Therapeutic delivery and expression system, methods and uses thereof

Abstract

Therapeutic methods for cancer treatments using a combined prokaryotic-eukaryotic delivery and expression system for the delivery of multiple therapeutic factors via a modified tumor-targeted bacteria. A targeted bacteria-vector system elicits an inter-kingdom dual expression (IKDE) of antitumor agents, in the nucleus or cytoplasm of eukaryotic cells, with priming and maintenance of the vector in the bacterium. The therapeutic factors include small interfering RNAs, tumoricidal proteins, DNA molecules, or a combination thereof. The system provides direct killing of tumor cells and alters the tumor microenvironment by expressing anti-angiogenic factors and cytokines in intracellular and/or extracellular environments. Also provided are methods of using natural exosomes comprising cargoes obtained from the bacterially infected cells. The bacteria-vector system is useful for many types of tumor and cancer as well as recombinant vaccines. The method causes significant regression of tumor and prolongs survival of tumor-bearing mice and subject without detectable systemic toxicity.

Claims

1. A method to transfer a therapeutic vector from a bacterium to a tumor cell in a subject, said method comprising the steps of: (A) providing the bacterium, wherein the bacterium is a ST1/pIKR-shCAT bacterium; and (B) administering the bacterium to the subject, wherein the tumor cell is a breast tumor cell, a colon tumor cell, or a metastasized tumor cell.

2. The method of claim 1, wherein the tumor cell is a breast tumor cell.

3. The method of claim 1, wherein the tumor cell is a colon tumor cell.

4. The method of claim 1, where the tumor cell is a metastasized tumor cell.

5. A method to transfer a therapeutic vector from a bacterium to a tumor in a subject, said method comprising the steps of: (A) providing the bacterium, wherein said bacterium is a ST1/pIKR-shCAT bacterium; (B) administering the bacterium to the subject; and (C) measuring a size of the tumor in the subject at about 20 days after the administration, wherein administration with the bacterium causes a decrease in tumor volume at about 20 days after the administration, and wherein the tumor is a breast tumor.

Description

4. BRIEF DESCRIPTION OF THE FIGURES

(1) FIGS. 1A-B Generation of a tumor-targeting Salmonella strain ST1 for delivery and expression of multiple therapeutic factors. (A) Schematic diagram of the creation process of ST1 strain. (B) PCR confirmation of the accurate insertion the four genes at their respective loci. The forward primers were positioned outside the homologous region. Reverse primers were positioned within the heterogeneous regions.

(2) FIGS. 2A-B Integration of T7 RNAP expression cassette into the gmd locus resulted in the generation of T7 RNAP-expressing Salmonella strains with weak biofilm-forming ability. (A) Western blot showing the expression of T7 RNAP (99 kDa) in SL7207 strain and its mutants using mouse monoclonal antibody against T7 RNAP. (B) Colonies on the Congo Red agar plates incubated at 30° C. Wild-type S. typhimurium 7207 strain exhibit the typical biofilm, i.e. the ‘rdar’ morphotype in vitro; while gmd knockout strains (SL001 and ST1) were no longer able to form the biofilm.

(3) FIGS. 3A-B The conversion of SL7207 to the anaerobic ST1 prevented bacterial killing of the mice. (A) Strains SL7207 and ST1 were grown on LB agar plates under aerobic (+O.sub.2) or anaerobic (−O.sub.2) conditions for 24 h at 37° C. (B) Kaplan-Meier survival curves of mice receiving ST1 or wild-type stain 7207 at a dose of 5×10.sup.7 cells/mouse.

(4) FIGS. 4A-B Examination of the tumor-targeting potential of ST1 in immunocompromised mice and bacterial colonization in the hypoxic core of solid tumors. (A) Preferential accumulation of ST1 within the tumors after one intravenous injection. Bacterial counts in the different organs were determined on day 7, 14 and 21 post infections. Measurements are from three independent experiments, and the error bars represent the s.e.m. (ND stands for not detected). (B) Composite images were generated for the whole tumor to observe macroscopic bacterial colonization. Immunohistochemical staining identified regions of the necrotic area (left), hypoxic region (middle) and Salmonella accumulation (right).

(5) FIG. 5 Bacterial counts per cell from Gentamicin protection assay in MDA-MB-231 cells at 2 and 4 h post infection at an MOI of 200:1.

(6) FIGS. 6A-C Fluorescence-activated cell sorting was used to demonstrate EGFP expression on day 2 following bacterial infections. Dot plot representation of tumor cells infected with ST1/pEGFP-C1 (plasmid DNA delivery) or ST1/pT7-EGFP (functional mRNA delivery) showing green fluorescence.

(7) FIG. 7 CFU tests of ST1/pcDNA3.1-infA (high-copy) and ST1/pET32a-infA (low-copy) were performed at 3 weeks after intravenous injections into tumor-bearing mice. Tumor lysate was homogenized in PBS and plated onto agar plates with or without ampicillin selection to determine the counts of recombinant and total bacteria, respectively. Results are expressed as mean±s.e.m. (n=5).

(8) FIG. 8 Schematic diagram of ST1-mediated inter-kingdom dual expression (IKDE) system. The activation of this system requires cytoplasmic delivery of both pIKDE-EGFP containing a reporter gene driven by P.sub.T7 and P.sub.CMV and an initial source of T7 RNAP or its mRNA.

(9) FIGS. 9A-C Theoretical steps of ST1-mediated inter-kingdom expression. (1) In the bacterial cytosol, T7 RNAPs bind to the P.sub.T7 on the plasmid (circle) and then mediate the efficient transcription of mRNA (curve). (2) Upon intracellular delivery, functional mRNAs will be translated into T7 RNAP (triangle) or EGFP (circle) in the cytoplasm, where an initial source of T7 RNAPs can transcribe T7 RNAPs (through a positive feedback loop) and reporter gene mRNA form pIKDE-EGFP. (3) A small percentage of DNA will enter the nucleus, where the transcription machinery will generate stable transcripts through the nuclear system.

(10) FIGS. 10A-B Schematic representations of the expression plasmids and the RT-PCR detection of EGFP mRNA in the bacterial hosts using an anchor gene specific primer.

(11) FIGS. 11A-C EGFP expression in the human MDA-MB-231 cells at 5 h after ST1/pIKDE-EGFP infection.

(12) FIG. 12 Expression kinetics of EGFP in the cells infected with ST1 harboring the indicated vectors (at an MOI of 200:1) were determined at 24, 48 and 72 h post infections. ST1 carrying an IKDE system leads to a rapid and high-level transgene expression.

(13) FIG. 13 Therapeutic effects of ST1 harboring different therapeutic factors on cell viability and apoptosis in human MDA-Mb-231 cells. MDA-MB-231 cells were incubated with ST1 harboring the indicated vectors (at an MOI of 200:1). Cell viability and Annexin-V/propidium iodide staining analysis of apoptotic cells following the indicated treatments were assessed at 48 h post infections. Data represent the values of triplicates (means±s.e.m.).

(14) FIG. 14 Diagram of soluble TRAIL expression and translocation through bacterial surface display or Salmonella type III secretion system.

(15) FIGS. 15A-B Expression of Lpp_ompA_sTRAIL fusion protein was observed in the outer membrane of ST1 transformed with pLpp_ompA_sTRAIL by immunoblot analysis. Samples were loaded with equal total protein content.

(16) FIGS. 16A-B Human MDA-MB-231 cells were incubated with type III secretion system competent ST1 strain or a translocation-defective strain carrying pSspH2-sTRAIL. Then the expression of SspH2-sTRAIL in the bacterial-associated and host cell fractions was examined. Actin was used as a loading control.

(17) FIGS. 17A-H Immunofluorescent staining of cytokine soluble TRAIL expression and the presence of Salmonella in a solid tumor treated with ST1/pLpp_ompA_sTRAIL or ST1/pSspH2-sTRAIL. Scale bar, 50 μm.

(18) FIGS. 18A-B Systemic administration of sTRAIL-expressing ST1 significantly suppresses the MDA-MB-231 tumor growth without apparent weight loss. (A) Tumor growth curves after receiving with PBS, ST1/control, ST1/pLpp_ompA_sTRAIL or ST1/pSspH2-sTRAIL during a 20-day observation. (B) Body weights of tumor-bearing mice receiving the indicated treatments.

(19) FIG. 19 Distribution and tumor colonization of ST1/pSspH2-sTRAIL in tumor-bearing nude mice. Different organs were homogenized and analyzed for the presence of bacteria. ND stands for not detected. Shown is the mean CFU per gram tissues plus s.e.m.

(20) FIG. 20 Biodistibution of ST1 in the 4T1 tumor-bearing mice. Female BALB/c mice (n=3 per group) bearing 4T1 mammary tumors received a single intravenous injection of 2×10.sup.7 cfu of ST1. Bacterial accumulation in the tumors, lungs, spleens, livers, kidneys and hearts were determined 7 and 14 days later. Bars correspond to mean±s.e.m. (n=3). ND stands for not detected.

(21) FIGS. 21A-B In vivo validation of ST1-mediated functional gene transfer. (A) Time course of DT A chain expression in tumors after ST1/pIKDE-DTA injections. (B) Transcript levels of nuclear and cytoplasmic DT-A transcripts (mean±s.e.m., n=5) were measured by quantitative real-time RT-PCR.

(22) FIGS. 22A-H Intracellular DT A chain expression was detected by immunostaining. Scale bar, 25 μm. Target gene expression was detected in the ST1/pIKDE-DTA treated tumors, but was absent in the vector control group.

(23) FIGS. 23A-F Detection of DT A chain expression in the ST1/pIKDE-DTA treated tumors by western blot (A) and immunohistochemistry (B) on day 21 after intravenous injection. (B) Composite images of a whole tumor infected with ST1/pIKDE-DTA stained to visualize bacteria (left) and DT A chain (right). Scale bar, 1 mm.

(24) FIGS. 24A-G In situ DT A chain expression induced massive cell death in ST1/pIKDE-DTA treated tumors on day 3 following systemic injection. (A) Apoptosis determined by TUNEL staining. The tumor sections were stained doubly with DAPI and TUNEL and visualized under a fluorescence microscope with 200× magnification. Scale bar, 50 μm. (B) Relative % of the TUNEL-positive cells was determined in four fields for each group.

(25) FIGS. 25A-H BALB/c mice with 4T1 breast tumors (6-8 mm in diameter) received intravenous injections of PBS, ST1/pIKDE-EGFP or ST1/pIKDE-DTA (2×10.sup.7 cfu/mouse) (n=5 to 8 per group). (A) Tumor volumes were measured every other day after a single injection. Values are expressed as mean±s.e.m. (B) Representative photomicrographs of the tumors treated with ST1/pIKDE-EGFP or ST1/pIKDE-DTA at the endpoint. (C) Bright field imaging and H&E staining of the lungs from 4T1 tumor-bearing mice treated as described above. Scale bars, 1 cm for bright field imaging; 250 μm for H&E staining. Each dot represents the number of nodules per mouse. Horizontal bars indicate the mean values in each group.

(26) FIG. 26 Kaplan-Meier survival curves of 4T1 tumor-bearing mice administered with the indicated treatments.

(27) FIGS. 27A-D ST1/pIKDE-DTA administration potently suppressed tumor growth in the MDA-MB-231 tumor-bearing nude mice. Tumor volumes were measured every other day over 20 days after a single injection. (A) Tumor growth curve for breast tumors received the indicated treatments. Values are expressed as mean±s.e.m. (n=5). (B) Kaplan-Meier survival curves of the tumor-bearing mice injected intravenously with either ST1/pIKDE-EGFP or ST1/pIKDE-DTA, and PBS. A significant improvement in survival was found in ST1/pIKDE-DTA treated mice compared with controls (n=12). (C) Representative photomicrographs of tumor-free mice after ST1/pIKDE-DTA treatment.

(28) FIG. 28 Schematic diagram of ST1-mediated inter-kingdom RNAi. After successful entry and rupturing the phagosomal membrane, all the bacterial content, including genetic materials (shRNAs and eukaryotic expression vectors encoding shRNA) and proteins, can reach to the cytoplasm of tumor cells. Only a finite amount of T7 RNAP and its mRNA could be released into the cytoplasm. Regardless, this should provide enough polymerases to trigger further T7 RNAP mRNA transcription in the cytoplam via P.sub.T7 through a positive feedback loop. After endocytosis, a small portion of plasmid DNA can be transferred to the nucleus where the transcription of T7 RNAP can be initiated at a constitutive P.sub.CMV promoter. The accumulation of T7 RNAPs driven by dual (cytoplasmic and nuclear) expression system results in a subsequent transcription of shRNA from pIKR-shRNA by mammalian cells takes place in the cytoplasm. Then a series of RNAi processing steps will occur sequentially in mammals.

(29) FIGS. 29A-B ST1-mediated combined inter-kingdom RNAi in vivo via specific cleavage of mRNA. Analysis of gene silencing effects in tumors at week 3 following treatments. (A) Quantitative real-time RT-PCR analysis of the reduction of PLK1 mRNA after the indicated treatments. (B) In vivo 5′-RACE analysis of RNA extracted tumors confirmed the presence of specific cleaved product (414 bp).

(30) FIGS. 30A-G Targeted knockdown of protein expression by ST1-mediated RNAi. (A) Western blot analysis for the target protein expression in the MDA-MB-231 tumors as indicated. (B) Representative histopathologic and immunohistochemical staining of target protein on tumor sections as indicated. Scale bar, 50 μm.

(31) FIG. 31 ST1-mediated RNAi does not upregulate the expression of OSA1 in the tumor-bearing mice. At the endpoint, the OSA1 mRNA levels in the indicated groups were determined by quantitative real-time RT-PCR. The levels of OAS1 mRNA were normalized to that of GAPDH mRNA, and the relative mRNA levels in the ST1/pIKR-shTom and ST1/pIKR-shPLK treated tumors were expressed as a ratio to that in PBS group. Values are mean±s.e.m. (n=3).

(32) FIGS. 32A-B Incorporation of T7 RNAP autogene cassette enhances the silencing efficiency. (A) The target protein levels treated with ST1 carrying shRNA expression plasmid with (ST1/pIKR-shPLK) or without T7 RNAP autogene (ST1/pIKR A T7P-shPLK) were compared at week 3 following injections. (B) shRNA levels in ST1/pIKR-shPLK and ST1/pIKRAT7P-shPLK treated mice were measured by quantitative stem-loop RT-PCR. Results are referred as mean±s.e.m. of 3 to 5 mice.

(33) FIG. 33 Tumor growth curves of mice receiving with PBS, ST1/pIKR-shTom or ST1/pIKR-shPLK treatments.

(34) FIGS. 34A-L Representative results of tumor sections immunostained for expression of endothelial cell marker CD31 and TUNEL assay for detecting cell apoptosis. Scale bar, 25 μm.

(35) FIGS. 35A-B Body weights (A) and spleen weights (B) of mice receiving with PBS, ST1/pIKDE-DTA or ST1/pIKR-shPLK treatments.

(36) FIG. 36 Serum ALT and AST levels (mean±s.e.m., n=3) in mice receiving the indicated treatments at the endpoint.

(37) FIGS. 37A-I Spleen, liver and kidney were fixed in 4% PFA and embedded in paraffin blocks. Tissue sections were stained using hematoxylin-eosin for light microscopic examination. Histopathological changes in the kidney, spleen and liver of the mice received bacterial treatments were examined. No apparent damages were found in any of the organs in either treatment group. Scale bar, 50 μm.

(38) FIGS. 38A-B Electron microscopy of exosome and western blot analysis of exosome-specific HSP70 protein.

(39) FIGS. 39A-B Presence of tumoricidal protein in the exosome-like microvesicles derived from the mice treated with ST1/pIKDE-DTA. (A) Isolated RNA from vesicles was used for RT-PCR detection. A specific PCR product was detected corresponding to DT-A transcript. (B) Validation of the presence of DT A chain by western blot. Exosomal proteins from the tumors were loaded onto a 12% acrylamide gel and probed with anti-DT A chain antibody. Exosomes derived from ST1/pIKDE-DTA treated tumors were positive for DT A chain.

(40) FIGS. 40A-D (A) Presence of shRNA against CTNNB1 in the exosomes isolated from tumors. Gel electrophoresis analysis confirmed the presence of shRNA against CTNNB1 in the exosomes from tumors infected with ST1/pIKR-shCAT but not in ST1/pIKR-shTom group. (B) Hematoxylin and eosin stain and immunohistochemical analyses on tumor sections. Excised breast tumors from tumor-bearing mice on day 20 were fixed in 4% paraformaldehyde and embedded in paraffin. Serial 5-μm sections were subjected to hematoxylin and eosin staining, immunohistochemical assay with Salmonella and β-Catenin antibody. Shown are low-power field examples of tumor sections from mice treated intravenously with PBS, ST1/pIKR-shTom or ST1/pIKR-shCAT. All images were acquired at ×40 magnification using Nikon microscope. Low magnification overviews (Scale bar, 2 mm).

(41) FIG. 41 Results from ELISA experiments showing HA-specific IgG responses raised by the ST1/pIKDE-HA. 10.sup.7 bacteria were used to prime and each mouse were given three boosts on day 14, 21 and 28; all by i.p. Blood sera from infected mice were collected on day 14, 28 and 35 for ELISA analysis.

(42) FIG. 42 The steps of constructing long homology-arm recombination vectors. Firstly, 1000 bp long homology arms targeting asd gene were cloned into the plasmid pYB-asd. Secondly, PsseA and chloramphenicol resistance gene (cat) were amplified and cloned into pYB-asd-PsseA-cat. Finally, hlyA gene was cloned into pYB-asd-PsseA-cat to generate plasmid pYB-asd-hlyA.

(43) FIGS. 43A-B HE-stained (left) and anti-Salmonella mmunohistochemical stained (right) paraffin sections of CT26 tumor on day 14 p.i. with SL008 cells. Low magnification overviews, black bar correspond to 1 mm.

(44) FIG. 44 Balb/c mice with CT26 colon tumor received temporal vein injections of ST1 (SL004), SL007 or SL008. Mice were euthanized on day 14 and liver, spleen and tumor tissues were collected and homogenized and bacterial accumulation evaluated. In ST1(SL004) (black), SL007 (white) or SL008 (gray) treated mice, CFU counts per gram organs are shown as mean±s.e.m. (n=3).

(45) FIG. 45 Construction of plasmid pET32a-infA for maintaining bacterial survival after infA deletion. The infA expression cassette including its promoter and terminator region was cloned from E. coli MG1655.

(46) FIG. 46 Stability determination of plasmid pET32-infA in vitro. Bacterial cells were routinely cultured by daily sub-culturing without antibiotic supplement. The number of plasmid-carrying cells was determined by replica plating onto LB agar plates with ampicillin. Numbers indicate the proportion of plasmid-harboring cells recovered at different time points. Filled line: infA-strain ST1 harboring pET32-infA, Broken line: Parental strain SL003 transformed with pET32-infA.

(47) FIGS. 47A-B EGFP positive cells were directly measured by FACS analysis. Human MDA-MB-231 cancer cells treated with PBS alone were defined as mock controls. 2000 cells were acquired. Dot plot representation of percentage of mammalian cells infected with ST1/psgfp showing green fluorescence.

(48) FIGS. 48A-O Surface display and secretion expression of reporter proteins by ST1. (A) ST1/pLpp_ompA_GFP was cultured and directly photographed by fluorescent microscopy. (B) Secretory expression of recombinant protein SspH2 (1-142aa)-GFP by ST1/pSspH2-GFP in vitro. The tdTomato-expressing MDA-MB-231 cells were infected with ST1 harboring pGFP or pSspH2-GFP for expressing fluorescent marker. The intracellular location of GFP was examined by fluorescent microscopy.

(49) FIGS. 49A-D The predicted sequence of pSspH2-Endostatin.

(50) FIGS. 50A-C Secretion of SspH2-Endostatin fusion proteins from SL008/pSspH2-Endostatin inhibits angiogenesis. (A) The cell lysate and cultured medium of SL008/pSspH2-Endostatin were positive for SspH2-Endostatin by western blot analysis. (B) Inhibition of tumor angiogenesis was estimated by CD31 immunohistochmical analysis. (Magnification, 200×).

(51) FIGS. 51 A-B Anti-tumor effects in the immune-competent mice with aggressive CT26 colon tumors. Tumor-bearing mice treated with Endostatin-expressing SL008. Tumor growth curve (A) and actual size (B) of mice received with the indicated treatments.

(52) FIGS. 52 A-B (A) Diagram of EGFP mRNA transcription in ST1/pT7-EGFP. FIG. 52A discloses “AAAA.sub.20” as SEQ ID NO: 100. (B) Western blot analysis of EGFP expression at 48 h post infection with ST1 harboring functional mRNA.

(53) FIGS. 53A-D Fluorescence microscopy analysis of the cells at 48 h post infection with ST1/pIKDE or ST1/pIKDE-EGFP.

(54) FIGS. 54A-E The predicted sequence (SEQ ID NO: 101) of pIKDE-DTA.

(55) FIGS. 55A-C Effects of ST1/pIKDE-DTA and SL008/pIKDE DTA in CT26-bearing mice. (A) Tumor growth curves for CT26 tumors receiving the indicated treatments. Values are expressed as mean±s.e.m. (B) Intratumoral expression of DT A chain was detected by western blot. (C) Representative photomicrographs of ST1/pIKDE-EGFP and ST1/pIKDE-DTA treated mice at the endpoint.

(56) FIGS. 56A-F The predicted sequence (SEQ ID NO: 102) of pIKDE-IIA.

(57) FIGS. 57A-E The predicted sequence (SEQ ID NO: 103) of pIKR-shCAT.

(58) FIGS. 58A-G ST1/pIKR-shCAT could elicit a potent and specific gene silencing and induce massive cell death in MDA-MB-231 cancer cells. (A) ST1/pIKR-shCAT infection decreased 13-Catenin and its downstream gene expression and activated Caspase-3 expression. ST1 harboring the control vector cannot interfere with 13-Catenin expression. (B) MTT analysis of cell viability (over 0-96 h) following PBS treatment, treatment with ST1/pIKR-shTom or ST1/pIKR-shCAT. The absorbance of each well at wavelength 600 nm was measured by an ELISA reader. (C) Annexin-V and propidium iodide staining analysis of cell death following the indicated treatments. Flow cytometry indicated cell fractions undergoing cell death (Annexin-V positive, propodium iodide positive) and early apoptosis (Annexin-V positive, propidium iodide negative). Data shown as mean±s.e.m. of three separate experiments.

(59) FIGS. 59A-F Effects of ST1/pIKR-shCAT injection on MDA-MB-231 breast tumors. Tumor growth curves (A) and actual sizes (B) receiving the indicated treatments. (C) Western blot analysis of 13-Catenin and a-Tubulin (internal control) expression in tumors at the end point. (D) Tumors were collected from 5 animals on day 20, homogenized and plated onto agar plates with or without ampicillin selection to determine the counts of recombinant and total bacteria, respectively. Values are expressed as mean±s.e.m.

5. DETAILED DESCRIPTIONS

(60) Since Salmonella is closely related to the Escherichia genus and has a broad host range, its genomic information is clear and share many common features with E. coli. Compared to gram-positive bacteria (e.g. Clostridium), Salmonella is easier to perform genetic manipulations. It survives and proliferates within cells; therefore it can deliver genetic materials in the targeted cells. For example, it may directly deliver ectopic mRNA and utilize the translation machinery of host cells to synthesize the corresponding exogenous proteins. On the other hand, since it is facultative anaerobic, it is easy to culture it in vitro and then send them to target hypoxic region within tumors. More important, genetically attenuated Salmonella vectors provide additional safety as they can be readily controlled or eliminated from the human body by the application of ciprofloxacin in case of serious sepsis and can avoid (random) genomic integration {Crull, 2011 #955}. Thus, Salmonella can serve as both bacterial “weapon” and “vector” in research and medication.

(61) In the process of utilizing live attenuated Salmonella as a carrier in cancer therapy or DNA vaccination, safety, stability and delivery efficiency are the most important issue, which can be solved by deleting virulent genes and inserting functional genes. For example, by placing an essential gene asd under a hypoxia controlled genetic circuit, S. typhimurium strain SL7207 was engineered to an obligate anaerobic Salmonella strain YB1. YB1 could only survive inside the tumor, but were totally cleared from other normal tissues. However, its curative ability needs to be further improved. Description of YB1 is in pending U.S. patent application Ser. No. 13/871,716, filed Apr. 26, 2013, the content of which is incorporated by reference in its entirety.

(62) Therefore, the present disclosure provides a superior modified bacterial strain that has improved curative ability. Provided herein is a modified bacteria comprising one or more of the following characteristics: (a) deletion of one amino acid biosynthesis-related gene aroA; (b) mutation of gmd gene to preclude the biofilm formation; (c) placing an essential gene aspartate-semialdehyde dehydrogenase (“asd”) with a tightly hypoxic control; (d) deletion of the stress response gene htrA; (e) introduction of an infA.sup.+ (cloned from E. coli MG1655 strain) plasmid in infA.sup.− mutant makes the bacterial strain plasmid-dependent and (f) integration of the hlyA gene coding for Listeriolysin O (LLO) under the regulation of Salmonella pathogenicity island II promoter into the genome. In certain embodiments, the modified bacteria comprise two, three, four or five of the above-identified characteristics. In one embodiment, the modified bacteria comprise all of the above-identified characteristics.

(63) In one embodiment, the modified bacterium comprises a vector comprising T7 RNAP and an essential gene under a tightly hypoxic regulation. In one embodiment, the T7 RNAP is under the control of lac promoter. In one embodiment, the essential gene is asd. In one embodiment, the FNR related anaerobic capable promoter PpepT controls asd transcription while an aerobic promoter, PsodA, facilitates transcription of antisense asd that blocks any leakage of asd expression under aerobic conditions. In one embodiment, the modified bacterium is ST1.

(64) In one embodiment, the modified bacterium comprises a vector comprising a transgene under the transcription regulation by P.sub.T7 and P.sub.CMV and a T7 RNAP autogene expression cassette. In one embodiment, the transgene and the T7 RNAP comprise a viral ribosome binding site (IRES.sub.EMCV). In one embodiment, the transgene expresses therapeutic molecules including RNA, DNA and proteins. In one embodiment, the transgene express cytokine. In one embodiment, the cytokine is cytokine sTRAIL. In one embodiment, the transgene expresses a fusion protein. In one embodiment, the transgene is a toxin. In one embodiment, the toxin is DT-A. In one embodiment, the transgene is an antigen. In one embodiment, the antigen is Influenza A virus (A/Shanghai/4664T/2013(H7N9)) hemagglutinin (HA). In one embodiment, the modified bacteria comprise a vector with chromosomal infA, aroA and gmd deletion and site-specific integration of T7 RNAP and hlyA gene. In certain embodiments, the vector comprises one or more of the following: (i) less than 10 kb of sequences; (ii) an origin of replication; (iii) E. coli infA locus; (iv) T7 RNAP autogene cassette; (v) a 72-bp element of the SV40 enhancer for enhancing nuclear entry and (vi) therapeutic gene expression driven by both P.sub.CMV and P.sub.T7. In one embodiment, the vector is ST1.

(65) In one embodiment, the transgene expresses an oligonucleotide encoding a shRNA or a microRNA precursor. In one embodiment, the shRNA is against a cell cycle-associated protein polo-like kinase 1 (“PLK1”). In one embodiment, the shRNA is against a key intracellular signal transducer beta-catenin (“CTNNB1”) in the Wnt signaling pathway. In one embodiment, the microRNA precursor is tumor suppressor microRNA let-7.

(66) Described herein is a method of making the modified bacteria. The method comprises one or more of the following steps: (a) deletion of the amino acid biosynthesis-related gene, such as aroA, gua, thy, leu and arg gene; (b) mutation of the genes required for biofilm formation on the surface of epithelial cells, such as csgD, adrA and gmd; (c) placing an essential gene asd with a tightly hypoxic control; (d) construction of a balanced-lethal system in which the infA gene of E. coli MG1655 strain was designed to be introduced in a plasmid that complements an infA mutation in the chromosome of the Salmonella strain; (e) deletion of the stress response gene, such as htrA, recA and hsp gene and (f) integration of a pore-forming cytolysin gene under the control of an in vivo-inducible promoter.

(67) Described herein is a tumor-targeting vector for prokaryotic-eukaryotic delivery and expression and a method of making the vector. In a preferred embodiment, an engineered strain ST1, was generated in the Salmonella 7207 strain background using the λ Red-mediated ‘long homology arm’ recombination technology. In certain embodiments, the method comprises one or more of the following steps: (i) integration of a T7 RNA polymerase (T7 RNAP) gene into the gmd chromosomal locus; (ii) mutation or deletion of gmd gene encoding GDP-mannose 4, 6-dehydratase; (iii) replacement of an essential gene, such as asd with a pore-forming listeriolysin O gene such as hlyA; (iv) the essential gene such as asd gene with anaerobic control, for example, an essential gene expression cassette comprising an essential gene cloned behind a hypoxia-inducible promoter in the sense orientation as well as a aerobic promoter in the antisense orientation is added at the htrA gene locus; (v) double mutation of asd and htrA; and (vi) relocate a small essential gene such as infA (encoding for translation initiation factor 1) from chromosome to plasmid.

(68) In certain embodiments, the modified bacteria include, but not limited to Salmonella, Escherichia coli, Shigella, Bacillus Calmette-Guerin (BCG), Listeria monocytogenes, Yersinia, Mycobacterium, Streptococcus, and Lactobacillus. In certain embodiments, the modified bacteria are Salmonella typhimurium, Salmonella choleraesuis, Salmonella enteritidis and S. typhimurium, Escherichia coli, Escherichia. coli K-12, Escherichia. coli O157:H7, Shigella, Shigella dysenteriae, Shigella flexneri, Shigella boydii, Shigella sonnei, Yersinia, Yersinia pestis, Yersinia pseudotuberculosis and Yersina enterocolitica.

(69) Provided herein is a method of producing exosomes comprising one or more protein or peptides, mRNA, shRNA, microRNA or a combination therefore. The method comprises the steps of infecting a host animal with ST1 that comprises a vector expressing a transgene; and isolating exosomes from said host animals.

5.1 Generation and Functional Assays of Tumor-Targeted Delivery and Expression Vector ST1

(70) ST1 strain was engineered from the auxotrophic S. typhimurium 7207 strain through a series of genetic manipulations (FIG. 1, Table 1). The SL7207 stain has the following genotype: S. typhimurium 2337-65 derivative hisG46, DEL407 [aroA::Tn10 (Tcs)]. First, the integration of T7 RNAP expression cassette into the gmd chromosomal locus leads to a moderate, stable level of T7 RNAP in the bacterial cells (FIG. 2A) and an inability to form colanic acid (FIG. 2B). T7 RNAP-mediated transcription within bacterial hosts triggered the expression of reporter gene downstream of the P.sub.T7. Next, by placing the essential gene asd under a tightly hypoxic regulation at the htrA locus, the lethal toxicity of parental strain has been totally removed while the targeted capability significantly increased without compromising the normal functions (FIG. 3 & FIG. 4A). ST1 is accumulated in tumors and other organs during a 3-week observation (FIG. 4A). A large number of bacteria accumulate within the solid tumors, achieving about 10.sup.8-10.sup.9 cfu/gram tissues. Lack of nonspecific accumulation in the liver and other organs is a major improvement over most current bacterial systems. In contrast, ST1 was gradually eliminated from healthy tissues. Biodistribution study of normal organs on 21 day post-infection also showed that the bacteria were barely detectable in mouse blood, lung, heart, liver, spleen, kidney and lymph node, which further showed that this bacterial vector is replication-incompetent in normal organ tissues. A more detailed examination of the distribution of ST1 inside the tumors revealed that the bacteria were resisted to the hypoxic regions (Hyperxyprobe-1 labeled) (FIG. 4B). As shown herein, after intravenous administration of ST1 into tumor-bearing animals, the bacteria are dispersed throughout the body, but only those that encounter the hypoxia/necrotic regions of the tumor can survive and amplify.

(71) ST1 can target the solid tumors and invade into the targeted cells (FIG. 5). Subsequently, the bacteria break the endosomal compartment with the helper protein LLO and release the multiple components into the cytosol of the targeted cells. For the first time, the phagosome-disrupting ST1 directly deliver both plasmid DNA and translation-competent mRNA with IRES.sub.ECMV structure driven by T7 RNAPs into the cytosol, leading to model gene (EGFP) expression (FIG. 6). To address the plasmid instability issue, an infA.sup.+ vector/infA.sup.− host maintenance system was developed. Colony-forming unit (CFU) tests suggested that both high-copy-number (pUC origin) and low-copy-number plasmid (CoE1 origin) in the ST1 was stable at 3 weeks in vivo (FIG. 7), while those in its paternal strain were disappearing within 48 h. The high-copy-number plasmids were still maintained (474.4±35.4 copies/cell) as long as 3 weeks in vivo. The advantages of this host/plasmid Salmonella stability system based on infA gene include no cross-feeding effect, small vector size, feasibility, avoiding antibiotics and antibiotic resistance genes.

(72) TABLE-US-00001 TABLE 1 Bacterial strains and plasmids used Strains and plasmids Relevant genotype Reference or source S. typhimurium SL7207 S. typhimurium 2337-65 derivative hisG46, Lab stock DEL407 [aroA::Tn10(Tc-s)]; wild type SL001 SL7207Δgmd::T7 RNAP This study SL002 SL7207Δgmd::T7RNAP; Δasd::PsseA-hlyA This study SL003 SL7207 Δgmd::T7 RNAP; Δasd::PsseA-hlyA; This study ΔhtrA::cat-PpepT-asd-sodA SL004 (ST1) SL7207 Δgmd::T7 RNAP; Δasd::PsseA-hlyA; This study ΔhtrA::cat-PpepT-asd-sodA; ΔinfA::tetR SL005 SL7207 Δgmd::T7 RNAP; ΔinvA This study SL006 SL7207 Δgmd::T7 RNAP; Δasd::PsseA-hlyA; This study ΔinfA::cat SL007 SL7207 Δgmd::T7 RNAP; ΔhtrA::PsseA-hlyA; This study ΔinfA::cat SL008 SL7207 Δgmd::T7 RNAP; Δasd::PsseA-hlyA; This study ΔhtrA::PpepT-asd-sodA; ΔinfA::tetR Plasmid pBSK-cat Ap.sup.R; Cm.sup.R; pBSK derivative with loxp-cat-loxp This study fragment pYB-asd-hlyA Ap.sup.R; Cm.sup.R; pBSK-cat derivative with long homology This study arms of asd sites; P.sub.sseA-hlyA-cat pYB-htrA-asd Ap.sup.R; Cm.sup.R; pBSK derivative with long homology This study arms of htrA sites; cat-PpepT-asd-sodA pYB-infA-tetR Ap.sup.R; Tet.sup.R; pBSK derivative with long homology This study arms of infA sites; infA locus from E.coli MG1655 strain pEGFP-C1 Km.sup.R; cloning vector Clontech pET32a-infA Ap.sup.R; pET32a (+) derivative with infA locus from This study E.coli MG1655 strain pcDNA3.1-infA Ap.sup.R; pcDNA3.1(+) derivative with infA locus This study pT7-EGFP Ap.sup.R; pET32-infA derivative with P.sub.T7-IRES- This study kozak-EGFP-pA.sub.20 (“A.sub.20” disclosed as SEQ ID NO: 1) pSE1 Ap.sup.R; pcDNA3.1(+) derivative with P.sub.CMV-IRES- This study EGFP pSE2 Ap.sup.R; pcDNA3.1(+) derivative with P.sub.T7-IRES- This study EGFP pSE3 Ap.sup.R; pcDNA3.1(+) derivative with P.sub.CMV/T7-IRES- This study EGFP pIKDE-EGFP Ap.sup.R; pcDNA3.1(+) derivative with EGFP expression This study cassette driven by P.sub.CMV/T7 dual promoter and T7 RNAP autogene cassette pIKDE Ap.sup.R; pIKDE-EGFP derivative without EGFP gene This study pIKDE-DTA Ap.sup.R; pcDNA3.1(+) derivative with DT-A expression This study cassette driven by P.sub.CMV/T7 dual promoter and T7 RNAP autogene cassette pIKDE-Endo Ap.sup.R; pcDNA3.1(+) derivative with Endostatin This study expression cassette driven by P.sub.CMV/T7 dual promoter and T7 RNAP autogene cassette pIKDE-HA Ap.sup.R; peDNA3.1(+) derivative with Influenza A virus This study hemagglutinin (HA) expression cassette driven by P.sub.CMV/T7 dual promoter and T7 RNAP autogene cassette pIKDE-PEA Ap.sup.R; pcDNA3.1(+) derivative with PEA (II + III) This study expression cassette driven by P.sub.CMV/T7 dual promoter and T7 RNAP autogene cassette pIKDE-shepherdin Ap.sup.R; pcDNA3.1(+) derivative with Shepherdin This study expression cassette driven by P.sub.CMV/T7 dual promoter and T7 RNAP autogene cassette pIKDE-sTRAIL Ap.sup.R; pcDNA3.1(+) derivative with soluble TRAIL This study expression cassette driven by P.sub.CMV/T7 dual promoter and T7 RNAP autogene cassette pLpp_ompA_GFP Ap.sup.R; pET32-infA derivative with Lpp_ompA This study fragment with GFP pSspH2-GFP Ap.sup.R; pET32-infA derivative with SspH2_(1-142aa)_ This study FLAG fragment with GFP pLpp_ompA_sTRAIL Ap.sup.R; pET32-infA derivative with Lpp_ompA This study fragment with sTRAIL pSspH2-sTRAIL Ap.sup.R; pET32-infA derivative with SspH2_(1-142aa)_ This study FLAG fragment with sTRAIL pSspH2-Endostatin Ap.sup.R; pET32-infA derivative with SspH2_(1-142aa)_ This study FLAG fragment with mouse Endostatin pIKR-shTom Ap.sup.R; pcDNA3.1(+)-infA derivative with T7 RNAP This study autogene cassette driven by P.sub.CMV/T7 dual promoter and shRNA cassette against tdTomato pIKR-shPLK Ap.sup.R; pIKR-shTom derivative with shRNA This study sequence against human PLK1 pIKR-shCAT Ap.sup.R; pIKR-shTom derivative with shRNA This study sequence against human CTNNB1 pIKR-shTAK1 Ap.sup.R; pIKR-shTom derivative with shRNA This study sequence against human TAK1 pIKR-let-7 Ap.sup.R; pIKR-shTom derivative with human let-7a This study miRNA TRIP Ap.sup.R; transkingdom RNA interference plasmid (Xiang, Fruehauf et al. 2006) TRIP-shCAT Ap.sup.R; TRIP derivative with shRNA sequence against (Xiang, Fruehauf et al. CAT 2006) TRIP-shCAT-infA Ap.sup.R; TRIP-shCAT derivative with infA locus This study

5.2 ST1 Carrying an Inter-Kingdom Dual Expression (IKDE) System Leads to a Rapid and High-Level Transgene Expression

(73) Although ST1 is able to localize the cell cytoplasm and efficiently release genetic materials, one obstacle most likely still hindering DNA delivery is the nuclear trafficking. Here, a novel IKDE system is provided, including a T7 RNAP-based cytoplasmic expression system as well as the nuclear system. The activation of transgene expression was based on an inter-kingdom interaction of bacteria and host cells (FIG. 8). First, plasmid pIKDE-EGFP was constructed (FIG. 9), which contains a transgene expression cassette under the transcriptional regulation by both P.sub.T7 (cytoplasmic) and P.sub.CMV (nuclear) through a dual expression system and a T7 RNAP autogene-based cytoplasmic expression cassette. Furthermore, the insertion of a ribosome binding site (IRES.sub.EMCV) allows for the cap-independent translation of cytoplasmic transcripts driven by T7 RNAPs.

(74) Next, kinetics of the reporter expression was tested after ST1-mediated delivery of an IKDE system versus that of plasmid DNA and/or translation-competent mRNA in the post-infection period (FIG. 10). The EGFP expression resulting from ‘pre-made’ translation-competent mRNA released by ST1/pIKDE-EGFP occurred as early as 5 h after infection (FIG. 11), whereas EGFP expression after delivery of plasmid DNA pSE3 (P.sub.CMV-IRES-EGFP) was only observed 24-48 h post infection (p.i.). The DNA/RNA dual delivery by ST1/pSE3 (P.sub.CMVM-IRES-EGFP) led to a higher expression level compared to a single delivery system, evidencing that ST1-mediated delivery of eukaryotic plasmid DNA plus translation-competent mRNA significantly enhanced ST1-mediated transfection efficiency. In the time course, EGFP expression in ST1/pIKDE-EGFP maintained at the highest levels at all time points, resulting in a >50-fold and 10-fold increase in the average gene expression compared to a standard nuclear and DNA/RNA dual delivery system, respectively (FIG. 12). This indicated that the incorporation of an autogene expression cassette can maintain a stable and continuous cytoplasmic expression of a gene of interest through a self-amplifying regeneration mechanism for the polymerases. It is the first report to date describing the design and use of such combined inter-kingdom expression system in gene therapy.

5.3 In Vitro Screening of Potential Drugs by ST1-Mediated Inter-Kingdom Gene Transfer and RNAi System

(75) We are capable of having far more effective in vitro and in vivo screening methods. Using our synthetic inter-kingdom expression platform, the intracellular expression of proteins and small interfering RNAs can be achieved by ST1-mediated gene transfer and RNAi. We sought to assess the therapeutic effects of promising candidates (Table. 2) on human cancers by in vitro screening. ST1 harboring different therapeutic candidates (e.g. protein, DNA or RNA, either individually or in combination) were added to the medium and released multiple cargos into the cells. The effects of the therapeutic factors were detected by measuring or monitoring physiological events such as cell death, proliferation or disturbances in signal transduction pathways. Here, cell viabilities and apoptosis rates were measured to rapidly evaluate anti-tumor factors, including protein, shRNA and microRNA on human breast cancer MDA-MB-231 cells. Polypeptide DT-A and shRNA against PLK1 were most effective in suppressing growth and killing abilities (FIG. 13).

(76) TABLE-US-00002 TABLE 2 Potential candidates tested by ST1-mediated inter-kingdom system in vitro Drug candidates Description Functions EGFP Enhanced GFP Fluorescent protein DTA Diphtheria toxin Protein synthesis inhibitor figment A Endostatin type XVIII collagen's Angiogenesis inhibitor C-terminal fragment PEA (II + III) Pseudomonas exotoxin Protein synthesis inhibitor A domain Shepherdin Shepherdin (79-87 aa) Peptidomimetic antagonist of the complex between Hsp90 and survivin sTRAIL TRAIL'S soluble domain Apoptotic inducer shTom shRNA against dtTomato No actual target shCAT shRNA against human Wnt signaling pathway β-Catenin inhibitor and metastatic inhibitor shHer-2 shRNA against human Pro-apoptotic inducer and cell Her-2 growth inhibitor shPLK shRNA against human Pro-apoptotic inducer and cell Polo-like kinase 1 growth inhibitor shTAK1 shRNA against human Wnt signaling pathway TAK1 inhibitor and apoptotic inducer let-7 Human let-7a micro Cell cycle, proliferation, and RNA apoptosis regulator

5.4 a Host/Plasmid System Based on infA that is not Dependent on Antibiotics and Antibiotic Resistance Genes for Stable Plasmid Maintenance

(77) The present invention provides a method for plasmid maintenance, the method comprising: providing expression plasmids comprising the plasmid maintenance systems described herein and encoding for a protein of interest, said expression plasmids having copy numbers which vary from low copy number (1˜10 copies per cell) to medium copy number (15˜20 copies per cell) to high copy number (up to 100's of copies per cell); transforming bacterial live vectors with such expression plasmids; and testing for stabilities in vivo (FIG. 7). This system takes advantage of the phenotype of the infA.sup.− mutant, which can not synthesize translation initiation factor 1. A complementation plasmid with a functional copy of the infA gene from E. coli MG1655 was constructed providing a translation initiation factor source and thus allowing growth of the auxotrophic bacterial strain. Interestingly, E. coli infA expression cassette succeeded to complement infA.sup.− mutant S. typhimurium. Plasmid constructs based on this backbone could therefore be selected and maintained in culture without addition of antibiotics. We demonstrate the plasmids carrying an infA gene complemented the phenotype of the infA.sup.−, and that therapeutic plasmids carrying this selectable marker were maintained faithfully both in vitro and in an animal system in the absence of selection pressure (FIG. 7, also see Example 6.5). The main advantages of infA targeting include minimal metabiolic burden and no cross-feeding effect.

5.5 Engineered Tumor-Targeting Bacterial Vector ST1 Expressing Active Cytokines Leads to Delayed Tumor Growth

(78) Provided herein is a method of delivery of active anti-tumor proteins. In accordance with this invention therapeutic proteins are introduced into tumor cells via a bacterial vector comprising a nucleic acid sequence encoding for a therapeutic gene. Unlike traditional chemotherapy drugs, as a carrier for generating heterogenous therapeutic proteins, ST1 can selectively grow inside solid tumors and continuously release the biologically active proteins in situ at high regional concentration, thereby achieving maximal killing effects while sparing systemic cytotoxicity. Special delivery systems in Salmonella carriers such as surface display or secretion of therapeutic proteins were shown to be advantageous for eliciting antitumor responses. FIG. 14 presented two strategies to express cytokine sTRAIL. One is to deliver the therapeutic proteins through a surface display system by fusing with E. coli lpp_ompA (46-159) hybrid protein. Another one is to secrete them via Salmonella type III secretion system in the intracellular space or inside the tumor cells.

(79) To examine whether the soluble TRAIL fusion protein could target to surface, the outer-membrane fraction of ST1/pLpp_ompA_sTRAIL bacterial cells was isolated by ultracentrifugation. One single band migrating at a molecular mass of the expected size of the monomeric form of the Lpp_ompA (46-159) fusion protein was detected by western blot (FIG. 15). Another plasmid pSspH2-sTRAIL was constructed to express chimeric proteins. In this plasmid, 1-142 amino acids from protein SspH2, which are recognized as the secretion signal for Salmonella type III secretion system, were fused to a soluble TRAIL encoding sequence. The correct plasmid was transformed into ST1 by electoporation. ST1/pSspH2-sTRAIL was exposed to MDA-MB-231 cells and the presence of SspH2-sTRAIL in the culture medium and the translocated fraction were confirmed by western blot. ST1 secreted the fusion proteins into the cytosol of target cells through the type III secretion system; while a type III secretion-defective (ΔinvA) failed to translate (FIG. 16). To study the bacterial colonization and distribution of sTRAIL inside the tumors, immunohistochemistry assays on tumor sections were carried out. As shown in FIG. 17, the presence of sTRAIL was detected in tumor specimens, indicating that sTRAIL-expressing ST1 successfully expressed exogenous cytokines in vivo.

(80) After validation of protein expression, the tumor inhibitory effects were examined in a nude mouse model. Tumor volumes were monitored by a two-dimensional caliper measurement. As indicated in FIG. 18A, tumors in the PBS treated group grew exponentially; increasing 10-fold during the observed period. Tumor growth was continuously reduced during the first week post-injection in the sTRAIL-expressing ST1 treated groups, and the difference between ST1/pLpp_ompA_sTRAIL or ST1/pSspH2-sTRAIL with vector controls was significant (P<0.05). ST1 alone had slight anti-cancer effect on breast tumors; with ˜25% inhibition on day 20. The mean tumor volume was reduced by approximately 70% after treatments with the sTRAIL-expressing ST1, which created a sTRAIL-enriched tumor microenvironment, leading to a more potent suppression effect that that achieved by ST1 treatment alone. During the treatments, the animals in bacterially treated groups showed a transient weight loss (FIG. 18B). However, the observed weight loss was totally reversible after several days post injections. ST1 gradually disappeared in normal tissues after intravenous administration with no significant side effects (FIG. 19). Gross appearances and behaviors of mice provided no signs of systemic toxicity.

5.6 Suppression of Tumor Growth and Metastasis by ST1-Mediated Expression of Therapeutic Genes

(81) In vitro results encourage us to determine whether ST1 could trigger a high level expression of therapeutic genes in vivo. In a certain embodiment, DT-A gene, encoding the catalytic fragment of diphtheria toxin, was cloned into plasmid pIKDE. The bacteria-vector system consists of the Salmonella ST1 with chromosomal infA and gmd deletion, integration of T7 RNAP and LLO expression cassette, and tightly anaerobic control of survival, carrying a plasmid pIKDE-DTA with the following features: (1) a reasonably small size (9.7 kb); (2) an origin of replication responding for a high copy number; (3) E. coli infA locus allowing in vivo plasmid maintenance; (4) T7 RNAP autogene cassette which can amplify the polymerases after cytoplasmic entry; (5) a 72-bp element of the SV40 enhancer and (6) the suicide gene was fused in frame with the Kozak sequence and inserted into down-stream of the CMV/T7 combinational promoter. It is the first report to date describing the design and use of such a T7 RNAP autogene-based nuclear/cytoplasmic dual expression system.

(82) The therapeutic efficiency of ST1/pIKDE-DTA was tested in a metastatic breast cancer model. To do so, 4T1 mouse tumor cells were implanted into the mammary fat pad of immune-competent, syngeneic BALB/c hosts. The 4T1 tumors are highly malignant and often lead to death because of metastasis, rapid growth rate and limited treatment options. Biodistribution experiments in the immune-competent mice confirmed that the bacteria were specifically internalized by primary tumors and metastatic nodules (FIG. 20). In animals that received ST1/pIKDE-DTA treatment, tumor-specific DT A chain expression increased gradually over the course of several weeks (FIG. 21A). After 3 weeks, all the mice have been sacrificed and primary tumors have been harvested. First, total RNA was reverse transcribed by using DT-A specific reverse anchor primer. 92.7±1.7% transcripts in cells were driven by T7 RNAP-based cytoplasmic expression system (FIG. 21B). Next, immunocytochemistry followed by indirect immnunofluorescence and DAPI staining on tumor sections revealed the definitive intracellular presence of bacterial toxins (red) in the cytosol of ST1/pIKDE-DTA (green) infected cells, but not in ST1/pIKDE infected counterparts (FIG. 22). Western blot (FIG. 23A) and immunohistochemical analysis also confirmed the intracellular expression of DT A chain (FIG. 23B). The spatial distribution of ST1 and DT A chain in tumor sections revealed the therapeutic proteins diffused around the bacteria and some molecules have been found to be transferred to the viable rim (FIG. 23B), which contributed to extensive tumor cytolytic abilities. Relative to vector control, the in situ expression of DT-A triggered by ST1/pIKDE-DTA caused significant cell death (P=0.022) in a short time (at 3 days) after treatments (FIG. 24).

(83) In vivo antitumor effect of ST1-mediated expression of DT A chain was evaluated in terms of tumor growth and survival rate. Systemic delivery of ST1/pIKDE-DTA potently reduced growth of primary tumors (FIG. 25A, B) and pulmonary metastases (FIG. 25C) in mouse models using multidrug-resistant murine tumors, whereas ST1/pIKDE-EGFP showed a slight inhibitory effect. A single dose of 5×10.sup.7 ST1/pIKDE-DTA resulted in turning tumor into a crusty mass and enabled the complete survival of mice bearing aggressive tumors (FIG. 26). Similar results were also obtained in the study of the MDA-MB-231 xenograft model. Mice bearing established tumors (˜250 mm.sup.3) were dosed once with 100 μl PBS, ST1/pIKDE or ST1/pIKDE-DTA. In the PBS treated group, the tumors grew rapidly and exceeded a mean of 2500 mm.sup.3 at day 24, while nearly 90% of tumor burden was inhibited in the ST1/pIKDE-DTA treated mice, with a mean volume of 274±66.0 mm.sup.3 at the same time point (FIG. 27A). Medium survival of ST1/pIKDE-DTA treated mice is significantly longer than either the empty vector treated mice (44 days) or untreated controls (41 days), with an increase in the 60-day survival from 0% to 75% (P<0.001) (FIG. 27B). After ST1/pIKDE-DTA injection, 25% tumors (3 of 12) were totally eliminated with breast tumors, and the animals remained cancer-free and survived till the 2-month observation stopped (FIG. 27C). Taken together, ST1/pIKDE-DTA treatment was effective in tumor shrinkage and greatly reduced the risk of death by tumor development.

5.7 ST1-Mediated an Enhanced Inter-Kingdom RNAi

(84) ST1 packaged with shRNA-encoding plasmid DNA has knockdown effects in human cancer xenografts. The theoretic steps implemented for inter-kingdom RNAi were shown in FIG. 28. First, the oligonucleotides encoding shRNA against no actual target tdTomato and a cell cycle-associated protein polo-like kinase 1 (PLK1) gene which express in most human tumors (Liu, Lei et al. 2006) was inserted to generate pIKR-shTom and pIKR-shPLK. The targeting sequence of human Plk1 (GenBank accession no NM_005030, term id. 34147632) is AGATCACCCTCCTTAAATATT (SEQ ID NO: 2), corresponding to the coding regions of positions 1424 to 1444. After transformation, a high amount of shRNA (5.9±0.6 pg/ng total RNA) was detected in the bacterial host. Subsequently, the MDA-MB-231 xenograft model was established and treated with PBS, ST1/pIKR-shTom or ST1/pIKR-shPLK. The targeted protein and mRNA expression were examined at 3 weeks following injections. PLK1 transcript level in tumors treated with ST1/pIKR-shPLK was 75.5±11.5% lower than the controls treated with the saline buffer (P=0.002) and 62.5±18.6% lower than in mice injected with vector control (P=0.015) (FIG. 29A). The presence of sequence-specific 5′ RACE-PCR cleavage products also confirmed a sustained RNAi-mediated mechanism of action up to 3 weeks after a single dose (FIG. 29B). A dramatic reduction of tumor-related gene expression in tumors with ST1/pIKR-shPLK at protein levels was also confirmed by western blot (FIG. 30A) and immunohistochemical assay (FIG. 30B). No induction in interferon-inducible gene OAS1 (encoding 2′, 5′-oligoadenlylate synthetases) (P=0.42, n=3) was detected in ST1/pIKR-shTom or ST1/pIKR-shPLK treated mice (FIG. 31), suggesting cytokine induction was not responsible for the observed effects.

(85) The incorporation of T7 RNAP autogene cassette is designed to maintain a high transcription level in the mammalian system, which was confirmed by quantitative RT-PCR (159.1±67.4 copies/ng RNA). To determine whether the T7 RNAP-based cytoplasmic expression system elicits vector specific shRNA transcription in the transformed Salmonella as well as in the bacterially infected host cells, the gene-silencing activity of ST1 harboring shRNA expression vector with or without the T7 RNAP locus were compared. As expected, the knockdown efficiency of ST1/pIKRΔT7P-shPLK (bacteria-mediated RNAi only) largely decreased compared to ST1/pIKR-shPLK (inter-kingdom RNAi) at a rather long time (FIG. 32A), which corresponded to a significantly lower level of shPLK expression as measured by quantitative real-time RT-PCR (FIG. 32B, P=0.006). These results suggested that systemic administration of ST1 with inter-kingdom RNAi system could induce a potent, specific and continuous gene silencing in mammals after a single treatment.

(86) The enhanced therapeutic effect of bacteria plus ST1-mediated inter-kingdom RNAi led to a noticeable tumor growth reduction compared to that in controls (FIG. 33). On day 24 following treatments, the tumor volume was 2777.0±371.5 mm.sup.3 and 1928.8±520.6 mm.sup.3 in the buffer control and ST1/pIKR-shTom group respectively, whereas it was 903.8±303.8 mm.sup.3 in the ST1/pIKR-shPLK treated mice. Furthermore, decreased angiogenic marker CD31 expression and increased apoptotic tumor cells were observed in the tumors treated with ST1/pIKR-shPLK, which may contribute to tumor inhibitory effects observed in this study (FIG. 34).

5.8 Systemic Toxicity Testing of ST1-Mediated Therapeutic System

(87) In order to exclude any unspecific toxic effect responsible for the observed effects, preliminary acute toxicity experiments were conducted. Body weight of each mouse was recorded every other day. Total body weights of ST1 treated mice reduced at the beginning and then recovered to normal conditions (FIG. 35A). Treatment was well tolerated with no gross sign of sepsis and no acute spleen enlargement was detected after ST1 infection (FIG. 35B). To investigate the long-term consequences, serum alanine aminotransferase (ALT) and aspartate aminotransferase (AST) levels, an indicator of liver injury, were measured at the end point. These levels in all treatment groups were in the normal range (FIG. 36), which indicated no detectable hepatic stress. The reason might be that our therapeutic system causes low systemic toxicity and early recovery from the impaired liver function. No detectable pathological damage in the livers, kidney and lungs as shown in the H&E stained tissue sections (FIG. 37). According to these data, we conclude that the observed curative effects of our therapeutic system are unlikely related to systemic cytotoxicity.

5.9 Exosomes Derived from the Mice Infected with ST1 Harboring Inter-Kingdom Therapeutic System

(88) Provided herein is a novel exosome-based delivery platform that transfers exogenous cargoes to selected tissues. Exosomes are membrane-bond vesicles of nanoparticle size (40-100 nm) of endocytotic origin and act as natural carriers of mRNA, small RNA and proteins. Accumulating evidences indicate the exosomes may play a critical role in cell-to-cell communication. Various bioactive molecules from one cell can be transferred to another cell via exosomes. By taking advantage of its natural carrier capability, the exosome with exogenous genetic cargoes can facilitate a long-distance delivery of therapeutic factors. In addition, one advantage of these natural nanoparticles is an immune evasion allowing for repeat administration.

(89) Provided herein is a method to load exosomes with exogenous protein, mRNA and shRNA in vivo by ST1 infection and isolated them from murine model. Exosome-like microvesicles were harvested from the tumors treated with ST1/pIKDE (empty vector) and ST1/pIKDE-DTA by ultracentrifugation or differential centrifugation and filtered through a 0.2 μm size filter to remove impurities. The pelleted exosomes were further dissolved in DEPC water for RNA isolation and Electron microscopy or lysis buffer for protein extraction. Electron microscopy and western blot analysis (FIG. 38) of specific marker protein HSP70 confirmed the presence of exosomes. Total RNA isolated from exosomes was subjected to RT-PCR analysis to identify the presence of DT-A mRNA (FIG. 39A). Immunoblot detected a specific band corresponding to DT A chain (FIG. 39B). These data confirmed the presence of microvesicles containing the transgene mRNA as well as protein in the tumor microenvironment. The transfer of bioactive molecules mediated by these exosomes may contribute to the delivery of therapeutic factors to the uninfected cells (FIG. 23B). Additionally, we also detected the presence of exosomes containing shRNA against CTNNB1 in the mice infected by ST1/pIKR-shCAT (FIG. 40A). These endogenous exosomes may transfer shRNA to the uninfected cells and elicit overall reduction of target proteins in the tumor tissues (FIG. 40B). ST1 infection could generate large quantities of ‘self’ exosomes loading with therapeutics for intracellular delivery of these factors. The spatial diffusion pattern of these cytotoxic molecules may exert an enhanced oncolytic effect.

5.10 a DNA/RNA Vaccine Encoding H7N9 Virus HA Antigen Delivered by ST1

(90) The mutant strains of the invention are highly suitable for use in a live attenuated vaccine, as a live vector and a DNA-mediated vaccine. DNA vaccines have been the subject of much promising research against influznea, but the high copy number plasmids required are notoriously unstable in Salmonella. To solve this problem, an expression plasmid is provided which encodes (1) a Plasmid Maintenance system and (2) a protein operably linked to a dual promoter (3) a T7 RNAP autogene-based cassette. Therefore the stability and novel inter-kingdom dual expression platform enables the possibility of new vaccination strategies against H7N9.

(91) Here, we used the hemagglutinin (HA) from the avian influenza H7N9 virus as a model antigen, which is the essential vaccine antigen, to evaluate the ability of our engineered strain to deliver an antigen encoded by the improved DNA vaccine vector to host tissues. A DNA fragment encoding Influenza A virus (A/Shanghai/4664T/2013(H7N9)) hemagglutinin (HA) with Kozak sequence was inserted downstream of the IRES.sub.EMCV in the improved DNA vaccine vector to obtain pIKDE-HA. BALB/c mice were immunized intraperitoneally with ST1/pIKDE-HA at the dosage of 10.sup.7 CFU. In order to evaluate the humoral immune responses mounted against ST1/pIKDE-HA strain, ELISA assays were performed to test the anti-HA IgG responses using blood sera of vaccinated mice the 14.sup.th, 35.sup.th and 48.sup.th day after immunization. Results indicated that anti-HA responses of mice immunized with ST1/pIKDE-HA strain were moderate on the day 14 after immunization. After receiving three boosts on day 14, 21 and 28, the anti-HA IgG response in the mice were greatly increased. 100% mice (all 7 mice) had high anti-HA IgG responses on day 48 (FIG. 41).

5.11 Formulations

(92) The modified bacteria containing the RNA and/or DNA molecules provided herein can be formulated for a variety of types of administration, including systemic and topical administration. For systemic administration, injection is preferred, including intravenous, intramuscular, intraperitoneal, intrarectal and subcutaneous routes. For injection, the composition can be formulated in liquid solutions, preferably in physiologically compatible buffers such as Hank's solution or Ringer's solution.

(93) For oral administration, the pharmaceutical compositions may take the form of, for example, tablets or capsules prepared by mixing the effective amount of bacteria and the proper amount of additives according to known methods in pharmaceutical chemistry. Suitable formulations can be prepared by methods commonly employed using conventional, organicor inorganic additives, such as an excipient selected from fillers or diluents (e.g., sucrose, starch, mannitol, glucose, cellulose, calcium phosphate or calcium carbonate and the like), binders (e.g., cellulose, carboxymethylcellulose, gelatin, gum arabic, polyethlyeneglycol or starch and the like), disintegrants (e.g., sodium starch glycolate, croscarmellose sodium and the like), lubricants (e.g., magnesium stearate, light anhydrous silicic acid, sodium lauryl sulfate and the like), flavoring agents (e.g., citric acid, menthol and the like), preservatives (e.g., sodium benzoate, sodium bisulfate, methylparaben and the like), stabilizers (e.g., citric acid, sodium citrate, acetic acid and the like), suspending agents (e.g., methylcellulose, polyvinyl pyrrolidone or aluminum stearate and the like), dispersing agents (e.g., hydroxypropylmethylcellulose and the like), surfactants (e.g., sodium lauryl sulfate, polaxamer, polysorbates and the like), antioxidants (e.g., Ethylene diamine tetraacetic acid (EDTA), butylated hydroxyl toluene (BHT) and the like) or solubilizers (e.g., polyethylene glycols, SOLUTOL™, GELUCIRE™ and the like).

(94) The modified bacteria provided herein can be administered to a patient in the conventional form of preparations, such as injections and suspensions. Suitable formulations can be prepared by methods commonly employed using conventional, organic or inorganic additives, such as an excipient selected from fillers or diluents, binders, disintegrants, lubricants, flavoring agents, preservatives, stabilizers, suspending agents, dispersing agents, surfactants, antioxidants or solubilizers.

(95) Excipients that may be selected are known to those skilled in the art and include, but are not limited to fillers or diluents (e.g., sucrose, starch, mannitol, sorbitol, lactose, glucose, cellulose, talc, calcium phosphate or calcium carbonate and the like), a binder (e.g., cellulose, carboxymethylcellulose, methylcellulose, hydroxymethylcellulose, hydroxypropylmethylcellulose, polypropylpyrrolidone, polyvinylpyrrolidone, gelatin, gum arabic, polyethyleneglycol or starch and the like), a disintegrants (e.g., sodium starch glycolate, croscarmellose sodium and the like), a lubricant (e.g., magnesium stearate, light anhydrous silicic acid, talc or sodium lauryl sulfate and the like), a flavoring agent (e.g., citric acid, or menthol and the like), a preservative (e.g., sodium benzoate, sodium bisulfite, methylparaben or propylparaben and the like), a stabilizer (e.g., citric acid, sodium citrate or acetic acid and the like), a suspending agent (e.g., methylcellulose, polyvinyl pyrrolidone or aluminum stearate and the like), a dispersing agent (e.g., hydroxypropylmethylcellulose and the like), surfactants (e.g., sodium lauryl sulfate, polaxamer, polysorbates and the like), antioxidants (e.g., ethylene diamine tetraacetic acid (EDTA), butylated hydroxyl toluene (BHT) and the like) and solubilizers (e.g., polyethylene glycols, SOLUTOL®, GELUCIRE® and the like). The effective amount of the modified bacteria provided herein in the pharmaceutical composition may be at a level that will exercise the desired effect.

(96) In another embodiment, provided herein are compositions comprising an effective amount of modified bacteria provided herein and a pharmaceutically acceptable carrier or vehicle, wherein a pharmaceutically acceptable carrier or vehicle can comprise an excipient, diluent, or a mixture thereof. In one embodiment, the composition is a pharmaceutical composition.

(97) Compositions can be formulated to contain a daily dose, or a convenient fraction of a daily dose, in a dosage unit. In general, the composition is prepared according to known methods in pharmaceutical chemistry. Capsules can be prepared by mixing the modified bacteria provided herein with a suitable carrier or diluent and filling the proper amount of the mixture in capsules.

5.12 Method of Use

(98) Solid tumor cancers that can be treated by the methods provided herein include, but are not limited to, sarcomas, carcinomas, and lymphomas. In specific embodiments, cancers that can be treated in accordance with the methods described include, but are not limited to, cancer of the breast, liver, neuroblastoma, head, neck, eye, mouth, throat, esophagus, esophagus, chest, bone, lung, kidney, colon, rectum or other gastrointestinal tract organs, stomach, spleen, skeletal muscle, subcutaneous tissue, prostate, breast, ovaries, testicles or other reproductive organs, skin, thyroid, blood, lymph nodes, kidney, liver, pancreas, and brain or central nervous system. In certain embodiments, the solid tumors that can be treated by the methods provided herein include, but are not limited to, sarcomas, carcinomas, and lymphomas. In specific embodiments, a cancer that can be treated in accordance with the methods described include, but are not limited to, cancer of the breast, liver, colon, neuroblastoma, head, neck, eye, mouth, throat, esophagus, chest, bone, lung, kidney, rectum or other gastrointestinal tract organs, stomach, spleen, skeletal muscle, subcutaneous tissue, prostate, ovaries, testicles or other reproductive organs, skin, thyroid, blood, lymph nodes, pancreas and brain.

(99) In particular embodiments, the methods for treating cancer provided herein inhibit, reduce, diminish, arrest, or stabilize a tumor associated with the cancer. In other embodiments, the methods for treating cancer provided herein inhibit, reduce, diminish, arrest, or stabilize the blood flow, metabolism, or edema in a tumor associated with the cancer or one or more symptoms thereof. In specific embodiments, the methods for treating cancer provided herein cause the regression of a tumor, tumor blood flow, tumor metabolism, or peritumor edema, and/or one or more symptoms associated with the cancer. In other embodiments, the methods for treating cancer provided herein maintain the size of the tumor so that it does not increase, or so that it increases by less than the increase of a tumor after administration of a standard therapy as measured by conventional methods available to one of skill in the art, such as digital rectal exam, ultrasound (e.g., transrectal ultrasound), CT Scan, MRI, dynamic contrast-enhanced MRI, or PET Scan. In specific embodiments, the methods for treating cancer provided herein decrease tumor size. In certain embodiments, the methods for treating cancer provided herein reduce the formation of a tumor. In certain embodiments, the methods for treating cancer provided herein eradicate, remove, or control primary, regional and/or metastatic tumors associated with the cancer. In some embodiments, the methods for treating cancer provided herein decrease the number or size of metastases associated with the cancer.

(100) In certain embodiments, the methods for treating cancer provided herein reduce the tumor size (e.g., volume or diameter) in a subject by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 80%, 85%, 90%, 95%, 99%, or 100%, relative to tumor size (e.g., volume or diameter) prior to administration of modified bacteria as assessed by methods well known in the art, e.g., CT Scan, MRI, DCE-MRI, or PET Scan. In particular embodiments, the methods for treating cancer provided herein reduce the tumor volume or tumor size (e.g., diameter) in a subject by an amount in the range of about 5% to 20%, 10% to 20%, 10% to 30%, 15% to 40%, 15% to 50%, 20% to 30%, 20% to 40%, 20% to 50%, 30% to 60%, 30% to 70%, 30% to 80%, 30% to 90%, 30% to 95%, 30% to 99%, 30% to 100%, or any range in between, relative to tumor size (e.g., diameter) in a subject prior to administration of modified bacteria as assessed by methods well known in the art, e.g., CT Scan, MRI, DCE-MRI, or PET Scan.

(101) In certain embodiments, the methods for treating cancer provided herein reduce the tumor perfusion in a subject by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 80%, 85%, 90%, 95%, 99%, or 100%, relative to tumor perfusion prior to administration of modified bacteria as assessed by methods well known in the art, e.g., MRI, DCE-MRI, or PET Scan. In particular embodiments, the methods for treating cancer provided herein reduce the tumor perfusion in a subject by an amount in the range of about 5% to 20%, 10% to 20%, 10% to 30%, 15% to 40%, 15% to 50%, 20% to 30%, 20% to 40%, 20% to 50%, 30% to 60%, 30% to 70%, 30% to 80%, 30% to 90%, 30% to 95%, 30% to 99%, 30% to 100%, or any range in between, relative to tumor perfusion prior to administration of modified bacteria, as assessed by methods well known in the art, e.g., MRI, DCE-MRI, or PET Scan.

(102) In particular aspects, the methods for treating cancer provided herein inhibit or decrease tumor metabolism in a subject as assessed by methods well known in the art, e.g., PET scanning. In specific embodiments, the methods for treating cancer provided herein inhibit or decrease tumor metabolism in a subject by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 80%, 85%, 90%, 95%, or 100%, relative to tumor metabolism prior to administration of modified bacteria, as assessed by methods well known in the art, e.g., PET scanning. In particular embodiments, the methods for treating cancer provided herein inhibit or decrease tumor metabolism in a subject in the range of about 5% to 20%, 10% to 20%, 10% to 30%, 15% to 40%, 15% to 50%, 20% to 30%, 20% to 40%, 20% to 50%, 30% to 60%, 30% to 70%, 30% to 80%, 30% to 90%, 30% to 95%, 30% to 99%, 30% to 100%, or any range in between, relative to tumor metabolism prior to administration of modified bacteria, as assessed by methods well known in the art, e.g., PET scan.

5.13 Patient Population

(103) In some embodiments, a subject treated for cancer in accordance with the methods provided herein is a human who has or is diagnosed with cancer. In other embodiments, a subject treated for cancer in accordance with the methods provided herein is a human predisposed or susceptible to cancer. In some embodiments, a subject treated for cancer in accordance with the methods provided herein is a human at risk of developing cancer.

(104) In one embodiment, a subject treated for cancer in accordance with the methods provided herein is a human infant. In another embodiment, a subject treated for cancer in accordance with the methods provided herein is a human toddler. In another embodiment, a subject treated for cancer in accordance with the methods provided herein is a human child. In another embodiment, a subject treated for cancer in accordance with the methods provided herein is a human adult. In another embodiment, a subject treated for cancer in accordance with the methods provided herein is a middle-aged human. In another embodiment, a subject treated for cancer in accordance with the methods provided herein is an elderly human.

(105) In certain embodiments, a subject treated for cancer in accordance with the methods provided herein has a cancer that metastasized to other areas of the body, such as the bones, lung and liver. In certain embodiments, a subject treated for cancer in accordance with the methods provided herein is in remission from the cancer. In some embodiments, a subject treated for cancer in accordance with the methods provided herein that has a recurrence of the cancer. In certain embodiments, a subject treated in accordance with the methods provided herein is experiencing recurrence of one or more tumors associated with cancer.

(106) In certain embodiments, a subject treated for cancer in accordance with the methods provided herein is a human that is about 1 to about 5 years old, about 5 to 10 years old, about 10 to about 18 years old, about 18 to about 30 years old, about 25 to about 35 years old, about 35 to about 45 years old, about 40 to about 55 years old, about 50 to about 65 years old, about 60 to about 75 years old, about 70 to about 85 years old, about 80 to about 90 years old, about 90 to about 95 years old or about 95 to about 100 years old, or any age in between. In a specific embodiment, a subject treated for cancer in accordance with the methods provided herein is a human that is 18 years old or older. In a particular embodiment, a subject treated for cancer in accordance with the methods provided herein is a human child that is between the age of 1 year old to 18 years old. In a certain embodiment, a subject treated for cancer in accordance with the methods provided herein is a human that is between the age of 12 years old and 18 years old. In a certain embodiment, the subject is a male human. In another embodiment, the subject is a female human. In one embodiment, the subject is a female human that is not pregnant or is not breastfeeding. In one embodiment, the subject is a female that is pregnant or will/might become pregnant, or is breast feeding.

(107) In some embodiments, a subject treated for cancer in accordance with the methods provided herein is administered modified bacteria or a pharmaceutical composition thereof, or a combination therapy before any adverse effects or intolerance to therapies other than the modified bacteria develops. In some embodiments, a subject treated for cancer in accordance with the methods provided herein is a refractory patient. In a certain embodiment, a refractory patient is a patient refractory to a standard therapy (e.g., surgery, radiation, anti-androgen therapy and/or drug therapy such as chemotherapy). In certain embodiments, a patient with cancer is refractory to a therapy when the cancer has not significantly been eradicated and/or the one or more symptoms have not been significantly alleviated. The determination of whether a patient is refractory can be made either in vivo or in vitro by any method known in the art for assaying the effectiveness of a treatment of cancer, using art-accepted meanings of “refractory” in such a context. In various embodiments, a patient with cancer is refractory when one or more tumors associated with cancer, have not decreased or have increased. In various embodiments, a patient with cancer is refractory when one or more tumors metastasize and/or spread to another organ.

(108) In some embodiments, a subject treated for cancer accordance with the methods provided herein is a human that has proven refractory to therapies other than treatment with modified bacteria, but is no longer on these therapies. In certain embodiments, a subject treated for cancer in accordance with the methods provided herein is a human already receiving one or more conventional anti-cancer therapies, such as surgery, drug therapy such as chemotherapy, anti-androgen therapy or radiation. Among these patients are refractory patients, patients who are too young for conventional therapies, and patients with recurring tumors despite treatment with existing therapies.

5.14 Dosage

(109) The effective amount of the modified bacteria provided herein to be administered to a subject will vary depending on the species of the subject, as well as the disease or condition that is being treated. Preferably, the dosage employed will be 10.sup.7 to 10.sup.10 viable microorganisms per subject.

(110) In one aspect, a method for treating cancer presented herein involves the administration of a unit dosage of modified bacteria thereof. The dosage may be administered as often as determined effective (e.g., once, twice or three times per day, every other day, once or twice per week, biweekly or monthly). In certain embodiments, a method for treating cancer presented herein involves the administration to a subject in need thereof of a unit dose of modified bacteria that can be determined by one skilled in the art.

(111) In some embodiments, a unit dose of modified bacteria or a pharmaceutical composition thereof is administered to a subject once per day, twice per day, three times per day; once, twice or three times every other day (i.e., on alternate days); once, twice or three times every two days; once, twice or three times every three days; once, twice or three times every four days; once, twice or three times every five days; once, twice, or three times once a week, biweekly or monthly, and the dosage may be administered orally.

5.15 Combination Therapy

(112) Presented herein are combination therapies for the treatment of cancer which involve the administration of modified bacteria in combination with one or more additional therapies to a subject in need thereof. In a specific embodiment, presented herein are combination therapies for the treatment of cancer which involve the administration of an effective amount of modified bacteria in combination with an effective amount of another therapy to a subject in need thereof.

(113) As used herein, the term “in combination,” refers, in the context of the administration of modified bacteria, to the administration of modified bacteria prior to, concurrently with, or subsequent to the administration of one or more additional therapies (e.g., agents, surgery, or radiation) for use in treating cancer. The use of the term “in combination” does not restrict the order in which modified bacteria and one or more additional therapies are administered to a subject. In specific embodiments, the interval of time between the administration of modified bacteria and the administration of one or more additional therapies may be about 1-5 minutes, 1-30 minutes, 30 minutes to 60 minutes, 1 hour, 1-2 hours, 2-6 hours, 2-12 hours, 12-24 hours, 1-2 days, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 9 weeks, 10 weeks, 15 weeks, 20 weeks, 26 weeks, 52 weeks, 11-15 weeks, 15-20 weeks, 20-30 weeks, 30-40 weeks, 40-50 weeks, 1 month, 2 months, 3 months, 4 months 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months, 1 year, 2 years, or any period of time in between. In certain embodiments, modified bacteria and one or more additional therapies are administered less than 1 day, 1 week, 2 weeks, 3 weeks, 4 weeks, one month, 2 months, 3 months, 6 months, 1 year, 2 years, or 5 years apart.

(114) In some embodiments, the combination therapies provided herein involve administering modified bacteria daily, and administering one or more additional therapies once a week, once every 2 weeks, once every 3 weeks, once every 4 weeks, once every month, once every 2 months (e.g., approximately 8 weeks), once every 3 months (e.g., approximately 12 weeks), or once every 4 months (e.g., approximately 16 weeks). In certain embodiments, modified bacteria and one or more additional therapies are cyclically administered to a subject. Cycling therapy involves the administration of modified bacteria for a period of time, followed by the administration of one or more additional therapies for a period of time, and repeating this sequential administration. In certain embodiments, cycling therapy may also include a period of rest where modified bacteria or the additional therapy is not administered for a period of time (e.g., 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 10 weeks, 20 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months, 2 years, or 3 years). In an embodiment, the number of cycles administered is from 1 to 12 cycles, from 2 to 10 cycles, or from 2 to 8 cycles.

(115) In some embodiments, the methods for treating cancer provided herein comprise administering modified bacteria as a single agent for a period of time prior to administering the modified bacteria in combination with an additional therapy. In certain embodiments, the methods for treating cancer provided herein comprise administering an additional therapy alone for a period of time prior to administering modified bacteria in combination with the additional therapy.

(116) In some embodiments, the administration of modified bacteria and one or more additional therapies in accordance with the methods presented herein have an additive effect relative the administration of modified bacteria or said one or more additional therapies alone. In some embodiments, the administration of modified bacteria and one or more additional therapies in accordance with the methods presented herein have a synergistic effect relative to the administration of the Compound or said one or more additional therapies alone.

(117) As used herein, the term “synergistic,” refers to the effect of the administration of modified bacteria in combination with one or more additional therapies (e.g., agents), which combination is more effective than the additive effects of any two or more single therapies (e.g., agents). In a specific embodiment, a synergistic effect of a combination therapy permits the use of lower dosages (e.g., sub-optimal doses) of modified bacteria or an additional therapy and/or less frequent administration of modified bacteria or an additional therapy to a subject. In certain embodiments, the ability to utilize lower dosages of modified bacteria or of an additional therapy and/or to administer modified bacteria or said additional therapy less frequently reduces the toxicity associated with the administration of modified bacteria or of said additional therapy, respectively, to a subject without reducing the efficacy of modified bacteria or of said additional therapy, respectively, in the treatment of cancer. In some embodiments, a synergistic effect results in improved efficacy of modified bacteria and each of said additional therapies in treating cancer. In some embodiments, a synergistic effect of a combination of modified bacteria and one or more additional therapies avoids or reduces adverse or unwanted side effects associated with the use of any single therapy.

(118) The combination of modified bacteria and one or more additional therapies can be administered to a subject in the same pharmaceutical composition. Alternatively, modified bacteria and one or more additional therapies can be administered concurrently to a subject in separate pharmaceutical compositions. Modified bacteria and one or more additional therapies can be administered sequentially to a subject in separate pharmaceutical compositions. Modified bacteria and one or more additional therapies may also be administered to a subject by the same or different routes of administration.

(119) The combination therapies provided herein involve administering to a subject to in need thereof modified bacteria in combination with conventional, or known, therapies for treating cancer. Other therapies for cancer or a condition associated therewith are aimed at controlling or relieving one or more symptoms. Accordingly, in some embodiments, the combination therapies provided herein involve administering to a subject to in need thereof a pain reliever, or other therapies aimed at alleviating or controlling one or more symptoms associated with or a condition associated therewith.

(120) Specific examples of anti-cancer agents that may be used in combination with modified bacteria include: a hormonal agent (e.g., aromatase inhibitor, selective estrogen receptor modulator (SERM), and estrogen receptor antagonist), chemotherapeutic agent (e.g., microtubule dissembly blocker, antimetabolite, topisomerase inhibitor, and DNA crosslinker or damaging agent), anti-angiogenic agent (e.g., VEGF antagonist, receptor antagonist, integrin antagonist, vascular targeting agent (VTA)/vascular disrupting agent (VDA)), radiation therapy, and conventional surgery.

(121) Non-limiting examples of hormonal agents that may be used in combination with modified bacteria include aromatase inhibitors, SERMs, and estrogen receptor antagonists. Hormonal agents that are aromatase inhibitors may be steroidal or nonsteroidal. Non-limiting examples of nonsteroidal hormonal agents include letrozole, anastrozole, aminoglutethimide, fadrozole, and vorozole. Non-limiting examples of steroidal hormonal agents include aromasin (exemestane), formestane, and testolactone. Non-limiting examples of hormonal agents that are SERMs include tamoxifen (branded/marketed as Nolvadex®), afimoxifene, arzoxifene, bazedoxifene, clomifene, femarelle, lasofoxifene, ormeloxifene, raloxifene, and toremifene. Non-limiting examples of hormonal agents that are estrogen receptor antagonists include fulvestrant. Other hormonal agents include but are not limited to abiraterone and lonaprisan.

(122) Non-limiting examples of chemotherapeutic agents that may be used in combination with modified bacteria include microtubule disassembly blocker, antimetabolite, topisomerase inhibitor, and DNA crosslinker or damaging agent. Chemotherapeutic agents that are microtubule disassembly blockers include, but are not limited to, taxenes (e.g., paclitaxel (branded/marketed as TAXOL®), docetaxel, abraxane, larotaxel, ortataxel, and tesetaxel); epothilones (e.g., ixabepilone); and vinca alkaloids (e.g., vinorelbine, vinblastine, vindesine, and vincristine (branded/marketed as ONCOVIN®)).

(123) Chemotherapeutic agents that are antimetabolites include, but are not limited to, folate anitmetabolites (e.g., methotrexate, aminopterin, pemetrexed, raltitrexed); purine antimetabolites (e.g., cladribine, clofarabine, fludarabine, mercaptopurine, pentostatin, thioguanine); pyrimidine antimetabolites (e.g., 5-fluorouracil, capcitabine, gemcitabine (GEMZAR®), cytarabine, decitabine, floxuridine, tegafur); and deoxyribonucleotide antimetabolites (e.g., hydroxyurea).

(124) Chemotherapeutic agents that are topoisomerase inhibitors include, but are not limited to, class I (camptotheca) topoisomerase inhibitors (e.g., topotecan (branded/marketed as HYCAMTIN®) irinotecan, rubitecan, and belotecan); class II (podophyllum) topoisomerase inhibitors (e.g., etoposide or VP-16, and teniposide); anthracyclines (e.g., doxorubicin, epirubicin, Doxil, aclarubicin, amrubicin, daunorubicin, idarubicin, pirarubicin, valrubicin, and zorubicin); and anthracenediones (e.g., mitoxantrone, and pixantrone).

(125) Chemotherapeutic agents that are DNA crosslinkers (or DNA damaging agents) include, but are not limited to, alkylating agents (e.g., cyclophosphamide, mechlorethamine, ifosfamide (branded/marketed as IFEX®), trofosfamide, chlorambucil, melphalan, prednimustine, bendamustine, uramustine, estramustine, carmustine (branded/marketed as BiCNU®), lomustine, semustine, fotemustine, nimustine, ranimustine, streptozocin, busulfan, mannosulfan, treosulfan, carboquone, N,N′N′-triethylenethiophosphoramide, triaziquone, triethylenemelamine); alkylating-like agents (e.g., carboplatin (branded/marketed as PARAPLATIN®), cisplatin, oxaliplatin, nedaplatin, triplatin tetranitrate, satraplatin, picoplatin); nonclassical DNA crosslinkers (e.g., procarbazine, dacarbazine, temozolomide (branded/marketed as TEMODAR®), altretamine, mitobronitol); and intercalating agents (e.g., actinomycin, bleomycin, mitomycin, and plicamycin).

(126) Non-limiting examples of other therapies that may be administered to a subject in combination with a Compound include:

(127) (1) a statin such as lovostatin (e.g., branded/marketed as MEVACOR®);

(128) (2) an mTOR inhibitor such as sirolimus which is also known as Rapamycin (e.g., branded/marketed as RAPAMUNE®), temsirolimus (e.g., branded/marketed as TORISEL®), evorolimus (e.g., branded/marketed as AFINITOR®), and deforolimus;

(129) (3) a farnesyltransferase inhibitor agent such as tipifarnib;

(130) (4) an antifibrotic agent such as pirfenidone;

(131) (5) a pegylated interferon such as PEG-interferon alfa-2b;

(132) (6) a CNS stimulant such as methylphenidate (branded/marketed as RITALIN®);

(133) (7) a HER-2 antagonist such as anti-HER-2 antibody (e.g., trastuzumab) and kinase inhibitor (e.g., lapatinib);

(134) (8) an IGF-1 antagonist such as an anti-IGF-1 antibody (e.g., AVE1642 and IMC-A11) or an IGF-1 kinase inhibitor;

(135) (9) EGFR/HER-1 antagonist such as an anti-EGFR antibody (e.g., cetuximab, panitumamab) or EGFR kinase inhibitor (e.g., erlotinib; gefitinib);

(136) (10) SRC antagonist such as bosutinib;

(137) (11) cyclin dependent kinase (CDK) inhibitor such as seliciclib;

(138) (12) Janus kinase 2 inhibitor such as lestaurtinib;

(139) (13) proteasome inhibitor such as bortezomib;

(140) (14) phosphodiesterase inhibitor such as anagrelide;

(141) (15) inosine monophosphate dehydrogenase inhibitor such as tiazofurine;

(142) (16) lipoxygenase inhibitor such as masoprocol;

(143) (17) endothelin antagonist;

(144) (18) retinoid receptor antagonist such as tretinoin or alitretinoin;

(145) (19) immune modulator such as lenalidomide, pomalidomide, or thalidomide;

(146) (20) kinase (e.g., tyrosine kinase) inhibitor such as imatinib, dasatinib, erlotinib, nilotinib, gefitinib, sorafenib, sunitinib, lapatinib, or TG100801;

(147) (21) non-steroidal anti-inflammatory agent such as celecoxib (branded/marketed as CELEBREX®);

(148) (22) human granulocyte colony-stimulating factor (G-CSF) such as filgrastim (branded/marketed as NEUPOGEN®);

(149) (23) folinic acid or leucovorin calcium;

(150) (24) integrin antagonist such as an integrin α5β1-antagonist (e.g., JSM6427);

(151) (25) nuclear factor kappa beta (NF-κB) antagonist such as OT-551, which is also an anti-oxidant.

(152) (26) hedgehog inhibitor such as CUR61414, cyclopamine, GDC-0449, and anti-hedgehog antibody;

(153) (27) histone deacetylase (HDAC) inhibitor such as SAHA (also known as vorinostat (branded/marketed as ZOLINZA)), PCI-24781, SB939, CHR-3996, CRA-024781, ITF2357, JNJ-26481585, or PCI-24781;

(154) (28) retinoid such as isotretinoin (e.g., branded/marketed as ACCUTANE®)

(155) (29) hepatocyte growth factor/scatter factor (HGF/SF) antagonist such as HGF/SF monoclonal antibody (e.g., AMG 102);

(156) (30) synthetic chemical such as antineoplaston;

(157) (31) anti-diabetic such as rosaiglitazone (e.g., branded/marketed as AVANDIA®)

(158) (32) antimalarial and amebicidal drug such as chloroquine (e.g., branded/marketed as ARALEN®);

(159) (33) synthetic bradykinin such as RMP-7;

(160) (34) platelet-derived growth factor receptor inhibitor such as SU-101;

(161) (35) receptor tyrosine kinase inhibitorsof Flk-1/KDR/VEGFR2, FGFR1 and PDGFR beta such as SU5416 and SU6668;

(162) (36) anti-inflammatory agent such as sulfasalazine (e.g., branded/marketed as AZULFIDINE®); and

(163) (37) TGF-beta antisense therapy.

(164) The following non-limiting examples are merely illustrative of the preferred embodiments of the present invention, and are not be construed as limiting the invention.

6. EXAMPLES

6.1: Construction of Tumor-Targeting Salmonella ST1 for Delivery and Expression

(165) With careful genetic engineering, S. typhimurium was modified to target solid tumor and express multiple therapeutic molecules. The starting parental strain is the auxotrophic Salmonella enterica serovar typhimurium 7207 strain (S. typhimurium 2337-65 derivative hisG46, DEL407 [aroA::Tn 10{Tc-s}], made by k-Red mediated recombineering, selecting for the appropriate antibiotic resistance markers. Strain SL001 was constructed by first replacing the gmd open reading frame by a RCR-amplified cassette containing a chloramphenicol resistance gene and a T7 RNAP gene (Δgmd::T7 RNAP-cat). Then the PCR product target gmd gene was electroporated into recombination-competent cells and selected on LB plates containing 25 μg/ml of chlormaphenicol. Then the excision of the antibiotic gene has been achieved here using plasmid p705cre to produce a recombinase that eliminates DNA fragment flanked by two loxP sites, generating the strain SL001.

(166) For the integration of hlyA gene into the genome, first, pYB-asd (a pBSK derivate with 1kb flanking regions of asd sites) has been generated to target the essential gene. Subsequently, an in vivo inducible promoter PsseA sequence was cloned from the Salmonella Pathogenicity Island 2 (SPI2) and ligated into plasmid pYB-asd through the NotI and HindIII cutting sites. PCR product loxp-cat-loxp was amplified from plasmid ploxp-cat-loxp and ligated into pYB-asd-PsseA at the XhoI site to create plasmid pYB-asd-PsseA-cat. A hlyA gene encoding LLO was PCR-amplified from Listeria genomic DNA and digested with HindIII and XhoI, then ligated into pYB-asd-PsseA-cat, to construct plasmid pYB-asd-hlyA (FIG. 42).

(167) Then the DNA-targeting cassette has been digested with KpnI and SacII from pYB-asd-hlyA. The fragment was purified and transformed into electro-competent SL001 cells induced for the phage λ Red-mediated recombineering system. After recombineering, the correct colonies were identified by colony PCR conformation, using a pair of primers: asd-test-f and PsseA-r. Chloramphenicol resistance gene was removed by site-specific Cre/loxP mediated recombination by transformation of plasmid p705cre-Km, generating the strain SL002. Similarly, an anti-stress related gene htrA was replaced by cat-PpepT-asd-sodA cassette. The essential gene with tightly anaerobic control was cloned back to develop strain SL003.

(168) Furthermore, to maintain the therapeutic plasmids without antibiotic selections, a “precise” deletion of the entire structural gene of initiation factor 1 (encoded by infA) from SL003 chromosome has been performed, which is presented in Example 6.5. After a series of genetic manipulations (FIG. 1), SL7207 has been engineered to be a tumor-targeting delivery and expression vector which was termed ST1. ST1 has the following genotype: S. typhimurium 2337-65 derivative hisG46, ΔaroA::Tn10 (Tcs), Δgmd::T7 RNAP, Δasd::PsseA-hlyA, ΔhtrA::cat-PpepT-asd-sodA, ΔinfA::tetR.

(169) TABLE-US-00003 TABLE 3 Oligonuclotides SEQ ID  Name Sequence (5′-3′) NO: Purpose loxp-F-XhoI CCGCTCGAGCCGATCATATTCAATAACCCT  3 pBSK-cat loxp-R-XhoI CCGCTCGAGGACTAGTGAACCTCTTCGAGGG  4 pBSK-cat Hind3-T7-ploy-F CCCAAGCTTCCGGATTTACTAACTGGAAGAGGCACT  5 Ts-Plac-T7P AAATG LacIZ-T7-ploy-R CCGCTCGAGAAGGGGATCCGGAGTCGTATTGATTTG  6 Ts-Plac-T7P gmd50-Plac-F AAGTCGCTCTCATTACTGGCGTAACCGGACAGGATG  7 T7 RNAP-cat GGTCTTACCTGGCAGTGCTGCAAGGCGATTAAGTTGG gmd50-T7-R TCTCAAGGAACCACTGGTAAGTACCGGCAAGCCCT  8 T7 RNAP-cat GCCTCCAGTGAAATTCTGTGGATAACCGTATTACCGC CT PsseA-F-NotI ATTTGCGCCGCAGAAGAGAACAACGGCAAGTTAC  9 pYB-asd-hlyA PsseA-R-HindIII CCAAGCTTACGATAGATAGATAATTAACGTGC 10 pYB-asd-hlyA hlyA-F-HindIII CCCAAGCTTATGAAAAAAATAATGCTAGTT 11 pYB-asd-hlyA hlyA-R-XhoI CCGCTCGAGCGGCCGCTACTAGTAAGCTTTTAAATC 12 pYB-asd-hlyA AGCAGGG asd-LA-F-SacI TCCGAGCTCGTAGACATGATGGAAACTATCCTCGGC 13 pYB-asd-hlyA ACG asd-LA-R-SacII TCCCCGCGGCGACATCAACATCAGGCTAACGGT 14 pYB-asd-hlyA asd-RA-F-XhoI CCGCTCGAGCGGAAACCAACAAGATCAAGATCCTA 15 pYB-asd-hlyA CAATA asd-RA-R-KpnI CGGGGTACCGTCGACGACACTTCTTTGACCTGAACG 16 pYB-asd-hlyA GCG htrA-LA-F-SacI TCCGAGCTCGTCGACGCCTACGTGGAAGTCGTCAGTA 17 pYB-htrA-asd htrA-LA-R-SacII TCCCCGCGGCGTCGGTCTGAATAAAGTTCTCGTAA 18 pYB-htrA-asd htrA-RA-F-XhoI CCGCTCGAGGGATGTCATTACCTCGCTGAACGGG 19 pYB-htrA-asd htrA-RA-R-KpnI CGGGGTACCGTCGACTCCCTAAACGCTGTCGCCATTC 20 pYB-htrA-asd cat-F-NotI ATTTGCGGCCGCCCGATCATATTCAATAACCCT 21 pYB-htrA-asd cat-R-NotI ATTTGCGGCCGCGACTAGTGAACCTCTTCGAGGG 22 pYB-htrA-asd P.sub.pepT-F-NotI ATTTGCGGCCGCGTAAACGCAACGGATGGCTGACCGC 23 pYB-htrA-asd P.sub.pepT-R-HindIII CCCAAGCTTCTTTTCGTGACAACATTATTAATAAG 24 pYB-htrA-asd asd-F-HindIII CCCAAGCTTTGGAGCGAAACCGATGAAAAATGTTG 25 pYB-htrA-asd GTTTTATCGGCTGGC asd-R-XhoI CCGCTCGAGCTACGCCAACTGGCGCAGCATTCGA 26 pYB-htrA-asd PsodA-F GACGAAAGTACGGCATTGATAATCATTTTCAATATCA 27 pYB-htrA-asd TTTAATTAACTATAATGAACCAAC PsodA-R TCGAGTTGGTTCATTATAGTTAATTAAATGATATTGAA 28 pYB-htrA-asd AATGATTATCAATGCCGTACTTTTCGTCTGACA infA-LA-F-XbaI GCCTCTAGATAAAAGGTCGGTTTAACCGGCC 29 pYB-infA-tetR infA-LA-R-SacII ACACCGCGGCACTGTAAAGCGATGCTGGT 30 pYB-infA-tetR infA-RA-F-XhoI TCTACTCGAGATCCTCTGGGGTATCACTACC 31 pYB-infA-tetR infA-RA-R-KpnI TTCTGGGTACCACGATGCTTGT 32 pYB-infA-tetR gmd-test-F GTTCAGAAAGTTACTCCC 33 Verification htrA-test-F GTCGACGCCTACGTGGAAGTCGTCGTCAGTA 34 Verification asd-test-F GTCGACATGATGGAAACTATCCTCGGCACG 35 Verification infA-test-F CTTGCGTACTGGAGTTTCG 36 Verification EGFP-pA-R-PstI GCGCTGCAGTTTTTTTTTTTTTTTTTTTTACTTGTACA 37 pT7-EGFP GCTCGTC P.sub.CMV-F-NdeI TATCATATGCCAAGTACG 38 pSE3 P.sub.T7-R-NheI AACGCTAGCCAGCTTGG 39 pSE3 T7 RNAP-F-XbaI TCTAGAATGAACACGATTAACATCGCTAAG 40 pIKDE, pIKRP T7 RNAP-R-NotI CTGCAGCGGCCGCTACTAGTTACGCGAACGCGAAGT 41 pIKDE, pIKRP CCGACT IRES-F-XbaI ATATCTAGAGCCCCTCTCCCTCCCCCCC 42 pIKDE, pIKRP IRES-R-NheI- CGCGAATTCGCTAGCATATTATCATCGTGTTTT 43 pIKDE, pIKRP EcoRI IRES-R-SpeI GGCACTAGTTGTGGCCATATTATCATCGT 44 pIKDE, pIKRP BGHpA-P.sub.T7-R- ATACCGCGGTCTCCCTATAGTGAGTCGTATTACCATA 45 pIKDE, pIKRP SacII GAGCCCACCGCATCC Kozak-EGFP-F-NheI GCTAGCACAACCATGGTGAGCAAG 46 pIKDE-EGFP Lpp_ompA-F- GGGAATTCCATATGAAAGCTACTAAACTGGTACTGG 47 pLpp_ompA_sTRAIL EcoRI GCGCGGTAAACCCGTATGTTGGCTTTGAAATGGG Lpp_ompA-R- CCGCTCGAGTTATGCGGCCGCGTTGTCCGGACGAGT 48 pLpp_ompA_sTRAIL NotI GCCGATGGTGT sTRAIL-F-NotI GCGGCCGCAGTGAGAGAAAGAGGTCCTCA 49 pLpp_ompA_sTRAIL sTRAIL-R-XhoI CTCGAGGCCAACTAAAAAGGCCCCGA 50 pLpp_ompA_sTRAIL sTRAIL-F-NheI- CGTGCTAGCATATGGTGAGAGAAAGAGGTCCTCA 51 pSspH2-sTRAIL NdeI sTRAIL-R-PstI- CTGAAGCTTCTGCAGTTAGCCAACTAAAAAGGCCC 52 pSspH2-sTRAIL HindIII SspH2-F-NcoI ATACCATGGCACCCTTTCATATTGGAAGC 53 pSspH2-sTRAIL SspH2-R-NcoI GTACCATGGACCCGGATGCCCCTTCCGCG 54 pSspH2-sTRAIL mEnd-R-PstI- AAGCTTCTGCAGTTATTTGGAGAAAGAGGTCATG 55 pSspH2-Endo HindIII statin 3xFlag-F-NcoI GACTATACCATGGACTACAAAGACCATGACGGTG 56 pIKDE-DTA 3xFlag-partial ACAAAGACCATGACGGTGATTATAAAGATCATGACA 57 pIKDE-DTA seq-F TCGATTACAAGGATGACGAC 3XFlag-R-NcoI AGAAGGAGATATACCATGGATTACAAGGATGACGAC 58 pIKDE-DTA GATAAGCATATG Kozak-3xFlag-F- TCTAGACCACCATGGACTACAAAGACCATGACGGTG 59 pIKDE-DTA XbaI DTA-R-PstI AAGCTTCTGCAGTTATCGCCTGACACGATTTCC 60 pIKDE-DTA HA-F-SpeI CATT CTAGAGCCACCATGGGAAACACTCAAATCC 61 pIKDE-HA HA-R-XbaI AGATCTAGACTCGACTGCAGTTAGTGCTTCAACTTAT 62 pIKDE-HA ATACAAAT AGTGCACCGC DTA-For AAAGGTTCGATGATGGTGCTTCGC 63 qRT-PCR DTA-Rev TCTACGCTTAACGCTTTCGCCTGT 64 qRT-PCR URP-DTA-R TGGTGTCGTGGAGTCGTCGCCTGACACGATTTCC 65 RT-PCR P.sub.T7-F-BglII CGAAGATCTAATACGACTCACTATAG 66 pIKR-shRNA t7 term-R-BglII CGAAGATCTCAAAAAACCCCTCAAGACC 67 pIKR-shRNA P.sub.T7-shTom-F- AGATCTAATACGACTCACTATAGGGCCAAGAAGCCC 68 pIKR-shTom BglII GTGCAATTCAAGAGATTGC shTom-t7 term TGCAATTCAAGAGATTGCACGGGCTTCTTGGCCTTT 69 pIKR-shTom TTAGCATAACCCCTTGGG P.sub.T7-shPLK-F TAATACGACTCACTATAGGGAGATCACCCTCCTTAAA 70 pIKR-shPLK TATTTTCAAGAGAAATAT HDV-shPLK-R GGAGATGCCATGCCGACCCAAAAAGATCACCCTCCT 71 pIKR-shPLK TAAATATTTCTCTTGAAAATAT P.sub.T7-let-7-F AGATCTTAATACGACTCACTATAGGAGACAGGAAGC 72 pIKR-let-7 TTTGGGATGAGGTAGT HDV-let-7-R TGGAGATGCCATGCCGACCCAAACTCGAGAAAAAAT 73 pIKR-let-7 AGGAAAG P.sub.T7-her-2-F AGATCTTAATACGACTCACTATAGGAGACAGGGTCA 74 pIKR-her-2 CAGGGGCCTCCCCAGG HDV-her-2-R TGGAGATGCCATGCCGACCCAAATCACAGGGGCCTC 75 pIKR-her-2 CCCAGGT HDV ribo seq-R CTTCTCCCTTAGCCTACCGAAGTAGCCCAGGTCGGA 76 pIKR-shPLK CCGCGAGGAGGTGGAGATGCCATGCCGACCC t7 term-HDV-R CAAAAAACCCCTCAAGACCCGTTTAGAGGCCCCAA 77 pIKR-shPLK GGGGTTATGCTAACTTCTCCCTTAGCCTACCGA bla-For CTACGATACGGGAGGGCTTA 78 qRT-PCR bla-Rev ATAAATCTGGAGCCGGTGAG 79 qRT-PCR CTNNB1-For GACAATGGCTACTCAAGCTG 80 qRT-PCR CTNNB1-Rev CAGGTCAGTATCAAACCAGG 81 qRT-PCR dxs-For CGAGAAACTGGCGATCCTTA 82 qRT-PCR dxs-Rev CTTCATCAAGCGGTTTCACA 83 qRT-PCR GAPDH-For AGCCACATCGCTCAGACAC 84 qRT-PCR GAPDH-Rev GCCCAATACGACCAAATCC 85 qRT-PCR PLK1-For CACAGTGTCAATGCCTCCA 86 qRT-PCR PLK1-Rev TTGCTGACCCAGAAGATGG 87 qRT-PCR sl-siCAT-RT CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAG 88 RT-PCR AGCTGATA sl-siPLK-RT CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAG 89 RT-PCR AGATCACC URP TGGTGTCGTGGAGTCG 90 qRT-PCR siCAT-For ACACTCCAGCTGGGCTGTCCATCAA 91 qRT-PCR siPLK-For ACACTCCAGCTGGGAATATTTAAGGAGGGT 92 qRT-PCR UAP poly G CGCGTCGACTAGTACGGGGGGGGGG 93 5′RACE PLK GSP1 GGGCAGCTATTAGGAGGCCTTGAGACG 94 5′RACE UAP CGCGTCGACTAGTACG 95 5′RACE PLK1 GSP2 AGTCCGGAGGGGGAGGGCAGC 96 5′RACE CTNNB1 GSP2 CGCATGATAGCGTGTCTGGAAGCTT 97 5′RACE

6.2: Generation of SL006, SL007 and SL008 Mutants

(170) These mutants are attracted to tumors, can penetrate into tumor tissue, but do not exclusively colonize tumor hypoxic cores. A series of ST1 mutants have been developed by a similar strategy.

(171) To decrease the fitness of tumor-targeting Salmonella, a replication-incompetent strain SL006 (diaminopimelic acid auxotropy) has been engineered. SL006 has the following genotype: S. typhimurium 2337-65 derivative hisG46, ΔaroA::Tn10 (Tcs), Δgmd:: T7 RNAP, Δasd::PsseA-hlyA, ΔinfA::cat, which was derived from SL002 strain by removing an essential gene. The ΔinfA::cat cassette generated using PCR with pYB-infA-cat was purified and transformed into electro-competent SL002 cells harboring plasmid pET28a-infA and psim6 for λ Red-recombination. Samples of the electroporation mixture were spread on LB plates supplemented with 25 μg/ml chloramphenicol. PCR amplification of the new junctions between the drug marker and infA homology arm-flanking DNA was performed to confirm that the wild-type copy of infA was removed.

(172) Because early metastases and viable tumor cells outside necrotic regions are well or partially oxygenated, they are inaccessible to obligate anaerobic bacteria. To increase the fitness in the non-hypoxic, outer rim of the solid tumor and metastases, replication-competent strains SL007 and SL008 have been developed. SL007 has the following genotype: S. typhimurium 2337-65 derivative hisG46, ΔaroA::Tn10 (Tcs), Δgmd:: T7 RNAP, ΔhtrA::PsseA-hlyA, ΔinfA::cat, which was derived from SL001 strain through two procedures. In the first step, pYB-htrA (a pBSK derivate with 1kb flanking regions of htrA locus) has been generated. The DNA sequence encoding PsseA-hlyA and loxp-cat-loxp were ligated into plasmid pYB-asd through multiple cutting sites to construct plasmid pYB-htrA-hlyA. Then the DNA-targeting cassette has been digested with KpnI and SacII from pYB-htrA-hlyA. The fragment was purified and transformed into electro-competent SL001 cells induced for the phage λ Red-mediated recombineering system. After overnight incubation, the correct colonies were identified by colony PCR conformation. Chloramphenicol resistance gene was removed by induction of Cre recombinase. In the second step, in the new mutant strain, the essential gene infA was replaced by cat cassette, generating SL007. ΔhtrA mutation causes low growth defects in growth at high or low temperatures and stationery phase further attenuating SL007 strain.

(173) SL008 has the following genotype: S. typhimurium 2337-65 derivative hisG46, ΔaroA::Tn10(Tcs), Δgmd::T7 RNAP, Δasd::PsseA-hlyA, ΔhtrA::PpepT-asd-sodA, ΔinfA::tetR, which was derived from SL003 strain. Chloramphenicol resistance gene in SL003 was eliminated by induction of Cre recombinase. Once the loxp sites have been removed, the transcription of asd gene is controlled by the upstream htrA promoter, which resulted in a leaky expression under normal oxygen levels. Then the infA gene was replaced by tetR expression cassette via recombineering, generating SL008 strain. This mutant is attracted to tumors, can penetrate into tumor tissue and effectively colonize viable regions of tumors otherwise unaffected by standard cancer therapy (FIG. 43).

6.3: The Growth of ST1 and its Mutant Strains Under Anaerobic Conditions

(174) Tight control of the expression of the essential gene asd under hypoxic conditions requires a precise genetic regulation. Based on the design of the “obligate” anaerobic S. typhimurium strain YB1, FNR regulated anaerobic capable promoter PpepT and aerobic promoter PsodA (antisense) were used to control asd transcription in ST1. If asd does not express, the bacteria will die in the absence of additional DAP. Survival of ST1 under normal and low oxygen conditions was tested. For anaerobic growth on LB agar plates, an ananerobic jar was applied to maintain low oxygen concentration (0.5% O.sub.2) by absorption of AnaeroPacks and monitored by an oxygen meter. ST1 showed the combination of growth under 0.5% oxygen concentration and repression in the aerobic environment without exogenous DAP supplement (FIG. 3A). In comparison, replication-competent SL007 and SL008 can grow in all conditions. Replication-competent SL008 showed growth only on the plates supplied with DAP (Data not shown).

6.4: Accumulation of ST1, SL007 and SL008 in Tumor and Normal Tissues In Vivo

(175) Three groups of six-week-old BALB/c mice were inoculated with CT26 colon cancer cells and, when tumor volumes reached 300-500 mm.sup.3, a single dose (5×10.sup.7) of ST1, SL007 or SL008 was injected via the tail vein. On day 14 post injections, mice were euthanized and most organs and tumor were collected, homogenized and cultured on LB agar plates with antibiotics. CFU/gram was used as a relative measure of the degree of colonization of the tissues with bacteria (FIG. 44).

(176) For SL007 inoculated mice, 10.sup.3 to 10.sup.5 CFU/gram of bacteria were found in normal organs. On day 14, SL007 levels in tumor reached 2.1×10.sup.8 CFU/gram. In comparison, by 2 weeks following injections, ST1 and SL008 were totally eliminated from spleen, liver and kidney, which could prevent a risk for sepsis in the clinical setting. Tuning survival gene asd expression level in SL008 strain leads to migration throughout the tumor (in both viable and necrotic region) (FIG. 43), with increased accumulation within tumors. The amounts of SL008 in the tumors retained at 10.sup.7-10.sup.8 levels during several weeks after systemic administration and were approximately two orders of magnitude higher than ST1 detected at the same time point. These high titers may enhance the therapeutic effects, as high amounts of therapeutic factors generated and delivered by bacteria.

6.5: Establishment of an In Vivo Plasmid Maintenance System Based on infA

(177) As live carriers, therapeutic efficacy of these bacteria is always related to the amount of protein presented or the dose of DNA delivered. Therefore, plasmid stability is the most critical parameter for the successful delivery of cargos. In this study, we describe the development of a balanced-lethal vector/host system based on an enzyme essential for protein synthesis in E. coli and S. typhimurium. In strain ST1, the exogenous plasmid is maintained, since it harbors a small essential gene infA, which has been removed from the chromosome. As a consequence, only plasmid-carrying infA.sup.− mutant cells can survive, making this strain totally dependent on the maintenance of the infA plasmids.

(178) First, the plasmid pET28a-infA containing infA cassette clone from E. coli MG1655 strain has been constructed and co-transformed with psim6 into SL003 (FIG. 45). Then plasmid pYB-infA-tetR containing tetracycline resistance gene flanked with 1 kb long homology arms of infA sites has been constructed and digested with KpnI and SacII. The selection cassette was purified and transformed into electro-competent SL003 cells carrying pET-infA and psim6 for recombineering. Samples of the electroporation mixture were spread on LB plates supplemented with 12.5 μg/ml tetracycline. PCR amplification of the new junctions between the drug marker and infA homology arm-flanking DNA was performed to confirm that the wild-type copy of infA was removed (FIG. 1B).

(179) After 5-day growth in antibiotic free medium, all the infA.sup.− mutant cells carried the exogenous infA.sup.+ plasmids. However, more than 80% of the parental SL003 cells had lost the plasmid (FIG. 46). The same results also obtained when the bacteria were cultured in minimal medium in absence of antibiotics selection pressure.

(180) Since it has been shown that both ST1 and SL008 are capable of targeting and proliferating in tumor tissue, we assessed the plasmid stability of ST1 and SL008 harboring high-copy-number plasmid pcDNA3.1-infA (pUC origin, Amp.sup.R) or low-copy-number plasmid pET32-infA (pER322 origin, Amp.sup.R) in tumor tissues after systemic administration. A mouse tumor model was created by implanting CT26 mouse colon cancer cells in the right thigh of BALB/c mice. No statistic difference was detected in the total number of bacteria and total account of ST1 containing high or low-copy-number plasmids harboring infA gene. Validating by CFU test on ampicillin-rich plates indicated that the plasmids containing ampicillin resistance gene still remained in ST1 strains after 3 weeks following injections (FIG. 7). In comparison, no high-copy-number plasmid harboring SL003 cells were recovered from tumors on 2 day post injection. It suggested that the infA+ plasmids in the ST1 and SL008 were stable while those in its paternal strain were disappeared quickly. This observation was consistent with the Gahan's report which indicated that these high-copy plasmids were unstable in Salmonella strains. In addition, the copy number of high-copy-plasmids (pUC origin) inside the ST1 three weeks after initial injection was still high in mice.

6.6: The Ability of ST1 to Invade and Deliver Exogenous Proteins in Mammalian Cells

(181) To confirm of the bacterial invasion of ST1, mouse colon cancer CT26 cell monolayer (80˜90% confluence) was incubated with ST1 (at an MOI of 200) for 3 h under 0.5% oxygen concentration. Subsequently, the culture medium was removed and replaced with fresh medium supplemented with gentamicin (50 μg/mL) to kill external bacteria. After 2 and 4 hours, cells were washed and treated with lysis buffer (1% Triton X-100 in PBS) for 30 min on ice. The amount of intracellular bacteria was measured by plating serial dilutions of cell lysates on LB plates with strepmycin and DAP. Invasion rate (%)=number of internalized Salmonella/number of mammalian cells per well ×100.

(182) At 2 h post infection, more than 80% of cells contained one or more bacteria. At a later time point (4 h) the number of infected cells kept unchanged, however, the amount of bacteria inside the infected cells increased approximately 2-fold, suggesting that ST1 can replicate within the tumor cells (FIG. 5).

(183) Furthermore, to ascertain the ability of ST1-mediated delivery of protein, GFP was used as a marker. Tumor cells were incubated with ST1 carrying a prokaryotic plasmid psgfp. After a 3 h-incubation, ST1/psgfp invaded nearly 80% of epithelial cells which was quantified by gentamicin protection assay, and elicit >50% fluorescent cells detected by flow cytometry using a FACScalibur cytometer (FIG. 47).

6.7: Reporter Protein Expression and Translocation Through Bacterial Surface Display or Type III Secretion System

(184) Plasmid pLpp_ompA_GFP encodes a hybrid protein consisting of (a) a signal sequence and first nine N-terminal amino acids of the major E. coli lipoprotein Lpp, (b) amino acids 46-159 of the outer membrane protein A (ompA) and the GFP domain. Fluorescence visualization of ST1/pLpp_ompA_GFP indicated the insertion of GFP on the outer membrane (FIG. 48A).

(185) Another plasmid pSspH2-GFP was constructed to fuse the marker protein with the secretion and translocation effectors SspH2 (1-142 aa domain) from the type III secretion system. Here, pGFP without the signal domain was constructed as control. Compared to the vector control, noticeably high fluorescence intensity and diffused location of reporter protein in the cytosol were detected in ST1/pSspH2-GFP infected cells, indicating that a more effective and efficient delivery of exogenous proteins can be achieved through the type III secretion system (FIG. 48B).

6.8: Anti-Angiogenic Effect by Combination of Tumor-Targeting Salmonella SL008 and Endostatin in a Murine Model

(186) Endostatin, a 20-kDa carboxy-terminal fragment of collagen XVIII, is a potent anti-angiogenic agent currently being evaluated in clinical trials. However, a discrepancy remained unresolved: sustained tumor regression has only been observed with a non-soluble, precipitated form of recombinant endostatin produced in bacteria. To shed light on this question and establish a model of systemic anti-angiogenic gene therapy of cancer that may surmount obstacles in protein production and delivery, we transformed SL008 with a plasmid pSspH2-Endostatin encoding a seretable form of murine endostatin (FIG. 49). Endostatin expression was tested by western blotting (FIG. 50A), and the biological activity of the secreted endostatin by tumor-targeting Salmonella was confirmed by anti-proliferative effect on blood vessels (FIG. 50B). As show in growth cures, by comparing mock control and ST1/control vector treated groups attenuated Salmonella itself has some inhibition effects on tumor growth. The mechanism is still not certain and there are some possible reasons. A large amount of Salmonella accumulated in the tumor sites could induce cell death by competing with the tumor for nutrients and releasing virulent factors. The bacteria may also stimulate the inflammatory response, recruit immune cells and provoke the activation of macrophages.

(187) Furthermore, the ability of Salmonella SL008 to secrete biologically active antiangiogenic factors at therapeutically sufficient levels largely enhanced the antitumor effects. Taking advantage of the tumor-targeting characteristics of SL008, secretion expression of Endostatin by SL008 throughout the tumors avoided systemic toxicity and markedly stopped tumor growth in mice (FIG. 51) These findings suggested that the combination of tumor-targeting bacteria with angiogenesis inhibitor might be effective in a variety of solid tumors.

6.9: Functional mRNA Delivery by T7 RNAP-Expressing ST1 Strain

(188) Beside exogenous proteins and eukaryotic plasmids, ST1 is capable of delivering of RNA. By integration of the T7 RNAP gene into the genome, ST1 is able to mediate a transcription of functional mRNA encoding proteins or shRNA. After adhesion and entry, ST1 could escape from the host-cell vacuole by equipping them with LLO and replicate in the cytoplasm of host cells. Some bacteria disrupt and release nucleic acids and proteins inside the cytosol. To investigate whether ST1 could deliver functional mRNA in host cells, EGFP was used as an indicator for monitoring target gene expression in our system. The released unmodified mRNAs without a 5′7-methylguanosine cap structure and a 3′ poly translation in mammals and block prokaryotic translation, Kozak consensus sequence as well as an IRES sequence of the encephalomyocarditis virus were cloned upstream of gene of interest.

(189) For mRNA delivery, the inserted cassettes P.sub.T7-kozak-IRES-EGFP-pA.sub.20 (“A.sub.20” disclosed as SEQ ID NO: 1) fragment was amplified from pIRES-EGFP and digested by BglII and NotI. The stabilized vector backbone was generated from the plasmid pET32-infA. pET32a-infA was digested with BglII and NotI and the backbone was purified using agarose gel extraction. The backbone was ligated with P.sub.T7-kozak-IRES-EGFP-pA.sub.20 (“A.sub.20” disclosed as SEQ ID NO: 1) fragment and after transformation; the plasmid pT7-EGFP was confirmed by sequencing. Then the prokaryotic plasmid was transformed into engineered ST1 strain to yield ST1/pT7-EGFP (FIG. 52A).

(190) RNA delivery of ST1/pT7-EGFP was examined. Infection of cultured mouse CT26 cells was performed using ST1/pT7-EGFP at an MOI of 200. At 48 h post infection, cells were detached by trypsinisation and EGFP expression was detected by western blot (FIG. 52B). In addition, no EGFP expression was observed in ST1/pT7-EGFP either by using fluorescence microscopy or by then the more sensitive western blot. Accordingly, our data indicated that EGFP expression after mRNA delivery completely based on the transcription/translation in mammalian cells, but not in prokaryotic cells. These results strongly showed the potential of ST1 in the functional delivery of nucleic acids to mammalian cells. We showed, for the first time, that the phagosome-disrupting S. typhmurium strain ST1 can directly deliver both plasmid DNA and translation-competent mRNA into the cytosol, leading to model gene expression. The established DNA/RNA delivery system in engineered bacteria has the potential to develop into a novel kind of inter-kingdom dual expression system based on the interaction of bacteria and host cells.

6.10: ST1/pIKDE-EGFP Mediating EGFP Expression in CT26 Mouse Colon Cancer Cells

(191) To monitor the ST1-mediated inter-kingdom expression in CT26 mouse colon cancer cells, EGFP was used as a marker. ST1/pIKDE-EGFP was co-cultured with a monolayer of CT26 mouse cancer cells at an MOI of 200 for 3 h. After removal of extracellular bacteria, cells were cultured in a hypoxic incubator containing 0.5% O.sub.2 and 5% CO.sub.2 at 37° C. for 48 h and then fixed. Fluorescence microscopy revealed fluorescence in the cytosol cells infected with ST1/pIKDE-EGFP and a lack of fluorescent signal from ST1/pIKDE treated cells (FIG. 53).

6.11: Systemic Administration of ST1/pIKDE-DTA and SL008/pIKDE-DTA and Significantly Shrinks CT26 Colon Tumors

(192) CT26 colon tumors are highly malignant and often lead to death. To investigate the anti-tumor effects of ST1/pIKDE-DTA and SL008/pIKDE-DTA, a colon tumor model was established in the immunocompetent mice. CT26 tumor models were prepared by subcutaneous injection of 1×10.sup.5 cells into the BALB/c inbred mice (6-8 weeks of age). When the tumor reached 500 mm.sup.3 in size, the mice were received treatments. ST1 or SL008 harboring pIKDE-DTA (FIG. 54) or control vector were injected through the tail vein (5×10.sup.7 cfu/100 μl PBS). In control animals, PBS was injected in the same volume. Mice were examined and the tumor diameters were measured every other day in two dimensions with an external microcaliper. Subcutaneous tumor size was calculated by using the formula: Tumor volume=length×width.sup.2×0.52. In the saline-treated groups, the CT26 tumors grew rapidly and exceeded a mean of 4000 mm.sup.3 within 10 days (FIG. 55A). Then the mice were killed due to the excessive tumor burden. Mice receiving ST1/pIKDE-EGFP exhibited a depressed effect, when were compared with PBS controls. In comparison, a single intravenous injection of ST1/pIKDE-DTA into CT26 bearing mice resulted in sustained regression of established tumors by cytotoxic toxins (FIG. 55B). Upon ST1/pIKDE-DTA infection, a large necrotic area was left behind in which bacteria resided and thrived. Some tumors even formed to severe scabs in ST1/pIKDE-DTA treated mice (FIG. 55C). Similar result was also observed in SL008 treated groups (Data not shown).

6.12: Analysis of HA-Antigen Expression and In Vivo Immune Response for Replication Defective Salmonella ST1/pIKDE-HA Strain

(193) The hemagglutinin protein (HA) gene of avian influenza virus was amplified by PCR from the cDNA of avian influenza H7N9 virus, and sub-cloned into eukaryotic expression vector pIKDE. The HA gene was identified by sequencing. The recombinant plasmid was transformed into asd mutant ST1 (replication-incompetent), and the recombinants were designed as ST1/pIKDE-HA (FIGS. 56A-F). In a study in mice, BALB/c mice were immunized intraperitoneally at the dosage of 10.sup.7 CFU/mouse. Blood samples were collected from the tail artery of the mice. Anti-HA IgG titers were determined by means of enzyme-linked immunosorbent assay (ELISA) using HA for coating. Comparison between sera of mice immunized with ST1/pIKDE-HA showed that in both cases anti-HA serum IgG responses were elicited. After receiving three boosts on day 14, 21 and 28, the anti-HA IgG response in the mice were greatly increased. 100% mice had anti-HA IgG responses with an average titer 1: 4000 on day 48 (FIG. 41).

6.13: ST1-Mediated CTNNB1-Specific shRNA Expression Inhibits the Target Gene Expression and Suppresses Cell Proliferation

(194) To determine whether specific gene silencing can be achieved by ST1 harboring an inter-kingdom RNAi system after its intracellular entry, MDA-MB-231 cancer cells were infected with ST1 carrying plasmid pIKR-shCAT encoding shRNA against the gene of β-Catenin (FIGS. 57A-E), which is the key mediator of Wnt/β-Catenin pathway. The targeting sequence of human CTNNB1 (GenBank accession no. NM_001904) is AGCTGATATTGATGGACAG (SEQ ID NO: 98), corresponding to the coding regions of positions 505 to 523. Subsequently, the targeted gene expression at mRNA and protein levels were examined at 48 h post infection. Semi-quantitative RT-PCR demonstrated that CTNNB1 mRNA decreased by ˜90% in ST1/pIKR-shCAT infected cells. Compared with the vector control, ST1/pIKR-shCAT reduced the level of target proteins by ˜50% at an MOI of 200 (FIG. 58A). Since, an increase of β-Catenin leads to an increased proliferation in many solid tumors, a time course of cell proliferation in vitro was assessed. ST1/pIKR-shCAT led to a 23.9% reduction in cell growth (FIG. 58B) and a 14.8% increase in cell death (FIG. 58C), which corresponded with a decline in the expression of β-Catenin and its downstream gene myc as well as the activation of caspase-3 expression (FIG. 58A). These results suggested that the ST1-mediated knockdown of the key signal transducer β-Catenin inhibits tumor cell proliferation, at least partly by the induction of caspase-dependent apoptosis.

6.14: Intravenous Administration of ST1/pIKR-shCAT Reduces Human MDA-MB-231 Xenograft Tumor Growth

(195) The MDA-MB-231 xenograft model was established in which 10.sup.6 cells were injected into BALB/c female nude mice. Then the mice with established tumors (˜250 mm.sup.3) were intravenously injected with PBS, ST1/pIKR-shTom or ST1/pIKR-shCAT. The monitoring of tumor growth for 20 days showed a substantial reduction in ST1/pIKR-shCAT treated mice (FIG. 59A). At the end point, the average tumor volume in this group was markedly decreased by 60.9% compared to the PBS group. In comparison, the difference between PBS treated and ST1/pIKR-shTom were not statistically significant, indicating that ST1 amplification is insufficient for tumor inhibition. As is shown in FIG. 59B, mice treated with ST1/pIKR-shCAT showed the smallest tumor sizes resulted by synergic effects of bacteria and inter-kingdom RNAi (FIG. 59C).

(196) Subsequently, the bacterial distribution was analyzed for safety issues. On day 20 post infection, all the mice were sacrificed and tumor, liver, spleen, kidney, lymph node, lung and heart were removed and weighted. Organs were homogenized in 9 volumes of H.sub.2O and CFU tests of viable Salmonella in each organ were determined by plating serial dilutions on LB agar plates supplemented with streptomycin or the antibiotic corresponding to the construction plasmid as well as DAP. The mean number of ST1 per gram tumor exceeded 10.sup.7˜10.sup.8 (FIG. 59D). In contrast, ST1 was totally eliminated from other normal organs. Furthermore, the shRNA expression vector backbone was modified from a high-copy plasmid pcDNA3.1 (+) (pUC ori, Amp.sup.R), which is unstable in Salmonella (Galen, Pasetti et al. 2009). Validating by CFU tests on ampicillin-rich plates indicated that the therapeutic plasmids containing resistance gene still remained in ST1 in vivo after 3 weeks following injections, despite the absence of any antibiotic selection (FIG. 59D).

6.15: Determination of the Copy Number of pIKR-shCAT in ST1

(197) Relative analysis was tested with two ST1/pIKR-shCAT colonies harboring pIKR-shCAT which were separated from tumors on day 20 post injections. The separate detection of pIKR-shCAT and host chromosomal DNA were achieved using two separate primer sets, specific for the plasmid β-lactamase gene (bla) and for the chromosomal D-1-deoxyxylulose 5-phosphate synthase gene (dxs). Since both bla and dxs gene are single-copy in the plasmid pIKR-shCAT and Salmonella chromosomal DNA, respectively. Thus the plasmid copy number can be determined as the copy ratio of bla to dxs. The result was consistent with the previously reported value of pUC copy number within bacterial host cells, 500˜700 (Table. 4).

(198) TABLE-US-00004 TABLE 4 Estimate pIkR-shCAT copy number by relative qualifications C.sub.T Colony Bla Dxs ΔC.sub.T Calibrator ΔΔC.sub.T Copies/cell 2.sup.−ΔΔCT 1 21.52 ± 0.19 30.41 ± 0.11 −8.90 ± 0.22 0.01 ± 0.06 −8.91 ± 0.22 480.7 (15.0%) 2 21.22 ± 0.08 30.36 ± 0.13 30.36 ± 0.13 0.01 ± 0.06 −9.37 ± 0.15 571.7 (10.1%)

(199) The invention is not to be limited in scope by the specific embodiments described herein. Indeed, various modifications of the invention in addition to those described will become apparent to those skilled in the art from the foregoing description and accompanying figures. Such modifications are intended to fall within the scope of the appended claims.

(200) All references cited herein are incorporated herein by reference in their entirety and for all purposes to the same extent as if each individual publication or patent or patent application was specifically and individually indicated to be incorporated by reference in its entirety for all purposes.

REFERENCE

(201) Barbe, S., L. Van Mellaert, et al. (2006). “The use of clostridial spores for cancer treatment.” Journal of Applied Microbiology 101(3): 571-578. Cunningham, C. and J. Nemunaitis (2001). “A phase I trial of genetically modified Salmonella typhimurium expressing cytosine deaminase (TAPET-CD, VNP20029) administered by intratumoral injection in combination with 5-fluorocytosine for patients with advanced or metastatic cancer. Protocol no: CL-017. Version: Apr. 9, 2001.” Human gene therapy 12(12): 1594-1596. Finn, J., A. C. Lee, et al. (2004). “An enhanced autogene-based dual-promoter cytoplasmic expression system yields increased gene expression.” Gene Therapy 11(3): 276-283. Forbes, N. S. (2010). “Engineering the perfect (bacterial) cancer therapy.” Nature reviews. Cancer 10(11): 785-794. Hoffman, R. M. (2011). “Tumor-seeking Salmonella amino acid auxotrophs.” Current opinion in biotechnology 22(6): 917-923. Liu, X., M. Lei, et al. (2006). “Normal cells, but not cancer cells, survive severe Plk1 depletion.” Molecular and cellular biology 26(6): 2093-2108. Minchinton, A. I. and I. F. Tannock (2006). “Drug penetration in solid tumours.” Nature reviews. Cancer 6(8): 583-592. Murli, S., R. O. Watson, et al. (2001). “Role of tyrosine kinases and the tyrosine phosphatase SptP in the interaction of Salmonella with host cells.” Cellular microbiology 3(12): 795-810. Souders, N. C., T. Verch, et al. (2006). “In vivo bactofection: Listeria can function as a DNA-cancer vaccine.” DNA and Cell Biology 25(3): 142-151. Strillacci, A., C. Griffoni, et al. (2010). “RNAi-based strategies for cyclooxygenase-2 inhibition in cancer.” Journal of biomedicine & biotechnology 2010: 828045. Westphal, K., S. Leschner, et al. (2008). “Containment of tumor-colonizing bacteria by host neutrophils.” Cancer research 68(8): 2952-2960. Xiang, S., J. Fruehauf, et al. (2006). “Short hairpin RNA-expressing bacteria elicit RNA interference in mammals.” Nature Biotechnology 24(6): 697-702. Yu, B., M. Yang, et al. (2012). “Explicit hypoxia targeting with tumor suppression by creating an “obligate” anaerobic Salmonella Typhimurium strain.” Scientific reports 2: 436. Yu, B., M. Yang, et al. (2011). “A method to generate recombinant Salmonella typhi Ty21a strains expressing multiple heterologous genes using an improved recombineering strategy.” Applied Microbiology and Biotechnology 91(1): 177-188. Zhang, H. Y., J. H. Man, et al. (2010). “Tumor-targeted delivery of biologically active TRAIL protein.” Cancer gene therapy 17(5): 334-343. Zhao, H. F., D. L'Abbe, et al. (2005). “High-throughput screening of effective siRNAs from RNAi libraries delivered via bacterial invasion.” Nature methods 2(12): 967-973.