Mutant genes related to drug resistance and relapse of acute lymphoblastic leukaemia and a use thereof

Abstract

This disclosure provides mutant genes related to drug resistance and relapse of acute lymphoblastic leukaemia (ALL) and a use thereof, treatment or prevention of drug resistance and relapse of ALL and a use thereof, a use of compound Lometrexol and related inhibitors targeting GART and AITC in prevention and treatment of drug resistance and relapse of ALL, and a kit for evaluation of the risk of drug resistance and relapse of ALL. The mutation gene is a mutant gene of PRPS1. The drug acts on enzymes in purine synthesis pathway and reduces drug resistance and relapse by decreasing the concentration of hypoxanthine. The kit comprises reagents for lysis of sample cells and an instruction. The invention provides a powerful technical means and support for the prevention and treatment of drug resistance and relapse of ALL.

Claims

1. A recombinant protein comprising a PRPS1 mutant fused to a heterologous His tag, wherein the PRPS1 mutant is formed by making amino acid substitution at any one or more of the following positions of SEQ ID NO: 2: serine is substituted by threonine at position 103, serine is substituted by asparagine at position 103, asparagine is substituted by serine at position 144, lysine is substituted by asparagine at position 176, aspartic acid is substituted by glutamic acid at position 183, alanine is substituted by threonine at position 190, leucine is substituted by phenylalanine at position 191, threonine is substituted by serine at position 303, valine is substituted by alanine at position 53, isoleucine is substituted by valine at position 72, cysteine is substituted by serine at position 77, aspartic acid is substituted by glycine at position 139, tyrosine is substituted by cysteine at position 311, serine is substituted by isoleucine at position 103, asparagine is substituted by aspartic acid at position 114 or glycine is substituted by glutamic acid at position 174.

2. A PRPS1 mutant gene, wherein the PRPS1 mutant gene encodes the recombinant protein according to claim 1.

3. The PRPS1 mutant gene according to claim 2, wherein the nucleotide sequence of said PRPS1 mutant gene comprises a nucleotide substitution at any one of the following positions of SEQ ID NO:1: G is substituted by C at position 308, G is substituted by A at position 308, A is substituted by G at position 431, G is substituted by C at position 528, C is substituted by G at position 549, G is substituted by A at position 568, G is substituted by C at position 573, C is substituted by G at position 908, T is substituted by C at position 158, A is substituted by G at position 214, G is substituted by C at position 230, A is substituted by G at position 416, A is substituted by G at position 932, G is substituted by T at position 308, A is substituted by G at position 340 or G is substituted by A at position 521.

4. A recombinant vector, wherein the recombinant vector comprises the PRPS1 mutant gene according to claim 2.

5. A transformant, wherein the transformant comprises the recombinant vector according to claim 4.

6. A PRPS1 mutant library for evaluating a risk of drug resistance and relapse of ALL, wherein said PRPS1 mutant library comprises at least a first recombinant protein comprising a first PRPS1 mutant fused to a heterologous His tag, and a second recombinant protein comprising a second PRPS1 mutant fused to a heterologous His tag, wherein each of the first PRPS1 mutant and the second PRPS1 mutant is formed by making amino acid substitution at any one or more of the following positions of SEQ ID NO: 2: serine is replaced by threonine at position 103, serine is replaced by asparagine at position 103, asparagine is replaced by serine at position 144, lysine is replaced by asparagine at position 176, aspartic acid is replaced by glutamic acid at position 183, alanine is replaced by threonine at position 190, leucine is replaced by phenylalanine at position 191, or threonine is replaced by serine at position 303.

7. The PRPS1 mutant library according to claim 6, further comprising a third recombinant protein comprising a third PRPS1 mutant fused to a heterologous His tag, wherein the third PRPS1 mutant is formed by making amino acid substitution at any one or more of the following positions of SEQ ID NO: 2: valine is replaced by alanine at position 53, isoleucine is replaced by valine at position 72, cysteine is replaced by serine at position 77, aspartic acid is replaced by glycine at position 139, tyrosine is replaced by cysteine at position 311, serine is replaced by isoleucine at position 103, asparagine is replaced by aspartic acid at position 114, glycine is replaced by glutamic acid at position 174, or alanine is replaced by valine at position 190.

8. A PRPS1 mutant gene library for evaluating a risk of drug resistance and relapse of ALL, wherein the PRPS1 mutant gene library comprises following PRPS1 mutant genes having a nucleotide sequence of SEQ ID NO: 1 according to claim 3, wherein G is replaced by C at position 308, G is replaced by A at position 308, A is replaced by G at position 431, G is replaced by C at position 528, C is replaced by G at position 549, G is replaced by A at position 568, G is replaced by C at position 573, or C is replaced by G at position 908.

9. The PRPS1 mutant gene library according to claim 8, wherein the PRPS1 mutant gene library further comprises one or more following PRPS1 mutant genes having a nucleotide sequence of SEQ ID NO: 1, wherein T is replaced by C at position 158, A is replaced by G at position 214, G is replaced by C at position 230, A is replaced by G at position 416, A is replaced by G at position 416, A is replaced by G at position 932, G is replaced by T at position 308, A is replaced by G at position 340, G is replaced by A at position 521, or C is replaced by T at position 569.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 PRPS1 was found to be mutated relapse-specifically using super-deep sequencing and the mutation rate was found to be increased rapidly before clinical relapse. FIG. 1A: Schematic diagram showing relapse-specific PRPS1 missense mutations and affected protein domains. FIG. 1B: Emergence of relapse-specific PRPS1 mutations during remission, as detected by ultra-deep sequencing (mean, 250,000 reads). Key indicates sample ID of specific study individuals and their respective PRPS1 mutations.

(2) FIG. 2 Structural representation of PRPS1 mutant protein.

(3) FIG. 3 Map of pET28a Vector.

(4) FIG. 4 SDS-PAGE results of purified wild-type and mutants PRPS1 proteins.

(5) FIG. 5 Agarose gel electrophoresis results of amplified PCR products from PRPS1 wild-type.

(6) FIG. 6 Western-blots of stable Reh cell line expressing PRPS1 wild-type and mutants.

(7) FIG. 7 Drug susceptibility of stable Reh cell line to 6-MP and 6-TG, of which the cell lines expresses PRPS1 wild-type and mutants. FIG. 7A: Viability of stable Reh cell line treated by different concentration of 6-MP. FIG. 7B: Viability of Reh cell line treated by different concentration of 6-TG. FIG. 7C: IC.sub.50 of 6-MP and 6-TG of the cell lines expressing PRPS1 wild-type and mutants.

(8) FIG. 8 The cell apoptosis effects of 6-MP and 6-TG on stable Reh cell line expressing PRPS1 wild-type and mutants. FIG. 8A: Apoptosis of cells expressing WT PRPS1 or drug-resistant mutants after treatment for 72 h with 10 μg/ml 6-MP or 6-TG. FIG. 8B: DNA damage response and apoptosis biomarkers in a western blot analysis of Reh cells with the indicated PRPS1 mutations and treated with 10 μg/ml 6-MP.

(9) FIG. 9 Detection results of intracellular metabolites of chemotherapeutic drugs 6-MP/6-TG. FIG. 9A: Intracellular concentration of TIMP, TGMP, r-MP, r-TG and r-MMP (in an order from upper left to lower right, respectively), as measured by LC-MS, within Reh cells expressing various PRPS1 mutants and treated with 10 μM 6-MP for 4 h. Values are relative concentrations estimated on the basis of standard curves of pure compounds without correcting for the cell matrix's effect. FIG. 9B: Heat map showed metabolomics analysis of nucleotides, de novo purine flux, purine salvage flux and PRPS1 activity in Reh cells expressing different PRPS1 variants. FIG. 9C: Diagram illustrating incorporation of [.sup.13C2, .sup.15N]-glycine into the de novo purine biosynthesis pathway, [.sup.13C.sub.5, .sup.15N.sub.4]-HX into the purine salvage pathway, and [.sup.13C.sub.6]-glucose into PRPP, which leads to both de novo and salvage pathways.

(10) FIG. 10 Detection results of PRPS1 enzyme activity of wild-type and mutants expressing PRPS1. FIG. 10A: Diagram illustrating incorporation of [.sup.13C2, .sup.15N]-glycine into the de novo purine biosynthesis pathway, [.sup.13C.sub.5, .sup.15N.sub.4]-HX into the purine salvage pathway, and [.sup.13C.sub.6]-glucose into PRPP, which leads to both de novo and salvage pathways. FIG. 10B: Comparison of the concentration of PRPP product catalyzed by the control group and each PRPS1 mutant gene in the experimental group.

(11) FIG. 11 Diagram of PRPS1 subjecting to feedback regulation of ADP and GDP.

(12) FIG. 12 Inhibitory effects of GDP/ADP on PRPS1's protein activity. FIG. 12A: Feedback inhibition of WT and mutant PRPS1 enzyme activities by GDP, showing titration curves for WT PRPS1, two representative drug-resistant mutants and one reduced-function mutant. FIG. 12B: Inhibition of GDP/ADP on protein activity of PRPS1 WT, representative drug-resistant mutants and reduced-function mutants. FIG. 12C: Nucleotide feedback inhibition of PRPS1 activity measured by [.sup.13C.sub.5]-PRPP in cells expressing WT PRPS1 and representative drug-resistant mutants.

(13) FIG. 13 Content determination of intracellular products in purine metabolic pathway. FIG. 13A: Reductive concentrations of IMP in Reh cells expressing PRPS1 WT and drug resistance mutations. FIG. 13B: Reductive concentrations of hypoxanthine in Reh cells expressing PRPS1 WT and drug resistance mutations. FIG. 13C: Reductive concentrations of AICAR in Reh cells expressing PRPS1 WT and drug resistance mutations. FIG. 13D: Reductive concentrations of Inosine in Reh cells expressing PRPS1 WT and drug resistance mutations. FIG. 13E: Reductive concentrations of IMP+9 in Reh cells expressing PRPS1 WT and drug resistance mutations.

(14) FIG. 14 Inhibitory effect of CRISPR guide RNA targeting purine synthesis pathway on the drug resistance of PRPS1 S103T and A190T mutants. FIG. 14A: The impact of GART and ATIC on 6-MP IC.sub.50 (left) and hypoxanthine cell concentration (right) of WT and mutants. FIG. 14B: Protein electrophoresis map indicated the impact of inhibitory effect of CRISPR guide RNA targeting purine synthesis pathway on the drug resistance of PRPS1 S103T and A190T mutants.

(15) FIG. 15 Exogenous purine affects the resistance of Reh cells to chemotherapeutic drug 6-MP. FIG. 15A: Viability of Reh cells at increasing concentrations of 6-MP and in the presence of HX. FIG. 15B: Viability of Reh cells at increasing concentrations of 6-MP and in the presence of IMP.

(16) FIG. 16 Exogenous purine affects the metabolism of Reh cells to chemotherapeutic drug 6-MP. FIG. 16A: Relative concentration of TIMP. FIG. 16B: Relative concentration of TGMP.

(17) FIG. 17 Hypoxanthine competitively inhibits the effect of chemotherapeutic drug 6-MP. FIG. 17A: The establishment of in vitro enzymatic reaction. FIG. 17B: Left, HX is preferred to 6-MP as an HPRT1 substrate. LC-MS measured the concentrations of reaction products (IMP, TIMP), Right, HX can suppress 6-MP prodrug conversion. Increasing concentrations of HX were added to compete the 6-MP conversion, and the TIMP concentration was measured by LC-MS.

(18) FIG. 18 Lometrexol reverses the 6-MP resistance resulting from PRPS1 gene mutant. FIG. 18A: IC.sub.50 of 6-MP on Reh cells with or without 5 ng/ml lometrexol. FIG. 18B: Hypoxanthine concentration of Reh cells with or without 5 ng/ml lometrexol. FIG. 18C: Relative TIMP concentration of cells treating with or without lometrexol. FIG. 18D: Relative TGMP concentration of cells treating with or without lometrexol.

(19) FIG. 19 Inhibitory effect of nucleic acid drug shRNA targeting to purine synthesis pathway on the drug resistance of PRPS1 S103T and A190T mutant. FIG. 19A: PRPS1 expression in Reh cells were knocked down using Lentiviral shRNAs. FIG. 19B: Relative expression level of PPAT RNA. FIG. 19C: IC.sub.50 of 6-MP shows the inhibitory effect of nucleic acid drug shRNA.

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENT

(20) The invention is further illustrated by means of embodiments, but the invention is not limited to the scope of the described embodiments. The experimental methods without specified conditions in the following embodiments are selected according to conventional methods and conditions, or in accordance with the product instruction.

(21) As used herein, the samples from 16 groups of childhood ALL in the phase of diagnosis, remission and relapse were sequenced by Whole Exome Sequencing technology, and it was found that the phosphoribosyl pyrophosphate synthase I gene has relapse-specific multiple sites mutations, and the genes in diagnosis and remission samples remain wild type genes. In the further sequencing of PRPS1 gene in 144 relapsed samples, PRPS1 gene mutation was found in 16 relapsed samples, and the mutation frequency was 13% (18/138) in B-ALL. In the meantime, Dr. Renate Kirschner-Schwarb from the Pediatric Blood and Cancer Center of Charité—Universitätsmedizin Berlin in Germany also confirmed that there was a relapse-specific mutation in PRPS1 in German Childhood ALL with a mutation rate of 2.7% (6/220). None of the most important four types of mutations A190T, T303S, K176N and N144S in all mutations have been found in all samples from ALL patients within the resolution range by ultra-deep sequencing a series of bone marrow samples during the diagnosis. In addition, these PRPS1 mutations were found to grown exponentially before the clinical phase of relapse, as shown in FIG. 1. After overexpressing the PRPS1 mutant gene in ALL cell line Reh which usually expressed wild-type PRPS1, it was shown that the relapse-specific PRPS1 gene mutations resulted in a resistance of Reh to 6-MP/6-TG in drug susceptibility test, which demonstrates that PRPS1 gene mutation plays an important role in the progress of drug resistance and relapse of childhood ALL.

(22) In combination with the methods of cell biology, molecular biology, metabonomics and the like, the present invention systematically studied the mechanism of drug resistance and relapse of childhood ALL which is regulated by PRPS1 gene mutation, from the aspects of the effect of PRPS1 gene mutation on its own enzyme activity, to its effect on the metabolism network of 6-MP drug and purine. The study revealed a new mechanism of drug resistance and relapse of Childhood ALL, suggesting that PRPS1 mutations can drive relapse and be the marker of drug resistance and relapse, meanwhile PRPS1 mutations have important implications for subsequent gene diagnosis and individualized treatment in early phase of clinical relapse.

(23) In the following embodiments, the D183H mutant, as gain-of-function mutant of the reported PRPS1 gene, and A87T and M115T mutants, as loss-of functions mutant of the reported PRPS1 gene, are used as the positive control and negative control, respectively, to evaluate whether the system of experimental detection is normal. As for the experimental groups, the mutants of S103T, S103N, N144S, T303S, K176N, D183E, A190T, A190V, A190V and L191F can be divided into two groups by comparing their crystal structure with that of human PRPS1, namely mutants having the mutation sites located at the dimer formation interface of PRPS1 and mutants having the mutation sites located at allosteric sites of PRPS1, which were shown in FIG. 2. The mutants within the group are drug-resistant mutants of the PRPS1 gene.

Embodiment 1

(24) Identification of PRPS1 Gene Mutations in Samples:

(25) PRPS1 sequencing was performed in 16 group of diagnostic, remission and relapse samples from subjects having childhood ALL and 144 relapsed samples using Whole Exome Sequencing technology.

(26) Quality control of the samples: The quality of the samples is directly related to the reliability of the sequencing results. The quality of the samples used for deep sequencing and subsequently validation is guaranteed by the following three methods: (i) In the stage of diagnosis and relapse, leukemia cells in the bone marrow may account for more than 90% of the nucleated cells, and residual normal granulocytes and nucleated red blood cells can be removed by Ficoll density gradient centrifugation to obtain leukemia cells with high purity used for subsequently DNA extraction and sequencing; (ii) Leukemia cells and normal bone marrow hematopoietic cells can be differentiated by multicolor fluorescent antibody combination, and samples with low purity can be sorted by flow cytometry to obtain samples with high purity (>99%); (iii) According to trace residual in the test results, samples in remission stage with the residual leukemia cells below 0.01% were selected for deep sequencing, thus ensuring the reliability of mutations specifically in the stage of diagnosis and relapse.

(27) Preparation of the samples: Genomic DNA from leukemia cells was extracted using QIAGEN Blood DNA kit, DNA concentration was determined using Q-bit Fluorescence Quantification Kit, and high purity of genomic DNA was used for subsequent deep sequencing.

(28) Amplification of PRPS1 exons: Amplification of PRPS1 exons was implemented by using suitable primers designed for genome sequence of PRPS1, wherein the PCR system and program are as follows:

(29) Specific PCR System:

(30) TABLE-US-00002 10 × KOD Buffer 2 μL 2 mM dNTP 2 μL 25 mM MgSO.sub.4: 0.8 μL Forward primer (10 pmol) 0.5 μL Reverse primer (10 pmol) 0.5 μL Genomic DNA template 1 μL(50 ng) Sterile water 12.7 μL KOD-PLUS polymerase 0.5 μL
Specific PCR Program: 95° C. for 10 min (Pre-denaturation) 95° C. for 10 sec (denaturation) 55° C. for 30 sec (annealing) 68° C. for 15 sec (elongation) 68° C. for 10 min.

(31) Primer sequences are shown in Table 1. PCR products were routinely subjected to capillary electrophoresis sequencing and mutation analysis, and mutation analysis was performed using the software Mutation Surveyor.

(32) Sequencing analysis: The target bands were sequenced after PCR successfully. The target sequence was compared with the PRPS1 gene sequence in NCBI to analyze the gene mutation of PRPS1. The experimental results are shown in Table 2 and Table 3.

(33) By sequencing the diagnostic, remission and relapse samples of 16 groups of children with ALL, it was found that there were multiple relapse-specific mutations in the PRPS1 (phosphoribosyl pyrophosphate synthase I) gene (see Table 2), while the PRPS1 is wild-type in diagnostic and remission samples. PRPS1 sequencing was conducted in 144 relapse samples and PRPS1 gene mutation was found in 16 relapse samples with a mutation frequency of 13% (18/138). In the meantime, Dr. Renate Kirschner-Schwarb in the Pediatric Blood and Cancer Center of Charité-Universitätsmedizin Berlin in Germany also confirmed the results of this invention and there was a relapse-specific mutation in PRPS1 in German Childhood ALL with a mutation rate of 2.7% (6/220) (see Table 2). Combined with clinical pathology analysis, it was shown that patients with PRPS1 mutations were in the early stage of relapse (P<0.005) (see Table 3). By ultra-deep sequencing, it was found that PRPS1 was a relapse-specific mutation and the mutation ratio increased rapidly before clinical relapse which means PRPS1 drives the relapse of patient and can be used as a genetic marker for clinical relapse diagnosis and an important target for therapy of clinical relapse.

(34) TABLE-US-00003 TABLE 1 Information of PCR for amplifying exons Annealing PRPS Temper- exons Primer sequence (5′-3′) ature Exon 1 Forward: TGAGTCTGTGGCCGACTTC 63° C. (SEQ ID NO: 3) Reverse: CGACCCCATCCCTCCTATAC (SEQ ID NO: 4) Exon 2 Forward: TCAATCCACACTTGGTTGAATC 63° C. (SEQ ID NO: 5) Reverse: TCCAGAGGAGTTGGTGCTTAG (SEQ ID NO: 6) Exon 3 Forward: ATGAATTTCTGGGTACCATAGTG 63° C. (SEQ ID NO: 7) Reverse: CTTCTCTGCAGTCTTCAGCATC (SEQ ID NO: 8) Exon 4 Forward: AATCTACCACACTGGGCCTG 63° C. (SEQ ID NO: 9) Reverse: CCATGTGCTAGCTACTTACATCC (SEQ ID NO: 10) Exon 5 Forward: CCCCGGCCTCTTTAGTCC 58° C. (SEQ ID NO: 11) Reverse: TCAGCAGGCTGAAGACATTC (SEQ ID NO: 12) Exon 6 Forward: GTTGTGGAAGCCTAAGCAGG 63° C. (SEQ ID NO: 13) Reverse CTTCAGAATCCAGAGACCTAATTC (SEQ ID NO: 14) Exon 7 Forward: TCATGACAGGGAAACAGCAC 63° C. (SEQ ID NO: 15) Reverse: GAGCTTCCCCAGTCACAGTC (SEQ ID NO: 16)

(35) TABLE-US-00004 TABLE 2 PRPS1 mutations in relapse samples of Chinese and German childhood B-ALL Sample Immuno- Site on Base Amino acids Case Mutation ID phenotype chromosome transformation transformation Amount frequency (%) China ALL-122 B ChrX: 106,882,560 T > C V53A 1 13.0 (18/138) ALL-102 B ChrX: 106,882,616 A > G I72V 1 ALL-157 B ChrX: 106,882,632 G > C C77S 1 ALL-058 B ChrX: 106,884,133 G > C S103T 1 ALL-088 B ChrX: 106,884,133 G > A S103N 2 ALL-151 B ChrX: 106,884,133 G > A S103N ALL-128 B ChrX: 106,885,606 A > G D139G 1 ALL-076 B ChrX: 106,885,621 A > G N144S 1 ALL-005 B ChrX: 106,885,718 G > C K176N 1 ALL-005 B ChrX: 106,888,425 C > G D183E 1 ALL-011 B ChrX: 106,888,444 G > A A190T 8 ALL-121 B ChrX: 106,888,444 G > A A190T ALL-122 B ChrX: 106,888,444 G > A A190T ALL-145 B ChrX: 106,888,444 G > A A190T ALL-146 B ChrX: 106,888,444 G > A A190T ALL-128 B ChrX: 106,888,444 G > A A190T ALL-137 B ChrX: 106,888,444 G > A A190T ALL-143 B ChrX: 106,888,444 G > A A190T ALL-148 B ChrX: 106,888,449 G > C L191F 1 ALL-141 B ChrX: 106,893,213 C > G T303S 1 ALL-026 B ChrX: 106,893,237 A > G Y311C 1 German ALL-374 B ChrX: 106,884,133 G > T S103I 1 2.7 (6/220) ALL-386 B ChrX: 106,884,165 A > G N114D 1 ALL-335 B ChrX: 106,885,621 A > G N144S 2 ALL-381 B ChrX: 106,885,621 A > G N144S ALL-335 B ChrX: 106,885,711 G > A G174E 1 ALL-248 B ChrX: 106,888,445 C > T A190V 1 ALL-253 B ChrX: 106,888,444 G > A A190T 2 ALL-374 B ChrX: 106,888,444 G > A A190T

(36) In the present invention, the bone marrow samples from diagnostic, remission and relapse of children ALL were sequenced using Whole Exome Sequencing technology and PRPS1 gene mutations was found in 18 relapse samples with a mutation frequency of 13% (18/138) as shown in Table 2, wherein the A190T site mutation occurred in 9 relapse samples. The collaboration with Dr. Renate Kirschner-Schwarb in the Children's Blood Cancer Center of Charité-Universitätsmedizin Berlin in Germany also confirmed that there was a relapse-specific mutation in PRPS1 in German Children ALL with a mutation rate of 2.7% (6/220).

(37) TABLE-US-00005 TABLE 3 Correlation between PRPS1 mutation and clinical features in Chinese and German children with B- ALL China (n = 138) Germany (n = 220) PRPS1 PRPS1 PRPS1 PRPS1 Wild-type Mutant Wild-type Mutant (%) (%) (%) (%) n = 120 n = 18 P n = 214 n = 6 P Age 0.365.sup.1 0.276.sup.1 <1 year old 6 (5.0) 0 (0.0) 5 (2.3) 0 (0.0) 1-9 years old 90 (75.0) 12 (66.7) 158 (73.8) 3 (50.0) >10 years old 24 (20.0) 6 (33.3) 51 (23.8) 3 (50.0) Gender 0.300.sup.2 0.684.sup.1 Girl 43 (35.8) 9 (50.0) 104 (48.6) 2 (33.3) Boy 77 (64.2) 9 (50.0) 110 (51.4) 4 (66.7) Amount of leukocytes 0.101.sup.1 0.441.sup.1 (×10.sup.9/L) <50 91 (75.8) 10 (55.6) 194 (91.1) 5 (83.3) 50-100 12 (10.0) 2 (11.1) 12 (5.6) 1 (16.7) >100 17 (14.2) 6 (33.3) 7 (3.3) 0 (0.0) No data 1 0 Genetic feature 0.324.sup.1 0.750.sup.1 E2A-PBX1 4 (4.7) 0 (0.0) 3 (1.4) 0 (0.0) TEL-AML1 9 (10.4) 0 (0.0) 34 (16.3) 0 (0.0) BCR-ABL1 17 (19.7) 4 (44.4) 4 (1.9) 0 (0.0) MLL-AF4 1 (1.2) 0 (0.0) 4 (1.9) 0 (0.0) Normal 55 (64.0) 5 (55.6) 163 (78.4) 6 (100.0) No data 34 9 6 0 Risk degree of relapse 0.203.sup.2 0.010.sup.1 Low risk, Moderate risk 76 (63.3) 8 (44.4) 153 (71.5) 1 (16.7) High risk 44 (36.7) 10 (55.6) 61 (28.5) 5 (83.3) Immuno-phenotype 0.456.sup.1 1.000.sup.1 pro-B 5 (4.9) 0 (0.0) 11 (5.6) 0 (0.0) common B 83 (81.4) 13 (76.5) 154 (78.6) 6 (100.0) pre-B 14 (13.7) 4 (23.5) 25 (12.8) 0 (0.0) Biphenotypic 0 (0.0) 0 (0.0) 6 (3.1) 0 (0.0) No data 18 1 18  0 Relapse time.sup.¶ 0.002.sup.1 ≤0.001.sup.1 Relative early 51 (42.5) 11 (61.1) 28 (13.1) 4 (66.7) Early 26 (21.7) 7 (38.9) 51 (23.8) 2 (33.3) Late 43 (35.8) 0 (0.0) 135 (63.1) 0 (0.0) Relapse time ≤0.001.sup.1 ≤0.001.sup.1 Relapse in therapy 77 (64.2) 18 (100.0) 51 (23.8) 6 (100.0) Relapse after therapy 43 (35.8) 0 (0.0) 163 (76.2) 0 (0.0) NT5C2 mutation No 43 2 105 (49.1) 3 (50.0) Yes  0 0 7 (3.3) 0 (0.0) No data 77 16  102 (47.6) 3 (50.0)

(38) .sup.1P value is calculated by the Fisher exact test. .sup.2P value is calculated by chi-square test. Relapse time.sup.¶: Relative early, within 18 months after diagnosis; Early, between 18 months and 36 months after diagnosis; Late, after 36 months after the initial treatment.

(39) As shown in Table 3, after analyzing clinicopathological data, it was found that PRPS1 mutations were all occurred in patients with early relapse (Chinese patient, P<0.005, Germany patient, P<0.001), suggesting the PRPS1 mutation is significant for diagnosing relapse in remission stage.

Embodiment 2

(40) Identification of PRPS1 Gene Mutations Involved in Purine Metabolic Pathway in Samples

(41) Sequencing of HGPRT, IMPDH, NT5C2, PRPS2, ATIC, ADSL, GART and PFAS enzymes involved in purine metabolism was performed in 160 relapse samples of childhood ALL using conventional next-generation sequencing.

(42) Quality control and preparation of the samples, and amplification of gene exons were the same as in Embodiment 1.

(43) Sequencing analysis: After successful PCR, the target bands were sequenced, and the target sequences were compared with the corresponding gene sequences in NCBI to analyze the gene mutation. If a mutation was found in the relapse sample, the diagnostic sample of the same patient will be detected to determine whether it is a relapse-specific mutation. The experimental results are shown in Table 4.

(44) By sequencing and sequence alignment, it was found that there were relapse-specific mutations in purine metabolism related enzymes such as PRPS2, ATIC, ADSL, GART and PFAS.

(45) TABLE-US-00006 TABLE 4 The mutations of enzymes related to purine metabolism in relapse samples of childhood ALL Gene Sample Immuno- Site on Base Amino acids Case Mutation name ID phenotype chromosome transformation transformation No. frequency (%) PRPS1 ALL-122 B ChrX: 106,882,560 T > C V53A 1 13 (18/138) ALL-102 B ChrX: 106,882,616 A > G I72V 1 ALL-157 B ChrX: 106,882,632 G > C C77S 1 ALL-058 B ChrX: 106,884,133 G > C S103T 1 ALL-088 B ChrX: 106,884,133 G > A S103N 2 ALL-151 B ChrX: 106,884,133 G > A S103N ALL-128 B ChrX: 106,885,606 A > G D139G 1 ALL-076 B ChrX: 106,885,621 A > G N144S 1 ALL-005 B ChrX: 106,885,718 G > C K176N 1 ALL-005 B ChrX: 106,888,425 C > G D183E 1 ALL-011 B ChrX: 106,888,444 G > A A190T 8 ALL-121 B ChrX: 106,888,444 G > A A190T ALL-122 B ChrX: 106,888,444 G > A A190T ALL-145 B ChrX: 106,888,444 G > A A190T ALL-146 B ChrX: 106,888,444 G > A A190T ALL-128 B ChrX: 106,888,444 G > A A190T ALL-137 B ChrX: 106,888,444 G > A A190T ALL-143 B ChrX: 106,888,444 G > A A190T ALL-148 B ChrX: 106,888,449 G > C L191F 1 ALL-141 B ChrX: 106,893,213 C > G T303S 1 ALL-026 B ChrX: 106,893,237 A > G Y311C 1 PRPS2 ALL-114 B ChrX: 12,809,680 C > A R22S 1 2.8 (3/107) ALL-120 B ChrX: 12,827,354 G > T S106I 1 ALL-127 T ChrX: 12,828,244 C > G P173R 1 ATIC ALL-140 T Chr2: 216,190,755 T > C V142A 1 1.7 (2/116) ALL-114 B Chr2: 216,191,545 G > T A178S 1 ADSL ALL-060 T Chr22: 40,745,936 G > A R85Q 1 0.9 (1/107) GART ALL-056 B Chr21: 34,876,538 G > A V976I 2 1.9 (2/105) ALL-077 B Chr21: 34,876,538 G > A V976I PFAS ALL-002 B Chr17: 8,170,084 T > A L945Q 1 1.3 (1/81)

Embodiment 3

(46) Construction of Prokaryotic Expression Vector for PRPS1

(47) 1. Acquisition of the target gene fragment: primers for amplifying PRPS1 wild-type, including forward primer 5′ cgcggcagccatATGCCGAATATCAAAATCTTCAG 3′ (SEQ ID NO: 17), and reverse primer 5′ gtggtggtgctcgagTTATAAAGGGACATGGCTGAATAGGTA 3′ (SEQ ID NO: 18), were designed according to the PRPS1 sequence provided by NCBI (gene ID: 5631, NM 002764). Primer contains exchanging-pairing base, cleavage site, and 5′end sequence of target gene used for PCR capturing target gene). Having a size of 957 bp, PRPS1 product was captured by PCR using cDNA extracted from Reh cells as template, and the product sequence was shown in SEQ ID No. 1.

(48) 2. Linearization of the prokaryotic expression vector: The pET28a vector was digested with the restriction endonuclease NdeI/XhoI, meanwhile the map of PET28a vector was shown in FIG. 3.

(49) 3. Construction of recombinant plasmid: The PCR product at Step 1 was recombinated into the linearized viral vector using In-Fusion™ PCR Cloning Kit from Clontech, and the recombinant was amplified by E. coli TOP10.

(50) 4. Identification of recombinant plasmids: the recombinants were confirmed by Sequencing.

(51) 5. Construction of prokaryotic vector containing PRPS1 mutant: 9 mutants of PRPS1 including S103T, S103N, N144S, T303S, K176N, D183E, A190T, A190V and L191F were constructed by circular PCR using KOD-Plus DNA polymerase with pOD28a-PRPS1 as plasmid template, wherein the PCR primers were shown in Table 5.

(52) Specific PCR system:

(53) TABLE-US-00007 10 × KOD Buffer 2 μL 2 mM dNTP 2 μL 25 mM MgSO.sub.4: 0.8 μL Forward primer (10 pmol) 0.5 μL Reverse primer (10 pmol) 0.5 μL Template of Plasmid GV303-PRPS1 1 μL (10 ng) Sterile water 12.7 μL KOD-PLUS polymerase 0.5 μL

(54) Specific PCR program: 95° C. for 10 min (Pre-denaturation) 95° C. for 10 sec (denaturation) 55° C. for 30 sec (annealing) 68° C. for 3 min elongation (30 s/Kb) 30 cycles 68° C. for 10 min.

(55) 1 μl of DpnI enzyme was added to PCR product and incubated in water to digest the plasmid template at 37° C. for 1 hour, and subsequently 10 μl of the product was added to E. coli TOP10 for amplification. The transformants were confirmed by Sequencing.

Embodiment 4

(56) Purification of PRPS1 Prokaryotic Protein

(57) 1. Transformation of pET28a-PRPS1 plasmids into E. coli BL21 (DE3)

(58) {circle around (1)} 1 μl of pET28a-PRPS1 plasmids and 100 μl of competent E. coli BL21 (DE3) cells were sequentially homogenized and placed on ice for 30 minutes, incubated in water at 42° C. for 90 seconds without shaking, and placed on the ice for 2 minutes immediately. After adding with 900 μl of SOC medium, the cells was incubated at 37° C. with shaking at 170 rpm for 1 hour.

(59) {circle around (2)} Coating the semi-solid LB agar culture medium containing kanamycin of 50 μg/ml with 1 ml of transformed competent cells. After 16 hours of inverted culturing, when colonies appeared, positive and grown well clones were selected for further experiments.

(60) 2. Pilot study of expression:

(61) {circle around (1)} Monoclonal from the pET28a-PRPS1 series transformation plate was inoculated into 3 ml of LB (containing antibiotics) and incubated at 37° C. for 10 to 12 hours with shaking at 220 rpm.

(62) {circle around (2)} The next day 50 μl bacterial suspension was inoculated into 5 ml LB (containing antibiotics) with a ratio of 1:100 inoculation herein, and incubated at 37° C. for 2 to 3 hours with shaking at 220 rpm until the OD value reaches 0.6.

(63) {circle around (3)} Sampling of control: 2 ml of bacteria suspension was taken and centrifugated for 1 minute at 12000 rpm, and the supernatant was discarded subsequently. 1 ml of PBS solution was added onto the cell pellets and the cell suspension was broken by ultrasonication (200 w for 3 seconds, and pause for 5 seconds, 20 cycles), and then SDS-PAGE Buffer (reduction, 4×) was added in and the mixture was incubated at 100° C. in water for 10 minutes follow by centrifuging at 12000 rpm for 10 minutes. The supernatant was pipetted and stored at −20° C. as a control without induction.

(64) {circle around (4)} The IPTG was added into the remained 3 ml of the bacterial solution to a final concentration of 1 mM, and the solution was incubated at 16° C. for 16 hours with shaking at 220 rpm. Then the solution was centrifuged for 1 minute at 12000 rpm and the supernatant was discarded, and the cell pellets were broken by ultrasonication and samples were stored at −20° C.

(65) {circle around (5)} The above-mentioned samples were identified by SDS-PAGE electrophoresis.

(66) 3. PRPS1 overexpression

(67) {circle around (1)} Monoclonal was inoculated into 3 ml of LB (containing antibiotics) and incubated at 37° C. for 10 to 12 hours with shaking at 220 rpm.

(68) {circle around (2)} Expanding culture: the ratio of inoculation is 1:100, that is, 20 ml of bacterial suspension was added into 2 L of LB culture medium (comprising antibiotics) and incubated at 37° C. for 4 to 5 hours with shaking at 220 rpm until the OD value reaches 0.6-0.8.

(69) {circle around (3)} Sampling of control: 2 ml of bacteria suspension was taken and centrifugated for 1 minute at 12000 rpm, and the supernatant was discarded subsequently. 1 ml of PBS solution was added onto the cell pellets, and the cell suspension was broken by ultrasonication (200 w for 3 seconds and pause for 5 seconds, 20 cycles), and then SDS-PAGE Buffer (reduction, 4×) was added in and mixture was incubated at 100° C. in water for 10 minutes follow by centrifuging at 12000 rpm for 10 minutes. The supernatant was pipetted and stored at −20° C. as a control without induction.

(70) {circle around (4)} After remained bacterial suspension was incubated at 16° C. for further 1 hour with shaking at 220 rpm, IPTG was added to the bacterial suspension to a final concentration of 1 mM, and the bacterial suspension was incubated at 16° C. for 16 hours with shaking at 220 rpm. Then the suspension was centrifuged at 4° C. for 10 minutes at 6000 rpm and the supernatant was removed. 5 ml of the bacteria was taken for identification of expression (sample at 16° C.), and the rest cell pellets were stored at −80° C.

(71) {circle around (5)} Said series samples of PRPS1 were ultrasonicated separately and then identified by SDS-PAGE electrophoresis (in consistent with {circle around (5)} of “Pilot study of expression”).

(72) 4. Purification of PRPS1 protein: the bacteria suspension which was broken by ultrasonication was then purified by nickel column in the AKTA-purifier system to obtain series of PRPS1 protein. The expression and purity of series of PRPS1 protein were identified by SDS-PAGE electrophoresis, as shown in FIG. 4. The series of PRPS1 proteins were quantified by BCA protein quantitative kit from Beyotime, and the PRPS1 wild-type protein was obtained with sequence as set forth in SEQ ID NO. 2 in Sequence Listing.

Embodiment 5

(73) Construction of Eukaryotic Expression Vector for PRPS1 Mutant Gene

(74) 1. Acquisition of the target gene fragment: primers for amplifying PRPS1 wild-type including forward primer 5′ GAGGATCCCCGGGTACCGGTCGCCACCATGCCG AATATCAAAATC 3′ (SEQ ID NO: 19) and reverse primer 5′ TCCTTGTAGTCCATACCGTGGTG GTGGTGGTGGTGCTCGAGTAAAG 3′ (SEQ ID NO: 20) were designed according to the PRPS1 sequence provided by NCBI (gene ID: 5631, NM 002764). Primers contains exchanged-pairing base, cleavage site, and 5′end sequence of target gene used for PCR capturing target gene. Having a product size of 1022 bp, PRPS1 was captured by PCR using Pet-28a-PRPS1 as plasmid template, and the PCR product was shown in FIG. 5.

(75) PCR System:

(76) TABLE-US-00008 10 × KOD Buffer 2 μL 2 mM dNTP 2 μL 25 mM MgSO.sub.4: 0.8 μL Forward primer (10 pmol) 0.5 μL Reverse primer (10 pmol) 0.5 μL Plasmid pET-28a-PRPS 1 μL (10 ng) Sterile water 12.7 μL KOD-PLUS polymerase 0.5 μL
PCR Reaction Program: 95° C. for 10 min (Pre-denaturation) 95° C. for 10 sec (denaturation) 55° C. for 30 sec (annealing) 68° C. for 3 min elongation (30 s/Kb) 30 cycles 68° C. for 10 min.

(77) 1 μl of DpnI enzyme was added to the PCR product and the plasmid template was digested by incubating in water at 37° C. for 1 hour, and 10 μl of digested product was added to E. coli TOP10 for following amplification. The transformants were sequenced to confirm whether the mutants were constructed successfully.

(78) 2. Linearization of the virus expression vector: The GV303 viral vector was reacted with the restriction endonuclease AgeI (Genechem).

(79) 3. Construction of recombinant plasmid: The PCR product of Step 1 was exchanged into the linearized viral vector using In-Fusion™ PCR Cloning Kit kit from Clontech, and the recombinant GV303-PRPS1 was amplified by E. coli TOP10.

(80) 4. Identification of recombinant plasmids by enzyme digestion: The recombinant was identified by restriction endonuclease Hind III, and the recombinant will be a positive clones if 354 bp fragment was identified.

(81) 5. Construction of plasmid of PRPS1 mutant: 9 lentivirus expression vectors containing PRPS1 mutants: GV303-PRPS1-S103T, GV303-PRPS1-S103N, GV303-PRPS1-N144S, GV303-PRPS1-T303S, GV303-PRPS1-K176N, GV303-PRPS1-D183E, GV303-PRPS1-A190T, GV303-PRPS1-A190V and GV303-PRPS1-L191F were constructed by PCR using KOD-Plus DNA polymerase from TOYOBO with GV303-PRPS1 as plasmid template, and PCR primers were shown in Table 5.

(82) TABLE-US-00009 TABLE 5 Sequence Listing of PCR primers of PRPS1 mutants Forward primers (5′-3′) Reverse primers (5′-3′) S103T GAAAGATAAGACCCGGGCGCC GGCGCCCGGGTCTTATCTTTC AATCTCAGCC TTATCCTGC (SEQ ID NO: 21) (SEQ ID NO: 22) S103N GAAAGATAAGAACCGGGCGC GGCGCCCGGTTCTTATCTTTC CAATCTCAGCC TTATCCTGC (SEQ ID NO: 23) (SEQ ID NO: 24) N144S CCAGTAGACAGTTTGTATGCA GCATACAAACTGTCTACTGG GAGCCGGC GATACAAAAAAAG (SEQ ID NO: 25) (SEQ ID NO: 26) T303S CATCAGGAGAAGTCACAATGG CCATTGTGACTTCTCCTGATG AGAATCCGT GCTTCTGC (SEQ ID NO: 27) (SEQ ID NO: 28) K176N GGAGCTAACAGAGTGACCTCC GTCACTCTGTTAGCTCCACC ATTGC AGCATC (SEQ ID NO: 29) (SEQ ID NO: 30) D183E CCATTGCAGAGAGGCTGAATG CATTCAGCCTCTCTGCAATG TGGACTTTGC GAGGTCACTC (SEQ ID NO: 31) (SEQ ID NO: 32) A190T GTGGACTTTACCTTGATTCACA GTGAATCAAGGTAAAGTCCA AAGAACGGA CATTCAGCCTG (SEQ ID NO: 33) (SEQ ID NO: 34) A190V GTGGACTTTGTCTTGATTCACA GTGAATCAAGACAAAGTCCA AAGAACGGA CATTCAGCCTG (SEQ ID NO: 35) (SEQ ID NO: 36) L191F GTGGACTTTGCCTTCATTCACA GTGAATGAAGGCAAAGTCCA AAGAACGGA CATTCAGCCTG (SEQ ID NO: 37) (SEQ ID NO: 38)

Embodiment 6

(83) Preparation of Reh Cells Expressing PRPS1 Mutant Genes

(84) Preparation of Virus

(85) 1. HEK293T cells were seeded into 10 cm dishes 24 hours before transfection and the transfection can be initiated when the cell density reaches 50% to 80% in next day.

(86) 2. Prepare the mixture of DNA-Opti-MEM and Fugene-6-Opti-MEM (one dish of cells).

(87) TABLE-US-00010 TABLE 6 Quanity of plasmid for Opti- Opti- tranfection MEM Fugene-6 MEM pMD2.G 1.1 μg 11 μl 19.8 μl 220 μl psPAX2 1.1 μg GV303 viral plasmids 1.65 μg  expressing PRPS1 mutant genes

(88) Transfection reagent Fugene-6 and Opti-MEM from Promega were mixed and allowed to stand for 5 minutes. DNA-Opti-MEM and Fugene-6-Opti-MEM were mixed and allowed to stand for 15 minutes.

(89) 3. During the standing process of mixture, replaced the dish culturing with HEK293T by fresh antibiotic-free medium.

(90) 4. The mixture was stood for 15 min, and added to the dish culturing with HEK293T cells by 233 μl/dish. The culture medium was mixed cruciformly, that is, shake the medium up, down, left and right for 5 times.

(91) 5. Cells were incubated under conditions of 37° C., 5% CO.sub.2 for 24 hours, and the culture medium was exchanged with fresh medium by 15 ml/dish. Cells were further cultured for another 72 hours and the medium containing virus was collected.

(92) 6. The collected supernatant containing virus was transferred to Amicon Ultra-15 100 KD ultrafiltration tubes and centrifuged at 4° C. for 30 minutes to obtain concentrated virus solution.

(93) 7. HEK293T cells were infected by gradient dilution of the virus solution and the titer of the virus was calculated based on the number of post-infected green fluorescent cells.

(94) Viral Infection

(95) 1. Cells inoculation: Reh cells were counted and seeded into 12-well plates, with each well inoculated 3×10.sup.5 cells.

(96) 2. Concentrated virus supernatant (MOI=10) and polybrene at a final concentration of 8 μl/ml were added to each well simultaneously and the cells were further cultured in incubator for 24 hours. Then the culture medium of the cells was exchanged to fresh complete medium followed by observing the fluorescence under a microscope after 48 hours.

(97) 3. Flow sorting of cells: The cells were infected by virus for 72 hours. Reh cells with green fluorescence were harvested by Beckman's flow cytometer Moflo XDP, and then cultured for enlargement.

(98) 4. The sorted Reh cells were collected and the expression of PRPS1 wild-type and PRPS1 mutant type was identified by Western blot to confirm whether the stable cell line was successfully constructed. The experimental results are shown in FIG. 6. The following nine stable cell lines: Reh-PRPS1-S103 T, Reh-PRPS1-S103N, Reh-PRPS1-N144S, Reh-PRPS1-T303 S, Reh-PRPS1-K176N, Reh-PRPS1-D183E, Reh-PRPS1-A190T, Reh-PRPS1-A190V and Reh-PRPS1-L191F were obtained.

(99) The stable cell line Reh-PRPS1-WT, of which stably overexpresses wild type PRPS1, was constructed using the GV303-PRPS1 lentiviral expression vector in the same manner as described above.

Embodiment 7

(100) Drug Susceptibility Test of 6-MP

(101) Reh cells are a strain of human acute B lymphoblastic leukemia. The susceptibility of the PRPS1 mutant to the chemotherapeutic drug 6-MP was determined by the survival rate of Reh cells expressing different PRPS1 mutant genes which were treated by chemotherapeutic drug 6-MP, wherein the process comprises steps of

(102) (i) Cell inoculation: Reh cells expressing the PRPS1 wild-type and all kinds of PRPS1 mutants were counted and seeded into 96-well plates with inoculated 10.sup.4 cells per well. Five parallel wells were designed.

(103) (ii) Cell treatment: the drug 6-MP was 3 folds diluted gradiently with an initial concentration of 100 μg/ml to obtain 10 gradient dilutions. Drugs were added into 96-well plates with grown cells and incubated at 37° C. for 72 hours.

(104) (iii) Cell viability test: after 72 hours, 50 μl of CellTiter-Glo reagent (Promega) was added to each well and incubated at room temperature for 10 minutes. The chemiluminescence values were read in a microplate reader (Biotek).

(105) (iv) IC.sub.50 calculation: IC.sub.50 values of drug were calculated using Graphpad 5.0 software and differences between groups were compared.

(106) The experimental results are shown in FIG. 7. Compared with the control group expressing empty-load, the IC.sub.50 values of the PRPS1 mutant genes in the experimental group were significantly increased, which indicates that the survival rate of cells containing the PRPS1 mutant in the experimental group is significantly increased after 6-MP treatment, i.e. drug resistance of cells is increased significantly.

Embodiment 8

(107) Drug Susceptibility Test of 6-TG

(108) The susceptibility of the PRPS1 mutant to the chemotherapeutic drug 6-TG was determined by the survival rate of Reh cells expressing different PRPS1 mutant genes which were treated by chemotherapeutic drug 6-TG, in which the process comprises steps of

(109) (i) Cell inoculation: Reh cells expressing the PRPS1 wild-type and all kinds of PRPS1 mutants were counted and seeded into 96-well plates with inoculated 10.sup.4 cells per well. Five parallel wells were set up.

(110) (ii) Cell treatment: the drug 6-TG was 3 folds diluted gradiently with an initial concentration of 100 μg/ml to obtain 10 of gradient dilutions. Drug were added into 96-well plates with grown cells and incubated at 37° C. for 72 hours.

(111) (iii) Cell viability test: after 72 hours, 50 μl of CellTiter-Glo reagent (Promega) was added to each well and incubated at room temperature for 10 minutes. The chemiluminescence values were read in a microplate reader (Biotek).

(112) (iv) IC.sub.50 calculation: IC.sub.50 values of drug were calculated using Graphpad 5.0 software and differences between groups were compared.

(113) The experimental results are shown in FIG. 7. Compared with the control group expressing empty load, the IC.sub.50 values of the PRPS1 mutant genes in the experimental group were significantly increased indicating that the survival rate of cells containing the PRPS1 mutant in the experimental group was significantly increased after 6-tg treatment, i.e. drug resistance of cells is increased significantly.

Embodiment 9

(114) Identification of Cells Apoptosis

(115) (i) Cell inoculation: Reh cells expressing the PRPS1 wild-type and various PRPS1 mutants were counted and seeded into 12-well plates with inoculated 3×10.sup.5 cells per well. Duplicated wells were set up.

(116) (ii) Cell treatment: the drug 6-MP or 6-TG with concentration of 10 μg/ml was added to a 12-well plate with grown cells and incubated at 37° C. for 72 hours.

(117) (iii) Cell staining: After 72 hours, the cells were collected by centrifugation, washed with PBS buffer, added in Annex I-V and 7-AAD dye labeled with PE from BD, and incubated for 15 minutes at room temperature. The cells were centrifuged to discard the supernatant and washed twice with PBS.
(iv) Identification by Flow Cytometer: proportion of cell apoptosis was determined using Flow Cytometer from Canto II BD.

(118) The experimental results are shown in FIG. 8. Compared with the control group expressing empty load, the apoptotic ratio of cells expressing PRPS1 mutant genes in the experimental group was significantly down-regulated, indicating that the livability of the PRPS1 mutant cells in the experimental group was significantly increased after 6-MP or 6-TG treatment, i.e. drug resistance of cells is increased significantly.

Embodiment 10

(119) Identification of Metabolites of Intracellular Chemotherapeutic Drugs 6-MP/6-TG.

(120) 6-MP is a prodrug and needs to be undergone metabolic reactions in vivo to form TIMP and TGMP before it works, as shown in FIG. 9C. The identification procedure is as follows:

(121) (i) Cell inoculation: Reh cells expressing the PRPS1 wild-type and various PRPS1 mutants were counted and seeded into 6 cm culture dish with inoculated 3×10.sup.6 cells in each plate.

(122) (ii) Cell treatment: 10 μM chemotherapy drug 6-MP was added into each 6 cm culture dish and treated for 4 hours;

(123) (iii) Cell collection: The cells were transferred to a centrifuge tube, centrifuged at 3,000 g for 5 minutes to remove the supernatant, and lysed at 3×10.sup.6 cells per 200 μl 80% methanol;

(124) (iv) The amounts of metabolites from chemotherapeutic drugs 6-MP, TIMP, TGMP, r-MP, r-TG and r-MMP were measured by LC-MS (ABI 5500 Qtrap coupled with Waters Acquity UPLC), and standard curve for quantification was made using TIMP (Jean Bioscience, cat #NU (Sigma, cat #854126), r-TG (Sigma, cat #858412), r-MMP (Sigma, cat #M4002) respectively.

(125) The experimental results are shown in FIG. 9. For those mutants in experimental groups being treated with 6-MP, the contents of chemotherapeutic drugs 6-MP metabolites TIMP, TGMP and r-MP, r-TG and r-MMP in cells were significantly lower than those in control group.

Embodiment 11

(126) Detection of PRPS1 Enzyme Activity

(127) (i) Cell culture: Reh cells expressing the PRPS1 wild-type and various PRPS1 mutants were counted and seeded into 6 cm culture dish, and 3×10.sup.6 cells were inoculated in each well.

(128) (ii) Cell treatment: The cells were resuspended the next day using glucose-free medium (Gibco, cat #11879-020), and 10 mM glucose labeled with .sup.13C.sub.6 was added into each 6 cm culture dish (Cambridge isotope laboratories, cat #CLM-1396-1) and label for 5 minutes;
(iii) Cell collection: The cells were transferred to a centrifuge tube, centrifuged at 3,000 g for 5 minutes, the supernatant was removed and the cells were lysed using 3×10.sup.6 cells/200 μl 80% methanol;
(iv) The level of .sup.13C.sub.5-PRPP was detected by LC-MS (ABI 5500 Qtrap coupled with Waters Acquity UPLC), and standard curve quantification was made using PRPP (sigma, cat #P8296).

(129) The experimental results are shown in FIG. 10. Compared with the control group expressing empty load, the concentration of PRPP product catalyzed by each PRPS1 mutant gene in the experimental group was significantly increased which confirms that PRPS1 enzyme activity of each mutant in experimental group was significantly increased.

Embodiment 12

(130) Determination of Feedback Regulation of Nucleotide ADP, GDP on PRPS1 Activity

(131) 1. In Vitro Protein Level

(132) (i) Establishment of enzymatic reaction catalyzed by PRPS1, as shown in FIG. 11. ATP (Item No. A7699), ADP (Item No. A2754), GDP (Item No. G7172) and ribose-5-phosphate (Item No. R7750) were purchased from Sigma. The reaction system comprised 50 mM Tris pH 7.5, 2 mM phosphate, 1 mM DTT, 10 mM MgCl2, 0.5 mM ribose-5-phosphate, 0.5 mM ATP and PRPS1 protein.

(133) (ii) Inhibition of GDP/ADP on PRPS1 protein activity: 3 times gradient dilution of the GDP/ADP with an initial concentration of 5 mM And 15 μL of PRPS1 in vitro enzyme reaction system was prepared, added into 384-well plate, and reacted at 37° C. for 30 minutes. Then 10 μL of Kinase-Glo reagent (Item No. V3722) from Promega was added reacted at 37° C. for 15 minutes to terminate the reaction. The chemiluminescence values can be read in a microplate reader, and the inhibition of GDP/ADP on PRPS1 protein activity was calculated by Graphpad 5.0.

(134) The experimental results were shown in FIG. 12A, 12B. It can be seen that the inhibition of GDP/ADP on PRPS1 mutants S103T, 5103N, N144S, T303S, K176N, D183E, A190T, A190V, L191F were significantly lower than that on PRPS1 wild-type, and the known loss-of-function mutants A87T and M115T has no significant difference with wild-type, that is, the relapse-specific mutation of PRPS1 escapes the negative feedback inhibition of the nucleotide GDP/ADP on PRPS1 activity which is a gain-of-function mutant.

(135) 2. Cell Level

(136) In the present invention, the intracellular activity of PRPS1 was detected by means of isotope labeling in combination with the technologies of cell biology and metabolomics, and based on this, the effect of nucleotide GDP/ADP on PRPS1 activity was evaluated. The preferred embodiment is as follows:

(137) (i) Cell culture: Reh cells expressing the PRPS1 wild-type and various PRPS1 mutants were counted and seeded into 6 cm culture dish, and 3×10.sup.6 cells were inoculated in each well.

(138) (ii) Cell treatment: 2 mM ADP or 0.5 mM GDP was added to the culture dish and cells were treated for 4 hours, after that, the cells were resuspended using glucose-free medium (Gibco, cat #11879-020), and 10 mM glucose labeled with .sup.13C.sub.6 was added into each 6 cm culture dish (Cambridge isotope laboratories, cat #CLM-1396-1) and labeled for 5 minutes.
(iii) Cell collection: The cells were transferred to a centrifuge tube, centrifuged at 3,000 g for 5 minutes, the supernatant was removed, and the cells were lysed using 3×10.sup.6 cells/200 μl 80% methanol.
(iv) The level of .sup.13C.sub.5-PRPP was detected by LC-MS (ABI 5500 Qtrap coupled with Waters Acquity UPLC), and standard curve quantification was made using PRPP (sigma, cat #P8296). The activity of PRPS1 was determined according to the level of PRPP.

(139) The experimental results are shown in FIG. 12C. The concentration of PRPP expressed in wild-type experimental group was decreased after adding the nucleotide GDP/ADP and the concentration of PRPP product catalyzed by each PRPS1 mutant gene in experimental group was not affected by nucleotide GDP/ADP indicating that the enzyme activity of the PRPS1 mutant in the cells expressing the PRPS1 mutant gene in the experimental group was not feedback-regulated by the nucleotide GDP/ADP.

Embodiment 13

(140) Activity Detection of Purine Metabolic Pathway

(141) In the present invention, the activity of purine de novo synthesis pathway and salvage synthesis pathway in cells were detected by means of isotope labeling in combination with the technologies of cell biology and metabolomics. The preferred embodiment is as follows:

(142) (i) Cell culture: Reh cells expressing the PRPS1 wild-type and various PRPS1 mutants were counted and seeded into 6 cm culture dish, and 3×10.sup.6 cells were inoculated in each well.

(143) (ii) Cell treatment: The cells were resuspended the next day using amino acid-free medium (Gibco, cat #ME100031L1). De novo synthesis pathway was labeled with 20 μl/ml .sup.13C.sub.2 and .sup.15N-glycine (Sigma, cat #489522), respectively, for 4 hours, and salvage synthesis pathway was labeled with 2 μM .sup.13C.sub.5 and .sup.15N.sub.4-hypoxanthine (Cambridge isotope laboratories, cat #489522), respectively, for 1 hour.
(iii) Cell collection: The cells were transferred to a centrifuge tube, centrifuged at 3,000 g for 5 minutes, the supernatant was removed, and each of 3×10.sup.6 cells were lysed using 200 μl 80% methanol.
(iv) The level of nucleotide labeled with .sup.13C.sub.2, .sup.15N-hypoxanthine (IMP+3), and .sup.13C.sub.5, .sup.15N.sub.4-hypoxanthine (IMP+9) was detected by LC-MS (ABI 5500 Qtrap coupled with Waters Acquity UPLC), and standard curve quantification was made using IMP (sigma, cat #I4625).

(144) The experimental results are shown in FIG. 13, FIG. 9B and FIG. 18. The concentration of IMP+3 and IMP+9 in Reh cells expressing PRPS1 drug resistance mutations were significantly increased compared to that in Reh cells expressing empty load and PRPS1 wild-type, i.e. the activity of purine de novo synthesis pathway and salvage synthesis pathway were significantly increased.

Embodiment 14

(145) Determination of the Contents of Hypoxanthine, AICAR and Inosine in Samples.

(146) In the present invention, the content of hypoxanthine in cells was detected by LC-MS technology in combination with the technologies of cell biology and metabolomics. The preferred embodiment is as follows:

(147) (i) Cell culture: viruses of PRPS1 wild-type and various mutants were transfected into human Reh cells (see Embodiment 4 herein), and cells were incubated.

(148) (ii) Cell counting: when the number of cells per well reached 5×10.sup.6/5 ml, samples were taken according to the number of cells required for the experiment.

(149) (iii) Cell collection: cells were pipetted out from the well and centrifuged at 1500 rpm to remove the supernatant. The cells were washed with PBS once, and centrifuged again (500 g). Removed the supernatant.

(150) (iv) Cell lysis: the cells were lysed using 200 μl 80% methanol per 3×10.sup.6 cells.

(151) (v) The lysed cells were centrifuged by 14,000 g at 4° C. for 10 minutes, and then the supernatant was transferred to a 1.5 ml EP tube.

(152) (vi) The contents of hypoxanthine, AICAR and Inosine were detected by LC-MS technology (ABI 5500 Qtrap coupled with Waters Acquity UPLC), and standard curves for absolute quantification were made using .sup.13C.sub.5, .sup.15N.sub.4-hypoxanthine (Cambridge isotope laboratories, cat #489522), AICAR (sigma, cat #A9978) and Inosine (Sigma, cat #I4125), respectively.

(153) The experimental results are shown in FIG. 13. Compared to the cells expressing empty vector and PRPS1 wild-type in the control group, the concentrations of hypoxanthine, AICAR and Inosine in Reh cells expressing PRPS1 drug resistance mutations in experimental group were significantly increased.

Embodiment 15

(154) Nucleic Acid Drugs Targeting Purine Synthesis Pathway

(155) Preparation of lentivirus LV-CRISPR-ATIC and LV-CRISPR-GART for purine de novo synthesis pathway and its application in reversing drug resistance of 6-MP caused by PRPS1 gene mutation.

(156) (i) Construction of CRISPR Lentiviral Vector: based on the sequences of GART and ATIC and the design criteria of CRISPR, the corresponding sequences were designed as follows: CRISPR-ATIC: TGAATCTGGTCGCTTCCGGA (SEQ ID NO: 40), CRISPR-GART: GCAGCCCGAGTACTTATAAT (SEQ ID NO: 39). The corresponding sequences were constructed into CRISPR lentiviral vector (Addgene, cat #49535) to form lentiviral vector, lentiCRISPR-ATIC and lentiCRISPR-GART.

(157) (ii) Lentivirus LV-CRISPR-ATIC and LV-CRISPR-GART expressing CRISPR RNA corresponding to gene ATIC and GART were obtained by packaging according to reported method (Shalem O, Sanjana N E, Hartenian E, Shi X, Scott D A, Mikkelsen T S, Heckl D, Ebert B L, Root D E, Doench J G, Zhang F, Science. 2014 Jan. 3; 343(6166):84-7. doi: 10.1126/science.1247005. Epub 2013 Dec. 12).

(158) (iii) Cell lines Reh-PRPS1-S103T and Reh-PRPS1-A190T were infected by packaged lentivirus with empty load lentivirus LV-CRISPR-ATIC and LV-CRISPR-GART, respectively, to form stable cell line, of which the MOI of lentivirus was 10. Then 8 μg/ml of polybrene was added in. After 24 hours, the culture medium was changed and the cells were cultured for further 48 hours, and then cells were treated with 0.8 μg/ml of puromycin for resistance screening for one week to form the following stable cell lines: the control cell line Reh-LV-CRISPR, Reh-S103T-CRISPR-ATIC, Reh-S103T-CRISPR-GART, Reh-A190T-CRISPR-ATIC and Reh-A190T-CRISPR-GART.

(159) (iv) Cell treatment: The drug 6-MP was diluted and added into 96-well plate plated with cell lines as described in step (iii). Five parallel wells were set up for each cell line to detect the susceptibility of lentiviral infected cells to 6-MP. The preferred embodiment is as Embodiment 8.

(160) As shown in FIG. 14, the IC.sub.50 values of 6-MP in cell lines Reh-S103T-CRISPR-ATIC, Reh-S103T-CRISPR-GART, Reh-A190T-CRISPR-ATIC and Reh-A190T were significantly decreased compared with the control cell line Reh-LV-CRISPR infected by virus with empty load, indicating that the resistance to drug 6-MP was significantly reduced.

Embodiment 16

(161) Addition of exogenous purine affects the resistance of Reh cells to chemotherapeutic drug 6-MP.

(162) The steps for determining the impacts of exogenous purine on drug susceptibility of Reh cells are as follows:

(163) (i) Cell inoculation: Reh cells were counted and seeded into 96-well plates, with 10.sup.4 cells inoculated in each well. Five parallel wells were set for each group.

(164) (ii) Cell treatment: 10 μM, 50 μM, 100 μM hypoxanthine (HX) or hypoxanthine (IMP) were added to each group for pretreatment for 1 hour. Then the drug 6-TG was 3 times diluted gradiently with an initial concentration of 100 μg/ml to obtain 10 gradient dilutions. Finally, the gradient dilutions were added into 96-well plates with plated cells and incubated at 37° C. for 72 hours.

(165) (iii) Cell viability test: subsequently, 50 μl of CellTiter-Glo reagent (Promega) was added to each well and incubated at room temperature for 10 minutes. The chemiluminescence values were read in a microplate reader (Biotek).

(166) (iv) IC.sub.50 calculation: IC.sub.50 values of drug were calculated using Graphpad 5.0 software and the differences between groups were compared.

(167) The experimental results are shown in FIG. 15. Compared with the water control, the IC.sub.50 values of 6-MP in the cells which was added with hypoxanthine and female xanthine nucleotides were significantly increased in the experimental group, which demonstrate that the viability of cells after 6-MP treatment was significantly improved when pre-treated by exogenous purine, i.e. drug resistance of Reh on 6-MP was significantly increased.

Embodiment 17

(168) Addition of exogenous purine affects the metabolism of chemotherapeutic drug 6-MP in Reh cells.

(169) (i) Cell inoculation: Reh cells were counted and seeded into 6 cm of culture dishes, and 3×10.sup.6 cells were inoculated in each dish.

(170) (ii) Cell treatment: 50 μM of hypoxanthine (HX) or hypoxanthine (IMP) was added into the 6 cm of culture dish for pretreating the cells for 1 hours, after that, 10 μM of chemotherapeutic drug 6-MP was added for treating the cells for 4 hours.

(171) (iii) Cell collection: The cells were transferred to a centrifuge tube, centrifuged at 3,000 g for 5 minutes, the supernatant was removed, and the cells were lysed at a volume of 200 μl 80% methanol per 3×10.sup.6 cells.

(172) (iv) The contents of 6-MP metabolites, TIMP and TGMP, were detected by LC-MS (ABI 5500 Qtrap coupled with Waters Acquity UPLC), and standard curve quantifications were made using TIMP (Jean Bioscience, cat #NU-1148) and TGMP (Jean Bioscience, cat #NU-1121), respectively.

(173) The experimental results are shown in FIG. 16. For those Reh cells treated with exogenous purine in the experimental group, the intracellular contents of metabolites TIMP, TGMP of 6-MP were significantly decreased compared with that of control group.

Embodiment 18

(174) Hypoxanthine competitively inhibits the response of chemotherapeutic drug 6-MP.

(175) Chemotherapeutic drug 6-MP is an analog of hypoxanthine, and both 6-MP and hypoxanthine are substrates of HGPRT. The present invention established an in vitro enzymatic reaction to determine the Km value of 6-MP and hypoxanthine reacting with HGPRT, respectively, which reflects the affinity of HGPRT to hypoxanthine and 6-MP. The preferred embodiment is as follows:

(176) The establishment of in vitro enzymatic reaction is shown in FIG. 17A:

(177) The specific reaction system is as follows:

(178) TABLE-US-00011 TABLE 7 2*Buffer Final concentration Volume (μl) KCl (mM) 200 320 Tris 8.5(mM) 200 800 MgCl.sub.2 (mM) 24 96 DTT(mM) 2 8 BSA 0.01 8 H.sub.2O 2776 Total volume 4000

(179) TABLE-US-00012 TABLE 8 Final concentration Volume (μl) HGPRT 0.047 1.74 (NOVOCIB, #E-NOV9) PRPP(Sigma, #P8296) 1 240.0 2*Buffer 1 1200.0 H.sub.2O 958.3 Total volume 2400

(180) TABLE-US-00013 TABLE 9 Final Final Hypoxanthine concentration(μM) 6-MP concentration (μM) 1 250 1 1 2 125 2 0.5 3 62.5 3 0.25 4 31.25 4 0.125 5 15.625 5 0.0625 6 7.8125 6 0.03125 7 3.90625 7 0.015625 8 1.953125 8 0.0078125 9 0.9765625 9 0.00390625 10 0.48828125 10 0.001953125 11 0.244140625 11 0.000976563

(181) Hypoxanthine and 6-MP were diluted in a concentration gradient, reacted at 37° C. for 1 hour, and 80% methanol was added to terminate the reaction. The contents of IMP and TIMP were detected by LC-MS. The reaction curves were plotted and the Km values of hypoxanthine and 6-MP were calculated by Graphpad 5.0 software.

(182) Results As shown in FIG. 17B, the affinity of hypoxanthine and HGPRT was significantly higher than that of 6-MP and HGPRT, and when 100 μM 6-MP was used as the reaction substrate, TIMP generation has been significantly inhibited with the increased concentration of hypoxanthine.

Embodiment 19

(183) Lometrexol Reverses the 6-MP Drug Resistance Induced by PRPS1 Gene Mutation

(184) Lometrexol is a small molecule inhibitor of GART. The present invention detected that lo Lometrexol can reverse the 6-MP drug resistance induced by of PRPS1 gene mutation, and the specific steps are as follows:

(185) (i) Cell inoculation: cell lines Reh-PRPS1-S103T and Reh-PRPS1-A190T were counted and seeded into 96-well plates with 10.sup.4 cells inoculating in each well and five parallel wells setting up.

(186) (ii) Cell treatment: the cells were pretreated with 5 ng/ml of Lometrexol or DMSO control, and 6-MP was diluted gradiently and added into 96-well plates plated with cells. Cells were cultured at 37° C. for 72 hours.

(187) (iii) Reading of values: subsequently, 50 μl of CellTiter-Glo reagent (Promega) was added to each well and incubated at room temperature for 10 minutes. The chemiluminescence values were read in a microplate reader.

(188) (iv) Calculation: IC.sub.50 values were calculated using Graphpad 5.0 software and the differences were compare.

(189) (v) Determining the concentration of 6-MP metabolites: the same as Embodiment 13.

(190) (vi) Determining the intracellular concentration of hypoxanthine: the same as Embodiment 14.

(191) The experimental results are shown in FIG. 18. Compared with the respective controls, the IC.sub.50 values of the drug 6-MP were significantly decreased in Reh-PRPS1-S103T and Reh-PRPS1-A190T cells treated with Lometrexol, meanwhile the in vivo 6-MP metabolites TIMP and TGMP were significantly increased, indicating that Lometrexol significantly reduced the resistance of cell lines Reh-PRPS1-S103T and Reh-PRPS1-A190T to 6-MP. And the intracellular levels of 6-MP metabolites TIMP and TGMP in treated cell lines Reh-PRPS1-S103T and Reh-PRPS1-A190T were significantly increased, meanwhile the concentration of hypoxanthine was significantly decreased.

Embodiment 20

(192) Mass spectrometry detects purine metabolites and purine analog metabolites of drugs.

(193) Drugs and Reagents

(194) Methanol and acetonitrile (HPLC grade) were purchased from Sigma-Aldrich (USA), formic acid (HPLC grade) was purchased from Merck (Germany), and experimental water was prepared by Millipore-Q.

(195) Experimental Instruments

(196) Liquid Chromatography/Mass Spectrometer (UPLC-MS/MS):

(197) AB SCIEX QTRAP® 5500 (Singapore)

(198) Waters Ultra Performance LC system (Singapore)

(199) 1. ACQUITY™ Binary Solvent Manager

(200) 2. ACQUITY™ Column Manager

(201) 3. ACQUITY™ Sample Organizer

(202) 4. ACQUITY™ Sample Manager

(203) Analyst, version 1.5.2 was used for data acquisition and processing systems.

(204) Other instruments: Thermo Fisher −70° C. ultra low temperature refrigerator (USA); Eppendorf 5810R high speed, high capacity, and low temperature centrifugator (Germany); IKA Vibrax VXR (Germany); IKA Vortex (Germany); KQ5200DA ultrasonic cleaner (Kunshan) etc.

(205) 1. Method of Sample Analysis

(206) Method of Sample Treatment

(207) The cells were collected using 80% methanol, and then centrifuged for 5 minutes at 12,000 rpm. The supernatant was transferred to a new EP tube and 20 μl of the supernatant was taken for LC-MS/MS analysis.

(208) 1) Labeled PRPP, ADP and GDP:

(209) Chromatographic Conditions

(210) Mobile phase composition: mobile phase A: 50 mM ammonium bicarbonate (pH 9.5)

(211) Mobile phase B: acetonitrile:water=6:1 (v/v)

(212) Gradient elution:

(213) TABLE-US-00014 TABLE 10 Time (min) Mobile phase B (%) 1.00 90 4.00 5.0 5.00 5.0 5.10 90 6.00 90

(214) Chromatographic column: apHera™ NH2 Polymer (2×150 mm);

(215) Flow rate: 0.6 ml/min; Injection volume: 20 μl;

(216) Detection Conditions of Mass Spectrometry

(217) Electron spray ion source (Turbo spray) was used for multi-channel reaction monitoring (MRM) mode analysis for two-stage mass spectrometry. The parameters of the mass spectrometry test and the parameters of the ion source are as follows:

(218) TABLE-US-00015 TABLE 11 Q1 Q3 DP Analyte (m/z) (m/z) (V) CE(V) PRPP label 394.0 177.0 −80 −26 ADP 426.1 158.9 −110 −31 GDP 442.1 78.8 −115 −95
2) IMP (labeled IMP+3 and labeled IMP+9), HX, TIMP, TGMP, AICAR, Inosine, 6-MP, 6-TG, MMP, r-MP, r-TG and r-MMP
Chromatographic Conditions

(219) Mobile phase composition: mobile phase A: Water-0.025% formic acid-1 mM

(220) Mobile phase B: Methanol-0.025% formic acid-1 mM ammonium acetate

(221) Gradient elution:

(222) TABLE-US-00016 TABLE 10 Time (min) Mobile phase B (%) 0.40 2.0 1.00 90 2.40 90 2.50 2.0 5.50 2.0

(223) Chromatographic column: Agilent Eclipse XDB-C18 (4.6×150 mm, 5 μm);

(224) Flow rate: 0.6 ml/min; Injection volume: 15 μl;

(225) Detection Condition of Mass Spectrometry

(226) Electron spray ion source (Turbo spray) was used for multi-channel reaction monitoring (MRM) mode analysis for two-stage mass spectrometry. The parameters of the mass spectrometry test and the parameters of the ion source are as follows:

(227) TABLE-US-00017 TABLE 13 Q1 Q3 DP CE Analyte (m/z) (m/z) (V) (V) IMP 347.1 78.7 −125 −80 Labeled IMP + 3 350.1 78.7 −125 −80 Labeled IMP + 9 356.1 78.7 −125 −80 HX 135.0 91.9 −115 −23 HX + 9 144.0 99.0 −99 −25 TIMP 363.0 79.0 −114 −60 TGMP 378.1 211.0 −100 −26 AICAR 259.1 110.0 55 40 Inosine 269.1 137.0 60 24 6-MP 153.2 119.0 130 30 6-TG 168.0 82.0 100 60 MMP 167.0 125.0 150 35 r-MP 285.0 119.0 80 58 r-TG 300.0 168.0 60 17 r-MMP 299.2 167.0 90 24

Embodiment 21

(228) Nucleic Acid Drugs Targeting Purine Synthesis Pathway

(229) Preparation of lentivirus LV-shATIC, LV-shGART and LV-shPPAT for purine de novo synthesis pathway and its application in reversing 6-MP drug resistance caused by PRPS1 gene mutation.

(230) (i) Construction of shRNA lentiviral vector: shRNA lentiviral vector GV298 for ATIC, GART and PPAT was purchased from Genechem, and DNA sequences corresponding to sequences of used shRNA were as follows:

(231) TABLE-US-00018 shATIC-1: (SEQ ID NO: 49) AATCTCTATCCCTTTGTAA, shATIC-2: (SEQ ID NO: 50) TGGAATCCTAGCTCGTAAT, shGART-1: (SEQ ID NO: 51) CCAGGAGTTTGACTTACAA, shGART-2: (SEQ ID NO: 52) CTAACTGTTGTCATGG CAA, shPPAT-1: (SEQ ID NO: 53) CTTCGTTGTTGAAACACTT, shPPAT-2: (SEQ ID NO: 54) TGTCTAACTGTAGA CAAAT, shControl: (SEQ ID NO: 55) TTCTCCGAACGTGTCACGT.

(232) (ii) Cell lines Reh, Reh-PRPS1-WT, Reh-PRPS1-S103 T and Reh-PRPS1-A190T were infected respectively by control lentivirus LV-shControl, lentivirus LV-shATIC1, LV-shATIC2, LV-shGART1, LV-shGART2, LV-shPPAT1 and LV-shPPAT2 which were obtained by packaging, of which the MOI was 10, to form stable cell lines. Then 8 μg/ml of polybrene was added in, the culture medium was changed then after 24 hours, and the cells were treated with 0.8 μg/ml of puromycin for resistance selection after further cultured for 48 hours. The following stable cell lines were formed after 1 week of resistance selection: the control cell line Reh-shControl, Reh-shATIC1, Reh-shATIC2, Reh-shGART1, Reh-shGART2, Reh-shPPAT1, Reh-shPPAT2, Reh-WT-shContro, Reh-WT-shATIC1, Reh-WT-shATIC2, Reh-WT-shGART1, Reh-WT-shGART2, Reh-WT-shPPAT1, Reh-WT-shPPAT2, Reh-S103 T-shControl, Reh-S103 T-shATIC1, Reh-S103 T-shATIC2, Reh-S103 T-shGART1, Reh-S103 T-shGART2, Reh-S103 T-shPPAT1, Reh-S103 T-shPPAT2, Reh-A190T-shControl, Reh-A190T-shATIC1, Reh-A190T-shATIC2, Reh-A190T-shGART1, Reh-A190T-shGART2, Reh-A190T-shPPAT1 and Reh-A190T-shPPAT2.

(233) (iii) Cell treatment: The drug 6-MP was diluted and added into 96-wells plate plated with cell lines as described in step (ii). Five parallel wells were set up for each cell line to detect the susceptibility of lentivirus infected cells to 6-MP. The preferred embodiment is the same as Embodiment 8.

(234) As shown in FIG. 19, the 6-MP IC.sub.50 values of cell lines Reh-S103T-shATIC1, Reh-S103 T-shATIC2, Reh-S103 T-shGART1, Reh-S103 T-shGART2, Reh-S103 T-shPPAT1, Reh-S103 T-shPPAT2, Reh-A190T-shATIC1, Reh-A190T-shATIC2, Reh-A190T-shGART1, Reh-A190T-shGART2, Reh-A190T-shPPAT1 and Reh-A190T-shPPAT2 were significantly decreased compared with the control cell line Reh-S103T-shControl and Reh-A190T-shControl infected by virus with empty load, indicating that the resistance to drug 6-MP was significantly reduced.

(235) While the specific embodiments of the present invention have been described above, it will be understood by a person skilled in the art that these are merely illustrative examples. Accordingly, it is intended that all such alternatives, modifications, and variations which fall within the spirit and the scope of the invention be embraced by the defined claims.