Medical use of CREG protein
11020450 · 2021-06-01
Assignee
Inventors
- Yaling Han (Shenyang, CN)
- Chenghui Yan (Shenyang, CN)
- Dan Liu (Shenyang, CN)
- Xiaoxiang Tian (Shenyang, CN)
- Yang LI (Shenyang, CN)
- Xiaolin ZHANG (Shenyang, CN)
- Haixu Song (Shenyang, CN)
- Meili Liu (Shenyang, CN)
Cpc classification
A01K2217/077
HUMAN NECESSITIES
G01N2800/324
PHYSICS
G01N2800/325
PHYSICS
A61K48/00
HUMAN NECESSITIES
A61P9/10
HUMAN NECESSITIES
International classification
A61P9/10
HUMAN NECESSITIES
Abstract
The present invention relates to a medical use of Cellular Repressor of E1A-stimulated Genes (CREG), in particular to a use of CREG protein or active fragment thereof in manufacture of a medicament for preventing and/or treating myocardial infarction, a use in manufacture of a medicament for preventing and/or treating ventricular remodeling after myocardial infarction and heart failure after myocardial infarction, a use in manufacture of a medicament for prevention and/or treatment of myocardial ischemia-reperfusion injury, a use in manufacture of a medicament for prevention and/or treatment of salt-sensitive hypertensive myocardial fibrosis.
Claims
1. A method of treatment of acute myocardial infarction; heart failure after acute myocardial infarction; or myocardial ischemia-reperfusion injury, comprising administering to a subject in need thereof an effective amount of a human Cellular Repressor of E1A-stimulated Genes (CREG) protein.
2. The method according to claim 1, wherein the human CREG protein is a glycosylated protein or a non-glycosylated protein.
3. The method according to claim 2, wherein the glycosylated protein is TP301654, wherein the amino acids at positions 160, 193, and 216 of the human CREG protein are glycosylated.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2) (A) General cardiac morphology of wild-type C57BL/6J mice, 7 days (left) and 28 days (right) after AMI;
(3) (B) Masson staining of myocardial tissue in wild-type C57BL/6J mice, 28 days after AMI;
(4) (C) CREG protein expression in myocardial infarction (MI) area and control area (CTL) of wild type C57BL/6J mice after AMI. was detected by Western blot at different time points (1, 3, 5, 7, 14 and 28 days).
(5)
(6) (A) Schematic diagram of CREG.sup.+/− mouse model gene targeting fragments;
(7) (B) Schematic diagram of CREG.sup.+/− mouse model gene targeting vector;
(8) (C) Genotypes of CREG.sup.+/− mice and littermate wild-type CREG.sup.+/+ mice were detected by RT-PCR genotyping method;
(9) (D) CREG protein expression in myocardial tissues of CREG.sup.+/− mice and littermate wild-type CREG.sup.+/+ mice was detected by Western blot;
(10) (E) CREG mRNA expression in myocardial tissues of CREG.sup.+/− mice and littermate wild type CREG.sup.+/+ mice was detected by RT-PCR;
(11) (F) CREG expression in myocardial tissues of CREG.sup.+/− mice and littermate wild type CREG.sup.+/+ mice was detected by Immunofluorescence staining method;
(12)
(13) (A) Survival analysis of CREG.sup.+/− mice at 28 days after AMI surgery;
(14) (B) Evaluation of cardiac systolic function by Small Animal ultrasonography in CREG.sup.+/− mice and littermate wild type CREG.sup.+/+ mice 28 days after AMI;
(15) (C) Evaluation of cardiac morphology and ventricular remodeling by HE staining and Masson staining in CREG.sup.+/− mice and littermate wild type CREG.sup.+/+ mice 28 days after AMI;
(16)
(17) (A) Mice were divided into sham-operation group, group of CREG.sup.+/+ mice (C57BL/6J group) receiving AMI only, groups of CREG.sup.+/+ mice being implanted subcutaneously with glycosylated and non-glycosylated CREG protein (150 μg/kg.Math.d). Survival analysis and death cause analysis in the mice of these groups were performed at 28 days after AMI;
(18) (B) Evaluation of cardiac contractile function performed by Small Animal ultrasonography in the mice of the sham-operation group, the C57BL/6J group, the glycosylated CREG protein group and the non-glycosylated CREG protein group at 28 days after AMI;
(19) (C) Evaluation of general morphology of cardiac tissues by HE staining after AMI in the mice of the sham-operation group, the C57BL/6J group, the glycosylated CREG protein group and the non-glycosylated CREG protein group;
(20) (D) Evaluation of ventricular remodeling by Masson staining at 28 days after AMI in the mice of the sham-operation group, the C57BL/6J group, the glycosylated CREG protein group and the non-glycosylated CREG protein group.
(21)
(22) (A) Without application of myocardial ischemia-reperfusion, CREG gene mRNA expression in myocardium was detected by RT-PCR in CREG.sup.+/+ mice, mice administrated with exogenous CREG protein (reCREG.sup.+/+), and CREG.sup.+/− mice;
(23) (B) Without application of myocardial ischemia-reperfusion, CREG protein expression in myocardium was detected by Western blot in CREG.sup.+/+ mice, reCREG.sup.+/+ mice, and CREG.sup.+/− mice;
(24) (C-D) With application of myocardial ischemia-reperfusion, CREG protein expression levels in myocardium at different time points were detected by Western blot in CREG.sup.+/+ mice, reCREG.sup.+/+ mice, and CREG.sup.+/− mice.
(25)
(26) (A-C) Comparison of cardiac function at 28 days after myocardial ischemia-reperfusion in the mice of three groups by Small Animal ultrasonography. EF refers to left ventricular ejection fraction, FS refers to shortening fraction of left ventricular;
(27) (D-E) Evaluation of myocardial injury at 24 h after myocardial ischemia-reperfusion in the mice of three groups by TTC staining (IS/AAR refers to a ratio of myocardial necrosis area to myocardial ischemia area).
(28)
(29) (A-B) cardiomyocyte apoptosis in the mice of three groups was detected by Tunel staining;
(30) (C-D) Expression of myocardial apoptosis protein cleaved caspase 3 in myocardium was detected by Western blot in the mice of three groups;
(31) (E) Expression of autophagy protein LC3B in myocardium was detected by Immunofluorescence staining in the mice of three groups;
(32) (F) Expression of autophagy protein in myocardium was detected by Western blot in the mice of three groups.
(33)
(34) (A) Expression of autophagy protein LC3B in myocardium was detected by Immunofluorescence staining in the reCREG.sup.+/+ mice and the reCREG.sup.+/+ mice administrated with autophagy inhibitor chloroquine (reCREG.sup.+/++CQ);
(35) (B) Expression of autophagy indicator proteins LC3, P62 and LAMP2 in myocardium of the mice of both groups was detected by Western blot;
(36) (C-D) Myocardial apoptosis was detected by Tunel staining in the mice of both groups after myocardial ischemia-reperfusion;
(37) (E-F) Expression of myocardial apoptosis protein cleaved caspase 3 was detected by Western blot in the mice of both groups.
(38)
(39) (A-C) Establishment of CREG low expression and over-expression models, i.e., transfecting H9C2 cells with siRNA and adenovirus, and detecting the transfection efficiency at RNA and protein levels;
(40) (D-E) Inducing different cell groups by serum-starvation, and detecting expression of apoptosis protein cleaved caspase3 by Western blot;
(41) (F-G) Expression of autophagy indicator proteins detected by Western blot in the above cells.
(42)
(43) (A) Systolic blood pressure, diastolic blood pressure and mean arterial pressure at different time points (1, 2, 3, 4, 5, 6, 7 and 8 weeks) after Dahl salt-sensitive rats being administrated with salt stress;
(44) (B) ratio of heart weight/body weight, ratio of heart weight/tibia length of Dahl salt-sensitive rats at 8 week with salt stress s;
(45) (C) General cardiac morphology and myocardial fibrosis detected by HE and Masson staining at 8 week with salt stress;
(46) (D) Myocardial macrophage infiltration detected by Immunohistochemical staining at different time points (4, 6, 8 weeks) after being administrated with salt stress;
(47) (E) Expression of CD68 protein in myocardial macrophages detected by Western blot at 8 week with salt stress.
(48)
(49) (A) Myocardial CREG protein expression detected by Western blot at different time points (2, 4, 6, 8 weeks) after being administrated with salt stress;
(50) (B) Myocardial CERG expression detected by Immunohistochemistry and immunofluorescence staining at 4 week with salt stress.
(51)
(52) (A) Heart weight/body weight, ratio of heart weight/tibia length at 8 weeks of salt stress in rats of groups (normal salt group, high salt group, high salt+reCREG group) after exogenous supplementation of recombinant CREG protein;
(53) (B) Macrophage infiltration detected by Immunohistochemical staining in rats of groups (normal salt group, high salt group, high salt+reCREG group) after exogenous supplementation of recombinant CREG protein;
(54) (C) General cardiac morphology and myocardial fibrosis detected by HE and Masson staining in rats of groups (normal salt group, high salt group, high salt+reCREG group) after exogenous supplementation of recombinant CREG protein.
(55)
(56) (A) Establishment of CREG low-expression and over-expression cell models, i.e., transfecting primary fibroblasts with siRNA and adenovirus with over-expression of CREG, and detecting transfection efficiency at protein level;
(57) (B) Establishment of CREG low-expression and over-expression models, i.e., transfecting primary fibroblasts with siRNA and adenovirus with over-expression of CREG, and detecting transfection efficiency at mRNA level;
(58) (C) Macrophage infiltration in fibroblasts detected by Transwell assay at CREG low-expression and over-expression group.
SPECIFIC MODEL FOR CARRYING OUT THE INVENTION
(59) The embodiments of the present invention are described in detail below in conjunction with examples. However, those skilled in the art will understand that the following examples are only for illustrating the present invention, and should not be construed as limiting the scope of the present invention. In the examples, for those without specific conditions, conventional conditions or conditions suggested by manufacturers were applied. The used reagents or instruments without being specified with manufacturers are all commercially available conventional products.
(60) The experimental data of the present invention are all percentages. The comparison between two sample rates were subjected to chi-square test, and statistical processing was performed by SPSS 17.0 software package. P<0.05 is statistically significant.
Example 1: Preparation of AMI Model in C57BL/6J Mice and Detection of CREG Expression in Myocardium at Different Time Points after AMI
(61) {circle around (1)} Establishment of AMI model in C57BL/6J MICE
(62) AMI model of mice was established by ligating anterior descending coronary artery. The instruments, materials and medicines were prepared before operation; mice were anesthetized with 3% chloral hydrate (450 mg/kg), and fixed on mouse plate in their supine position. Their tracheas were intubated, and connected with ventilator. Preoperative standard II lead ECG was measured and stored in the computer. The hair at chest operation area was cut off, then the skin, subcutaneous tissue, chest muscle and 3-4 cm of fascia were cut, the chest was opened, and the left anterior descending coronary artery was ligated at ⅓ up position with (6-0) suture. The appearance of height-increased and enlarged QRS wave indicated the successful ligation (S-T segment of ECG might not be necessarily visible), and penicillin in dose of 80 000 U/100 g was intramuscularly administrated after surgery.
(63) Results: According to the above experimental method, AMI model was prepared in mice, and height-increased and enlarged QRS wave appeared in ECG, suggesting AMI model was successfully prepared. The general cardiac morphology of the mice was observed at 7 day and 28 day after AMI, and the heart volume was obviously increased (see
(64) {circle around (2)} Observation of collagen content in myocardium of mice by Masson staining
(65) 1) Tissue pieces were drawn, fixed, embedded in paraffin, sectioned in 5 μm slices and dewaxed;
(66) 2) Washed with tap water and distilled water in order;
(67) 3) The paraffin slices were placed into Bouin's solution overnight;
(68) 4) Rinsed with water for 2-3 h, until the yellow disappeared completely;
(69) 5) Stained nucleus with Weigert iron hematoxylin solution for 20 min;
(70) 6) Rinsed with water for 30 seconds, differentiated with 1% ethanol hydrochloride;
(71) 7) Rinsed with water for 30 seconds, and returned back to blue with 0.2% ammonia;
(72) 8) Stained with Biebrich-Sdarlet-Acid for 15 min;
(73) 9) Rinsed with water for 30 seconds, stained with phosphoric acid solution for 2 min;
(74) 10) Shaken to remove phosphoric acid, without washing, directly stained with aniline blue liquid for 15 min;
(75) 11) Rinsed with water for 30 seconds, absolute ethanol for 10 seconds, absolute ethanol for 5 min;
(76) 12) Transparentized with xylene, mounted and fixed with neutral gum.
(77) The results showed that the collagen content in myocardium in C57BL/6J mice increased obviously at 28 days after AMI, which indicated that myocardial fibrosis occurred and ventricular remodeling appeared in the mice (see:
(78) {circle around (3)} Western blot was used to detect the expression of CREG in myocardium in C57BL/6J mice at different time points after AMI.
(79) In order to detect the CREG expression in myocardium of the mice, the proteins of myocardial necrosis zone, marginal zone and contralateral zone were extracted respectively, and the expression of CREG protein was detected by Western blot. BCA colorimetric kit was used to determine the protein concentration. After 50 μs of protein was boiled at 95° C. for 5 min, SDS-PAGE electrophoresis was performed on 12% separation gel to determine the termination time of electrophoresis. The sample was transferred to a cellulose membrane at a current of 350 mA for 45 min; after being blocked with 5% non-fat dry milk in TBS-T for 1.5 h at room temperature, the primary antibody was added and incubated overnight at 4° C. Respectively, 1:1000 anti-CREG antibody (Abcam, USA) and 1:1000 anti-beta-actin (Santa Cruz, USA) antibody were used as primary antibodies, goat-anti-mouse antibody labeled with horseradish peroxidase (Cell Signalling company, USA) was used as secondary antibody, Western blot detection was performed using ECL kit (Amersham, USA) for light-emitting development. Protein bands of about 24 KD and 43 KD in size were detected with CREG antibody and beta-actin antibody, respectively.
(80) The results showed that the expression of CREG in myocardium of C57BL/6J mice was decreased rapidly in the early period (within 1 day) after AMI, and then gradually recovered, but did not return to the normal level at the later period of AMI (after 28 days) (see:
Example 2: Establishment of CREG Heterozygote (CREG.SUP.+/−.) Model in Mice with Low Expression of CREG, and CREG Expression Decreased in Myocardial Tissue of CREG.SUP.+/− Mice
(81) {circle around (1)} CREG.sup.+/− mice preparation and genotyping.
(82) CREG.sup.+/− knockout mice were established through the Shanghai Southern Model Animal Center. Methods: 2-3 exons of mouse CREG1 gene (Ensembl Gene ID: ENSMUSG000000111432) were deleted to cause mutation of CREG gene, resulting in the early termination of protein translation. Neo element was inserted between intron 1-2 and intron 3-4 (see
(83) 1) 5′ arm PCR identification: P1 Creg1-5P112-ATGTGCACAGTCATGGTTCTCC (SEQ ID NO: 1), P2 neo reverse-GGCCTACCCGCTTCCATTGCTC (SEQ ID NO: 2); amplification position was plasmid 17919-17940, fragment length was 3531 bp. PCR reaction conditions: 95° C. 4 min, 94° C. 45 s, 63.6° C. 210 s, 72° C. 10 min, 34 cycles.
(84) 2) 3′ arm PCR identification: P3 neo-Lh-CCGTGCCTTCCTTGACCCTGG (SEQ ID NO: 3), P4 Creg1-3P216-GATGAACCTGGCGTCCAGCAC (SEQ ID NO: 4); amplification position was plasmid 23090-23110, fragment length was 1378 bp. PCR reaction conditions: 95° C. 4 min, 94° C. 45 s, 65.9° C. 330 s, 72° C. 10 min, 34 cycles.
(85) PCR Reaction System: (25 μl)
(86) TABLE-US-00001 Reagent Volume (μl) ddH.sub.2O 16.0 10xBuffer 2.5 dNTP 4.0 P1 or P3 0.5 P2 or P4 0.5 DNA* 1.0 LaTaq 0.5
(87) The results showed that all of the presently born mice were CREG.sup.+/− mice and CREG.sup.+/+ wild type mice (i.e, littermate control group), and without CREG homozygous gene deletion mice (CREG.sup.−/−), which suggested that CREG gene might play a very important role in mouse embryonic development (see
(88) {circle around (2)} Compared with the littermate control group, the CREG expression in myocardium of CREG.sup.+/− mice was significantly reduced.
(89) Western blot, RT-PCR and tissue immunofluorescence staining methods were used to detect the expression of CREG in myocardium of CREG.sup.+/− mice and the littermate CREG.sup.+/+ wild-type mice, respectively.
(90) 1) CREG protein expression levels was detected by Western blot method in myocardium of the mice of the littermate control group and the CREG.sup.+/− mice
(91) The specific method was the same as in Example 1.
(92) The results showed that the CREG protein expression level in myocardium of the CREG.sup.+/− mice was significantly decreased in comparison with the mice of the littermate control group (see:
(93) 2) CREG mRNA levels in myocardium of the CREG.sup.+/− mice and the littermate CREG.sup.+/+ wild-type mice was detected by RT-PCR
(94) a. Design of mouse CREG RT-PCR primer: the mouse CREG mRNA sequence (NM_011804.2) was queried in GenBank, and the mouse CREG gene RT-PCR primer was designed using the Primer Premier5.0 software and sent to and synthesized in Shanghai Sangon Biotech. The primer sequences were as follows:
(95) TABLE-US-00002 CREG upstream GAGGAAGAGAGGTGCAGGTG primer (SEQ ID NO: 5) CREG downstream CATTGCTGTCCTCGACTGAA primer (SEQ ID NO: 6) GAPDH upstream AGAAGGCTGGGGCTCATTTG primer (SEQ ID NO: 7) GAPDH downstream AGGGGCCATCCACAGTCTTC primer (SEQ ID NO: 8)
(96) b. Trizol extraction of total RNA from mouse myocardium: The myocardial tissue was lyophilized and pulverized in 100 cm mortar by adding liquid nitrogen, 1 mL of Trizol lysis buffer was added and stood at room temperature for 5 min; 200 μl of chloroform was added, mixed thoroughly, and stood at room temperature for 10 min; centrifugation at 12000 rpm/s for 10 min at 4° C. was performed, the supernatant was transferred to a clean centrifuge tube; 200 μl of isopropanol was added to the supernatant and mixed thoroughly; centrifugation at 12000 rpm/s for 10 min at 4° C. was performed, the supernatant was discarded; 1 ml of 75% ethanol was added to suspend deposit; centrifugation at 12000 rpm/s for 10 min at 4° C. was performed, the supernatant was discarded; 50 μl of RNase-Free deionized water was added to dissolve the deposit. After that, spectrophotometer and 1% agarose gel electrophoresis were used to detect RNA concentration, purity and integrity.
(97) c. RT-PCR reaction: Total RNA extracted from mouse myocardium was reverse transcribed into cDNA (using cDNA first-strand synthesis kit of TakaRa; amplification conditions: 37° C. for 15 min, 85° C. for 5 s), and the mouse CREG coding sequence was amplified by the following reaction system and reaction conditions, and the fragment length was 250 bp.
(98) Specific Reaction System and Conditions:
(99) TABLE-US-00003 Reagents Volume (μl) ddH.sub.2O 9.5 2 × Taq Master Mix 12.5 Upstream primer 1 Downstream primer 1 cDNA template 1 LaTaq 0.5
(100) Reaction conditions: 95° C., 3 min, 94° C., 30 s; 59° C., 30 s; 72° C., 1 min, 30 cycles, 72° C., 10 min.
(101) The amplified products were separated and detected by 2% agarose gel electrophoresis, and the images were stored by gel imager.
(102) The results showed the CREG mRNA level in myocardium of the CREG.sup.+/− mice showed a significant decrease in comparison with the mice of the littermate control group (see:
(103) 3) Expression of CREG in myocardium of the mice of the littermate control group and the CREG.sup.+/− mice was detected by tissue immunofluorescence staining method
(104) a. The freshly harvested mouse heart tissue was embedded in a frozen embedding material and frozen sectioned, with a thickness of 5 μm;
(105) b. Fixed with 4% paraformaldehyde at room temperature for 20-30 min;
(106) c. Sealed with goat serum at room temperature for 30 min;
(107) d. Added with 1:100 anti-CREG antibody (Abcam, USA) and 1:100 anti-Troponin I (TNI) antibody (cardiomyocyte marker, Abcam, USA), placed in a wet box and stood at 4° C. overnight;
(108) e. Washed with PBS three times, each 10 min;
(109) f. Added with fluorescent labeled secondary antibody (1:100), and incubated at room temperature for 2 h in dark;
(110) g. Washed with PBS three times, each 10 min;
(111) h. Nuclei were stained with DAPI;
(112) i. Mounted with 95% glycerol.
(113) The results showed that in comparison with the mice of the littermate control group, the CREG expression in myocardium decreased significantly in the CREG.sup.+/− mice (the results were shown in
Example 3: In Comparison with the Mice of the Littermate Control Group, the CREG.SUP.+/− Mice after AMI Showed a Significant Increase in Mortality, Significant Deterioration of Cardiac Contractile Function and Increased Ventricular Remodeling
(114) {circle around (1)} Establishment of AMI model in CREG.sup.+/− mice and littermate control group was same as in Example 1.
(115) {circle around (2)} Survival analysis after AMI in the CREG.sup.+/− mice and the mice of the littermate control group.
(116) After AMI in mice, the number of dead mice was observed and recorded daily until the 28th day, and the survival curve was drawn.
(117) The results showed a significant increase in mortality with 28 days after AMI in the CREG.sup.+/− mice compared to the mice of the littermate control group (see
(118) {circle around (3)} Evaluation of cardiac systolic function in mice by small animal ultrasonography
(119) The mice were anesthetized with isoflurane and the cardiac contractile function was measured with a Vevo2100 type small animal cardiac ultrasonographer. ECG, respiration and other physiological parameters of mice were simultaneously recorded, the heart rate was maintained at about 450 beats/min and the heart rate was stabilized for 1 min, then a coupling agent was coated on chest for ultrasonography. Line M-type ultrasound and acquisition of images were performed, which were measured and analyzed by the heart function analysis software accompanied with the small animal ultrasonographer to obtain ejection fraction value and shortening fraction value.
(120) The results showed that, compared with the littermate control group, the CREG.sup.+/− mice had significantly worse heart function at 28 days after AMI, with a significant decrease in ejection fraction and shortening fraction (see:
(121) {circle around (4)} Observation of general cardiac morphology by HE in the CREG.sup.+/− mice and the littermate control group mice 28 days after AMI
(122) 1) Tissue material were drawn, fixed, paraffin embedded in conventional way, and sectioned into 5 μm slices;
(123) 2) The slices were deparaffinized with xylene and washed with ethanol at all levels: xylene (I) 5 min.fwdarw.xylene (II) 5 min.fwdarw.100% ethanol 2 min.fwdarw.95% ethanol 1 min.fwdarw.80% ethanol 1 min.fwdarw.75% ethanol 1 min.fwdarw.distilled water 2 min;
(124) 3) Stained with hematoxylin for 5 min, rinsed with tap water;
(125) 4) Differentiated with ethanol hydrochloride for 30 s;
(126) 5) Immersed in tap water for 15 min;
(127) 6) Placed in Eosin liquid for 2 min;
(128) 7) Conventionally dehydrated, and transparent mounted: 95% ethanol 1 min.fwdarw.95% ethanol 1 min.fwdarw.100% ethanol (I) 1 min.fwdarw.100% ethanol (II) 1 min.fwdarw.xylene (I) 1 min.fwdarw.xylene (II) 1 min.fwdarw.Neutral resin sealing.
(129) {circle around (5)} Ventricular remodeling was observed by Masson staining in the CREG.sup.+/− mice and the littermate control group mice 28 days after AMI, and details could be seen in Example 1.
(130) The results showed that, compared with the mice of the littermate control group, the ventricular wall thickness became significantly thinner, the ventricular cavity became larger, and the degree of ventricular fibrosis was significantly increased in the CREG.sup.+/− mice at 28 days after AMI (see:
Example 4: Exogenous Supplementation of Glycosylated CREG Protein and Non-Glycosylated CREG Protein could Significantly Increase Survival Rate and Cardiac Contractility Function, and Improve Ventricular Remodeling in C57BL/6J Mice at 28 Days after AMI
(131) {circle around (1)} Survival analysis of the C57BL/6J mice and the mice with exogenously supplemented with glycosylated and non-glycosylated CREG proteins was examined at 28 days after AMI.
(132) The mice were divided into sham-operation group, C57BL/6J control group receiving AMI operation only, therapeutic groups in which mice were subcutaneously embedded with glycosylated CREG protein (Origene, USA, TP301654, in which the amino acids at positions 160,193 and 216 of CREG protein were glycosylated, 150 μg/kg.Math.d), or administrated with non-glycosylated CREG protein (Abcam company, USA, ab131699, in which none of the amino acid site of CREG protein was glycosylated, 150 μg/kg.Math.d). After AMI of mice, the number of dead mice was observed and recorded daily until the 28th day, and the survival curve was drawn. At the same time, the dead mice were autopsied and the cause of death was clarified.
(133) The results showed that all of the mice in the sham operation group survived, while the survival rates in the mice of the glycosylated CREG protein group and the non-glycosylated CREG protein group were significantly higher than that in the C57BL/6J control group. In addition, the analysis of the death cause showed that the number of mice in the glycosylated and non-glycosylated CREG protein groups that died of pulmonary congestion were significantly lower than those in the C57BL/6J group, suggesting that the both groups had less heart failure than the control group (see
(134) {circle around (2)} The cardiac contractile function of the sham operation group, the C57BL/6J group, the glycosylated CREG protein group and the non-glycosylated CREG protein group was evaluated by small animal ultrasonography, and the details were the same as Example 3.
(135) The results showed that in comparison with the sham operation group, the C57BL/6J mice after AMI had worse cardiac contractile function, and significantly decreased ejection fraction and shortening fraction. Compared with the C57BL/6J mice, the mice of both the glycosylated CREG protein group and non-glycosylated CREG protein group showed significantly improved cardiac contractile function and remarkably increased ejection fraction and shortening fraction at 28 days after AMI (results as shown in
(136) {circle around (3)} The myocardium remodeling was observed by HE staining and Masson staining in the mice of each group at 28 day after AMI, in which the details were the same as Examples 1 and 3.
(137) The results showed that compared to the sham-operation group, the C57BL/6J mice at 28 days after AMI showed more obvious ventricular remodeling, thinned ventricular wall, enlarged ventricular cavity, and significantly increased degree of ventricular fibrosis. Compared to the C57BL/6J group mice, the mice of the glycosylated and non-glycosylated CREG protein groups showed significantly improved ventricular remodeling, thickened ventricular wall (see
(138) The above findings suggested that glycosylated and non-glycosylated CREG proteins were expected to be potent drugs for the treatment of AMI and/or heart failure after AMI.
Example 5: Application of Myocardial Ischemia-Reperfusion in Mice would Down-Regulate the Expression of CREG Protein in Myocardium
(139) {circle around (1)} Establishment of myocardial ischemia-reperfusion model in mice
(140) Instruments, materials and medicines were prepared before operation. The thoracotomy ligation of left anterior descending coronary artery comprised the following steps and methods: the skin at 2 mm left side of sternum was cut, the ribs were exposed by blunt dissection of muscle, the intercostal muscle was gently separated in the fourth intercostal space with eye scissors, the two ribs were repeatedly clamped with upward vascular clamp to reduce bleeding. The 3,4 ribs were cut, the chest wall was pulled open with a pull hook, and double strand ligatures were pulled through the chest wall muscles of both sides to left small circles inner side. The envelope was carefully cut, and the heart was gently pressed with a cotton swab. A needle was inserted at a position about 2 mm to the inferior margin of left aurcle with a needle deep of about 1.5 mm, the needle was withdrawn diagonally to the upper right direction of pulmonary artery cone, the needle spacing was about 2-3 mm, and the two ends of the ligatures passed through the small circles, respectively. The ligatures were temporarily kept without ligation. After being stabilized for 10 minutes, the ligatures were tighten, and ligated together with a small segment of polyethylene tube (for pressing blood vessels). ECG was immediately observed, and the appearance of height-increased and enlarged QRS wave was used as an indicator of successful ligation (change of S-T segment might not be visible, see the literature), and the time of ischemia was recorded. After 30 min, the ligatures were loosen to open the vascular for reperfusion, ECG was immediately observed, and the QRS wave should be decreased and narrowed after a few minutes.
(141) {circle around (2)} Detection of CREG mRNA levels after myocardial ischemia-reperfusion
(142) C57BL/6 wild type (CREG.sup.+/+) mice, CREG.sup.+/− mice, and wild type mice administrated with exogenous recombinant CREG protein (300 μg/kg.Math.d) (reCREG.sup.+/+) were respectively studied, and RT-PCR method was used to detect the expression of CREG in myocardium of mice. Myocardial tissues of CREG.sup.+/+, CREG.sup.+/− and reCREG.sup.+/+ mice were withdrawn, and added with 1 ml of Trizol lysis solution to extract total RNA of myocardium. According to the mouse CREG mRNA sequence (NM_011804.2) in GenBank, the mouse CREG gene RT-PCR primers were designed and synthesized as follows: Mouse CREG upstream primer: 5′-GAGGAAGAGAGGTGCAGGTG-3′ (SEQ ID NO: 9), downstream primer: 5′-CATTGCTGTCCTCGACTGAA-3′ (SEQ ID NO: 10); internal reference GAPDH upstream primer: 5′-AGAAGGCTGGGGCTCATTTG-3′ (SEQ ID NO: 11), downstream primer: 5′-AGGGGCCATCCA CAGTCTTC-3′ (SEQ ID NO: 12).
(143) After cDNA was synthesized according to the extracted RNA (cDNA First Strand Synthesis Kit, TakaRa; Amplification conditions: 37° C., 15 min; 85° C., 5 s), the mouse CREG coding sequence with a total of 250 bases was amplified by the following reaction system and reaction conditions.
(144) The amplified products were separated by 2% agarose gel and stained with EB. The myocardial tissue lysates of the CREG.sup.+/− and CREG.sup.+/+ mice were detected to cDNA expression with bands of approximately 250 bp in size. The results suggest that the CREG expression in myocardium of the CREG.sup.+/− mice is significantly reduced in comparison with the CREG.sup.+/+ mice and reCREG.sup.+/+ mice (the results were shown in
(145) {circle around (3)} CREG protein expression was detected by Western blot in myocardium of CREG.sup.+/+, CREG.sup.+/− and reCREG.sup.+/+ mice after myocardial ischemia-reperfusion.
(146) Western blot was used to detect CREG protein expression in the CREG.sup.+/+, CREG.sup.+/− and reCREG.sup.+/+ mice. The myocardial tissues of the three groups were taken and lysed, the protein concentrations of in the lysates were determined by BCA colorimetric kit. 45 μs of protein was added to 4×Loading buffer, boiled at 95° C. for 5 min, and SDS-PAGE electrophoresis was performed by 10% separation gel to determine the electrophoresis termination time. The sample was transferred to a cellulose membrane with a current of 350 mA for a period of 80 min; after being blocked with 5% non-fat dry milk in TBS-T for 1.5 h at room temperature, the primary antibody (anti-CREG antibody, 1:1000, anti-β-actin antibody, 1:2000) was added and incubated overnight at 4° C.; on the next day, placed on a shaker and shaken for 30 minutes, then the membrane was washed with TBS-T for 3 times, each 15 min; a rabbit-anti-mouse secondary antibody (1:1000 dilution) was added, incubated at room temperature for 2 h, the membrane was washed with TBS-T for 4 times, each 20 min; and ECL chemiluminescence imaging was performed.
(147) The results suggested that the expression of CREG protein gradually decreased with the extension of reperfusion time after myocardial ischemia-reperfusion, and such decrease is more obvious in the CREG.sup.+/− mice (see
Example 6: Changes in the Expression of CREG Protein in Mouse Myocardium can Affect Cardiac Function in Mice
(148) {circle around (1)} Comparison of cardiac function in the CREG.sup.+/+ and CREG.sup.+/− mice at 28 days after myocardial ischemia-reperfusion. Vevo2100 ultrasound biomicroscopy system from VisualSonics of Canada was used, and the probe center frequency was 30 MHz. After the mice were anesthetized with 2% isoflurane, the hair of chest and abdomen was cut. The mice were fixed in supine position on a thermostat examination table and the temperature was kept at 37° C. The physiological parameters such as ECG and respiration of the mice were recorded synchronously. The heart rate was maintained at about 450 beats/min and the heart rate was stabilized for 1 min, then a coupling agent was coated on chest for ultrasonography. The results showed that at 28 days of myocardial ischemia-reperfusion, the CREG.sup.+/− mice had a significantly lowered cardiac function in comparison with the CREG.sup.+/+ mice, whereas the mice administrated with exogenous recombinant CREG protein had a significantly improved cardiac function (the results were shown in
(149) {circle around (2)} Comparison of myocardial ischemic and necrosis in the CREG.sup.+/+ mice, the CREG.sup.+/− mice and the mice administrated with exogenous recombinant CREG protein at 24 h after myocardial ischemia reperfusion.
(150) The results of TTC staining suggested that the area of myocardial necrosis in the CREG.sup.+/− mice was significantly increased in comparison with the CREG.sup.+/+ mice.
(151) The above results showed that the expression of CREG protein was positively correlated with the cardiac function in mice during myocardial ischemia-reperfusion, in which the CREG.sup.+/− mice showed the lowest expression of CREG protein in myocardium and the worst cardiac function, while the mice administrated with exogenous recombinant CREG protein showed the highest level of CREG protein expression in myocardium and the best cardiac function (the results were shown in
Example 7: Administration of Exogenous Recombinant CREG Protein During Myocardial Ischemia-Reperfusion can Result in Decrease in Apoptosis of Cardiomyocytes in Mice, and Further Activation of Autophagy
(152) {circle around (1)} Tunel staining method was used to detect the cardiomyocytes apoptosis in CREG.sup.+/+, CREG.sup.+/− and reCREG.sup.+/+ mice. During Tunel staining, the reagents for staining were prepared, then the frozen tissue sections was placed in 4% paraformaldehyde and fixed at room temperature 10 min, washed with PBS for 2 times, each 10 min. After treatment with 3% hydrogen peroxide in methanol solution for 20 min, the sections were washed with PBS for 3 times, each 5 min, contacted with 0.1% sodium citrate for 2 min on ice; then Tunel staining solution was added to the sample surface, incubation was performed at 37° C. for 1 h in dark; washed with PBS, and nuclei stained with DAPI. The results suggested that the CREG.sup.+/− mice after myocardial ischemia-reperfusion exhibited the largest number of apoptotic cardiomyocytes, while the mice administrated with exogenous recombinant CREG protein exhibited the smallest number of apoptotic cardiomyocytes (the results were shown in
(153) {circle around (2)} Western blot was used to detect the expression of apoptotic protein in myocardium. Western blot method was used to detect the expression of apoptosis indicator protein cleaved caspase 3 in myocardium of mice after myocardial ischemia-reperfusion. The results showed that the CREG.sup.+/− mice gave the highest of expression level of cleaved caspase 3 in myocardium, while the mice administrated with exogenous recombinant CREG protein gave the lowest expression level (the results were shown in
(154) {circle around (3)} Using immunofluorescence staining to observe the expression of autophagy protein LC3B in myocardium.
(155) a. Frozen sections were allowed to dry at room temperature for 15 min;
(156) b. The tissues to be stained were circled with a immunohistochemical oil pen, soak in PBS for 10 min to remove OCT;
(157) c. The sections were blocked with PBS containing 10% normal serum for 1 h, without washing in this step, the blocking solution was just sucked out;
(158) d. Rabbit-anti-mouse autophagy microtubule related protein light chain 3 (LC3B) monoclonal antibody (1:100) (purchased from Cell Signaling company, UK) was added and incubated overnight at 4° C.;
(159) e. Washed with PBS for 3 times, each 10 min;
(160) f. Added with fluorescence-labeled secondary antibody (1:100) (donkey-anti-rabbit Alex488 marker, Invitrogen, USA), incubated for 2 h at room temperature;
(161) g. Washed with PBS for 3 times, each 15 min;
(162) h. Mounted, and then observed and photographed the result with a fluorescence microscope.
(163) The results showed that, in comparison with the CREG.sup.+/+ mice, the LC3B expression in myocardium of the mice administrated with exogenous recombinant CREG protein at different phases of myocardial ischemia-reperfusion was significantly increased (the results were shown in
(164) {circle around (4)} Using Western blot to detect autophagy protein expression in myocardium of the three kinds of mice.
(165) Western blot was used to detect the expression of autophagy proteins in myocardium of three kinds of mice at different phases of myocardial ischemia-reperfusion. As a result, autophagy substrate protein P62 was found to accumulate in myocardium of the CREG.sup.+/− mice (the results were shown in
Example 8. Lysosomal Inhibitor Chloroquine was Administered to Observe the Expression of Apoptosis and Autophagy Proteins in Myocardium
(166) {circle around (1)} Immunofluorescence staining was used to observe the expression of autophagy protein LC3B in myocardium.
(167) Immunofluorescence staining showed that the expression of autophagy protein LC3B after myocardial ischemia-reperfusion was significantly increased in the mice administrated with chloroquine in comparison with the control group, suggesting that chloroquine inhibited the autophagy procedure and resulted in the accumulation of LC3B (the results were shown in
(168) {circle around (2)} Western blot was used to detect the expression of autophagy proteins in myocardium of the two kinds of mice.
(169) Western blot was used to detect the expression of autophagy proteins in myocardium of the two kinds of mice at different phases of myocardial ischemia-reperfusion. As a result, it was found that autophagy function in the mice administered with exogenous recombinant CREG protein was further activated, suggesting that CREG promoted the occurrence of autophagy (the results were shown in
(170) {circle around (3)} Tunel staining was used to observe the cardiomyocytes apoptosis in the reCREG.sup.+/+ mice and the reCREG.sup.+/++CQ mice.
(171) Tunel staining found that the mice administrated with both chloroquine and recombinant CREG protein showed a significantly increased number of apoptotic cardiomyocytes after myocardial ischemia-reperfusion in comparison with the mice administrated with only recombinant CREG protein (the results were shown in
(172) {circle around (4)} Western blot was used to detect the expression of apoptosis-related protein cleaved-caspase3 in myocardium of the three groups of mice.
(173) The results showed that the apoptotic protein cleaved caspase3 was increased in myocardium of the mice administrated with both chloroquine and recombinant protein simultaneously (the results were shown in
Example 9: Effect of CREG in Regulation of Autophagy to Combat Apoptosis and Protect Cardiomyocytes was Observed in H9C2 Cardiomyocyte Line
(174) {circle around (1)} To investigate the effect of CREG gene over-expression on CREG mRNA and protein expression in H9C2 cells, we first established a cell model overexpressing CREG gene. The preparation of recombinant adenovirus (Ad5-CREG) carrying human CREG gene was disclosed in Chinese Patent No. 200810000053.8 (Publication No. CN101475961A) which was deposited with the China Center for Type Culture Collection (CCTCC, Wuhan, Wuhan University) on Jan. 2, 2008, Accession No. CCTCC-V200801. The deposit information was disclosed in Chinese Patent CN 101475961A. The adenovirus expressing only GFP protein (Ad-GFP) served as a control. H9C2 cells were inoculated into culture flasks, and infected on the next day with Ad-CREG-GFP and Ad-GFP respectively at a multiplicity of infection (MOI) of 300, and the cells were harvested after 48 hours of culture for detection of CREG gene expression.
(175) The cells transfected with Ad-CREG-GFP and Ad-GFP were collected, mRNA was extracted and reverse transcribed, RT-PCR was used to detect the expression of CREG gene, which details were the same as Example 1. As a result, the expression level of hCREG mRNA in the Ad-CREG-GFP group cells was significantly increased, suggesting that H9C2 cell model with over-expression of CREG gene was successfully established (the results were shown in
(176) {circle around (2)} The effect of CREG gene low-expression on the expression of CREG mRNA and protein in H9C2 was studied. Firstly, a CREG low-expression model was established by using CREG small interfering (siRNA) (SANTA CRUZ) and FuGENE HD Transfection Reagent (Promega) for 3 days, and the successful establishment of the model was verified by RT-PCR and Western blot (the results were shown in
(177) {circle around (3)} The cells were treated with serum-starvation, and the apoptosis and autophagy in different groups were detected by Tunel staining and Western blot.
(178) The results of Tunel staining and Western blot showed that the CREG low-expression group exhibited the largest number of apoptotic cells and the highest expression level of cleaved caspase3, while the CREG over-expression group exhibited the smallest number of apoptotic cells and the lowest expression level of cleaved caspase3 (
(179) The results of Western blot showed that the autophagy proteins LC3A and P62 in the CREG low-expression group were significantly accumulated, suggesting that the autophagy function was inhibited, while the CREG over-expression group was further activated by autophagy; when lysosome inhibitor chloroquine was administrated on the basis of serum deprivation treatment of cells, the CREG over-expression group and the control group showed no significant difference in apoptosis and autophagy protein expression (the results were shown in
(180) The results of the above studies suggested that the recombinant CREG protein was expected to become an effective drug for prevention or treatment of myocardial ischemia-reperfusion injury.
Example 10: Construction of Salt-Sensitive Hypertension and Myocardial Fibrosis Models in Dahl Salt-Sensitive Rats by Administrating with a High Salt Stress of 8%
(181) {circle around (1)} Construction of hypertension and myocardial fibrosis model in Dahl rats
(182) Dahl rats were divided into normal salt group and high salt group, the normal salt group was given 0.3% normal salt diet, the high salt group was given 8% high salt diet; blood pressures were measured by in vitro rat tail blood pressure measurement method after 1, 2, 3, 4, 5, 6, 7 and 8 weeks of salt stress, and the rats were intraperitoneally anesthetized with 3% chloral hydrate (0.3 ml/100 g) at time point of 8 weeks. The hair of chest surgery area was cut, the skin was cut off, the chest was opened, the heart was removed, and the indicators such as heart weight, body weight, tibia length were measured.
(183) The results showed that in comparison with the normal salt group, the high-salt group exhibited an increased blood pressure from 1 week after salt stress, which increased gradually with the extension of salt stress time, and gave a significant increase of blood pressure at time point of 8 weeks, suggesting the hypertension model was successfully established in salt-sensitive rats; when the heart was drawn at time point of 8 weeks, it was found that the ratio of heart weight/body weight, and the ratio of heart weight/tibia length were significantly increased (the results were shown in
(184) {circle around (3)} General cardiac morphology and myocardial collagen content in Dahl rats of the normal salt group and the high salt group were observed by HE and Masson staining at time point of 8 weeks.
(185) He Staining:
(186) 1) Tissue blocks were taken, fixed, paraffin embedded conventionally, and sectioned into 5 μm slices;
(187) 2) The slices were deparaffinized with xylene and washed with ethanol at all levels: xylene (I) 5 min.fwdarw.xylene (II) 5 min.fwdarw.100% ethanol 2 min.fwdarw.95% ethanol 1 min.fwdarw.80% ethanol 1 min.fwdarw.75% ethanol 1 min.fwdarw.distilled water 2 min;
(188) 3) Stained with hematoxylin for 5 min, rinsed with tap water;
(189) 4) Differentiated with ethanol hydrochloride for 30 s;
(190) 5) Immersed in tap water for 15 min;
(191) 6) Placed in Eosin solution for 2 min;
(192) 7) Conventionally dehydrated, transparent, mounted: 95% ethanol 1 min.fwdarw.95% ethanol 1 min.fwdarw.100% ethanol (I) 1 min.fwdarw.100% ethanol (II) 1 min.fwdarw.xylene (I) 1 min.fwdarw.xylene (II) 1 min.fwdarw.neutral resin sealed.
(193) Masson Staining:
(194) 1) Tissue blocks were drawn, fixed, conventionally embedded in paraffin, sectioned into 5 μm sections and dewaxed;
(195) 2) Rinsed with tap water and distilled water in order;
(196) 3) The paraffin sections were placed in Bruin's solution overnight;
(197) 4) Rinsed with running water for 2-3 h, until the yellow disappeared completely;
(198) 5) Stained nucleus with Wiegert iron hematoxylin solution for 20 min;
(199) 6) Rinsed with running water for 30 s, differentiated with 1% ethanol hydrochloride;
(200) 7) Rinsed with running water for 30 s, returned back blue with 0.2% ammonia solution;
(201) 8) Stained with Biebrich-Sdarlet-Acid for 15 min;
(202) 9) Rinsed with running water for 30 s, stained with phosphoric acid solution for 2 min;
(203) 10) Shaken to remove phosphoric acid, without washing, directly stained with aniline blue liquid for 15 min;
(204) 11) Rinsed with running water for 30 s, absolute ethanol for 10 s, absolute ethanol for 5 min;
(205) 12) Transparentized with xylene, mounted and fixed with neutral gum.
(206) The results showed that, in comparison with the normal salt group, the Dahl salt-sensitive rats at 8 weeks of high salt stress showed significant concentric hypertrophy, and the collagen content in myocardial interstitium and around coronary arteries were significantly increased (the results were shown in
(207) {circle around (3)} Myocardial macrophage infiltration at different time points was detected by immunohistochemical staining.
(208) 1) Paraffin sections were routinely dewaxed to water;
(209) 2) Heat repair: the sections were boiled in water at 100° C. for 40 min, closed and naturally cooled;
(210) 3) Endogenous peroxidase was blocked with hydrogen peroxide for 10 min; washed with PBS for 3 times;
(211) 4) Blocked with normal non-immune animal serum for 30 min at room temperature;
(212) 5) Removing serum and dropping the primary antibody: the serum was absorbed with filter paper, without washing, directly added dropwise with the primary antibody (1:100, Abcam, USA) for 2 h at room temperature (optionally, placed in 4° C. refrigerator overnight). Dropping the secondary antibody: if staying overnight, rewarmed for 30 min on the next day, washed with PBS for 3 times, added dropwise with 50 ul of biotinylated secondary antibody, and incubated at room temperature for 10 min;
(213) 6) Dropping streptavidin: washed with PBS for 3 times, added dropwise with 50 ul of peroxidase solution, incubated at room temperature for 10 min;
(214) 7) developed with DAB, observed under microscopy, timely terminated (terminated with tap water);
(215) 8) Counterstained with hematoxylin at room temperature for 5 min, rinsed with tap water;
(216) 9) Rinsed with tap water to return back blue, 5 min;
(217) 10) Dehydrated with gradient alcohol solutions, transparentized with xylene: I, II (xylene), each 15 min.
(218) 11) Mounted with neutral gum.
(219) The results showed that there was a small amount of macrophage infiltration in myocardium of Dahl rats at 6 weeks after high salt stress for; and a large amount of macrophages were found in myocardium at 8 weeks in comparison with normal salt group (the results were shown in
(220) {circle around (4)} Western blot was used to detect the expression of macrophages in myocardium of rats in two groups at time point of 8 weeks of salt stress.
(221) The BCA colorimetric kit was used to determine the protein concentration in lysates. After 50 μg of protein was boiled at 95° C. for 5 min, SDS-PAGE electrophoresis was performed on 12% separation gel to determine the termination time of electrophoresis. The sample was transferred to a cellulose membrane at a current of 350 mA for 45 min. After blocking with 5% skim milk powder diluted in TBS-T for 1.5 h at room temperature, the primary antibody was added and incubated overnight at 4° C. Respectively, 1:1000 anti-CREG antibody (Abcam, USA) and 1:1000 anti-beta-actin (Santa Cruz, USA) antibody were used as primary antibodies, goat-anti-mouse antibody labeled with horseradish peroxidase (Cell Signalling company, USA) was used as secondary antibody, Western blot detection was performed using ECL kit (Amersham, USA) for light-emitting development.
(222) The results showed that, compared to the normal salt group, the expression of macrophage in the myocardium of the high salt group at 8 weeks of salt stress was significantly increased (results shown in
Example 11: Myocardial CREG Protein Expression in Dahl Salt-Sensitive Rats after being Administrated with 8% High Salt Stress
(223) {circle around (1)} Western blot was used to detect the myocardial CREG protein expression in rats of two groups at different time points of salt stress.
(224) The results showed that the CREG protein levels of the Dahl salt-sensitive rats under high salt stress at different time points (2, 4, 6, 8 weeks, respectively) were detected, in comparison with the normal salt group rats, the myocardial CREG protein level in the high salt group rats was significantly down-regulated from 4 weeks of salt stress, which continued to 8 weeks (the results were shown in
(225) {circle around (2)} Immunohistochemical staining was used to detect the expression of CREG in myocardium of the two groups rats at time point of 4 weeks.
(226) {circle around (3)} Immunofluorescence staining was used to detect the expression of CREG in myocardium of the two groups at time point of 4 weeks.
(227) 1) Freshly drawn cardiac tissues were embedded and fixed in frozen embedding agent and frozen sectioned into sections with thickness of 5 μm;
(228) 2) Fixed with 4% paraformaldehyde at room temperature for 20-30 min;
(229) 3) Blocked with goat serum at room temperature for 30 min;
(230) 4) Added with 1:100 anti-CREG antibody (Abcam company, USA), placed in a wet box, stood overnight at 4° C.;
(231) 5) Washed with PBS for 3 times, each 10 min;
(232) 6) Added with fluorescent labeled secondary antibody (1:100) and incubated in dark for 2 h at room temperature;
(233) 7) Washed with PBS for 3 times, each 10 min;
(234) 8) Nucleus stained with DAPI;
(235) 9) Mounted with 95% glycerol.
(236) The results showed that the expression of CREG protein was significantly down-regulated in Dahl rats after high salt stress, suggesting that CREG protein expression was down-regulated during the pathological process of hypertensive myocardial fibrosis in salt-sensitive rats (see
Example 12: Exogenously Supplementing Recombinant CREG Protein Improved Myocardial Fibrosis and Cardiac Inflammation after Salt Stress
(237) {circle around (1)} Exogenous over-expression of recombinant CREG protein inhibited the ratio of heart weight/body weight and the ratio of heart weight/tibia length.
(238) The results showed that after administration of exogenous recombinant CREG protein, the Dahl rats after salt stress were able to effectively suppress the ratio of heart weight/body weight and the ratio of heart weight/tibia length (see
(239) {circle around (2)} Immunohistochemical staining was used to detect macrophage infiltration in myocardial tissue of Dahl rats administrated with exogenous overexpressed recombinant CREG protein after salt stress.
(240) The results showed that the macrophage infiltration in myocardium of the Dahl rats administrated with exogenous recombinant CREG protein were significantly reduced after salt stress (see
(241) {circle around (3)} Using HE and Masson staining to detect the effect of exogenous over-expressed recombinant CREG protein on the myocardial fibrosis and remodeling in Dahl rats after salt stress.
(242) The results showed that after being administrated with exogenous recombinant CREG protein, the Dahl rats after salt stress exhibited significant improvement in cardiac concentric hypertrophy, and a significant reduction in both myocardial interstitium and perivascular collagen (see
Example 13: Effect of CREG in Combating Inflammatory Response and Regulating Myocardial Fibrosis was Observed at Level of Dahl Salt-Sensitive Rat Primary Fibroblasts
(243) {circle around (1)} In order to investigate the effect of CREG gene over-expression on CREG mRNA and protein expression in Dahl primary fibroblasts, we first established a cell model overexpressing CREG gene. The preparation of recombinant adenovirus (Ad5-CREG) carrying human CREG gene was disclosed in Chinese Patent No. 200810000053.8 (Publication No. CN101475961A), which was deposited with the China Center for Type Culture Collection (CCTCC, Wuhan, Wuhan University) on Jan. 2, 2008, Accession No. CCTCC-V200801. The deposit information was disclosed in Chinese Patent CN 101475961A. Adenoviruses expressing only GFP protein (Ad-GFP) served as a control. Primary fibroblasts were seeded in culture flasks, infected on the next day with Ad-CREG-GFP and Ad-GFP respectively at a multiplicity of infection (MOI) of 300. After 48 hours of culture, cells were harvested and examined for CREG gene expression.
(244) After Ad-CREG-GFP and Ad-GFP transfected cells were collected, mRNA and protein were extracted and RT-PCR and Western blot were used to detect whether the CREG over-expression model was successfully established. The Western blot method was the same as Example 1, and the RT-PCR method was as follows:
(245) a. Design of rat CREG RT-PCR primers: The rat CREG mRNA sequence (NM_001105966.1) was queried in GenBank, and RT-PCR primers of rat CREG gene were designed by using the Primer Premier 5.0 software, sent to and synthesized in Shanghai Bioengineering Co., Ltd. The primer sequences were as follows:
(246) b. Trizol extraction of total RNA from primary fibroblasts of rat myocardium: primary fibroblasts of each group in culture dish were added with 1 mL of Trizol lysis buffer, stood at room temperature for 5 min; added with 200 μl of chloroform, mixed thoroughly, stood at room temperature for 10 min; centrifuged at 12000 rpm/s for 10 min at 4° C., the supernatant was transferred to a clean centrifuge tube; 200 μl of isopropanol was added to the supernatant and mixed thoroughly; centrifuged at 12000 rpm/s for 10 min at 4° C., the supernatant was discarded; added with 1 ml of 75% ethanol to suspend the deposit; centrifuged at 12,000 rpm/s for 10 min at 4° C., the supernatant was discarded; added with 50 μl of RNase-Free deionized water to dissolve the deposit. After that, spectrophotometer and 1% agarose gel electrophoresis were used to detect RNA concentration, purity and integrity.
(247) c. RT-PCR reaction: the extracted total RNA was reverse transcribed into cDNA (using cDNA first-strand synthesis kit from TakaRa, amplification conditions: 37° C. for 15 min; 85° C. for 5 s), and the rat CREG coding sequence was amplified by the following reaction system and reaction conditions, and the fragment length was 250 bp.
(248) Specific Reaction System and Conditions:
(249) TABLE-US-00004 Reagent Volume (μl) ddH.sub.2O 9.5 2 × Taq Master Mix 12.5 Upstream primer 1 Downstream primer 1 cDNA template 1 LaTaq 0.5
(250) Reaction conditions: 95° C., 3 min; 94° C., 30 s; 59° C., 30 s; 72° C., 1 min; 30 cycles; 72° C., 10 min.
(251) The amplified products were separated and detected by 2% agarose gel electrophoresis, and the images were stored by gel imager.
(252) The results showed that CREG mRNA expression and protein levels were significantly increased in cells of the Ad-CREG-GFP group (
(253) {circle around (2)} Effect of low-expression of CREG gene on CREG mRNA and protein expression in primary fibroblasts. Firstly, a model of low-expression of CREG was established, by using CREG small interfering (siRNA) (SANTA CRUZ) and FuGENE HD Transfection Reagent (Promega) for 3 days, and RT-PCR and Western blot was used to detect whether the model was successfully established.
(254) The results showed that the CREG mRNA expression and protein levels were significantly decreased in the cells of the si-CREG group (
(255) {circle around (3)} Transwell experiments were used to detect the effects of different groups of cells on the migration of macrophages.
(256) The results showed that the macrophage infiltration was significantly increased in the primary fibroblasts treated with low-expressed CREG (the si-CREG group); however, the macrophage infiltration was significantly inhibited in the primary fibroblasts treated with over-expressed CREG (the results were shown in
(257) The above results suggested that recombinant CREG protein was expected to become an effective drug for prevention or treatment of myocardial fibrosis in salt-sensitive people.
(258) Although specific embodiments of the present invention have been described in detail, those skilled in the art will understand, and various modifications and substitutions to those details may be made in accordance with all the teachings disclosed, and all of which are within the scope of the invention. The full scope of the invention is given by the appended claims and any equivalents thereof.