1B-Flt3L-TRAIL-H1-shHSP25-U6-mshTGFβ1)
[0276] For viral production, homologous recombinant DNA was produced through transformation of E. coli BJ5183 by cleaving the backbone DNA d1324-BstBI-H1-shHSP25-U6-mshTGFP l(Preparation Example 9) obtained through homologous recombination of the pSP72-ΔE3-H1-shHSP25-U6-mshTGFβ1 (Preparation Example 8) as a viral backbone and d1324-BstBI with Bsp1191, and linearizing the pVAX1-3484-CMVp-ΔE1B-Flt3L-TRAIL obtained in Preparation Example 2 using PmeI. As a result, recombination was confirmed using a HindIII pattern and PacI cleavage (
[0277] Through the homologous recombination described above, d1324-3484-CMVp-ΔE1B-Flt3L-TRAIL-H1-shHSP25-U6-mshTGFβ1 was constructed.
Preparation Example 19
Construction of GM-CSF, Flt3L-TRAIL, shTGF-β and shHSP27-Loaded Oncolytic Adenoviruses (Human) (d1324-3484-CMVp-ΔE1B-GMCSF-IRES-Flt3L-TRAIL-H1-shHSP27-U6-shTGFβ1, and d1324-3484-CMVp-ΔE1B-GMCSF-IRES-Flt3L-TRAIL-U6-shTGFβ2-H1-shHSP27)
[0278] Through homologous recombination of the d1324-BstBI-ΔE3-U6-TGF-β2-H1-HSP27 or d1324-BstBI-ΔE3-H1-HSP27-U6-TGF-β obtained in Preparation Example 9 and the pVAX1-3484-CMVp-ΔE1B-GMCSF-IRES-Flt3L-TRAIL obtained in Preparation Example 6, d1324-3484-CMVp-ΔE1B-GMCSF-IRES-Flt3L-TRAIL-U6-shTGFβ2-H1-shHSP27 (YSC-01) (
[0279] DNA obtained from a bacterial clone in which homologous recombination had been confirmed was cleaved with PacI, and introduced into a 293A (a subclone of the 293 human embryonic kidney cell line) cell line for transfection, thereby producing an adenovirus. The purified adenovirus obtained by proliferation in the 293 cell line, isolation according to a CsCl concentration gradient by ultracentrifugation and dialysis was analyzed using a standard plaque assay kit developed by Qbiogene (Carlsbad, Calif., USA) to estimate a titer. The final virus titer was 1×10.sup.12 to 5×10.sup.12.
Preparation Example 20
Construction of GM-CSF, Flt3L-TRAIL, shTGF-β and shHSP25-Loaded Oncolytic Adenovirus (Mouse) (d1324-3484-CMVp-ΔE1B-mGMCSF-IRES-Flt3L-TRAIL-H1-shHSP25-U6-mshTGFβ1)
[0280] For homologous recombination of the d1324-BstBI-H1-mshHSP25-U6-mshTGFβ1 obtained in Preparation Example 10 and the pVAX1-3484-CMVp-ΔE1B-mGMCSF-Flt3L-TRAIL obtained in Preparation Example 6, a shuttle vector pVAX1-3484-CMVp-ΔE1B-mGMCSF-Flt3L-TRAIL was cleaved with PmeI, and backbone DNA d1324-BstBI-H1-shHSP25-U6-mshTGFβ1 was cleaved with Bsp1191, followed by confirming recombination (
[0281] Through the homologous recombination described above, d1324-3484-CMVp-βE1B-mGMCSF-IRES-Flt3L-TRAIL-H1-shHSP25-U6-mshTGFβ1 was constructed.
Example 1
Antitumor Effect of Tumor-Selective Replication-Competent Virus that Expresses each or both of shTGF-β and shHSP27 on in Vivo Nude Mouse
[0282] 1×10.sup.7 cells/100 μl of cells of a human MDAMB-231-Her2 cell line were injected into an abdominal wall, and infected through intratumoral injection of each of adenoviruses (control groups: control virus, oncolytic NC, one type of oncolytic shTGF-β1 of Preparation Example 3, and one type of oncolytic shHSP27 of Preparation Example 4) and two types (shTGF-β1+shHSP27) of Preparation Example 7 three times every two days (1×10.sup.9 pfu/50 μl) when a tumor size reached 60 mm.sup.3. Six mice per experimental group were used.
[0283] As a result, the oncolytic adenovirus/shTGF-β1+shHSP27 of Preparation Example 7 into which two genes were injected exhibited the most superior antitumor effect (
Example 2
Comparison in Survival Potential According to TGF-β Isotype
[0284] A cell line that overexpresses Her2 in pancreatic cancer cell lines MiaPaCa-2, HPAC, BxPC3, AsPc-1 and Capan-1, hepatocellular carcinoma cell lines SK-Hep1 and Huh7, a lung cancer cell line A549, a prostatic cancer cell line DU-145, a melanoma cell line A375, a glioma cell line U251N, or a breast cancer cell line MDAMB231 was plated on a 6-well plate at 2×10.sup.5 cells per well, infected with defective adenovirus/negative control (NC), adenovirus/shTGF-β1 of Preparation Example 3, or adenovirus/shTGF-β2 at 100 MOI, after two days, the cells were detached and dispensed into 6 wells at 1×10.sup.5 cells/well, and then the medium was replaced with a 5% FBS-containing medium every two days. After 10 days, the culture medium was removed, and the cells were fixed with 4% paraformaldehyde and stained with crystal violet to observe the cells.
[0285] As a result, in most cancer cell lines, an effect of decreasing a survival rate due to a decrease in TGF-β1 was superior to that due to a decrease in TGF-β2, and in most pancreatic cancer cell lines except Capan-1, an effect of decreasing TGF-β was relatively insignificant (
Example 3
Confirmation of Effect of Two-Type Gene Delivery System on Various Types of Cancer Cell Lines
[0286] To examine whether, in addition to shTGF-β1, shHSP27 is needed for MDAMB231-Her2, cells were infected with defective adenovirus/negative control (NC), one type of Preparation Example 3 (adenovirus/shTGF-β1), or two types of Preparation Example 7 (adenovirus/shTGFβ1-shHSP27) at 100 MOI, and then western blotting was performed.
[0287] As a result, it was confirmed that, while a decrease in Akt phosphorylation did not occur, other than this, pSTAT3, pSrc and pEGFR were further decreased (
Example 4
Confirmation of Effects of Three-Type Gene Delivery System (Adding TRAIL to Example 3) on Various Types of Cancer Cell Lines
[0288] One specific matter is the possibility that increased cytotoxicity by TRAIL is increased such that, when TGF-β and HSP27 are simultaneously decreased, TRAIL receptors such as DR4 and DR5 are increased, and CDK9 which contributes to TRAIL resistance is decreased.
Example 5
Confirmation of Insertion and Expression of Four Types of Genes Loaded in YSC-01 and YSC-02
[0289] Normal insertion of four foreign genes into a virus was confirmed from viral DNA of YSC-01 and YSC-02 through sequencing of the viral DNA (
[0290] Pancreatic cancer cells HPACs and MiaPaCa-2 were seeded at 1×10.sup.5 cells/well of 6 well plate, infected with Ad-3484-NC (negative control oncolytic adenovirus) at 100 MOI, and infected with each of YSC-01 and 02 at 5, 10, 50 or 100 MOI, followed by culturing for 2 days, and then for the last 24 hours, levels of GM-CSF and TRAIL, which had been secreted into a serum-free medium, were measured. Secretion of GM-CSF, TRAIL and TGF-β1 was confirmed by ELISA, a decrease in mRNA of TGF-β2 was confirmed by real-time PCR, and Flt3L expression in Flt3L-TRAIL and a decrease in HSP27 expression were confirmed by western blotting (
Example 6
In Vitro Tumor-Selective Anticancer Activity Confirmed Through Clonogenic Assay for Ad-3484-GM-CSF-Flt3LTRAIL, YSC-01 and YSC-02
[0291] Clonogenic assays were performed for some cell lines including p53 mutant types such as MDA-MB231-Her2, MiaPaCa-2, A549, Huh? and DU145, p53 normal-type cancer cell lines such as A375 and HPAC, normal cells lines such as pancreatic normal cells and Chang to confirm a survival rate.
[0292] For an experiment, 4×10.sup.5 cells of each cell line were plated into a 60 mm dish, and the following day, infected with 1 MOI of Ad-3484-NC (negative control, oncolytic adenovirus), 1 MOI of Ad-3484-GM-CSF-Flt3L-TRAIL of Preparation Example 6, or 1 MOI of Ad 3484-GM-CSF-Flt3L-TRAIL-shTGFβ2-shHSP27 (YSC-01) of Preparation Example 19. The medium was replaced with 5% FBS-containing DMEM. The next day, the cells were dispensed into a 6-well plate at 1×10.sup.5 cells per well, and cultured until colonies were formed while the medium was changed every two days. At the suitable point of time in which colonies are formed (within 10 days), the medium was removed, the cells were fixed through treatment of 4% paraformaldehyde for 15 minutes at room temperature, stained with 0.05% crystal violet for 1 hour, and washed with water, followed by observing colonies stained in purple. As a result, it was confirmed through a clonogenic assay that YSC-01 and YSC-02 further degrade survival potential in a p53 normal-type cell line as well as a p53 mutant-type cell line, compared to the oncolytic adenovirus expressing GMCSF-Flt3L-TRAIL, described in Preparation Example 6 (
Example 7
Antitumor Effect Induced by Tumor-Selective Adenovirus Coexpressing Four Types of Genes in in Vivo Nude Mouse
[0293] 8×10.sup.6 cells/100 μl of cells of an MiaPaCa-2 cell line were injected into an abdominal wall, and infected through intratumoral injection of each of an adenovirus (negative control group: Ad-3484-NC), two types of Preparation Example 6 (Ad-3484-GM-CSF-Flt3L-TRAIL), and four types of Preparation Example 19 (Ad-3484-GM-CSF-Flt3L-TRAIL-shTGFβ2-shHS P27 (YS C-01) and Ad-3484-GM-CSF-Flt3L-TRAIL-shHSP27-shTGFβ31 (YSC-02)) three times every two days (1×10.sup.9 pfu/50 μl) when a tumor size reached 60 mm.sup.3. Six mice per experimental group were used.
[0294] As a result, the four genes-inserted YSC-02 of Preparation Example 19 exhibited the highest antitumor effect, and the YSC-01 of Preparation Example 19 exhibited the second highest antitumor effect (
Example 8
Confirmation of Antitumor Effect Induced by Tumor-Selective Adenovirus Coexpressing Four Types of Genes in Mouse with in Vivo Immunity
[0295] To compare the antitumor effect by murine-type YSC-02 with several comparative groups, an immunocompetent mouse model was first prepared. That is, a murine hepatocellular carcinoma cell line (BNL-CAR-E1B55K-HSP25) capable of infecting and replicating an adenovirus in an immunocompetent mouse (Balb/c) was constructed.
[0296] To this end, first, heat shock was applied to a BNL 1ME A.7R.1 (BNL) murine hepatocellular carcinoma cell line for 4 hours at 43° C., and the cells were cultured for 24 hours at 37° C., and then an experiment to confirm HSP25 and HSP27 expression was performed. Afterward, mRNA was extracted to synthesize cDNA, and PCR was performed using PCR primers to measure a size, followed by cloning. The primers used herein include mouse HSP25 sense :(Bam HI) 5′-cgc ggatcc atg acc gag cgc cgc gtg cc-3′ (SEQ ID NO: 29) and anti-sense: (XhoI) 5′-ccg ctcgag ctacttggctccagactgtt-3′ (SEQ ID NO: 30). The cloned DNA fragment was cleaved with BamHI/XhoI and inserted into pCDNA3.1 cleaved with BamHI/XhoI, thereby obtaining pcDNA3.1-HSP25. BNL cells were transfected with pcDNA3.1-HSP25, and selection was carried out using hygromycin B (250 μg/ml) to obtain HSP25-expressing clones. To produce an E1B55KD or CAR-expressing retrovirus, a pLNCX vector was used. For E1B55KD cloning, by adding HpaI and ClaI enzyme sites, E1B55KD was extracted from pcDNA3.1-E1B55KD by PCR and inserted into a pLNCX vector. For CAR cloning, by adding HindIII and ClaI enzyme sites, CAR was extracted from pCDNA3.1-CAR by PCR and inserted into a pLNCX vector. The selected BNL-HSP25 cells were coinfected with a retrovirus expressing CAR or E1B55KD, and then selected using G418 (1 mg/ml), thereby obtaining a BNL-CAR-E1b55KD-HSP25 cell line (
[0297] 1×10.sup.7 cells/100 μl of cells of the BNL-CAR-E1B55KD-HSP25 cell line were injected into an abdominal wall, and when a tumor size reached 60 mm.sup.3, infected with an adenovirus (negative control group: Ad-3484-NC), one type of Preparation Example 1 (Ad-3484-mGM-CSF), one type of Preparation Example 2 (Ad-3484-Flt3L-TRAIL), two types of Preparation Example 6 (Ad-3484-mGMCSF-Flt3L-TRAIL), three types of Preparation Example 12 and Preparation Example 14 (Ad-3484-mGMCSF-Flt3L-TRAIL-shHSP25, and Ad-3484-mGMCSF-Flt3L-TRAIL-mshTGFβ1), four types of Preparation Example 20 (Ad-3484-mGMCSF-Flt3L-TRAIL-shHSP25-mshTGFβ1) and murine-type oncolytic virus 4m (GMCSF+DCN+shFoxp3+shTGFβ2) of Preparation Example 9 [hereinafter, referred to as GX-03] disclosed in Korean Unexamined Patent Application Publication No. 2015-0044507 as a comparative control group through intratumoral injection three times every two days (1×10.sup.9pfu/50 μl). Six mice per experimental group were used.
[0298] As a result, murine type YSC-02 including 4 types of genes exhibited the highest antitumor effect, and an adenovirus having three types of genes containing TGF-β1 shRNA exhibited the second highest antitumor effect, which was higher than GX-03 (
[0299] In the present invention, as TGF-β expression is inhibited using shRNA-mediated RNA interference acting on a tumor-associated gene of TGF-β, which is a protein causing the onset of a disease, to restrict a factor inducing immune tolerance and induce an immune boosting response induced by GM-CSF, an antitumor effect is enhanced, Flt3L-TRAIL is expressed, and also TGF-β and HSP expression is simultaneously inhibited, resulting in considerable enhancement in an antitumor effect in a cancer disease animal model. Binding of a total of four individual genes including these fusion genes, rather than a random combination of genes simply having an antitumor function, was made for these genes to be closely and organically associated with each other.
[0300] It will be apparent to those skilled in the art that various modifications can be made to the above-described exemplary embodiments of the present invention without departing from the spirit or scope of the invention. Thus, it is intended that the present invention covers all such modifications provided they come within the scope of the appended claims and their equivalents.