Compositions and methods for identifying anti cancer, anti-metastatic and anti-stress agents
11021755 · 2021-06-01
Assignee
Inventors
- David Cheresh (Encinitas, CA)
- Maricel Gozo (San Diego, CA, US)
- Mayra Yebra (Cardiff by the Sea, CA, US)
- Laetitia SEGUIN (La Jolla, CA, US)
Cpc classification
C12N15/00
CHEMISTRY; METALLURGY
C07K14/70557
CHEMISTRY; METALLURGY
International classification
C07K14/705
CHEMISTRY; METALLURGY
Abstract
In alternative embodiments, provided are products of manufacture, such as assays, chimeric nucleic acids and nucleic acid constructs, recombinant cells, and methods, comprising use of beta3-integrin (ITGB3) promoters operatively linked to a reporter, for drug screening, and in particular, screening for agents that inhibit cancer cell survival and metastasis. In alternative embodiments, compositions and methods as provided herein also can be used to identifying novel pathways that lead to acquired resistance, stemness, and anchorage independent growth; and characterizing distinct populations of cancer cells within a tumor microenvironment.
Claims
1. A method for identifying or screening for an agent or a compound: that inhibits or decreases the amount of metastasis or circulating tumor cells; that reverses cancer cell acquired resistance to a drug; and/or that inhibits, negatively affects or decreases anchorage independent growth of a cancer cell, comprising: (a) providing a test compound; (b) providing a recombinant or an engineered cell, or a cell free expression system, comprising a nucleic acid construct or a chimeric or recombinant nucleic acid comprising a beta3-integrin (ITGB3) promoter operably linked to a nucleic acid encoding a reporter or a marker protein or marker compound, wherein inhibiting activity of the beta3-integrin (ITGB3) promoter results in decreased expression and measurable levels of the nucleic acid encoding the reporter or marker protein or marker compound; (c) measuring or determining the level of the nucleic acid encoding the reporter or marker protein or marker compound before adding the test compound, and (d) administering to or contacting the test compound with the recombinant or engineered cell, or to the cell free expression system, and measuring or determining the level of the nucleic acid encoding the reporter or marker protein or marker compound, wherein measuring or determining an increase in the level of the nucleic acid encoding the reporter or marker protein or marker compound, as compared to the level measured in step (c), indicates that the test compound is an beta3-integrin (ITGB3) promoter inducer, and wherein measuring or determining a decrease in the level of the nucleic acid encoding the reporter or marker protein or marker compound, as compared to the level measured in step (c), indicates that the test compound is a beta3-integrin (ITGB3) promoter inhibitor, and by measuring or determining a decrease in the level of the nucleic acid encoding the reporter or marker protein or marker compound, as compared to the level measured in step (c), indicates that the test compound can: inhibit or decrease the amount of metastasis or circulating tumor cells; reverse cancer cell acquired resistance to a drug; and/or inhibit, negatively affect or decrease anchorage independent growth of a cancer cell.
2. The method of claim 1, further comprising administering a negative control compound known to not affect beta3-integrin (ITGB3) promoter activity.
3. The method of claim 1, wherein the nucleic acid construct, or a chimeric or recombinant nucleic acid comprises or is contained in an expression cassette, a vector, a plasmid, a phagemid or an artificial chromosome.
4. The method of claim 1, wherein the test compound comprises or is a biologic, a drug, a small molecule or a small molecule drug, a bio-molecule, a protein, a lipid, a polysaccharide, or a nucleic acid.
5. The method of claim 1, wherein the reporter or marker protein or compound comprises a bioluminescent or a fluorescent protein or compound, or a luciferase or a green fluorescent protein (GFP).
6. The method of claim 1, wherein the nucleic acid construct or a chimeric or recombinant nucleic acid further comprises an ITGB3 enhancer.
7. The method of claim 1, wherein the ITGB3 promoter is an ITGB3 distal promoter.
8. The method of claim 7, wherein the ITGB3 distal promoter comprises a sequence as set forth in SEQ ID NO:2.
9. The method of claim 1, wherein the beta3-integrin (ITGB3) promoter is constitutively active and the reporter nucleic acid, or the reporter or marker protein is constitutively expressed.
10. The method of claim 1, wherein the beta3-integrin (ITGB3) promoter is inducibly expressed before addition of the test compound, resulting in inducible expression of the reporter nucleic acid, or the reporter or marker protein.
11. The method of claim 10, wherein the beta3-integrin (ITGB3) promoter is inducibly expressed by addition of a chemical or a drug or a conditioned media.
12. The method of claim 11, wherein the conditioned media is obtained from serum deprived cells or cancer cells.
13. The method of claim 1, wherein the beta3-integrin (ITGB3) promoter is inducibly expressed by addition of erlotinib.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1) The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
(2) The drawings set forth herein are illustrative of embodiments as provided herein and are not meant to limit the scope of the invention as encompassed by the claims.
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
(22)
(23)
(24)
(25)
(26)
(27)
(28)
(29)
(30)
(31)
(32)
(33)
(34)
(35)
(36) For
(37)
(38)
(39)
(40)
(41)
(42)
(43)
(44)
(45)
(46)
(47)
(48)
(49)
(50)
(51)
(52)
(53)
(54)
(55)
(56)
(57)
(58)
(59)
(60)
(61)
(62)
(63) For
(64)
(65) Like reference symbols in the various drawings indicate like elements.
(66) Reference will now be made in detail to various exemplary embodiments as provided herein, examples of which are illustrated in the accompanying drawings. The following detailed description is provided to give the reader a better understanding of certain details of aspects and exemplary embodiments, and should not be interpreted as a limitation on the scope of the invention.
DETAILED DESCRIPTION
(67) In alternative embodiments, provided are products of manufacture, such as assays, kits and the like, and nucleic acid constructs, including vectors, expression systems, reporter constructs, and the like, and recombinant or engineered cells and non-human transgenic organisms comprising same, and methods for using these compositions comprising e.g., use of beta3-integrin (ITGB3) promoters operatively linked to a reporter for drug screening, and in alternative embodiments, screening for agents that inhibit beta3-integrin (ITGB3) promoters and/or inhibit cancer cell survival and metastasis. In alternative embodiments, compositions and methods as provided herein are used to identifying novel pathways that lead to cancer cell acquired resistance to drugs, stemness (characteristics of a stem cell that distinguishes it from ordinary cells) and anchorage independent growth. In alternative embodiments, compositions and methods as provided herein are used to characterize distinct populations of cancer cells within a tumor microenvironment. Compounds identified by practicing the methods as provided herein can also modify or regulate, e.g., Hedgehog signaling, IL6 signaling (Jak/Stat), Wnt signaling (canonical and non-canonical), NFKB and the like.
(68) In alternative embodiments, provided are nucleic acids, including e.g., DNA or RNA constructs, such as vectors and expression cassettes, and cells and non-human transgenic organisms comprising these nucleic acids and construct, and methods for using same, for example, screening for agents that inhibit cancer cell survival and metastatic inhibitors to treat cancer. In alternative embodiments, the nucleic acids as provided herein, including e.g., DNA or RNA constructs, vectors, expression cassettes and the like, comprise all or any functional subsequence of (e.g., a functional portion of) a beta3-integrin (ITGB3) promoter, e.g., a human ITGB3 promoter, operatively linked to a reporter or a marker, e.g., a luciferase, a green fluorescent protein (GFP), MILLI-MARK™ anti-Integrin αVβ3 Antibody, clone LM609-FITC (Millipore Corporation, Billerica, Mass.), AP3 Luciferase Reporter Vector (Affymetrix, Santa Clara, Calif.), or other suitable or equivalent reporter or marker. In alternative embodiments, these nucleic acids, including e.g., the DNA or RNA constructs, vectors, expression cassettes and the like, are stably expressed, and/or inducibly or constitutively expressed, in a beta3-negative cell. In alternative embodiments, the ITGB3 promoter is inducible and is activated to express detectable reporter or a marker, e.g., a luciferase, a GFP or other suitable or equivalent reporter or marker. In alternative embodiments, the ITGB3 promoter is constitutively expressed.
(69) In alternative embodiments, before exposure to a test compound, an inducible ITGB3 promoter is exposed to an inducing agent to induce or upregulate expression of the operatively linked nucleic acid marker or reporter (or nucleic acid encoding a reporter or marker). In alternative embodiments, the inducing agent is a drug or chemical, e.g. erlotinib (e.g., TARCEVA™), where the promoter is induced following drug administration. In alternative embodiments, the inducing agent is a conditioned media (CM) comprising a soluble factor from a cell, e.g., a cell under a stress, e.g., a metabolic stress, e.g., because of low/no serum. In alternative embodiments, soluble “inducing” factors are produced by introducing a cellular stress (e.g., a metabolic, a drug treatment and/or a nutrient deprivation). In alternative embodiments, these factors are collected and concentrated from conditioned media at different time points, and optionally also characterized, before administration to the cell or the cell-free extract. In alternative embodiments, the following soluble “inducing” factors are used to induce ITGB3 promoter:
(70) TABLE-US-00001 WNT5A wingless-type MMTV integration site family, member 5A LAMA4 laminin, alpha 4 BDNF brain-derived neurotrophic factor TIMP3 TIMP metallopeptidase inhibitor 3 SLC46A3 solute carrier family 46, member 3 MSLN mesothelin MFAP2 microfibrillar-associated protein 2 METRN meteorin, glial cell differentiation regulator MATN2 matrilin 2 IGFBP4 insulin-like growth factor binding protein 4 FBLN1 fibulin 1 COL5A1 collagen, type V, alpha 1 PAPPA PAPPA antisense RNA (non-protein coding); pregnancy-associated plasma protein A, pappalysin 1 HTRA1 HtrA serine peptidase 1 ERAP1 endoplasmic reticulum aminopeptidase 1
(71) Agents of interest, for example, potential cancer cell survival inhibitors or metastatic inhibitors, are screened for a change in (e.g., a reduction in) reporter or marker (e.g., luciferase, GFP) expression (by e.g., detection of lower amounts of reporter or marker, or lower amount of activity of reporter or marker) when the candidate agents are applied to the cells with the active ITGB3 promoter, e.g., with an induced ITGB3 promoter, such as an induced ITGB3-Luc construct.
(72) In alternative embodiments, applications of methods as provided herein include: screening for agents that inhibit cancer cell survival; identifying novel pathways that lead to acquired resistance or stemness or anchorage independent growth; and characterizing distinct populations of cancer cells within its tumor microenvironment.
(73) In alternative embodiments, provided are compositions and methods for the detection of the upregulation of ITGB3, wherein the detection is by an increase in a reporter or a marker, such as an increase in a bioluminescence or a fluorescence, e.g., a luciferase or a green fluorescent protein (GFP). In alternative embodiments, the cells as provided herein or cells used in the methods as provided herein are cancer cells, or cancer cell lines, or stable cancer cell lines, that express the reporter or marker (e.g., luciferase or GFP) regulated by the ITGB3 promoter region; thus, the methods as provided herein can be used as a tool to identify inhibitors of drug resistance, cellular stress, cancer cell growth, and cancer metastasis. In alternative embodiments, cell lines as provided herein or used to practice embodiments as provided herein include: carcinoma and immortalized cell lines that are beta3 negative (e.g., FG, HCC827, BT474, H441, MCF10A), and drug resistant cell lines, e.g., HCC827R, FGR, H441R.
(74) Described herein for the first time is the function of the ITGB3 promoter region during cellular stress and cancer metastasis, and for the first time describes use of the compositions as provided herein to identify and characterize cancer cells that induce ITGB3 expression.
(75) In alternative embodiments as provided herein, a nucleic acid used to practice embodiments as provided herein comprises a reporter or a marker gene, including nucleic acid sequences that encode proteins that can be used for reporting activity, e.g., enzymes or epitopes. In one aspect, the reporter or marker gene is used to monitor beta3-integrin (ITGB3) promoter expression. In alternative embodiments, the reporter or marker gene is used to monitor beta3-integrin (ITGB3) promoter inhibition, suppression or silencing. In alternative embodiments, the reporter gene encodes or comprises, or contained in: a luciferase; a green fluorescent protein (GFP); a MILLI-MARK™ anti-Integrin αVβ3 Antibody; a clone LM609-FITC (Millipore Corporation, Billerica, Mass.); an AP3 Luciferase Reporter Vector (Affymetrix, Santa Clara, Calif.), and/or the like. Any compound, fluorophore, label, isotope, protein or gene that has a reporting or marking function can be used in the methods provided herein.
(76) In alternative embodiments, nucleic acids used to practice embodiments as provided herein are inserted into the genome of a host cell by e.g. a vector, a virus or any nucleic acid shuttling or insertional mechanism. In alternative embodiments, the insertion is stable. For example, a nucleic acid sequence can be inserted into a genome or a vector by a variety of procedures. In one aspect, the sequence is ligated to the desired position in the vector following digestion of the insert and the vector with appropriate restriction endonucleases. Alternatively, blunt ends in both the insert and the vector may be ligated. In alternative embodiments, viral long terminal repeats (LTRs) are inserted in a flanking pattern to effect insertion of a desired sequence (e.g., a nucleic acid construct, or a chimeric or recombinant nucleic acid, comprising a beta3-integrin (ITGB3) promoter, or a functional subsequence thereof; and a reporter nucleic acid, or a nucleic acid encoding a reporter or a marker protein) into a genome. In alternative embodiments, sequences homologous to a genome target sequence (targeting where in the genome it is desired to insert the desired nucleic acid are inserted in a flanking pattern to effect insertion of the desired sequence into a genome. A variety of cloning techniques are known in the art, e.g., as described in Ausubel and Sambrook. Such procedures and others are deemed to be within the scope of those skilled in the art.
(77) In alternative embodiments, the ITGB3 promoter sequence used in the construct as provided herein or to practice a method as provided herein comprises or consists of (SEQ ID NO:1):
(78) TABLE-US-00002 TTTGCAGAGCTGGCTTTTCCCCTTGCAAATTGCTAGTGACGCTTCAGCTG ATGTGTGTTACTATTAAGGTCCTAGTGTTTGGGAGGGTGGGGCAGGAGGT GGAGGATTGTCAGAAAAAAATTACATGGAAAAAGATGGCATCTGAGATGT TTTGAAAGATAAGTGGAATTTTCCAAGTGGAAAAAGGAAGGAAAATCAGT CAGATAGGAAGGCATGGAGCATTGGGGAATGACAAGTATCTTCTTGGACT AGGGTGGGAGATGGGCTGGAGAGATGGGTCAGGGCCAGTTGTCTGGCATC TTGTGTGTCTCAGAAGAGGGTGGGCACGCTGCGTAGGGAAGCCCAGGGCC ACTCTGAAAGCCCTAAAGGGGAACTGATGCCTCTGGCCTTGTTTTTATCA CCATCAGGACTACCCATTGAGGCAGGCTGCACTACCAGCTACTTCCTGGT GCCCTCTTGCTCATAGCCATAGTATTTTGCCTCTCTGAGCTTCCAGAGGT TTTAAGTCTGGGGAAGACCCAGGGACTCAAAGAAAGATTGGGGTGGGAGA TAAGGGGCCACAGTTTGGGGGAGTCAGGCAGGAGGCCTTTGAGGAAAATA GATAAAGTCCCAAAGCCTGTGAGTGTGAATTTGGAGGCAATATGCTGTGT TCTGAAACGTTTTCAGACACTGGCTAGGTGCAAGCAAGTGTTTGTAGGGC GAGGCTCTTCATGGACCTATCACTGCTTACGCAAGCTTGGGATGTGGTCT TGCCCTCAACAGGTAGGTAGTCTACCGGAAAACCAAACTAAGGCAAGAAA AAAATTAGTGAATAATAAAGGACTGAACCGGTTCAGAGAAGGCATTCAGC AGATGTTTGCCAGTCAAATGAATTAAAGTGTGAATGAATGAAACTCGAGG TAGTGGGTGAATGTGTCCCAAGAATCCAGCGAAACAGGGTCTCCCAGGAG GCGGGACTGGAAGGGTCCGGAGAGGGGCCACAGGCTCCTGGCCTTTCTAA GCACACCAAGTGCCCAGTCGCGGACCCCCGGGACCAGGATGCGCTGACGA CCCGGCTGGCAGGCGGGTCCTCGTGGGCGAGGCGAGGGAGGCGGCGAGAG AGGAGCAATAGTTTCCCACCGCTCCCTCTCAGGCGCAGGGTCTAGAGAAG CGCGAGGGGATCTAGAGAAGCCGGAGGGGAGGAAGCGCGAGTCCGCGGCC CGCCCCGTTGCGTCCCACCCACCGCGTCCCCTCCCCTCCCCTCCCGCTGC GGGAAAAGCGGCCGCGGGCGGCGGCGCCCACTGTGGGGCGGGCGGAGCGC CGCGGGAGGCGGACGAGAT
(79) In alternative embodiments, related ITGB3 promoter sequences that are biologically active, including fragments, modifications, derivatives, substitutions and the like are suitable for use with embodiments as provided herein.
(80) In alternative embodiments, nucleic acid constructs, or chimeric or recombinant nucleic acids as provided herein, or expression cassettes, vectors, plasmids, phagemids, artificial chromosomes and the like, further comprise a distal promoter region of ITGB3, or an enhancer region of ITGB3, e.g., as illustrated in
(81) The vector used to make or practice embodiments as provided herein can be chosen from any number of suitable vectors known to those skilled in the art, including cosmids, YACs (Yeast Artificial Chromosomes), megaYACS, BACs (Bacterial Artificial Chromosomes), PACs (P1 Artificial Chromosome), MACs (Mammalian Artificial Chromosomes), a whole chromosome, or a small whole genome. The vector also can be in the form of a plasmid, a viral particle, or a phage. Other vectors include chromosomal, non-chromosomal and synthetic DNA sequences, derivatives of SV40; bacterial plasmids, phage DNA, baculovirus, yeast plasmids, vectors derived from combinations of plasmids and phage DNA, viral DNA such as vaccinia, adenovirus, fowl pox virus, and pseudorabies. A variety of cloning and expression vectors for use with prokaryotic and eukaryotic hosts are described by, e.g., Sambrook. Particular bacterial vectors which can be used include the commercially available plasmids comprising genetic elements of the well-known cloning vector pBR322 (ATCC 37017), pKK223-3 (Pharmacia Fine Chemicals, Uppsala, Sweden), GEM1 (Promega Biotec, Madison, Wis., USA) pQE70, pQE60, pQE-9 (Qiagen), pD10, psiX174 pBluescript II KS, pNH8A, pNH16a, pNH18A, pNH46A (Stratagene), ptrc99a, pKK223-3, pKK233-3, DR540, pRIT5 (Pharmacia), pKK232-8 and pCM7. Particular eukaryotic vectors include pSV2CAT, pOG44, pXT1, pSG (Stratagene) pSVK3, pBPV, pMSG, and pSVL (Pharmacia). However, any other vector may be used to practice embodiments as provided herein as long as it is viable in the host cell. In one aspect, target sequences are integrated into genomes using a lentiviral feline immunodeficiency (FIV) vector for the transduction process.
(82) The invention will be further described with reference to the following examples; however, it is to be understood that the invention is not limited to such examples.
EXAMPLES
Example 1: Making and Demonstrating Efficacy of Compositions and Methods
(83) The data presented herein demonstrates making and using compositions and products of manufacture of embodiments as provided herein.
(84) In alternative embodiments, provided are stable cell lines expressing reporters or markers, e.g., GFP or luciferase, regulated by the ITGB3 promoter and/or enhancer region. Findings show that ITGB3 expression is induced during acquired drug resistance and metastasis. In addition, findings show that ITGB3 expression is required for survival during cellular stress.
(85) In alternative embodiments, provided are compositions and methods for screening for agents that inhibit ITGB3 expression and the phenotypes resulting from ITGB3 upregulation. For example, in screens involved in identifying agents that rescue drug sensitivity, the generated drug resistant cell lines expressing b3 reporter (HCC827R, FGR, BT474R, H441R) can be used. In alternative embodiments, in screens that involve identifying secreted factors that induce ITGB3 expression during cellular stress, conditioned media from serum deprived cancer cells is introduced to exemplary ITGB3 reporter cell lines that are not drug resistant.
(86) An exemplary protocol for making constructs and cells as provided herein, or constructs and cells used to practice methods as provided herein: Step 1: Generate lentivirus particles containing the ITGB3 reporter construct (as illustrated in
(87) A. Regulators of ITGB3 Expression During Metabolic Stress:
(88) Grow cell line from Step 2 in 3D under stress conditions (e.g., serum deprivation, conditioned media from a serum-starved cell, RTK inhibitors, hypoxia) for 48-72 hours so that luciferase is expressed. Conditioned media is prepared by metabolically stressing the cell line by serum starvation for 14 days.
(89) Apply an active compound or gene targeting shRNA to the cells in Step 2 to identify agents that alter ITGB3 promoter activity.
(90) B. Inhibitors of Cancer Metastasis, Stemness and Anchorage Independent Growth:
(91) Drug resistant cancer cell lines expressing ITGB3 reporter are grown in 3D. Reduction in ITGB3 promoter activity correlates with an inhibitor of stemness, anchorage-independent growth, or metastasis.
(92) In
(93)
Example 2: Integrin Alpha-v/Beta-3 (αvβ3) Drives Slug Activation and Stemness in the Pregnant and Neoplastic Mammary Gland
(94) The data presented herein demonstrates making and using compositions and products of manufacture of this invention and used to practice methods of this invention, and describes a role for αvβ3 in regulating Slug activation in MaSCs leading to MaSC expansion and mammary gland remodeling during pregnancy. The data presented herein also demonstrates that αvβ3 also promotes Slug activation, anchorage-independent growth, and tumor initiation in human breast cancer cells, hallmarks of tumor stemness.
(95) Although integrin alpha-v/beta-3 (αvβ3, or avb3) is linked to cancer progression, its role in epithelial development is unclear. Here, we show that αvβ3 plays a critical role in adult mammary stem cells (MaSCs) during pregnancy. Whereas αvβ3 is a luminal progenitor marker in the virgin gland, we noted increased αvβ3 expression in MaSCs at midpregnancy. Accordingly, mice lacking αvβ3 or expressing a signaling-deficient receptor showed defective mammary gland morphogenesis during pregnancy. This was associated with decreased MaSC expansion, clonogenicity, and expression of Slug, a master regulator of MaSCs. Surprisingly, αvβ3-deficient mice displayed normal development of the virgin gland with no effect on luminal progenitors. Transforming growth factor β2 (TGF-β2) induced αvβ3 expression, enhancing Slug nuclear accumulation and MaSC clonogenicity. In human breast cancer cells, avb3 was necessary and sufficient for Slug activation, tumorsphere formation, and tumor initiation. Thus, pregnancy-associated MaSCs require a TGF-β2/αvβ3/Slug pathway, which may contribute to breast cancer progression and stemness.
(96) The epithelial hierarchy in the adult mammary gland represents a well-characterized system with rigorously defined markers (Asselin-Labat et al., 2007; Shackleton et al., 2006; Stingl et al., 2006), allowing us to characterize a possible role for avb3 in this process. Here, we describe a role for αvβ3 in regulating Slug activation in MaSCs leading to MaSC expansion and mammary gland remodeling during pregnancy. Interestingly, αvβ3 also promotes Slug activation, anchorage-independent growth, and tumor initiation in human breast cancer cells, hallmarks of tumor stemness.
(97) Results
(98) β3 is Required for Mammary Gland Development During Pregnancy
(99) Previous studies showed β3 surface expression in luminal progenitors and some MaSCs from dissociated virgin mammary glands (Asselin-Labat et al., 2007). Consistent with these findings, we observed β3 expression in basal cells and a subset of luminal cells within the ducts of adult virgin mice (
(100) β3 expression in glands from both virgin and pregnant mice suggests a potential function for this receptor in mammary gland morphogenesis at either stage. To address this possibility, we examined the morphology of mammary gland whole mounts from virgin and P12.5 wild-type (WT) and β3 knockout (b3KO) mice, which lack β3 expression in the mammary gland. Although no differences were observed in mammary glands from virgin β3KO mice (
(101)
(102)
(103)
(104)
(105)
(106)
(107)
(108) To discern a potential mechanism that accounts for this phenotype, we assessed the relative amounts of epithelial cell proliferation, apoptosis, and differentiation in WT and β3KO P12.5 mammary glands. Quantitative RT-PCR from whole mammary glands showed reduced mRNA levels of the alveolar marker ELF5 (57% decrease), but not the luminal differentiation marker GATA3, in P12.5 β3KO mammary glands relative to WT controls (
(109) Importantly, we noted similar levels of nuclear ELF5 protein in β3KO alveoli compared to those from WT mice, indicating that the decreased ELF5 mRNA levels observed in P12.5 β3KO mammary glands are consistent with fewer alveoli and not due to dysregulated ELF5 expression. Taken together, these data show that β3 deletion is associated with defective initiation of alveologenesis during pregnancy, suggesting that b3KO mice may display a defect in MaSCs/progenitor cells.
(110) Pregnancy is Associated with Increased β3 Expression in MaSCs
(111) Mammary gland remodeling and differentiation during pregnancy require the coordinated response of multiple cell types, including MaSCs and progenitors (Asselin-Labat et al., 2010; Jeselsohn et al., 2010; van Amerongen et al., 2012; Van Keymeulen et al., 2011). To determine which MaSC/progenitor cell types might require b3 during pregnancy, we first compared β3 expression in WT virgin and P12.5 mammary glands by flow cytometry. Analysis of live (propidium iodide negative) lineage-negative (Lin.sup.−; CD31.sup.−, CD45.sup.−, Ter119.sup.−) mammary cells for surface expression of CD24 and CD29 (b1 integrin) identifies enriched populations of mature luminal and progenitor cells (CD24.sup.+CD29.sup.lo as well as basal and MaSCs (CD24.sup.+CD29.sup.hi) in both virgin (Shackleton et al., 2006) and P12.5 mammary glands (Asselin-Labat et al., 2010).
(112) We then evaluated surface β3 levels in these live Lin.sup.−CD24.sup.+CD29.sup.hi/lo cells to determine the MaSCs/progenitor cells that express b3 during pregnancy. We found that most b3.sup.+ cells in the virgin gland resided in the CD29.sup.lo population, and the percentage of b3.sup.+CD29.sup.lo cells decreased during pregnancy, as previously described by Asselin-Labat et al. (2007) (
(113) Consistent with b3 expression in CD29.sup.hi MaSCs/basal cells during pregnancy, we observed that (33.sup.+ epithelial cells (Lin.sup.−CD24.sup.+b3.sup.+) from P12.5 mice were unable to form colonies in Matrigel compared to β3.sup.− cells (
(114) Accordingly, we examined whether (33.sup.+ epithelial cells from P12.5 mice were enriched for MaSCs capable of repopulating a fully functional mammary gland similar to CD29hi cells (Asselin-Labat et al., 2010; Shackleton et al., 2006). We tested this possibility by injecting 10,000 Lin.sup.−CD24.sup.+ β3.sup.+ and β3.sup.− mammary cells from the same donor mice into cleared fat pads of weanling recipients and examining repopulating potential. To simultaneously assess differences in functionality, all outgrowths were harvested at lactating day 2. Although few outgrowths were observed in mice injected with β3.sup.− cells (27%), (33.sup.+ cells were enriched for repopulating potential (71%) (
(115)
(116)
(117)
(118)
(119)
(120)
(121)
(122)
(123)
(124)
(125) β3 is Required for Expansion of Pregnancy-Associated MaSCs
(126) During pregnancy, the proportion of CD29hi MaSCs/basal cells increases dramatically compared to CD29.sup.lo luminal cells (
(127) This defect in CD29.sup.hi cell expansion suggests that β3 deletion may result in fewer repopulating cells at midpregnancy. To address this, we performed limiting dilution mammary gland-transplantation assays with CD29.sup.hi cells from WT and β3KO P12.5 mammary glands. Results from these experiments showed decreased repopulating frequency in β3KO CD29.sup.hi cells that corresponded to a 3.6-fold decrease in the absolute number of MaSCs relative to WT mice (
(128)
(129)
(130)
(131)
(132) For
(133)
(134) β3 Signaling is Required for MaSC Clonogenicity During Pregnancy
(135) Decreased MaSC expansion in pregnant β3KO mice suggests a possible defect in MaSC clonogenicity. To evaluate this role for β3, we examined mammary cells from virgin or P12.5 WT or β3KO mice for colony formation on irradiated mouse embryonic fibroblasts (MEFs). In order to preserve the luminal-basal cross-talk present in the intact mammary gland, we used total mammary cells for these experiments. In this assay, MaSCs and progenitor cells form colonies that can be distinguished based on morphology (Stingl, 2009) (
(136) However, loss of β3 significantly decreased the frequency of MaSCs and basal colonies at P12.5 compared to WT mice (
(137) In addition to their role as cell-adhesion receptors, integrins activate important signaling pathways influencing a diverse array of cell behaviors, including proliferation, survival, and migration. To examine a role for β3 signaling in MaSC/progenitor, behavior, we analyzed knock-in mice expressing a signaling-deficient β3 mutant lacking only the last three amino acids of the β3 cytoplasmic domain (b3DC) (Ablooglu et al., 2009). This mutant prevents the interaction with c-Src and other signaling proteins (Arias-Salgado et al., 2003), resulting in deficient b3 signaling, but does not influence ligand binding (Ablooglu et al., 2009; Arias-Salgado et al., 2003; Desgrosellier et al., 2009). Importantly, previous studies showed that cells from b3DC knockin mice express similar levels of β3 protein compared to those from WT mice, and the β3DC mutant forms functional integrin αvβ3 heterodimers capable of mediating adhesion to β3 substrates (Ablooglu et al., 2009), which we validated in P12.5 mammary glands.
(138) Similar to the β3KO (
(139)
(140)
(141)
(142)
(143)
(144)
(145) For
(146) TGF-b2 Stimulates b3 Expression, Enhancing MaSC Clonogenicity
(147) Although hormones like progesterone have been shown to increase β3 expression in MaSCs/basal cells of ovariectomized mice (Joshi et al., 2010), this is unlikely to be a direct effect because MaSCs lack steroid hormone receptors (Asselin-Labat et al., 2006). Therefore, to investigate the factors that may account for β3 expression in MaSCs during pregnancy, we evaluated several paracrine factors associated with pregnancy, such as transforming growth factor β (TGF-β) family members and receptor activator of nuclear factor kB ligand (RANKL). Importantly, both RANKL and TGF-β ligands are increased during pregnancy (Asselin-Labat et al., 2010; Fata et al., 2000; Monks, 2007; Robinson et al., 1991), and both pathways affect development of the pregnant mammary gland (Fata et al., 2000; Gorska et al., 2003). Furthermore, RANKL and TGF-b ligands are known to regulate β3 expression in other systems (Galliher and Schiemann, 2006; Lacey et al., 1998).
(148) To examine the ability of these factors to increase β3 expression, we stimulated cells from virgin WT mice and measured β3 expression in MaSCs/basal cells, defined by expression of K14 and SMA. Unexpectedly, we found that TGF-β2, but not TGF-β1 or RANKL, stimulated β3 expression in MaSCs/basal cells relative to vehicle-treated cells (
(149) Similar effects were observed in human mammary epithelial cells (HMECs), including MCF10As where TGF-β2 was a potent driver of (3 expression (
(150) However, SMADs commonly exert their transcriptional effects through interacting with SP1 (Feng et al., 2000; Jungert et al., 2006; Poncelet and Schnaper, 2001), which has previously been shown to directly bind the β3 promoter (Evellin et al., 2013). Accordingly, knockdown of SP1 potently blocked TGF-b2-induced b3 mRNA and protein expression (
(151) The ability of TGF-b2 to drive β3 expression suggested that this ligand may affect MaSC clonogenicity in a β3-dependent manner. Compared to vehicle, only TGF-β2 increased the frequency of bipotent, MaSC-like colonies grown on irradiated MEFs (
(152)
(153)
(154)
(155)
(156)
(157)
(158) For
(159) b3 Mediates Slug Activation in Response to TGF-b2 and Pregnancy
(160) The bipotent MaSC-like colonies observed in response to TGF-β2 possess morphological characteristics reminiscent of an epithelial-mesenchymal transformation (EMT) (
(161) Although TGF-β2 induced similar effects on EMT marker protein expression in WT, but not b3KO 2D colonies from virgin mice, no such changes in mRNA expression were noted in sorted CD29hi or CD29lo cells. Thus, TGF-b2-stimulated changes in colony morphology (
(162) Despite the apparent absence of an effect on EMT, Slug protein levels were consistently reduced in TGF-β2-stimulated β3KO 2D colonies compared to WT, specifically in the K14+SMA+ MaSCs/basal cells. Slug was recently characterized as a determinant of the MaSC fate in the virgin mammary gland (Guo et al., 2012) and is expressed during early to midpregnancy but is negatively regulated by Elf5 during late stage pregnancy/lactation, allowing for alveolar maturation (Chakrabarti et al., 2012). Therefore, we considered whether β3 was required for TGF-β2-mediated Slug expression in MaSCs/basal cells. In virgin WT mammary cells, TGF-β2 induced nuclear Slug expression specifically in K14+SMA+ cells compared to cells treated with a vehicle control (
(163) Given that TGF-β2 expression is induced during pregnancy (Robinson et al., 1991), we hypothesized that β3 may similarly regulate Slug expression in the pregnant mammary gland. Compared to WT glands, we observed dramatically reduced levels of nuclear Slug in the K14+ basal cells of P12.5 β3KO mice (
(164) To determine the potential mechanism by which αvβ3 regulates Slug, we considered whether αvβ3 signaling may be required by assessing whether the b3DC mutant affects Slug expression. Whereas TGF-β2 induced Slug in K14+SMA+ mammary cells from virgin WT mice, no increase was observed in cells from β3DC knockin mice (
(165) Interestingly, treatment with an αvβ3 function-blocking antibody (LM609) failed to affect SFK activation or Slug expression, suggesting that this role for αvβ3 may be ligand independent. The absence of an effect on Slug mRNA suggested that αvβ3 may regulate Slug protein through an alternative mechanism. Indeed, Slug protein levels are highly regulated through degradation by the proteasome (Kim et al. 2012; Wu et al., 2012). We found that short-term incubation with a proteasome inhibitor (MG132) was sufficient to restore Slug protein levels to normal in b3 knockdown cells with little effect on Slug levels in control cells (
(166)
(167)
(168)
(169)
(170)
(171)
(172)
(173)
(174) For
(175) αvβ3 is Associated with Slug Activation and Stemness in Human Breast Cancer Cells
(176) Previous studies showed that Slug promotes properties associated with both MaSCs and aggressive stem-like breast cancer cells (Guo et al., 2012; Proia et al., 2011). Our observation that αvβ3 regulates Slug in pregnancy-associated MaSCs prompted us to investigate whether a similar relationship exists in human breast cancer cells. Indeed, using gain- and loss-of-function approaches (
(177) Notably, even unligated αvβ3 was capable of driving Slug expression, as assessed with a b3 mutant deficient in ligand binding (b3 D119A) (Desgrosellier et al., 2009). This is consistent with the inability of αvβ3 antagonists to inhibit Slug expression in nontransformed cells and suggests a ligand-independent role for αvβ3.
(178) Additionally, the b3DC mutant was defective in Slug expression compared to full-length b3 (
(179) These findings demonstrate that αvβ3 promotes stem-like properties in tumor cells, which we assessed by tumorsphere formation in vitro and limiting dilution tumor-initiation experiments in vivo. Consistent with the role of unligated αvβ3 in promoting Slug expression, stable b3 knockdown in triple-negative BT-20 and MDA-MB-231 (HM) cells resulted in fewer anchorage-independent tumorspheres relative to controls (
(180) Additionally, b3 knockdown in MDAMB-231 (HM) cells reduced the number of tumor-initiating cells compared to control when injected orthotopically into adult female mice at limiting dilution (
(181)
(182)
(183)
(184)
(185)
(186)
(187)
(188) For
(189)
DISCUSSION
(190) Integrin αvβ3 is found in some of the most aggressive tumor cells in a diverse array of carcinomas including breast cancer, where it is associated with enhanced tumorigenicity and metastasis (Desgrosellier et al., 2009; Felding-Habermann et al., 2001; Liapis et al., 1996; Sloan et al., 2006; Takayama et al., 2005), yet it is unclear if this is related to a role in epithelial stem/progenitor cells. We now show that αvβ3 plays a specific role in driving MaSC expansion during pregnancy. Genetic deletion of the integrin b3 subunit, or expression of a signaling-deficient form of this receptor, resulted in defective mammary gland development during pregnancy with no effect on ductal morphogenesis in the virgin gland. This phenotype was associated with increased expression of b3 in the MaSC-enriched pool at midpregnancy, an effect reproduced by stimulation with TGF-b2 (
(191) Distinct MaSC/progenitor populations contribute to the development, maintenance, and remodeling of the adult mammary gland (Asselin-Labat et al., 2010; Spike et al., 2012; Van Keymeulen et al., 2011; Wagner et al., 2002). Adult MaSC behavior is highly sensitive to steroid hormones released during the estrus cycle and pregnancy (Asselin-Labat et al., 2007, 2010; Joshi et al., 2010), and these pregnancy-induced MaSCs possess distinct properties compared to MaSCs in the virgin gland, such as more limited self-renewal (Asselin-Labat et al., 2010). Additionally, some MaSCs/progenitors are retained post-pregnancy in the parous gland where they represent a functionally distinct population of parity-induced cells (Matulka et al., 2007). We observed that b3 levels associated with MaSCs during pregnancy were transient, diminishing to levels found in virgin mice after involution. Thus, b3-expressing MaSCs are unlikely to represent parity-induced cells. Instead, our findings characterize integrin αvβ3 as a critical determinant of the MaSC state during midpregnancy, and a requirement for αvβ3 serves to distinguish these cells from MaSCs required for maintenance in the virgin gland.
(192) To our surprise, b3 was not required for luminal progenitor cell function despite characterization of b3 as a surface marker of luminal progenitor cells in the virgin mammary gland (Asselin-Labat et al., 2007). Although our findings show that b3 enriches for luminal progenitors in the virgin gland, consistent with others (Asselin-Labat et al., 2007), genetic deletion of b3 had no effect on luminal progenitor cell clonogenicity or ductal morphogenesis. This is consistent with other reports where genetic deletion of b3 had no effect on ductal morphogenesis in virgin adult murine mammary glands (Taverna et al., 2005). Thus, a potential role for αvβ3 in tumor cell clonogenicity may be linked to its expression on MaSCs during pregnancy rather than on luminal progenitors.
(193) The steroid hormone progesterone is critical for mammary gland remodeling during pregnancy and regulates b3 expression in MaSCs (Joshi et al., 2010). However, MaSCs lack the progesterone receptor (Asselin-Labat et al., 2006), suggesting that progesterone regulates MaSCs indirectly through stimulating release of paracrine factors such as TGF-b and RANKL during pregnancy (Asselin-Labat et al., 2010; Fata et al., 2000; Monks, 2007; Robinson et al., 1991). We show that the TGF-b family member TGF-b2, and not TGF-b1 or RANKL, drives b3 expression in MaSCs/basal cells enhancing MaSC clonogenicity. Similar to our observations regarding b3 expression and function during pregnancy, progesterone and TGF-b family members are critically expressed early in pregnancy and are reduced in late pregnancy, allowing lobular maturation (Gorska et al., 2003; Jhappan et al., 1993; Monks, 2007; Robinson et al., 1991). Thus, integrin αvβ3 may function as a key molecular switch downstream of progesterone-TGF-b signaling that promotes the activation of the MaSC pool during early pregnancy and is reduced in late pregnancy allowing for alveolar secretory maturation most aggressive breast cancers due to frequent metastasis (Schedin, 2006). Interestingly, recent studies have shown that pregnancy is a major regulator of MaSC number and function, suggesting a relationship between MaSCs and pregnancy-associated breast cancers (Asselin-Labat et al., 2010). Accordingly, some proteins that regulate MaSCs during pregnancy also have important functions in aggressive breast tumors (Gonzalez-Suarez et al., 2010; Schramek et al., 2010).
(194) Our findings reveal a specific role for integrin αvβ3 in regulating Slug expression and MaSC expansion during pregnancy. In breast cancer cells, αvβ3 also appears to be necessary and sufficient for Slug activity, anchorage-independent growth, and tumor initiation, properties of stem-like cancer cells (
(195) Experimental Procedures
(196) Histological Analysis, Immunohistochemistry, and Immunofluorescence
(197) For immunohistochemical staining of formalin-fixed paraffin-embedded tissues, antigen retrieval was performed in citrate buffer at pH 6.0 and 95° C. for 20 min. Sections were blocked in normal goat serum diluted in PBS, incubated overnight at 4° C. in primary antibody, followed by biotin-conjugated anti-rabbit immunoglobulin G and an avidin-biotin peroxidase detection system with 3,30-diaminobenzidine substrate (Vector Laboratories), then counterstained with hematoxylin. Whole-mount mouse mammary glands were fixed in Carnoy's solution and stained with carmine. For quantitation of duct/alveoli density, three to four images were randomly sampled from H&E-stained paraffin sections from each mouse with a 43 objective and analyzed with MetaMorph software. For immunofluorescence, frozen sections or fixed cells were blocked with normal goat serum in PBS and incubated in primary antibody overnight at 4° C. followed by secondary at room temperature for 1 hr.
(198) Lysates and Immunoblotting
(199) Whole-mammary gland lysates were prepared by pulverizing glands flash frozen in liquid nitrogen with a mortar and pestle and then lysing the tissue with radio-immunoprecipitation assay lysis buffer (RIPA) lysis buffer. The lysate was further processed with a handheld tissue homogenizer and cleared. Whole-cell lysates were prepared from cell lines with RIPA lysis buffer combined with scraping. Standard western blotting procedures were performed.
(200) Flow Cytometry and Mammary Outgrowth Assays
(201) Single-cell suspensions were prepared and stained with antibodies as described in detail in Supplemental Experimental Procedures. Cell sorting was performed using a FACSDiva or FACSAria (BD Biosciences). For outgrowth experiments, sorted cells were injected into the cleared abdominal fat pads of 3-week-old syngeneic recipients. Estimated repopulating cell frequencies were calculated using the ELDA web-based tool (Hu and Smyth, 2009). All experiments involving mice were conducted under protocols approved by the UCSD animal subjects committee and are in accordance with the guidelines set forth in the NIH Guide for the Care and Use of Laboratory Animals.
(202) Mammary Colony Assays
(203) For colony formation on irradiated MEFs, 100,000 MEFs were seeded into 6-well dishes for 48 hr prior to adding 40,000 cells from digested mammary glands and grown in complete Dulbecco's modified Eagle's medium (DMEM). Colonies formed over 5-6 days before fixing and staining with either 0.1% crystal violet/20% methanol/PBS or 2% paraformaldehyde/PBS for immunofluorescent staining and counting colonies. For Matrigel colonies, 5,000 fluorescence-activated cell sorting (FACS) mammary gland cells were suspended in 50 ml growth factor-reduced Matrigel (BD PharMingen) and grown 14 days in serum-free mammary epithelial cell medium-basal medium (Cambrex) supplemented with B27 supplement, 20 ng/ml epidermal growth factor, 20 ng/ml basal fibroblast growth factor, 4 mg/ml heparin, 100 U/ml penicillin, and 100 mg/ml streptomycin. Total colonies per well were counted from each of the four replicates per experiment.
(204) Growth Factor and Inhibitor Experiments
(205) Cells from digested mammary glands were seeded at 40,000 cells per well onto MEFs (for colony-formation assays) or 8-well chamber slides (Lab-Tek) coated with 2% Matrigel/DMEM. At the time of seeding, cells were suspended in complete DMEM supplemented with vehicle (0.1% BSA/PBS), RANKL (50 ng/ml), TGF-b1 (5 ng/ml), or TGF-b2 (5 ng/ml) (PeproTech). Cells were fixed with 2% paraformaldehyde/PBS after 48 hr (chamber slides) or 5 days (colonies) for immunofluorescent staining.
(206) For experiments with MCF10A and HMECs, TGF-b2 stimulations were performed with 5 ng/ml TGF-b2 (PeproTech) or 0.1% BSA/PBS (vehicle) for 48 hr prior to lysis. In some experiments, 30 mg/ml of the anti-αvβ3 function-blocking antibody LM609 (Millipore) was added to cells at the same time as TGF-b2 or vehicle addition. For the proteasome inhibitor experiments, 10 mM MG132 (Sigma-Aldrich) or DMSO (vehicle) was added to transfected MCF10A cells 5 hr prior to lysis. Treatment of MCF10A cells with the SFK inhibitor dasatinib (ChemieTek) or DMSO (vehicle) was performed with 100 nM dasatinib for the indicated times prior to harvesting lysates.
(207) Orthotopic Breast Cancer
(208) Tumors were generated by injection of MDA-MB-231 (HM) cells expressing nonsilencing or b3 shRNA at limiting dilution (in 50 ml sterile PBS) into the inguinal fat pads of adult (12 weeks) female nonobese diabetic/severe combined immunodeficiency/interleukin-2 receptor g chain knockout mice. Mice were monitored weekly for tumor formation by gentle palpation. Primary tumor mass was determined by assessing the wet weight of the resected tumors. All tumors formed within 5 weeks, and all tumor-bearing mice were harvested at 6 weeks. Tumor-free mice were harvested at 13 weeks, and the absence of any detectable tumor was confirmed by whole-mount staining.
(209) Statistical Analyses
(210) Data presentation and statistical tests are indicated in the figure legends. For all analyses, p<0.05 was considered statistically significant.
REFERENCES
(211) Ablooglu, A. J., Kang, J., Petrich, B. G., Ginsberg, M. H., and Shattil, S. J. (2009). Antithrombotic effects of targeting alphaIIbbeta3 signaling in platelets. Blood 113, 3585-3592. Al-Hajj, M., Wicha, M. S., Benito-Hernandez, A., Morrison, S. J., and Clarke, M. F. (2003). Prospective identification of tumorigenic breast cancer cells. Proc. Natl. Acad. Sci. USA 100, 3983-3988. Arias-Salgado, E. G., Lizano, S., Sarkar, S., Brugge, J. S., Ginsberg, M. H., and Shattil, S. J. (2003). Src kinase activation by direct interaction with the integrin beta cytoplasmic domain. Proc. Natl. Acad. Sci. USA 100, 13298-13302. Asselin-Labat, M. L., Shackleton, M., Stingl, J., Vaillant, F., Forrest, N. C., Eaves, C. J., Visvader, J. E., and Lindeman, G. J. (2006). Steroid hormone receptor status of mouse mammary stem cells. J. Natl. Cancer Inst. 98, 1011-1014. Asselin-Labat, M. L., Sutherland, K. D., Barker, H., Thomas, R., Shackleton, M., Forrest, N. C., Hartley, L., Robb, L., Grosveld, F. G., van der Wees, J., et al. (2007). Gata-3 is an essential regulator of mammary-gland morphogenesis and luminal-cell differentiation. Nat. Cell Biol. 9, 201-209. Asselin-Labat, M. L., Vaillant, F., Sheridan, J. M., Pal, B., Wu, D., Simpson, E. R., Yasuda, H., Smyth, G. K., Martin, T. J., Lindeman, G. J., and Visvader, J. E. (2010). Control of mammary stem cell function by steroid hormone signalling. Nature 465, 798-802. Bai, L., and Rohrschneider, L. R. (2010). s-SHIP promoter expression marks activated stem cells in developing mouse mammary tissue. Genes Dev. 24, 1882-1892. Bruno, R. D., and Smith, G. H. (2011). Functional characterization of stem cell activity in the mouse mammary gland. Stem Cell Rev. 7, 238-247. Chakrabarti, R., Hwang, J., Andres Blanco, M., Wei, Y., Luka_ci_sin, M., Romano, R. A., Smalley, K., Liu, S., Yang, Q., Ibrahim, T., et al. (2012). Elf5 inhibits the epithelial-mesenchymal transition in mammary gland development and breast cancer metastasis by transcriptionally repressing Snai12. Nat. Cell Biol. 14, 1212-1222. Desgrosellier, J. S., and Cheresh, D. A. (2010). Integrins in cancer: biological implications and therapeutic opportunities. Nat. Rev. Cancer 10, 9-22. Desgrosellier, J. S., Barnes, L. A., Shields, D. J., Huang, M., Lau, S. K., Pre' vost, N., Tarin, D., Shattil, S. J., and Cheresh, D. A. (2009). An integrin alpha(v)beta(3) c-Src oncogenic unit promotes anchorage-independence and tumor progression. Nat. Med. 15, 1163-1169. Evellin, S., Galvagni, F., Zippo, A., Neri, F., Orlandini, M., Incarnato, D., Dettori, D., Neubauer, S., Kessler, H., Wagner, E. F., and Oliviero, S. (2013). FOSL1 controls the assembly of endothelial cells into capillary tubes by direct repression of αv and β3 integrin transcription. Mol. Cell. Biol. 33, 1198-1209. Fata, J. E., Kong, Y. Y., Li, J., Sasaki, T., Irie-Sasaki, J., Moorehead, R. A., Elliott, R., Scully, S., Voura, E. B., Lacey, D. L., et al. (2000). The osteoclast differentiation factor osteoprotegerin-ligand is essential for mammary gland development. Cell 103, 41-50. Felding-Habermann, B., O'Toole, T. E., Smith, J. W., Fransvea, E., Ruggeri, Z. M., Ginsberg, M. H., Hughes, P. E., Pampori, N., Shattil, S. J., Saven, A., and Mueller, B. M. (2001). Integrin activation controls metastasis in human breast cancer. Proc. Natl. Acad. Sci. USA 98, 1853-1858. Feng, X. H., Lin, X., and Derynck, R. (2000). Smad2, Smad3 and Smad4 cooperate with Sp1 to induce p15(Ink4B) transcription in response to TGF-beta. EMBO J. 19, 5178-5193. Galliher, A. J., and Schiemann, W. P. (2006). Beta3 integrin and Src facilitate transforming growth factor-beta mediated induction of epithelial-mesenchymal transition in mammary epithelial cells. Breast Cancer Res. 8, R42. Gonzalez-Suarez, E., Jacob, A. P., Jones, J., Miller, R., Roudier-Meyer, M. P., Erwert, R., Pinkas, J., Branstetter, D., and Dougall, W. C. (2010). RANK ligand mediates progestin-induced mammary epithelial proliferation and carcinogenesis. Nature 468, 103-107. Gorska, A. E., Jensen, R. A., Shyr, Y., Aakre, M. E., Bhowmick, N. A., and Moses, H. L. (2003). Transgenic mice expressing a dominant-negative mutant type II transforming growth factor-beta receptor exhibit impaired mammary development and enhanced mammary tumor formation. Am. J. Pathol. 163, 1539-1549. Guo, W., Keckesova, Z., Donaher, J. L., Shibue, T., Tischler, V., Reinhardt, F., Itzkovitz, S., Noske, A., Zu″ rrer-Ha″ rdi, U., Bell, G., et al. (2012). Slug and Sox9 cooperatively determine the mammary stem cell state. Cell 148, 1015-1028. Hu, Y., and Smyth, G. K. (2009). ELDA: extreme limiting dilution analysis for comparing depleted and enriched populations in stem cell and other assays. J. Immunol. Methods 347, 70-78. Jeselsohn, R., Brown, N. E., Arendt, L., Klebba, I., Hu, M. G., Kuperwasser, C., and Hinds, P. W. (2010). Cyclin D1 kinase activity is required for the selfrenewal of mammary stem and progenitor cells that are targets of MMTVErbB2 tumorigenesis. Cancer Cell 17, 65-76. Jhappan, C., Geiser, A. G., Kordon, E. C., Bagheri, D., Hennighausen, L., Roberts, A. B., Smith, G. H., and Merlino, G. (1993). Targeting expression of a transforming growth factor beta 1 transgene to the pregnant mammary gland inhibits alveolar development and lactation. EMBO J. 12, 1835-1845. Joshi, P. A., Jackson, H. W., Beristain, A. G., Di Grappa, M. A., Mote, P. A., Clarke, C. L., Stingl, J., Waterhouse, P. D., and Khokha, R. (2010). Progesterone induces adult mammary stem cell expansion. Nature 465, 803-807. Jungert, K., Buck, A., Buchholz, M., Wagner, M., Adler, G., Gress, T. M., and Ellenrieder, V. (2006). Smad-Sp1 complexes mediate TGFbeta-induced early transcription of oncogenic Smad7 in pancreatic cancer cells. Carcinogenesis 27, 2392-2401. Katsuno, Y., Lamouille, S., and Derynck, R. (2013). TGF-b signaling and epithelial-mesenchymal transition in cancer progression. Curr. Opin. Oncol. 25, 76-84. Kim, J. Y., Kim, Y. M., Yang, C. H., Cho, S. K., Lee, J. W., and Cho, M. (2012). Functional regulation of Slug/Snail2 is dependent on GSK-3b-mediated phosphorylation. FEBS J. 279, 2929-2939. Lacey, D. L., Timms, E., Tan, H. L., Kelley, M. J., Dunstan, C. R., Burgess, T., Elliott, R., Colombero, A., Elliott, G., Scully, S., et al. (1998). Osteoprotegerin ligand is a cytokine that regulates osteoclast differentiation and activation. Cell 93, 165-176. Liapis, H., Flath, A., and Kitazawa, S. (1996). Integrin alpha V beta 3 expression by bone-residing breast cancer metastases. Diagn. Mol. Pathol. 5, 127-135. Lim, E., Vaillant, F., Wu, D., Forrest, N. C., Pal, B., Hart, A. H., Asselin-Labat, M. L., Gyorki, D. E., Ward, T., Partanen, A., et al.; kConFab (2009). Aberrant luminal progenitors as the candidate target population for basal tumor development in BRCA1 mutation carriers. Nat. Med. 15, 907-913. Lim, E., Wu, D., Pal, B., Bouras, T., Asselin-Labat, M. L., Vaillant, F., Yagita, H., Lindeman, G. J., Smyth, G. K., and Visvader, J. E. (2010). Transcriptome analyses of mouse and human mammary cell subpopulations reveal multiple conserved genes and pathways. Breast Cancer Res. 12, R21. Matulka, L. A., Triplett, A. A., and Wagner, K. U. (2007). Parity-induced mammary epithelial cells are multipotent and express cell surface markers associated with stem cells. Dev. Biol. 303, 29-44. Monks, J. (2007). TGFbeta as a potential mediator of progesterone action in the mammary gland of pregnancy. J. Mammary Gland Biol. Neoplasia 12, 249-257. Moustakas, A., and Heldin, C. H. (2007). Signaling networks guiding epithelial-mesenchymal transitions during embryogenesis and cancer progression. Cancer Sci. 98, 1512-1520. Munoz, R., Man, S., Shaked, Y., Lee, C. R., Wong, J., Francia, G., and Kerbel, R. S. (2006). Highly efficacious nontoxic preclinical treatment for advanced metastatic breast cancer using combination oral UFT-cyclophosphamide metronomic chemotherapy. Cancer Res. 66, 3386-3391. Pece, S., Tosoni, D., Confalonieri, S., Mazzarol, G., Vecchi, M., Ronzoni, S., Bernard, L., Viale, G., Pelicci, P. G., and Di Fiore, P. P. (2010). Biological and molecular heterogeneity of breast cancers correlates with their cancer stem cell content. Cell 140, 62-73. Poncelet, A. C., and Schnaper, H. W. (2001). Sp1 and Smad proteins cooperate to mediate transforming growth factor-beta 1-induced alpha 2(I) collagen expression in human glomerular mesangial cells. J. Biol. Chem. 276, 6983-6992. Proia, T. A., Keller, P. J., Gupta, P. B., Klebba, I., Jones, A. D., Sedic, M., Gilmore, H., Tung, N., Naber, S. P., Schnitt, S., et al. (2011). Genetic predisposition directs breast cancer phenotype by dictating progenitor cell fate. Cell Stem Cell 8, 149-163. Raney, B. J., Cline, M. S., Rosenbloom, K. R., Dreszer, T. R., Learned, K., Barber, G. P., Meyer, L. R., Sloan, C. A., Malladi, V. S., Roskin, K. M., et al. (2011). ENCODE whole-genome data in the UCSC genome browser (2011 update). Nucleic Acids Res. 39, D871-D875. Robinson, S. D., Silberstein, G. B., Roberts, A. B., Flanders, K. C., and Daniel, C. W. (1991). Regulated expression and growth inhibitory effects of transforming growth factor-beta isoforms in mouse mammary gland development. Development 113, 867-878. Schedin, P. (2006). Pregnancy-associated breast cancer and metastasis. Nat. Rev. Cancer 6, 281-291. Schramek, D., Leibbrandt, A., Sigl, V., Kenner, L., Pospisilik, J. A., Lee, H. J., Hanada, R., Joshi, P. A., Aliprantis, A., Glimcher, L., et al. (2010). Osteoclast differentiation factor RANKL controls development of progestin-driven mammary cancer. Nature 468, 98-102. Seguin, L., Kato, S., Franovic, A., Camargo, M. F., Lesperance, J., Elliott, K. C., Yebra, M., Mielgo, A., Lowy, A. M., Husain, H., et al. (2014). An integrin beta(3)-KRAS-RalB complex drives tumour stemness and resistance to EGFR inhibition. Nat. Cell Biol. 16, 457-468. Shackleton, M., Vaillant, F., Simpson, K. J., Stingl, J., Smyth, G. K., Asselin-Labat, M. L., Wu, L., Lindeman, G. J., and Visvader, J. E. (2006). Generation of a functional mammary gland from a single stem cell. Nature 439, 84-88. Sloan, E. K., Pouliot, N., Stanley, K. L., Chia, J., Moseley, J. M., Hards, D. K., and Anderson, R. L. (2006). Tumor-specific expression of αvβ3 integrin promotes spontaneous metastasis of breast cancer to bone. Breast Cancer Res. 8, R20. Smith, G. H., and Medina, D. (2008). Re-evaluation of mammary stem cell biology based on in vivo transplantation. Breast Cancer Res. 10, 203. Spike, B. T., Engle, D. D., Lin, J. C., Cheung, S. K., La, J., and Wahl, G. M. (2012). A mammary stem cell population identified and characterized in late embryogenesis reveals similarities to human breast cancer. Cell Stem Cell 10, 183-197. Stingl, J. (2009). Detection and analysis of mammary gland stem cells. J. Pathol. 217, 229-241. Stingl, J., Eirew, P., Ricketson, I., Shackleton, M., Vaillant, F., Choi, D., Li, H. I., and Eaves, C. J. (2006). Purification and unique properties of mammary epithelial stem cells. Nature 439, 993-997. Taddei, I., Deugnier, M. A., Faraldo, M. M., Petit, V., Bouvard, D., Medina, D., Fassler, R., Thiery, J. P., and Glukhova, M. A. (2008). Beta1 integrin deletion from the basal compartment of the mammary epithelium affects stem cells. Nat. Cell Biol. 10, 716-722. Takayama, S., Ishii, S., Ikeda, T., Masamura, S., Doi, M., and Kitajima, M. (2005). The relationship between bone metastasis from human breast cancer and integrin alpha(v)beta3 expression. Anticancer Res. 25 (1A), 79-83. Taverna, D., Crowley, D., Connolly, M., Bronson, R. T., and Hynes, R. O. (2005). A direct test of potential roles for beta3 and beta5 integrins in growth and metastasis of murine mammary carcinomas. Cancer Res. 65, 10324-10329. Vaillant, F., Asselin-Labat, M. L., Shackleton, M., Forrest, N. C., Lindeman, G. J., and Visvader, J. E. (2008). The mammary progenitor marker CD61/beta3 integrin identifies cancer stem cells in mouse models of mammary tumorigenesis. Cancer Res. 68, 7711-7717. van Amerongen, R., Bowman, A. N., and Nusse, R. (2012). Developmental stage and time dictate the fate of Wnt/b-catenin-responsive stem cells in the mammary gland. Cell Stem Cell 11, 387-400. Van Keymeulen, A., Rocha, A. S., Ousset, M., Beck, B., Bouvencourt, G., Rock, J., Sharma, N., Dekoninck, S., and Blanpain, C. (2011). Distinct stem cells contribute to mammary gland development and maintenance. Nature 479, 189-193. Visvader, J. E. (2009). Keeping abreast of the mammary epithelial hierarchy and breast tumorigenesis. Genes Dev. 23, 2563-2577. Wagner, K. U., Boulanger, C. A., Henry, M. D., Sgagias, M., Hennighausen, L., and Smith, G. H. (2002). An adjunct mammary epithelial cell population in parous females: its role in functional adaptation and tissue renewal. Development 129, 1377-1386. Wu, et al (2012) Canonical Wnt signaling regulates Slug activity and links epithelial-mesenchymal transition with epigenetic Breast Cancer 1, Early Onset (BRCA1) repression. Proc. Natl. Acad. Sci. USA 109, 16654-16659.
(212) A number of exemplary embodiments have been described. Nevertheless, it will be understood that various modifications may be made without departing from the spirit and scope of the invention. Accordingly, other embodiments are within the scope of the following claims.