MONO AND BISPECIFIC ANTIBODY BINDING TO HERG1 AND HERG1/INTEGRIN BETA 1
20210147574 · 2021-05-20
Inventors
- Annarosa ARCANGELI (Firenze, IT)
- Claudia Duranti (Pontassieve, IT)
- Laura CARRARESI (Firenze, IT)
- Silvia CRESCIOLI (Firenze, IT)
Cpc classification
C07K2317/90
CHEMISTRY; METALLURGY
C07K16/2842
CHEMISTRY; METALLURGY
C07K16/28
CHEMISTRY; METALLURGY
A61P35/00
HUMAN NECESSITIES
International classification
A61P35/00
HUMAN NECESSITIES
C07K16/28
CHEMISTRY; METALLURGY
Abstract
The present invention describes a bispecfic antibody composed of the variable domains (VH and VL) of two antibodies, hERG1 mAb (which binds the extracellular domain S5-P of hERG1) and of β1 integrin mAb TS2/16 or BV7, which bind the extracellular domain of β1 integrin. The present invention relates also to a novel anti-hERG1 molecule bearing a Cys in position 95 of the VH domain. The invention describes also their application for diagnostic and therapeutic purposes in oncology and other fields of medical sciences.
Claims
1. A bispecific antibody (Ab) comprising the Heavy chain Variable (VH) domain and Light chain Variable (VL) domain of an anti-hERG1 Ab which binds the extracellular domain S5-P of hERG1 and the Heavy chain Variable (VH) domain and Light chain Variable (VL) domain of a anti-β1 integrin Ab which bind the extracellular domain of 1 integrin, wherein the Heavy chain Variable (VH) domain of anti-hERG1 Ab has 85% identity with SEQ ID No: 8 or SEQ ID No: 2; and the Light chain Variable (VL) domain of anti-hERG1 Ab has 85% identity with SEQ ID No: 4; and the Heavy chain Variable (VH) domain of anti-0 integrin Ab have at least 85% identity with SEQ ID N: 26 or SEQ ID N: 46 and a Light chain Variable (VL) domain of anti-01 integrin Ab have at least 85% identity with SEQ ID N: 24 or SEQ ID N: 48.
2. The bispecific Ab according to claim 1 has a format selected in the group consisting of Tandem scFvs, Diabody format, Single-chain diabodies, Tandem diabodies (TandAbs) and Dual-affinity retargeting molecules (DARTs).
3. The bispecific Ab according to claim 2 comprising a first Heavy chain Variable (VH) domain having at least 85% identity with SEQ ID NO:8 wherein residue at position 95 is Cys, and a first VL domain having at least 85% identity with SEQ ID NO:4, and a second VH domain having at least 85% identity with SEQ ID NO:26 or SEQ ID N: 46, and a second VL domain having at least 85% identity with SEQ ID NO:24 or SEQ ID N: 48.
4. The bispecific Ab according to claim 3 wherein domains are assembled in the following order: anti-hERG1-Cys VH domain linked by a first linker to anti-1-integrin VL domain linked by a second linker to anti β1-integrin VH domain linked by a third linker to anti-hERG1-Cys VL domain.
5. An anti-hERG1 molecule comprising a Heavy chain Variable (VH) domain having at least 85% identity with SEQ ID NO:8 wherein residue at position 95 is Cys, and a Light chain Variable (VL) domain having at least 85% identity with SEQ ID NO:4, said molecule having specificity against hERG1 S5-pore extracellular portion.
6. The anti-hERG1 molecule according to claim 5 which is a fully humanized recombinant Ab, a scFv, Fab, Fv form of simple chain of scFv, diabodies, triabodies, bispecifics, minibodies or phage antibodies.
7. The anti-hERG1 molecule according to claim 6, wherein said molecule is a scFv and wherein VH and VL are linked by a peptide linker.
8. The bispecific Ab according to claim 4 wherein the linkers comprise (Gly4Ser)3 motifs.
9. The anti-hERG1 molecule according to claim 5 having SEQ ID No: 10.
10. The anti-hERG1 molecule according to claim 5 any which is labelled with a fluorophore or a radionuclide.
11. A method for the treatment of a disease characterized by overexpression/mis-expression of hERG1 comprising: administering a therapeutically effective amount of the bispecific Ab according to claim 1 to the subject in need thereof.
12. The method according to claim 11, wherein the disease is selected from the group consisting of tumours, neurological diseases, endocrine diseases and neuro-endocrine diseases.
13. A pharmaceutical composition comprising a bispecific Ab according to claim 1 and at least another pharmaceutically acceptable ingredient.
14. A polynucleotide encoding the bispecific Ab according to claim 1.
15. An expression vector or a plasmid comprising the polynucleotide according to claim 14.
16. A genetically modified microorganism or a cell comprising the expression vector or plasmid according to claim 15.
17. An in vitro diagnostic kit of parts for the simultaneous, separate or sequential use, said kit comprising: a container containing a bispecific Ab according to claim 1; and optionally a container containing an intact monoclonal anti-hERG1 Ab as reference control.
18. The in vitro diagnostic kit of claim 17, said kit further comprising: a container containing an anti-hERG1-Cys scFv according to claim 5.
19. An in vitro diagnostic kit of parts for the simultaneous, separate or sequential use, said kit comprising: a container containing an anti-hERG1-Cys scFv according to claim 5; and optionally a container containing an intact monoclonal anti-hERG1 Ab as reference control.
20. A method for the treatment of a disease characterized by overexpression/mis-expression of hERG1 comprising: administering a therapeutically effective amount of the anti-hERG1 molecule according to claim 5 to the subject in need thereof.
21. A pharmaceutical composition comprising the anti-hERG1 molecule according to claim 5 and at least another pharmaceutically acceptable ingredient.
22. A polynucleotide encoding the anti-hERG1 molecule according to claim 5.
23. An expression vector or a plasmid comprising the polynucleotide according to claim 22.
24. A genetically modified microorganism or a cell comprising the expression vector or plasmid according to claim 23.
25. The anti-hERG1 molecule according to claim 7, wherein the peptide linker comprises a (Gly4Ser)3 motif.
Description
BRIEF DESCRIPTION OF THE FIGURES
[0071]
[0072]
[0073]
[0074]
[0075] (B) Immunofluorescence performed on fixed and live HEK293-Mock and HEK293-hERG1 cells, using both unlabeled (I. IF) and labelled scFv-hERG1-D8-Cys antibody (D.IF). Representative images taken at 20× magnification, nuclei staining is represented by blue fluorescence, membranous staining is represented by the green staining (Alexa 488).
[0076] (C) Graphs showing the IF intensity (A.U.) calculated using Image J Software (ImageJ 1.38, U.S. National Institutes of Health). For each image, the mean of the fluorescence intensity of three different areas was calculated after the subctraction of the blue channels values (which refers to nuclei staining).
[0077] In all experiments results on HEK 293-hERG1 were significantly higher compared to those obtained on HEK 293-Mock. Statistical analysis was performed assessing data normality and homoskedasticity assumptions applying Shapiro-Wilk test, while variance was analyzed through Anova. Pairwaise significance was estimated applying t-test or Bonferroni test (* p<0.05).
[0078]
[0079] All experiments were performed in triplicate.
[0080]
[0081]
[0082]
[0083]
[0084]
[0085]
[0086]
[0087] Panel B shows chromatogram generated after purification of supernatant deriving from high-scale expression of G5 clone: one single peak is visible and elutions underlying the blue area have been analyzed and Coomassie staining is reported in panel C, showing bands with proper molecular weight in all the elutions tested.
[0088]
[0089]
[0090]
[0091]
[0092]
[0093]
[0094]
[0095]
[0096] (C) In vivo analysis. Each panel reports the fluorescent signal in a representative mouse treated with scFv-hERG1-D8Cys antibody conjugated with Alexa750 compared to a control mouse treated with PBS solution. The maximum signal detected was at 10 minutes after the injection; and no fluorescence signal was detected after 24 hours from the intravenous administration.
[0097] (D) scFv-hERG1-D8Cys-Alexa750 uptake and retention of scFv-hERG1-D8Cys-Alexa750 in a MIAPaCa-2-nu/nu mice model of PDA. Mice were administered through tail vein injection with 6.5 μg of scFv-hERG1-D8Cys-Alexa750 antibody. Representative pictures of mice i.v. injected with the labelled antibody (left) have been compared with control mice (right). Fluorescence intensity in the abdominal area, the site proximal to tumor has been analyzed. Fluorescent emission spectra were measured using Photon imager (Biospace Lab), images have been acquired at different time-points, every 5 min, starting 5 min after injection until 60 min after injection.
[0098]
[0099] (B) ECG, electrocardiogram registration. The ECG graph obtained after the administering of scDb-hERG1-Cys-β1 antibody shows no significant changes compared to the control graph reported in
[0100] (C) Table showing the pancreas volume (mm.sup.3) of MIAPaCa-2-nu/nu tumor-bearing mice treated and untreated with the scDb-hERG1-Cys-β1 antibody. Metastatic diffusion, % of necrotic area in the slide and number of vessels are also reported.
[0101] (D) Images of pancreas after nescroscopy: 1, untreated; 2, treated with three doses of scDb-hERG1-Cys-1 antibody; 3, treated with six doses of scDb-hERG1-Cys-β1 antibody.
EXPERIMENTAL SECTION
[0102] 1. scFv-hERG1 Mutagenesis
[0103] The amino acid sequence of the scFv hERG1 molecule as described in WO2016020483 (A1) presents the amino acid Phe in position 95 of the VH domain. The nucleotide sequence SEQ ID No: 1 unraveled the presence of T in position 283 (c283T) of the VH domain. According the present invention, the substitution of a G was introduced instead of the T in position 283 (c283T>G) of the VH domain leading to the switch of the Phe (TTT) in position 95 with a Cys (TGT). This mutation resulted in the introduction of one amino acid (Cys) in the position between Framework 3 and CDR3, which surprisingly resulted fundamental for the formation of the disulfide bond in the immunoglobulin variable domain. The Cys was introduced in the original construct, setting up a mutagenesis protocol (see Materials and Methods). The cDNA obtained from four mutagenized scFv-hERG1 colonies was sequenced and the sequencing results (
[0104] 2. Expression and Protein Purification
[0105] Either plasmids, scFv-hERG1 and the mutagenized scFv-hERG1 (hence named scFv-hERG1-Cys), were transformed into GS115 P. pastoris host strain, using the spheroplasting technique. Six clones (C7, C12, D9, E8, G3, G7) among the scFv-hERG1 transformants and six (B11, C3, D8, D9, G4, G10) from the scFv-hERG1-Cys were analyzed. Results of the small-scale expression are shown in
[0106] All the clones revealed protein expression after 72 h induction (upper panels), as also shown in slot blot.
[0107] After purification, the presence of the protein was assessed through western-blot (panel B and D).
[0108] The two best expressing clones were chosen for the two antibodies: G3 for scFv-hERG1 (hereafter named scFv-hERG1-G3) and D8 for scFv-hERG1-Cys (named scFv-hERG1-D8-Cys).
[0109] Larger-scale expression analyses are shown in
TABLE-US-00001 PROTEIN YIELD (mg/l) scFv-hERG1-G3 0.200 scFv-hERG1-D8Cys 1 .sup.aThe yields were normalized to mg protein per liter of Pichia Pastoris yeast culture.
[0110] 3. Comparison of Antigen Affinity Between scFv-hERG1-G3 and scFv-hERG1-D8Cys
[0111] Chromatograms reported in
[0112] 4. scFv-hERG1-D8Cys Antibody Stability Test
[0113] The stability of the scFv-hERG1-D8Cys antibody was directly assessed analyzing the protein through SDS-Page Coomassie Brilliant blue staining at different time points (6, 12, 18 months) after purification. Data in
[0114] 5. Evaluation of Immunoreactivity of scFv-hERG1-G3 and scFv-hERG1-D8Cys
[0115] Then an immunofluorescence analysis was performed using scFv-hERG1-G3 and scFv-hERG1-D8Cys on fixed cells, to determine the immunoreactivity of the two antibodies. Were used, as cellular model, HEK 293 transfected with the hERG1 cDNA (HEK-hERG1) and, as a control HEK-MOCK, that do not express the hERG1 protein. HEK-MOCK cells showed no or weak signal with both antibodies, while HEK 293 hERG1 showed a good labeling with the scFv-hERG1-G3 and, even better, with the scFv-hERG1-D8Cys (
[0116] It was also tested the immunoreactivity of the two antibodies after direct labelling with the fluorescent molecule Alexa 488. scFv-hERG1-G3-Alexa488 and scFv-hERG1-D8Cys-Aexa488 antibody was tested in IF on fixed cells (
[0117] In order to assess and compare the potential use in vivo of scFv-hERG1-G3-Alexa488 and scFv-hERG1-D8Cys-Alexa488 as molecular tools, both antibodies were used in IF on live cells (
[0118] The experiment confirmed the results obtained with the staining on fixed cells; HEK293 hERG1 cells appear to have a stronger signal, if compared with the negative control HEK293 MOCK cells. HEK 293 hERG1 cells appear to have a more specific spotty cellular labelling, while HEK-MOCK cells have a non-specific diffuse background. For this reason, it has been reported the bright-field image of the same section.
[0119] 6. scFv-hERG1-D8Cys Antibody Viability Inhibition and Spheroids Test
[0120] At this stage, it has been further explored the potential capacity of scFv-hERG1-D8Cys of inhibiting cell growth on a panel of neoplastic cell lines. As reported in
[0121] In order to investigate the effect of scFv-hERG1-D8Cys on a 3D cellular model we have tested three different concentrations of scFv-hERG1-D8Cys (10; 20; 40 μg/ml) on spheroids.
[0122]
[0123] In
[0124] Panel C shows the effect obtained on pancreatic ductal adenocarcinoma Mia Paca 2 cells. A decrease in the volume of spheroids was observed both for cells treated with 20 μg/ml and 40 μg/ml scFv-hERG1-D8Cys, with a more pronounced effect obtained at the highest concentration tested compared to the controls, at each timepoint. Images taken at 72 h, reported on the right part of the figure, show a picture of a control spheroid of Mia Paca 2 taken at 4× magnification; while the right image shows a picture of a Mia Paca2 spheroid treated with 40 μg/ml scFv-hERG1-D8Cys, taken at 10× magnification. In fact, it wasn't possible to acquire pictures of control Mia Paca 2 spheroids after 72 h with 10× magnification, as the volume was too enlarged to allow a proper focusing; while Mia Paca 2 spheroids at 72 h treated with scFv-hERG1-D8Cys can be visualized using 10× magnification, as their volume, compared to control, was strongly reduced.
[0125] Panel D shows MDA-MB 231 spheroids: a marked effect of volume reduction is observed for all the three concentrations of scFv-hERG1-D8Cys tested (10, 20, 40 μg/ml) compared to the control. Volume reduction can be inferred also from the pictures of MDA-MB 231 spheroids reported on the right side of the figure.
[0126]
[0127] 7. ScDb-hERG1-β1 It has been developed a bispecific antibody (bsAb) comprising a single chain antibody directed against β1-integrin (scFv-TS2/16) and a scFv-hERG1-Cys or scFv-hERG1 (as above described).
[0128] Nucleotide sequence encoding VL domain of TS2/16 is SEQ ID No: 23; nucleotide sequence encoding VH domain of TS2/16 is SEQ ID No: 25 (see
[0129] The bispecific antibody format is the single-chain diabody (scDb), which comprising the variable domains (VH and VL) of two antibodies, connected by peptide linkers, as showed in
[0130] The lower panel schematizes the final structure of the bispecific antibody anti-hERG1-β1-integrin, which has been assembled using the variable domains of the two antibodies in the following order: VH scFv-hERG1 antibody (SEQ ID No: 8 or SEQ ID No: 2), VL scFv-TS2/16 antibody (SEQ ID No: 24), VH scFv-TS2/16 antibody (SEQ ID No: 26), VL scFv-hERG1 antibody (SEQ ID No: 4).
[0131] VL scFv-TS2/16 antibody (SEQ ID No: 24) and VH scFv-TS2/16 antibody (SEQ ID No: 26), are linked by peptide linker.
[0132] VH scFv-hERG1 antibody (SEQ ID No: 2 or 8) and VL scFv-TS2/16 antibody (SEQ ID No: 24) are linked by a peptide linker.
[0133] VH scFv-TS2/16 antibody (SEQ ID No: 26) and VL scFv-hERG1 antibody (SEQ ID No: 4) are linked by a peptide linker
[0134] At 5′ and 3′ ends were inserted the FspI and AvrII restriction sites (reported underlined below)
TABLE-US-00002 VLFspI: (SEQ ID No: 27) AAAATGCGCAGACTACAAAGATATTGTGATGACACAGAC VHAvrII: (SEQ ID No: 28) GGGGCCTAGGATAGACAGATGGGGGTGTCGCGACACCCCCATCTGTCTAT.
[0135] The following sequence (SEQ ID No: 29) is the complete nucleotide sequence encoding for the scDb-hERG1-1 (SEQ ID No: 30): scFv-hERG1-Cys VH sequence is reported highlighted in grey, VL sequence of scFv-TS2/16 is reported in underlined italics, in bold are reported A, M, B linker sequence, in underlined bold italics is reported VH sequence of scFv-TS2/16 antibody, in underlined highlighted in grey is reported VL sequence of scFv-hERG1-Cys.
[0136] Myc-tag is reported in italics bold, while His-tan is reported underlined in bold.
[0137] Restriction sites are reported underlined.
TABLE-US-00003 SEQ ID No 29: GAGGCTGAGTGCCCAGACGAGGTCCAACTGCAACAGTCTGGACCTGAACT GGTGAAGCCTGGGGCTTCTGTGAAGATATCCTGCAAGACTTCAGGATACA CATTCACTGAATACACCGTTCACTGGGTGAAACAGAGCCATGGAAAGAGC CTTGAATGGATTGGAGGCATTAATCCTAATGGTGGTACTACCTATAATCA GAAGTTCAAGGGCAAGGCCACATTGACTATTGACAAGTCCTCCAGCTCAG CCTTCATGGAGCTCCGCAGCCTGACATCTGAGGATTCTGCAGTCTATTAC TGTGCAACAGGTTGGGGACCTGACTACTGGGGCCAAGGCACCACTCTCAC AGTCTCCTCAGCCAAAACAACACCCCCATCAGTCTATCCACTGGCCCCTG GCTCGAGTGATATTGTGATGACACAGACTCCAACCACCATGGCTGCATCT CCCGGGGACAAGATCACTATCACCTGCAGTGTCAGTTCAATTATAAGTTC CAATTACCTGCATTGGTATAGTCAGAAGCCAGGATTCTCCCCTAAACTCT TGATTTATAGGACATCCAATCTGGCTTCTGGAGTCCCACCTCGCTTCAGT GGCAGTGGGTCTGGGACCTCTTACTCTCTCACAATTGGCACCATGGAGGC TGAAGATGTTGCCACTTACTACTGCCAGCAGGGTTCTGATATTCCACTCA CGTTCGGTGATGGGACCAAGCTGGACCTGAAACGGGCTGATGCTGCACCA ACTGTATCCGGTGGTGGTGGTTCTGGTGGTGGTGGTTCTGGCGGCGGCGG CTCCGGTGGTGGTGGATCC
GATATTGTGCTGACACAATCTCCACTCACTTTG TCGGTTAACATTGGTCAACCAGCCTCTATCTCTTGCAAGTCAAGTCAG AGCCTCTTATATACTAATGGAAAAACCTATTTTAATTGGTTATTACAG AGGCCAGGCCAGTCTCCAAAGCGCCTAATCTATCTGGTGTCTAAACTG GACTCTGGAGTCCCTGACAGGTTCACTGGCAGTGGATCAGGAACAGAT TTTACACTGAAAATCAGCAGAGTGGAGGCTGAAGATTTGGGAGTTTAT TACTGCGCGCAAGGTACACATTTTCCGTGGACGTTCGGTGGAGGGACC AAGCTGGAAATCAAACGGGCTGATGCTGCACCAACTGTATCCGCGGCC GCA
AATGGGGCCCCTAGG CATCATCACCATCACCATCATCACTAATAG
[0138] The sequence has been cloned, using the restriction sites indicated above, into the commercially available vector pPIC9K (Life Technologies).
[0139] 8. scDb-hERG1-Phe-β1: Expression and Characterization
[0140] The construct expressing anti-hERG1-Phe-1-scDb antibody has been cloned into pPIC9K expression vector, which is a vector suitable for expression in Pichia pastoris yeast cells.
[0141] GS115 Pichia pastoris strain was transformed, according to the spheroplasting protocol and 96 clones were screened on YPD-agar plates containing G418 for selection. Six clones were then induced on a small scale and purified using Sepharose Ni beads (GE Healthcare), exploiting the Histidine tag introduced with the pPIC9K vector. Coomassie staining is reported in
[0142] Then it was started large-scale expression of the G5 anti-hERG1-Phe-β1-scDb clone, adapting the induction protocol for bigger culture volumes.
[0143] Supernatant resulting from 1 L Pichia pastoris cells culture has been purified using AKTA Pure (GE Healthcare). Results are reported in
[0144] Anti-hERG1-β1-scDb fractions 8; 9; 10; 11; 12; 13; 14; 15; 16; 18; 20 were gathered together, and dialyzed against PBS 1×. Thus, a detailed characterization of the antibody was started.
[0145] One of the crucial steps was the choice of a proper model to test the anti-hERG1-Phe-β1-scDb antibody. The table below summarizes the expression profile related to hERG1 and β1 integrin of the cell lines, chosen for characterization experiments.
TABLE-US-00004 TABLE HEK 293 HERG1, HEK 293 WT and GD25 expression profile related to hERG1 and β1 integrin hERG1 β1 integrin EXPRESSION EXPRESSION HEK293 hERG1 + + HEK 293 WILD TYPE − + GD25 − −
[0146] The bsAb was first analyzed on HEK 293 hERG1 cells which express both hERG1 and β1 antigens. Cell-ELISA was performed and results are reported on
[0147] Moreover, the anti-hERG1-β1-scDb bispecific antibody showed the capacity to bind the antigen in native conditions, as it is for the antigen endogenously expressed by cells. Binding specificity of anti-hERG1-Phe-β1-scDb bispecific antibody is also corroborated by the comparison between the same amount (0.5 μg) of anti-hERG1-Phe-β1-scDb and anti-scFv-hERG1-Phe, which is one of the two single-chain antibodies that form the bispecific antibody. In fact, the signal obtained after incubating with anti-hERG1-Phe-β1-scDb is higher than the one obtained using anti-scFv-hERG1-Phe. Such result is in line with what expected, since the signal obtained with anti-hERG1-Phe-β1-scDb results from the binding to both antigens, hERG1 and β1; while the signal obtained using scFv-hERG1 results from the binding to hERG1 antigen, only.
[0148] It has also been evaluated the immunoreactivity of the anti-hERG1-Phe-β1-scDb antibody through IF, on cells grown on BSA (
[0149] To further confirm the evidences obtained from previous experiments, it has been evaluated the binding of anti-hERG1-Phe-1-scDb, on HEK293-hERG1 cells administering, before antibody incubation, an excess of peptide S5PORO, which is the peptide towards which the scFv-hERG1 antibody is directed. As it can be inferred from
[0150] 9. scDb-hERG1-Cys-β1: Expression and Characterization
[0151] The construct expressing scDb-hERG1-Cys-β1 antibody cloned into pPIC9K expression vector, which is a vector suitable for expression in Pichia pastoris yeast cells, has been transformed into GS115 yeast cells.
[0152] Clones derived from scDb-hERG1-Cys-β1 transformation have been screened according to the protocol previously described for scDb-hERG1-Phe-31 antibody. Supernatant resulting from 1 L Pichia pastoris cells culture has been purified using AKTA Pure (GE Healthcare). Results are reported in
[0153] After the successful protein purification, the antibody has been tested in direct immunofluorescence (IF) after direct conjugation with Alexa488. Results are reported in
[0154] It has been thus tested the effect of scDb-hERG1-Cys-β1 on cancer cell migratory behavior through lateral motility assay. Experiments have been performed on MDA-MB 231, MDA-MB 231-hERG1, PANC-1 and HCT116 cells. Results are reported in the graphs in
[0155] Promising results have also been obtained on PANC-1 and HCT116 cells, with a reduction of motility behavior in treated cells compared to controls
Materials and Methods
[0156] 10. Cloning of the Heavy and Light Chain of the hERG1 Antibody.
[0157] The heavy and light chain of the monoclonal antibody against hERG1 (hERG1-mAb) were isolated from cDNA obtained from the mRNA purified from hybridomas secerning hERG1-mAb. For the amplification of VH and VL regions, a 5′ primer that anneal to the framework 1 (FR1) of the variable domain of each chain (primer forward) and a primer that anneal to the constant region near the variable domain of each chain (primer reverse) were chosen. For VL was designed a degenerate primer that anneal to the kappa light chain, since this is the immunoglobulin phenotype more expressed in mice (Honjo and Alt, 1995). The heavy chain (VH) of antibody was amplified by PCR using the following set of primers: degVH forward, 5′ GAGGTCCARCTGCAACARTC 3′ (SEQ ID No: 11) and IgG2 reverse, 5′ AGGGGCCAGTGGATAGACTGATGG 3′ (SEQ ID No: 12) (Wang, 2000). The following set of primers was used to PCR amplify the light chain (VL) of antibody: degVL(K), 5′ GAYATTGTGMTSACMCARWCTMCA 3′ (SEQ ID No: 13) and K reverse, 5′ GGATACAGTTGGTGCAGCATC 3′ (SEQ ID No: 14) (Wang, 2000). The cDNA was amplified using Phusion® High-Fidelity DNA Polymerase (Finnzymes Reagents). Cycling conditions were: initial melt at 94° C. for 2 min followed by 25 cycles of a three-step program (94° C., 30 sec; 56° C. (VH); 48° C. (VL), 1 min; and 72° C., 1 min. The reactions were then held at 72° C. for 10 min and cooled to 4° C.
[0158] The antibody fragments (VH and VL) isolated from agarose gel elecrophoresis, were purified using QIAquick PCR Purification Kit (QIAGEN) and then inserted into pCR™-Blunt vector (Invitrogen) following the manufacturer's instructions. The recombinant plasmid were sequenced through Automated DNA sequencing service (PRIMM). VH and VL fragments were then cloned into pHENIX expression vector, which contain the linker sequence (Gly4Ser)3between two different cloning sites. Primers with appropriate restriction sites to clone antibody fragments into pHenIX vector were designed. VL primers: forward VL-ApaLI, 5′ acgcgtgcactgGATATTGTGCTGACACAATCTCCA 3′(SEQ ID No: 15); reverse VL-NotI, 5′ ataagaatgcggccgcGGATACAGTTGGTGCAGCATC 3′(SEQ ID No: 16). VH primers: forward VH-Salk, 5′ acgcgtcgacGAGGTCCAACTGCAACAGTC 3′(SEQ ID No: 17); reverse VH-XhoI, 5′ ccgctcgagccAGGGGCCAGTGGATAGACTGATGG 3′(SEQ ID No: 18). PCR products were digested either with ApaLI and NotI (for VH) or SalI and XhoI (for VL) restriction enzymes (New England BioLabs) and ligated into pHENIX vector in the compatible cloning sites. Digestion were performed 2 h at 37° C. To avoid re-ligation of compatible ends, the 5′ phosphate group was removed from the 5′ terminus of the vector using the calf intestine phosphatise (CIP) according to the following protocol: pHENIX vector (50 ng/μl), Buffer 3 (New England BioLabs) 1× and CIP (0.5 u/μg of vector). Dephosphorylation reaction was incubated for 1 hour at 37° C. Phosphorylated vector was purified with QIAquick PCR Purification Kit (QIAGEN).
[0159] Ligations between the scFv-hERG1 fragment and pHENIX were performed in a mixture of Buffer 2 (New England BioLabs) and T4 Ligase. Vector: scFv ratios of 1:3 and 1:10 were set up in the ligation mixture and incubation was done 15 min at 25° C.
[0160] 2 μl of the ligation mixture were electroporated into E. coli TOP10F′ and HB2151 cells (2500 mV pulse). The electroporated cells were recovered with 450 μl SOC medium (SOB medium supplemented with 1 mM MgSO.sub.4, 1 mM MgCl.sub.2) and incubated 1 hour at 37° C. on shaking. Bacteria were plated into pre-warming LB-Agar plates containing antibiotic and incubated lid-side down overnight at 37° C.
[0161] 11. Cloning of scFv-hERG1-G3 in pPIC9K Expression Vector
[0162] The scFv-hERG1 expression cassette was cloned into a transformed pPIC9K vector (kindly gifted by Prof. Ermanno Gherardi, University of Pavia), which contain a 6×His tag. The scFv construct was isolated and amplified from pHENIX vector by PCR using primers which allow the addiction of FspI and AvrII restriction sites respectively at 3′ and 5′ ends of the sequence (forward VH-FspI, AAAATGCGCAGAGGTCCAACTGCAACAGTC (SEQ ID No: 19); reverse VL-AvrII, GGGGCCTAGGGGATACAGTTGGTGCAGCATC (SEQ ID No: 20)).
[0163] The vector pPIC9 is composed of the AOX1 promoter, 3′AOX1 transcriptional terminator (TT), and a multi-cloning site into which a foreign gene is inserted.
[0164] The expression cassette was cutted with FspI and AvrII and cloned into pPIC9K cut with Eco53KI and AvrII restriction enzymes (New England BioLabs).
[0165] 12. scFv-hERG1 Mutagenesis
[0166] Mutagenesis was performed on the scFv-hERG1 expression cassette cloned into pPIC9K using the QuikChange® XL Site-Directed Mutagenesis Kit (Stratagene, Agilent Technologies). Suitable primers for the introduction of the Cys amminoacid were designed according to the manufacturer's indications and designed by Primm Biotech, left primer:
TABLE-US-00005 (SEQ ID No: 21) GGATTCTGCAGTCTATTACTGTGCAACAGGTTGGGGACCTG; right primer: (SEQ ID No: 22)) CAGGTCCCCAACCTGTTGCACAGTAATAGACTGCAGAATCC.
[0167] The sample reaction was prepared as follows: 5 μl of 10× reaction buffer; 1 μl of scFv-hERG1 dsDNA template (13 ng/μl); 1.84 μl (125 ng) left primer; 1.84 μl (125 ng) right primer; 1 μl of dNTP mix; 3 μl of QuickSolution; 36, 32 μl ddH.sub.2O. Then 1 μl of PfuTurbo DNA polymerase (2.5 U/μl) was added. Cycling conditions were adjusted: initial melt was performed at 95° C. for 1 min, followed by 18 cycles of a three-step program (95° C., 50 sec; 60° C. 50 sec and 68° C., 4 min). The reaction was then held at 68° C. for 7 min and cooled to 4° C.
[0168] After the amplification reaction, 1 μl of DnpI restriction enzyme (10 U/μl) was added directly to the reaction mixture, that was incubated right after at 37° C. for 1 h to digest the parental.
[0169] At this point, bacterial DH5a ultra competent cells were transformed through heat-shock. Cells were gently thaw on ice and 2 μl of the DpI-treated DNA was transferred in a separate aliquot of 200 μl of ultracompetent cells. The reaction was incubated on ice for 30 min. The tube was then heat-pulsed at 42° C. in a dry-bath for 45 sec. The tube was incubated on ice for 2 min. Cells were recovered with 450 μl SOC medium (SOB medium supplemented with 1 mM MgSO.sub.4, 1 mM MgCl.sub.2) and incubated 1 hour at 37° C. on shaking. Bacteria were plated into pre-warming LB-Agar plates containing Ampicillin antibiotic (50 μg/ml) and incubated lid-side down overnight at 37° C.
[0170] The following day, several colonies were grown and some of them were picked and DNA was extracted and sequenced to verify the presence of the desired mutation.
[0171] The construct obtained was labelled scFv-hERG1-Cys.
[0172] 13. scFv-hERG1-G3 and scFv-hERG1-D8Cys Expression in Pichia pastoris
[0173] Linearised scFv-hERG1 and scFv-hERG1-Cys were both digested with SalI and transformed into the Pichia pastoris strain GS115 by spheroplasting, generating Mut.sup.+ transformants. For the transformation we have referred to the Pichia Expression Kit (Invitrogen) indications.
[0174] After five days from transformation, single colonies were visible to the naked eye, 92 clones and 4 negative controls were picked and transferred in three different 96-well plates, with different concentration of G418: without G418, 5 mg/ml, 15 mg/ml. G418 selection was performed exploiting the characteristic that pPIC9K contains the bacterial kanamycin gene that confers resistance to Geneticin® in Pichia. The level of Geneticin® resistance approximately depends on the number of kanamycin genes integrated. A single copy of pPIC9K integrated into the Pichia genome confers resistance to Geneticin® to a level of ˜0.25 mg/ml. Multiple integrated copies of pPIC9K can increase the Geneticin® resistance level from 0.5 mg/ml (1-2 copies) up to 4 mg/ml (7-12 copies). Due to the genetic linkage between the kanamycin gene and the expression cassette (both under the P.sub.AOX1 promoter), we can infer that Geneticin® resistant clones contain multiple copies of the gene of interest. For this same reason, secreted protein expression may increase because of a gene dosage effect. Thus, the presence of pPIC9K was used as a tool to reveal pPIC9K transformants that harbor multiple copies of the genes of interest, scFv-hERG1 and scFv-hERG1-Cys.
[0175] After two days of growth at 30° C., six best grown clones from the 15 mg/ml G418 plates were picked up and evaluated for their capacity to expressed the protein of interest, setting up a small scale liquid culture, according to Pichia Expression Kit protocol (Invitrogen).
[0176] Samples from each clone's culture were collected at different timepoints: 24 h, 48 h, 72 h. After three days of induction with 0.5% final concentration of 100% methanol, supernatants were collected and tested through slot blot.
[0177] 14. Slot Blot Analysis
[0178] Yeast supernatants were collected and tested for protein expression through slot blot; 200 μl of each supernatant were applied to a PVDF membrane (Amersham) assembled in a slot blot device between two squares of 3 mM Whatman paper. The samples were left in incubation for 15 min, then vacuum was applied to dry the samples. The membrane was recovered and wash with T-PBS. Blocking was performed with T-PBS 5% BSA for 45 min and then washed 10 min with T-PBS. The membrane was incubated for 1 hour with anti-6×His-HRP conjugated antibody (Sigma) diluted 1:2000 in 15 ml T-PBS 5% BSA.
[0179] 15. Ni Sepharose Purification
[0180] Supernatants, obtained from the screening of the clones after yeast transformation, were incubated O/N in rolling with Ni Sepharose 6 Fast Flow (Ge Healthcare) according to manufacturer's instructions. After, two wash steps were carried out with 500 μl Wash Buffer (20 mM sodium phosphate, 500 mM NaCl, pH 7.3) and elution was performed using 250 μl Elution buffer (20 mM sodium phosphate, 500 mM imidazole, pH 7.3).
[0181] 16. AKTA Purification
[0182] Purification of 1 liter yeast supernatant of scFv-hERG1-G3 and scFv-hERG1-D8Cys, respectively, was performed by Affinity Chromatography, using an AKTA Protein Purification System (Ge Healthcare Life Sciences) with HisTrap HP 1 ml columns. Wash steps and equilibration were performed according to the manufacturer's instructions, using Wash buffer (20 mM sodium phosphate, 500 mM NaCl, pH 7.3); elution was performed utilizing a linear gradient of Elution buffer (20 mM sodium phosphate, 500 mM NaCl, 500 mM imidazole, pH 7.3). Analysis was accomplished using UNICORN 7.0 software.
[0183] 17. Gel Filtration
[0184] Samples obtained from purification of both antibodies were gel filtered, using Superdex 75 HR 10/30 (Ge Healthcare Life Sciences). Wash buffer composition (20 mM sodium phosphate, 150 mM NaCl, pH 7.3) was adjusted to optimize protocol conditions. Elutions were analyzed through SDS-Page.
[0185] 18. Sodium Dodecyl Sulphate Polyacrylamide Gel Electrophoresis (SDS-PAGE)
[0186] Each sample was applied with the same volume of 15 μl to a stacking gel (400 μl acrylamid (40%)-bisacryamide (0.8%), 1 ml 0.5 M Tris-HCl, pH 6.8, 40 μl 10% SDS, 20 μl 10% ammonium persulfate, 4 μl TEMED, 2.54 ml H.sub.2O). Stacking gel were added on the resolving gel (2.6 ml acrylamid (40%)-bisacryamide (0.8%), 1.75 ml 1.5 M Tris-HCl, pH 8.8, 70 μl 10% SDS, 35 μl 10% ammonium persulfate, 3.5 μl TEMED, 2.55 ml H.sub.2O). Electrophoretic run were performed at 150 V. Gels were either stained with Coomassie Brilliant Blue or transferred to PVDF membranes for western blotting analysis to assess the presence of the protein (around 30 KDa).
[0187] 19. Western Blotting
[0188] After SDS-PAGE gels were transferred to PVDF membrane (Amersham) in transfer buffer (14.4 g, 3.03 g TrisHCl, 200 ml methanol, 800 ml H.sub.2O) at 100 V for one hour. Membranes were washed in T-PBS (PBS 0.1% Tween) and then blocked with T-PBS 5% BSA O/N. Membranes were exposed to primary antibody peroxidise-coupled (Sigma) diluted in T-PBS 5% BSA for one hour at room temperature. After washing the membranes three times for ten minutes, signals were visualized using ECL reagent (Amersham).
[0189] WB were performed by using the following antibodies: antimyc (1:1000) and anti-6×His-HRP conjugated antibody (Sigma).
[0190] 20. scFv-hERG1-G3 and scFv-hERG1-D8Cys quantification, ELISA assay and Biacore analysis
[0191] scFv-hERG1-G3 and scFv-hERG1-D8Cys were gathered together and dialyzed against PBS 1× using Slide-A-Lyzer™ Dialysis Cassettes (Thermo Fisher). Protein absorbance at 280 nm was measured and Lambert-Beer equation was applied.
[0192] To evaluate if the two engineered antibodies, scFv-hERG1-G3 and scFv-hERG1-D8Cys, have still the ability to bind the antigen and afterwards to investigate the different affinity of the two antibodies ELISA assays were performed using plates coated with S5-Pore peptide (sequence: EQPHMDSRIGWLHN), towards which the antibody is directed. This peptide is the same we used to screen anti-hERG1 A7 antibody.
[0193] 21. Antibody Labeling with Alexa 488
[0194] scFv-hERG1-G3 and scFv-hERG1-D8Cys were conjugated with Alexa Fluor® 488 Microscale Protein Labeling Kit (Thermo Fisher Scientific), according to the protocol indications.
[0195] 22. Immunofluorescence on Fixed Cells
[0196] HEK 293 hERG1 (HEK293 stably transfected with pcDNA3.1-hERG1 cDNA construct) and HEK-MOCK (HEK 293 stably transfected with pcDNA 3.1 cDNA) were grown in DMEM medium with 10% FBS EU serum in a 37° C. incubator with 5% CO.sub.2. Cells were seeded O/N on glass coverslips and then washed once with PBS and fixed with 4% paraformaldeide for 20 min at room temperature. Blocking was performed with 10% BSA for 2 h at room temperature. Antibody incubation was performed using scFv-hERG1-G3, scFv-hERG1-D8Cys, diluted 1:20 in blocking solution and incubated for 2 and half hours, followed by anti-His (1:250; Abcam) O/N incubation in blocking solution. The following day, cells were washed three times with PBS and incubated with anti-mouse Alexa488 antibody (Invitrogen) for 1 h. Whereas, scFv-hERG1-G3-Alexa488 and scFv-hERG1-D8Cys-Alexa488, diluted 1:20 in blocking solution, were incubated O/N at 4° C.
[0197] For revelation cells were incubated with Hoechst (1:1000) for 30 min and then mounted with propyl gallate. Cells were visualized on a confocal microscope (Nikon, C1).
[0198] Immunofluorescence quantification was performed using ImageJ software: for each image, the measure of three different areas was performed and the mean was calculated.
[0199] 23. Immunofluorescence on Live Cells
[0200] Cells were grown O/N on 60 mm plates (Sarstedt) using an agarose (15 g/L) ring in order to isolate cells and minimize the volumes of reagents needed for incubations. Cells were incubated with scFv-hERG1-G3-Alexa488 and scFv-hERG1-D8Cys-Alexa488 diluted 1:20 in complete culture medium in a 37° C. incubator with 5% C02 for 4 h. Rivelation was performed using Hoechst, as previously described. Cells were visualized on a inverted light microscopy (Nikon, Eclipse TE300).
[0201] 24. Cell Viability Cell viability was evaluated performing Trypan blue assay; briefly HCT-116, MDA-MB231, MIA PACA2, HEK293 hERG1, HEK-MOCK, FLG 29.1, PANC-1, BXPC3 cells at a density of 5×10.sup.3 cells/well were seeded in a 96-well plate. After 24 h, the medium was replaced by 100 μl of fresh medium containing different concentrations of the scFv-hERG1-D8Cys antibody (10 μg/ml and 20 μg/ml). The complete immunoglobulin, anti-hERG1 monoclonal antibody was tested at a concentration of 100 μg/ml. Cells were cultured 24 h in a humidified incubator at 37° C. and 5% CO.sub.2. After the treatment cells were detached and viable cells were counted. Experiments were performed in triplicate.
[0202] 25. Spheroids 3D Culture and scFv-hERG1 Test on Spheroids
[0203] HEK-293 hERG1, HEK-MOCK, MDA-MB231, MIA PACA2 and PANC-1 were seeded in a 96-well plate at a density of 10.sup.3 cells/well for each well on a 1.5% agarose base-layer. 100 μL of fresh medium were added to each well and cells were left to grow for 72 h in a 37° C. incubator with 5% C02. After 72 h spheroids were visible and the medium was replaced by 100 μl of fresh medium containing different concentrations of the scFv-hERG1-D8Cys antibody (10 μg/ml and 20 μg/ml and 40 μg/ml).
[0204] Pictures were taken using Nikon, Eclipse TE300 every 24 h until 72 h when Calcein AM cell viability assay was performed.
[0205] The volume of spheroids was evaluated analyzing the pictures taken at 24 h, 48 h and 72 h using MATLAB Software.
[0206] Experiment was performed in triplicate.
[0207] 26. β1Integrin mAb: RNA Reverse Transcription
[0208] TS2/16 and BV7 RNA was reverse transcribed into cDNA using oligo(dT) primers (Invitrogen) and SuperScript® II Reverse Transcriptase (Invitrogen) according to manufacturer's instructions in a total volume of 40 μl.
TABLE-US-00006 Stock Final Component concentration concentration Amount RNA 100 ng/μl 4 μg Oligo(dT)12-18 500 μg/ml 25 μg/ml 2 μl dNTPmix 10 mM each 0.5 mM 2 μl PCR grade H2O — — 18 μl
[0209] The mix was incubated in the thermocycler at 65° C. for 5 minutes, and then quickly chilled on ice and added with the following components:
TABLE-US-00007 Stock Final Component concentration concentration Amount 5x First Strand Buffer 5x 1x 8 μl PCR grade H2O — — 6 μl
[0210] The mix was then heated at 42° C. for 2 minutes and then added with the enzyme
TABLE-US-00008 Stock Final Component concentration concentration Amount Superscript ™ II RT 200 U/μl 5 U/μl 2 μl
[0211] The mix (40 μl) was then incubated at 42° C. for 50 minutes and then the reaction was inactivated at 70° C. for 15 minutes.
[0212] 27. β1 Integrin mAb: Isolation of Variable Domains BY Polymerase Chain Reaction (PCR)
[0213] To isolate antibody variable domains (VL and VH) was performed a PCR with the primers reported in Wang et al. (2000) with modifications (Table 2).
[0214] Table 2. Primers used for the isolation of VL and VH variable domains, form Wang et al., (2000) with modifications
TABLE-US-00009 Kappa light chain Primer name Sequence Forward primer degKappadir GAYATTGTGMTSACMCARWCTMCA (SEQ ID No 31) Reverse primer Kapparev GGATACAGTTGGTGCAGCATC (SEQ ID No 32) IgG1 heavy chain Primer name Sequence Forward primer degH1dir CAGGTTACTCTGAAAGWGTSTG (SEQ ID No 33) Forward primer degH2dir GAGGTCCARCTGCAACARTC (SEQ ID No 34) Forward primer degH3dir CAGGTCCAAACTUCAGCARCC (SEQ ID No 35) Forward primer degH4dir GAGGTGAASSTGGTGGAATC (SEQ ID No 36) Forward primer degH5dir GATGTGAACTTGGAAGTGTC (SEQ ID No 37) Reverse primer IgG1rev GGAAGATCTATAGACAGATGGGGGTGTCGTTTTGGC (SEQ ID No 38)
[0215] There are two classes of light chain: kappa and lambda; but since the 95% of mouse antibodies have kappa light chain (Honjo and Alt, 1995) were chosen primers specific for kappa light chain ignoring the lambda type. Forward primers were designed using protein sequence alignment of Framework1 (FRW1) of each chain variable region. Reverse primers were designed on the constant region (CH1) next to the end of the variable domain of each chain (Kappa light chain or IgG1 heavy chain). For kappalight chain were used only one primer pair, while for heavy chain were used 5 primer pairs composed by IgG1rev in combination with the 5 forward primers.
[0216] For VH isolation of both TS2/16 and BV7 were chosen IgG1rev-degH4dir primer pair.
[0217] In order to prevent mutation due to DNA Polymerase, were used a high fidelity DNA polymerase with proof reading activity: KOD Hot Start DNA Polymerase (Novagen) using the following protocol:
TABLE-US-00010 Stock Final Component concentration concentration Amount 10x Buffer 10x 1x 5 μl MgSO4 25 mM 1.5 mM 3 μl dNTPs 2 mM each 0.2 mM each 5 μl Forward primer 10 μM 0.3 μl 1.5 μl Reverse primer 10 μM 0.3 μl 1.5 μl DNA — — 10 ng KOD Hot Start DNA 1 U/μl 0.02 U/μl 1 μl Polymerase PCR grade H2O — — to 50 μl
[0218] The mix was incubated in the thermocycler with following protocol:
TABLE-US-00011 Step Temperature Time 1 95° C. 2 min 2 95° C. 20 sec 3 54° C. (VH) or 10 sec 46° C. (VL) 4 70° C. 10 sec 5 70° C. 5 min
[0219] Steps 2-4 were repeated 30 times.
[0220] 28. β1 Integrin mAb: Cloning of Variable Domains without the Use of Restriction Enzymes
[0221] In order to sequence VH and VL variable domains were cloned without the use of restriction enzymes in a vector suitable for DNA sequencing. We used TA-Cloning Kit or Zero-Blunt Cloning kit (Invitrogen) following manufacturer's instructions.
[0222] DNA Electrophoresis and Purification from Agarose Gel
[0223] DNA electrophoresis uses an electrical field to move the negatively charged DNA toward a positive electrode through an agarose gel matrix. PCR products and restriction enzyme digested DNA were run on agarose gel (1.5% agarose in TAE (Tris, Acetic acid, EDTA) buffer) stained with ethidium bromide, alongside 2 log DNA ladder (NEB) in order to separate different size fragments. Electrophoresis was run at 100 V. The band of interest was thus excised from gel with a clean scalpel and purified using QIAquick PCR Purification Kit (QIAGEN) following manufacturer's instructions. Purified DNA was eluted with 30 μl PCR grade H.sub.2O.
[0224] Splicing by Overlap Extension PCR (SOE-PCR)
[0225] ScFv construct was assembled by Splicing by Overlap Extension PCR (SOE-PCR) in the order VL-linker-VH, using the primers described in (Wang et al 2000) with modifications (Table 3). The polypeptide linker joining the variable domains was designed as four GGGGS repeats.
[0226] Table 3. Primer designed to assemble the construct VL-linker-VH by SOE-PCR (VLREVSOE and VHFORSOE) and clone the sequence into pHenIX vector (VLFORSFI and VHREVNOT), or into scFv-hERG-pHenIX vector (VLFORXHO and VHREVAPALI). In italics are the portions of the primers that anneal to the template, highlighted in grey are the sequences added to clone the construct in frame with the expression cassette in pHenIX or in scFv-hERG1-pHenIX vector, underlined are the restriction sites, grey are the sequences added to facilitate enzyme digestion, and bold are the sequenced that overlap in SOE-PCR.
TABLE-US-00012 Name Sequence VLFORSFI GGCCCAGCCGGCCATGGCCGATATTGTGATGACACA GACTCCA (SEQ ID No 39) VLREVSOE GGAGCCGCCGCCGCCAGAACCACCACCACCAGAACCACCAC CACCGGATACAGTTGGTGCAGCATC (SEQ ID No 40) VHFORSOE GGCGGCGGCGGCTCCGGTGGTGGTGGATCCGAGGTGAAGG TGGTGGAATC (SEQ ID No 41) VHREVNOT
GCGGCCGCATAGACAGATGGGGGTGTCGTTTT GGC (SEQ ID No 42) VLFORXHO
CTCGAGTGATATTGTGATGACACAGACTCCA (SEQ ID No: 431 VHREVAPALI
GTGCACTATAGACAGATGGGGGTGTCGTTTTGGC (SEQ ID No 44)
[0227] The protocol consists in two steps described in
[0228] In the first step were performed two parallel PCR: one with VLFORSFI-VLREVSOE primer pair and pCRII-VL template; and the other with VHFORSOE-VHREVNOT primer pair and pCRII-VH template. PCR protocol using KOD DNA Polymerase was performed as previously described.
[0229] In the second step, we settled up the SOE-PCR using as template 1 μl of each PCR reaction performed in the first step, and VLFORSFI-VHREVNOT primer pair, following the protocol below:
TABLE-US-00013 Stock Final Component concentration concentration Amount 10x Buffer 10x 1x 5 μl MgSO4 25 mM 1.5 mM 3 μl dNTPs 2 mM each 0.2 mM each 5 μl VLFORSFI primer 10 μM 0.3 μl 1.5 μl VHREVNOT primer 10 μM 0.3 μl 1.5 μl PCR VL (STEP 1) — — 1 μl PCR VH (STEP 1) — — 1 μl KOD Hot Start DNA 1 U/μl 0.02 U/μl 1 μl Polymerase PCR grade H2O — — to 50 μl
[0230] The mix (50 μl) was incubated in the thermocycler according to the protocol below:
TABLE-US-00014 Step Temperature Time 1 95° C. 2 min 2 95° C. 20 sec 3 70° C. 10 sec 4 70° C. 10 sec 5 70° C. 5 min
[0231] Steps 2-4 were repeated 30 times
[0232] 29. Production and Characterization of Anti-hERG1-β1 Single Chain Diabody (scDb)-scDb-hERG1-β1 Antibody
[0233] The construct hERG1-β1-scDb was transformed into GS115 Pichia pastoris strain according to the spheroplasting technique previously described and the protein has been expressed and purified applying the expression and purification protocol previously described for the scFv-hERG1 and scFv-hERG1-Cys antibodies.
[0234] Cell ELISA
[0235] Cell ELISA on living cells was performed according to Sette et al., (2013). HEK 293 WT (hERG1−/β1+) and HEK 293-hERG1 (hERG1+/β1+) cells were seeded to semiconfluence in 96-well plate in DMEM plus 10% fetal bovine serum (FBS) and incubated overnight at 37° C. and 5% C02. After three washes with PBS, anti-hERG1-β1-scDb was diluted at different concentrations into culture medium and added to the cells for two 2 hours at room temperature. The following steps were the same as described above.
[0236] Immunofluorescence (IF)
[0237] IF was performed following the protocol which has been previously described. Coverslips were coated with BSA and Fibronectin for two hours. IF was performed on HEK 293 WT (hERG1−/β1+), HEK 293-hERG1 (hERG1+/β1+) and GD25 WT cells (hERG1−/β1−).
[0238] 30. Production and Preliminary Characterization of Anti-hERG1-β1 Single Chain Diabody (scDb)-scDb-hERG1-Cys-β1-Antibody
[0239] scDb-hERG1-β1 MUTAGENESIS
[0240] Mutagenesis was performed on the scDb-hERG1-β1 expression cassette cloned into pPIC9K using the QuikChange®XL Site-Directed Mutagenesis Kit (Stratagene, Agilent Technologies). Suitable primers for the introduction of the Cys amminoacid were designed according to the manufacturer's indications and designed by Primm Biotech, left primer:
TABLE-US-00015 (SEQ ID No: 21) GGATTCTGCAGTCTATTACTGTGCAACAGGTTGGGGACCTG; right primer: (SEQ ID No: 22)) CAGGTCCCCAACCTGTTGCACAGTAATAGACTGCAGAATCC.
[0241] The sample reaction was prepared as follows: 5 μl of 10× reaction buffer; 1 μl of scFv-hERG1 dsDNA template (13 ng/μl); 1.84 μl (125 ng) left primer; 1.84 μl (125 ng) right primer; 1 μl of dNTP mix; 3 μl of QuickSolution; 36, 32 μl ddH.sub.2O. Then 1 μl of PfuTurbo DNA polymerase (2.5 U/μl) was added. Cycling conditions were adjusted: initial melt was performed at 95° C. for 1 min, followed by 18 cycles of a three-step program (95° C., 50 sec; 60° C. 50 sec and 68° C., 4 min). The reaction was then held at 68° C. for 7 min and cooled to 4° C.
[0242] After the amplification reaction, 1 μl of DnpI restriction enzyme (10 U/μl) was added directly to the reaction mixture, that was incubated right after at 37° C. for 1 h to digest the parental. At this point, bacterial DH5α ultra competent cells were transformed through heat-shock. Cells were gently thaw on ice and 2 μl of the DpI-treated DNA was transferred in a separate aliquot of 200 μl of ultracompetent cells. The reaction was incubated on ice for 30 min. The tube was then heat-pulsed at 42° C. in a dry-bath for 45 sec. The tube was incubated on ice for 2 min. Cells were recovered with 450 μl SOC medium (SOB medium supplemented with 1 mM MgSO.sub.4, 1 mM MgCl.sub.2) and incubated 1 hour at 37° C. on shaking. Bacteria were plated into pre-warming LB-Agar plates containing Ampicillin antibiotic (50 μg/ml) and incubated lid-side down overnight at 37° C.
[0243] The following day, several colonies were grown and some of them were picked and DNA was extracted and sequenced to verify the presence of the desired mutation.
[0244] The construct obtained was labelled scDb-hERG1-Cys-β1.
[0245] Expression and Purification of scDb-hERG1-Cys-β1 Antibody.
[0246] scDb-hERG1-Cys-β1 was transformed in GS115 Pichia pastoris yeast strain according to the spheroplasting technique previously described and the protein has been expressed and purified applying the expression and purification protocol previously described for the scFv-hERG1 and scFv-hERG1-Cys antibodies using AKTA Pure (Ge Healthcare). Chromatograms were analyzed using Unicorn 7.0 Software.
[0247] Immunofluorescence (IF)
[0248] IF was performed following the protocol which has been previously described. Coverslips were coated with BSA and Fibronectin for two hours. IF was performed on GD25 WT cells (hERG1−/β1−), HEK 293 WT (hERG1−/β1+), HEK 293-hERG1 (hERG1+/β1+), following the protocol previously described. IF was performed using scDb-hERG1-Cys-1 conjugated with Alexa488 fluorophore.
[0249] Viability Assay
[0250] PANC-1 (pancreatic ductal adenocarcinoma) cells and MDA-MB 231 (breast cancer) cells were seeded at 5*10.sup.5 in 96 well-plates and let grown O/N. The following day cells were treated with scDb-hERG1-Cys-β1 at different dilutions (0, 10, 20, 40, 100 μg/ml) and incubate with the antibody 24 h. Each condition was performed in triplicate.
[0251] After incubation cells were detached and counted, for IC.sub.50 determination Origin Software was applied.
[0252] 3D Spheroid Culture
[0253] 10.sup.3 PANC-1 and MDA-MB 231 cells were seeded on an agarose base layer (1.5 g/l) in 96 well plate and grown for 72 hours in a humidified incubator at 37° C. and 5% CO.sub.2. Then scDb-hERG1-Cys-1 was administered (40 μg/ml), diluted in culture medium, while fresh medium without antibody was added to wells containing cells treated as negative controls. Photos were taken at 24 hours to monitor cell growth using a Nikon, Eclipse TE300 microscope.
[0254] Lateral Motility Assay
[0255] Cells were plated in 35 mm Petri dishes at an initial density of 5*10.sup.5 and allowed to settle for 24 h.
[0256] Lateral motility was assessed by a monolayer wound assay (Silletti et al., 1995; Peck and Isacke, 1996). Wound widths were determined immediately afterwards (0 h) by measuring the width of the wound at 45 fixed points Cellular motility was quantified as the “motility index” (MI) defined as follows:
MI=1−(Wt/Wo)
[0257] MI=0 indicated no movement of cells whilst values of MI=1 indicated complete wound closure
[0258] Biodistribution of scFv-hERG1-D8Cys and scDb-hERG1-Cys-β1 Antibodies.
[0259] 160 μg of each antibody have been injected in two Balb/c mice i.v. Blood samples have been collected from each mouse at different timpanist following the i.v.: 5, 10, 30 min 1 h, 2 h, 6 h, 24 h after injection. Blood samples have been processed and plasma isolated. ELISA test on plasma samples was performed following the protocol previously described in this section. t/2 were calculated applying Precise PK Pharmacokinetic Software.
[0260] ECG Measurements.
[0261] ECG measurements were performed before antibody administration and continuously after i.v. injection of the antibody for 15 min.
[0262] In Vivo Experiments
[0263] In Vivo Analysis
[0264] Labeling of the scFv-hERG1-D8Cys with Alexa 750: 150 μg of scFv-hERG1-D8Cys at a concentration of 2 mg/ml in PBS solution and 0.1 M sodium bicarbonate buffer pH 8.3, were incubated 1 h at 22° C. in agitation with 12 μl of Alexa Fluor® 750 NHS Ester (Succinimidyl Ester) (Thermo Fisher Scientific), resuspended in DMSO at 10 mg/ml. The reaction was blocked for 5 min in ice and the labelled protein was purified by size exclusion chromatography on a Sephadex G25 (Sigma) column equilibrated with PBS.
[0265] In vivo imaging. Three six-week old, female immunodeficient Athymic Nude-Foxn1 nu/nu mice were injected intravenously with 50 μl (1 nm dye/mouse) of scFv-hERG1-D8Cys labeled with the fluorophore Alexa 750 and fluorescence was measured 5, 10, 60 min and 24 h after antibody injection. One control mouse was treated with sterile PBS solution. All the fluorescent emission spectra were measured using a Photon imager (Biospace Lab). The imager had a laser source for fluorescence excitation (A=679 nm), an emission filter (A=702 nm) for fluorescence detection, and a computer for data analysis.
[0266] Mouse Model: the MIAPaCa-2 cell line was used for tumor cell implantation, as described in Lastraioli et al., 2015. Cells were cultured in DMEM supplemented with L-glutamine (4 mM), 10% fetal bovine serum and Geneticin (G418) (2.4 mg/ml) (Gibco) at 37° C. in a humidified atmosphere of 5% C02. MIAPaCa-2-luc cells were injected into the pancreas of nu/nu mice and the animals were monitored (as described in [17]) and 45 days after the cell inoculum, mice were administered with scFv-hERG1-D8Cys-Alexa750 antibody.