LENTIVIRAL VECTOR AND METHOD FOR DELIVERING EXOGENOUS RNA BY THE LENTIVIRAL VECTOR

Abstract

A lentiviral vector and a method for delivering an exogenous RNA by the lentiviral vector are provided. The lentiviral vector is prepared by transfecting plasmids containing a genome sequence of the lentiviral vector into a virus-producing cell, collecting a supernatant and concentration. Specifically, according to the principle of combining an RNA-binding protein with an RNA sequence identified by the RNA-binding protein, the RNA-binding protein is integrated into a skeleton of a lentivirus GagPol long-chain protein, and the RNA sequence identified by the RNA-binding protein is connected to the exogenous target RNA, so that the exogenous target RNA is packaged into lentiviral particles during the assembly of the lentiviral particles. The exogenous target RNA can be mRNA, gRNA or RNA with other functions. The present invention can be used in the fields of gene editing, gene therapy, cell therapy, immunotherapy, regenerative medicine and basic biology.

Claims

1. A lentiviral vector, wherein the lentiviral vector is prepared by transfecting plasmids containing a genome sequence of the lentiviral vector into a virus-producing cell, collecting a first supernatant and concentrating the first supernatant; the plasmids comprise a plasmid expressing a envelope protein, a plasmid expressing a lentivirus GagPol long-chain protein containing a RNA-binding protein and a plasmid containing an RNA stem-loop structure identified by the RNA-binding protein.

2. The lentiviral vector according to claim 1, wherein the virus-producing cell is one selected from the group consisting of 293T, 293FT and HEK293.

3. The lentiviral vector according to claim 1, wherein the plasmid expressing the envelope protein is one selected from the group consisting of vesicular stomatitis virus G protein (VSV-G), cluster of differentiation 4 (CD4) recognition protein, cluster of differentiation 8 (CD8) recognition protein, RD114 and baboon endogenous retrovirus envelope protein-modified envelope protein.

4. The lentiviral vector according to claim 1, wherein the plasmid expressing the lentivirus GagPol long-chain protein containing the RNA-binding protein integrates the RNA-binding protein into an N-terminal of the lentivirus GagPol long-chain protein.

5. The lentiviral vector according to claim 1, wherein in the plasmid expressing the lentivirus GagPol long-chain protein containing the RNA-binding protein, a codon sequence of the lentivirus GagPol long-chain protein is shown in SEQ ID No. 1.

6. The lentiviral vector according to claim 5, wherein in the plasmid expressing the lentivirus GagPol long-chain protein containing the RNA-binding protein, the RNA-binding protein is MS2 coat protein, and a codon sequence of the MS2 coat protein is shown in SEQ ID No. 2.

7. The lentiviral vector according to claim 6, wherein in the plasmid containing the RNA stem-loop structure identified by the RNA-binding protein, a sequence of an RNA identified by the RNA-binding protein is shown in SEQ ID No. 3.

8. A method for delivering an exogenous target RNA by the lentiviral vector according to claim 1.

9. The method according to claim 8, comprising the following steps: S1. co-transfecting the virus-producing cell with the plasmid expressing the envelope protein, the plasmid expressing the lentivirus GagPol long-chain protein containing the RNA-binding protein and a plasmid expressing the exogenous target RNA containing the RNA stem-loop structure identified by the RNA-binding protein; S2. collecting a second supernatant containing viral particles, and concentrating the second supernatant to obtain lentiviral particles containing the exogenous target RNA.

10. A method of using the lentivirus vector according to claim 1 in delivering Cas9 mRNA and gRNA for gene editing and gene therapy, or carrying mRNAs expressing a tumor antigen and a virus antigen for vaccine, or expressing a cell reprogramming factor for generating multipotent stem cells and modifying cell functions, or delivering a chimeric antigen receptor mRNA for cellular immunotherapy.

11. The lentiviral vector according to claim 4, wherein in the plasmid expressing the lentivirus GagPol long-chain protein containing the RNA-binding protein, a codon sequence of the lentivirus GagPol long-chain protein is shown in SEQ ID No. 1.

12. The method according to claim 8, wherein the virus-producing cell is one selected from the group consisting of 293T, 293FT and HEK293.

13. The method according to claim 8, wherein the plasmid expressing the envelope protein is one selected from the group consisting of vesicular stomatitis virus G protein (VSV-G), cluster of differentiation 4 (CD4) recognition protein, cluster of differentiation 8 (CD8) recognition protein, RD114 and baboon endogenous retrovirus envelope protein-modified envelope protein.

14. The method according to claim 8, wherein the plasmid expressing the lentivirus GagPol long-chain protein containing the RNA-binding protein integrates the RNA-binding protein into an N-terminal of the lentivirus GagPol long-chain protein.

15. The method according to claim 8, wherein in the plasmid expressing the lentivirus GagPol long-chain protein containing the RNA-binding protein, a codon sequence of the lentivirus GagPol long-chain protein is shown in SEQ ID No. 1.

16. The method according to claim 15, wherein in the plasmid expressing the lentivirus GagPol long-chain protein containing the RNA-binding protein, the RNA-binding protein is MS2 coat protein, and a codon sequence of the MS2 coat protein is shown in SEQ ID No. 2.

17. The method according to claim 16, wherein in the plasmid containing the RNA stem-loop structure identified by the RNA-binding protein, a sequence of an RNA identified by the RNA-binding protein is shown in SEQ ID No. 3.

18. The method according to claim 10, wherein the virus-producing cell is one selected from the group consisting of 293T, 293FT and HEK293.

19. The method according to claim 10, wherein the plasmid expressing the envelope protein is one selected from the group consisting of vesicular stomatitis virus G protein (VSV-G), cluster of differentiation 4 (CD4) recognition protein, cluster of differentiation 8 (CD8) recognition protein, RD114 and baboon endogenous retrovirus envelope protein-modified envelope protein.

20. The method according to claim 10, wherein the plasmid expressing the lentivirus GagPol long-chain protein containing the RNA-binding protein integrates the RNA-binding protein into an N-terminal of the lentivirus GagPol long-chain protein.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0045] Other features, objectives and advantages of the present invention will become more apparent upon reading the detailed description of non-restrictive embodiments with reference to the following drawings:

[0046] FIG. 1 is a diagram showing an experiment of a lentiviral vector delivering GFP mRNA; and

[0047] FIG. 2 is a diagram showing an experiment of a lentiviral vector delivering Cas9 mRNA for gene editing.

DETAILED DESCRIPTION OF THE EMBODIMENTS

[0048] The present invention is described in detail below in combination with the embodiments. The following embodiments will help those skilled in the art to further understand the present invention, but will not limit the present invention in any form. It should be noted that numerous modifications and improvements may be made by those skilled in the art without departing from the spirit of the present invention. These modifications and improvements are within the protection scope of the present invention.

Embodiment 1: Preparation of Lentiviral Particles

[0049] Step 1: a plasmid expressing a envelope protein, a plasmid expressing a lentivirus GagPol long-chain protein containing a RNA-binding protein and a plasmid expressing an exogenous target RNA containing an RNA stem-loop structure identified by the RNA-binding protein are co-transfected into virus-producing cells (293T).

[0050] 1) The plasmid expressing the envelope protein includes VSV-G, CD4 recognition protein, CD8 recognition protein, RD114 and baboon endogenous retrovirus envelope protein-modified envelope protein. VSV-G is selected in the present embodiment.

[0051] 2) The virus-producing cells include 293T, 293FT, HEK293, etc. 293T is selected in the present embodiment.

[0052] 3) The plasmid expressing the lentivirus GagPol long-chain protein containing the RNA-binding protein is obtained by fusing an MS2 coat protein with the lentivirus GagPol long-chain protein in the present embodiment.

[0053] A codon sequence of the GagPol long-chain protein is as follows (SEQ ID No. 1):

TABLE-US-00001 SEQ ID NO. 1 gccagggccagcgtgctgagcggcggcgagctggacaggtgggagaagat caggctgaggcccggcggcaagaagaagtataagctgaagcacatcgtgt gggccagcagggagctggagaggttcgccgtgaaccccggcctgctggag accagcgagggctgcaggcagatcctgggccagctgcagcccagcctgca gaccggcagcgaggagctgaggagcctgtacaacaccgtggccaccctgt actgcgtgcaccagaggatcgagatcaaggacaccaaggaggccctggac aagatcgaggaggagcagaacaagtccaagaagaaggcccagcaggccgc cgccgacaccggccacagcagccaggtgagccagaactaccccatcgtgc agaacatccagggccagatggtgcaccaggccatcagccccaggaccctg aacgcctgggtgaaggtggtggaggagaaggccttcagccccgaggtgat ccccatgttcagcgccctgagcgagggagccaccccccaggacctgaaca ccatgctgaacaccgtgggcggccaccaggccgccatgcagatgctgaag gagaccatcaacgaggaggccgccgagtgggacagggtgcaccccgtgca cgccggccccatcgcccccggccagatgagggagccccgcggcagcgaca tcgccggcaccaccagcaccctgcaggagcagatcggctggatgaccaac aacccccccatccccgtgggcgaaatctacaagaggtggatcatcctggg cctgaacaagatcgtgaggatgtacagccccaccagcatcctggatatca ggcagggccccaaagagcccttcagggactacgtggacaggttctacaag accctgcgcgccgagcaggccagccaggaggtgaagaactggatgaccga gaccctgctggtgcagaacgccaaccccgactgcaagaccatcctgaagg ccctgggacccgccgccaccctggaggagatgatgaccgcctgccagggc gtgggcggccccggccacaaggccagggtgctggccgaggccatgagcca ggtgaccaacaccgccaccatcatgatgcagaggggcaacttcaggaacc agaggaagatggtgaagtgcttcaactgcggcaaggagggccacaccgcc aggaactgccgcgcccccaggaagaagggctgctggaagtgcggcaagga gggccaccagatgaaggactgcaccgagaggcaggctaattttttaggga agatctggccttcctacaagggaaggccagggaattttcttcagagcaga ccagagccaacagccccaccatttcttcagagcagaccagagccaacagc cccaccagaagagagcttcaggtctggggtagagacaacaactccccctc agaagcaggagccgatagacaaggaactgtatcctttaacttccctcaga tcactctttggcaacgacccctcgtcacaataaagatcggtggccagctg aaggaggccctgctggacaccggcgccgacgacaccgtgctggaggagat gagcctgcccggcaggtggaagcccaagatgatcggcggcatcggcggct tcatcaaggtgaggcagtacgaccagatcctgatcgagatctgcggccac aaggccatcggcaccgtgctggtgggacctacacctgtgaacatcatcgg caggaacctgctgacccagatcggctgcaccctgaacttccccatcagcc ccatcgagaccgtgcccgtgaagctgaagcccggcatggacggccctaag gtgaagcagtggcccctgaccgaggagaagatcaaggccctggtggagat ctgcaccgagatggagaaggagggcaagatcagcaagatcggccccgaga acccctacaacacccccgtgttcgccatcaagaagaaggacagcaccaag tggaggaagctggtggacttcagggagctgaacaagaggacccaggactt ctgggaggtgcagctgggcatcccccaccccgccggcctgaagaagaaga agagcgtgaccgtgctggacgtgggcgacgcctacttcagcgtgcccctg gacgaggacttcaggaagtataccgccttcaccatccccagcatcaacaa cgagacccccggcatccgctaccagtacaacgtgctgccccagggctgga agggcagccccgccatcttccagagcagcatgacaaagatcctggagccc ttcaagaagcagaaccccgacatcgtgatctatcagtacatggacgacct gtacgtgggcagcgacctggagatcggccagcacaggaccaagatcgagg agctgaggcagcacctgctgaggtggggcctgaccacccccgacaagaag caccagaaggagcccccattcctgtggatgggctacgagctgcaccccga caagtggaccgtgcagcccatcgtgctgcccgagaaggacagctggaccg tgaacgacattcagaagctggtgggcaagctgaactgggccagccagatc taccccggcatcaaggtgaggcagctgtgcaagctgctgaggggcacaaa ggctctgaccgaggtgatccccctgaccgaggaggccgagctggagctgg ccgagaacagggagatcctgaaggagcccgtgcacggcgtgtactacgac cccagcaaggacctgatcgccgagatccagaagcagggccagggccagtg gacctaccagatctaccaggagcccttcaagaacctgaagaccggcaagt acgcccgcatgcgcggcgcccacaccaacgacgtgaagcagctgaccgag gccgtgcagaagatcaccaccgagagcatcgtgatctggggcaagactcc taagttcaagctgcccatccagaaggagacctgggagacctggtggaccg agtactggcaggccacctggattcccgagtgggagttcgtgaacacccct cccctggtgaagctgtggtatcagctggagaaggagcccatcgtgggcgc cgagaccttctacgtggacggcgccgccaacagggagaccaagctgggca aggccggctacgtgaccaacaagggccgccagaaggtggtgcccctgacc aacaccaccaaccagaagaccgagctgcaggctatctacctggccctgca ggactcaggcctggaggtgaacatcgtgaccgacagccagtacgccctgg gcatcatccaggcccagcccgacaagagcgagagcgagctggtgaaccag atcatcgagcagctgatcaagaaggagaaggtgtacctggcctgggtgcc cgcccacaagggcatcggcggcaacgagcaggtggacaagctggtgagcg ccggcatcaggaagatcctgttcctggacggcatcgacaaggcccaggac gagcacgagaagtaccacagcaactggagggctatggctagcgacttcaa cctgcctcccgtggtggctaaggagatcgtggccagctgcgacaagtgcc agctgaagggcgaggccatgcacggccaggtggactgcagccccggcatc tggcagctggtttgcacccacctggagggcaaggtgatcctggtggccgt gcacgtggcctccggctacatcgaggccgaggtgatccccgccgagaccg gccaggagaccgcctacttcctgctgaagctggccggccgctggcccgtg aagaccatccacaccgacaacggcagcaacttcaccagcgccaccgtgaa ggccgcctgctggtgggccggcatcaagcaggagttcggcatcccctaca acccccagtctcagggcgtggtggagagcatgaacaaggagctgaagaag atcatcggccaggtgagggaccaggccgagcacctgaagaccgccgtgca gatggccgtgttcatccacaacttcaagaggaagggcggcatcggcggct acagcgccggcgagaggatcgtggacatcatcgccaccgacatccagacc aaggagctgcagaagcagatcaccaagatccagaacttcagggtgtacta cagggacagcaggaaccctctgtggaagggccccgccaagctgctgtgga agggcgagggcgccgtggtgatccaggacaacagcgacatcaaggtggtg cccaggaggaaggccaagatcatcagggactacggcaagcagatggccgg cgacgactgcgtggcctccaggcaggacgaggactga.

[0054] A codon sequence of the MS2 coat protein is as follows (SEQ ID No. 2), and its encoded protein can be linked to the GagPol long-chain protein encoded by the sequence of SEQ ID No. 1, for example, the protein encoded by the MS2 coat protein is placed on the N-terminal of the GagPol long-chain protein.

TABLE-US-00002 SEQ ID NO. 2 atggcctctaattttactcaatttgtgcttgtcgataatggggggacggg agatgtgaccgttgcccctagcaatttcgcaaatggcgttgcagaatgga tctctagcaacagcagaagccaagcgtacaaagtaacgtgttccgttcgc caaagctccgcccaaaaacggaagtatacaataaaggttgaggtgccgaa agtagccactcaaacagttggtggggtagaattgcccgtagcggcatggc ggtcatatctcaatatggaactcactatcccaatcttcgccacgaatagc gattgtgagctgatagttaaggctatgcaaggtcttctcaaagatggaaa ccctattccatctgctatcgccgccaacagcgggatatac.

[0055] 4) The plasmid expressing the exogenous target RNA containing the RNA stem-loop structure identified by the RNA-binding protein is obtained by fusing a sequence of an RNA identified by the MS2 coat protein with a sequence of the target RNA.

[0056] The sequence of the RNA identified by the MS2 coat protein is as follows (SEQ ID No. 3), which can be linked with the exogenous target RNA by single or multiple repeats.

TABLE-US-00003 SEQ ID No. 3 ACAUGAGGAUCACCCAUGU.

[0057] 5) The plasmids for preparing lentiviral particles carrying the exogenous target RNA mentioned in 3) and 4) above are obtained by a molecular cloning method.

[0058] Step 2: a supernatant containing viral particles is collected and concentrated by a high-speed centrifugation or a HPLC method to obtain the lentiviral particles containing the exogenous target RNA with a high titer.

Embodiment 2: Delivery of GFP mRNA Using a Lentiviral Vector

[0059] The specific steps are the same as those in embodiment 1. GFP mRNA is selected as an exogenous target RNA. Green fluorescent protein (GFP) is a fluorescent protein as a reporter gene. The present embodiment specifically delivers the GFP mRNA into 293T cells by a lentiviral vector.

[0060] As shown in FIG. 1, after the 293T cells are infected with lentiviral particles carrying the GFP mRNA for 48 h, GFP positive cells reached 99.8% by flow cytometry.

Embodiment 3: Delivery of Cas9 mRNA and gRNA Targeting AAVS1 Site by a Lentiviral Vector

[0061] The specific steps are the same as those in embodiment 1. Cas9 mRNA and gRNA targeting AAVS1 site are selected as exogenous target RNAs. The present embodiment specifically delivers the Cas9 mRNA and the gRNA targeting the AAVS1 site of human genome into 293T cells by a lentiviral vector.

[0062] As shown in FIG. 2, after the 293T cells are infected with lentiviral particles carrying the Cas9 mRNA and the gRNA targeting the AAVS1 site for 72 h, the AAVS1 site is amplified by PCR and sequenced. Gene knock-out efficiency is 34.1% by TIDE analysis.

[0063] In conclusion, by using the method of the present invention, RNA becomes more stable through the protection of lentiviral particles; meanwhile, with the help of the ability of lentiviral particles to efficiently infect cells, the target RNA can effectively enter the cells to express gene-editing enzymes, tumor or viral antigens, cell reprogramming factors, chimeric antigen receptors, etc. Therefore, the present invention can deliver Cas9 mRNA and gRNA for gene editing and gene therapy; can deliver tumor or viral antigens mRNAs for immunotherapy; can deliver reprogramming factors mRNAs for generating multipotent stem cells and modifying cell functions; and can deliver chimeric antigen receptors mRNAs for cellular immunotherapy.

[0064] Specific embodiments of the present invention have been described above. It should be understood that the present invention is not limited to the above-mentioned specific embodiments, and that various variations or modifications within the scope of claims may be made by those skilled in the art, which do not affect essence of the present invention.