Immortalized stem cells and method for producing same

11015171 · 2021-05-25

Assignee

Inventors

Cpc classification

International classification

Abstract

The purpose of the present invention is to provide immortalized stem cells for producing culture supernatant that can be used in the treatment of human diseases. Provided is a method for producing immortalized stem cells, the method being provided with: a step for producing a DNA fragment that includes a telomerase reverse transcriptase and at least one gene selected from the group consisting of Bmi-1, human papilloma virus E6, and human papilloma virus E7; a step for producing a viral vector that incorporates the DNA fragment including the gene; a step for transfecting the viral vector into mammalian stem cells and introducing the gene into the stem cells; and a step for culturing the stem cells into which the gene was introduced and using a drug to select immortalized stem cells.

Claims

1. A method for producing an immortalized stem cell comprising the steps of: producing DNA fragment comprising 3 genes selected from the group consisting of Bmi gene, human papilloma virus E6 gene and/or human papilloma virus E7 gene, and telomerase reverse transcriptase gene (TERT); constructing a virus vector into which said DNA fragment comprising said genes are inserted, wherein said genes comprise SEQ ID NO: 3 or SEQ ID NO: 4 when the virus vector is a lentivirus, selected from the group consisting of lentivirus plasmid vector pLVSIN-CMV Neo, Lenti Vector E7T, Lenti Vector BT, Lenti Vector BE6T, and Lenti Vector E6E7T, or said genes comprise 3 of SEQ ID NO: 5, 6, 7, 8, and 9 when the virus vector is a retrovirus, selected from the group consisting of pDON-5 Neo hTERT vector, pDON-5 Neo HPV16E6 vector, pDON-5 Neo HPV16E7 vector, pDON-5 Neo pHTERT vector, and pDON-5 Neo hBmil vector; introducing said genes into a mammal dental pulp stem cell by infecting said cell with a packaged virus vector produced from said virus vector DNA; and culturing said immortalized dental pulp stem cell to which said gene is introduced to select said immortalized stem cell by using a drug.

2. The method for producing an immortalized stem cell according to the claim 1, wherein said DNA fragment comprises any one of gene set selected from the group consisting of (a) bmi-1 gene, human papilloma virus E6 gene and TERT; and (b) human papilloma virus E6 gene, human papilloma virus E7 gene and TERT|.

3. The method for producing an immortalized stem cell according to claim 1, wherein said telomerase reverse transcriptase gene is derived from human or swine.

4. The method for producing an immortalized stem cell according to claim 1, wherein said mammal dental pulp stem cell is any one of the cells selected from the group consisting of a human dental pulp stem cell and a swine dental pulp stem cell.

5. The method for producing an immortalized stem cell according to claim 1, wherein said drug is GENETICIN.

6. The method for producing an immortalized stem cell according to the claim 1, further comprising the step of cloning said selected immortalized stem cell.

7. The immortalized stem cell expressing all of the genes introduced produced by any one of the methods for producing said immortalized stem cell claimed in claim 1.

8. The immortalized stem cell according to the claim 7, wherein said cell is capable of undergoing at least 200 PD.

9. The immortalized stem cell according to claim 7, wherein a STRO-1 expression amount thereof at 200 PD is almost equal to that of stem cell which is not immortalized.

10. The method for producing an immortalized stem cell according to claim 2, wherein said telomerase reverse transcriptase gene is derived from human or swine.

11. The method for producing an immortalized stem cell according to claim 2, wherein said drug is GENETICIN.

12. The method for producing an immortalized stem cell according to claim 3, wherein said drug is GENETICIN.

13. The method for producing an immortalized stem cell according to claim 1, wherein said drug is GENETICIN.

14. The immortalized stem cell expressing all of the genes introduced produced by any one of the method for producing said immortalized stem cell claimed in claim 2.

15. The immortalized stem cell expressing all of the genes introduced produced by any one of the method for producing said immortalized stem cell claimed in claim 3.

16. The immortalized stem cell expressing all of the genes introduced produced by any one of the method for producing said immortalized stem cell claimed in claim 1.

17. The immortalized stem cell according to the claim 8, wherein a STRO-1 expression amount thereof at 200 PD is almost equal to that of stem cell which is not immortalized.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 is a schematic figure showing a structure of a lentivirus plasmid vector pLVSIN-CMV Neo.

(2) FIGS. 2A-2E show a result for confirming whether the lentivirus plasmid vector exists in the cell or not. FIG. 2A shows positive control, FIG. 2B shows SYN4122-1-7, FIG. 2C shows SYN4122-2-2, FIG. 2D shows SYN4122-3-3, and FIG. 2E shows SYN4122-4-4, respectively.

(3) FIG. 3 is an agarose gel electrophoresis of the transfection plasmid.

(4) FIG. 4 is a calibration curve for obtaining an amplification amount of transfected genes after infection of the virus vector into a swine dental pulp stem cell or swine adipose stem cell.

(5) FIG. 5 is a graph showing relative index of the genes transfected after infection of the virus vector into a swine dental pulp stem cell or swine adipose stem cell.

(6) FIGS. 6A-6B show relative indexes of the gene expression amount in each cell populations (pool cell) or a cloned cell after gene introduction by using the virus vector. FIG. 6A is the graph showing the relative indexes of gene expression in transfected cells or the pool cell by using either of virus vector #1 or #2; FIG. 6B is the graph showing these expression in transfected cells or the pool cell by using either of virus vector #3 or #4.

(7) FIG. 7 is the schematic figure showing the structure of retrovirus vector, pDON-5 Neo. In the figure, MCS indicates the multi-cloning sites, and the restriction enzyme r be used for gene introduction is described under PmaCI (1370).

(8) FIG. 8 is the calibration curve for obtaining the gene amplification amounts after the virus vector infection to the human dental pulp stem cells.

(9) FIG. 9 is the graph for showing the relative index of the expression amounts of the gene (hTERT) after the retrovirus vector infection to the human dental pulp stem cells.

(10) FIGS. 10A-10E microscope images after cultivation of the immortalized swine dental pulp stem cells or human dental pulp stem cells prepared by using the present method ((A) to (E)).

MODE FOR CARRYING OUT THE INVENTION

(11) The method for producing the immortalized stem cells of the present invention, it comprises following steps of: (1) producing DNA fragment comprising 3 genes selected from the group consisting of Bmi gene, human papilloma virus E6 gene and/or human papilloma virus E7 gene, and telomerase reverse transcriptase gene (TERT); (2) constructing a virus vector to which said DNA fragment comprising said genes; (3) introducing said genes into a mammal stem cell by transfecting said virus vector to said cell; and (4) culturing said immortalized dental pulp stem cell to which said gene is introduced to select said immortalized dental pulp stem cell by using a drug.

(12) By using the preparation method comprising the procedures (1) to (4), the stem cell, on which all of the genes for immortalization of the cells are stably expressed, is obtained. On the other hand, thus obtained immortalizes stem cells are obtained as cell population which consist of plurality of the cells having genes inserted in different sites, not but the same site on chromosomes (Herein below, such cell population is sometimes referred to as simply the “pool cell”). Therefore, the method is further comprising the step for cloning for choosing such a pool cell.

(13) Herein below, the method of the present invention and the immortalized cells by using the method are explained in detail.

(14) 1. Step for Preparing DNA Fragments and Virus Vectors

(15) 1.1 Preparation of DNA Fragments to be Incorporated into the Virus

(16) Firstly, sequence information of the vector, which is used for incorporating the DNA fragment, is obtained. In the present method, any one of the virus selected from the group consisting of lentivirus, adenovirus, and retrovirus is preferably used as a vector for gene transduction, because it enables to non-transient gene expression of the transduced genes. Lentivirus is preferably used, because it has high production efficiency for the gene transduced cells which stably express thereof.

(17) Hereinbelow, it is explained by using Lenti-plasmid vector (pLVSIN) is raised as an example. For example, the sequence information of pLVSIN is downloaded from TakaraBio web catalogue for confirming multi-cloning sites.

(18) Next, DNA fragments are prepared as follows. In the present invention, 2 to 4 genes are introduced into the DNA fragments for preparing the immortalized stem cells. The cells used are not particularly limited when they are stem cells obtained from mammals. However, the swine dental pulp tissue or human dental pulp tissue are preferably used as the source, because they are easily obtained and stem cells with stable properties are produced.

(19) Also, as the genes to be introduced here, gene set comprising at least 2 genes selected from the group consisting of two early genes of papilloma virus, telomerase reverse transcriptase (TERT), and bmi; because stem cells with stable properties are produced. The early genes of papilloma virus are preferably human papilloma virus E6 or human papilloma virus E7, because of expression efficiency.

(20) It is preferable to prepare and employ the DNA fragments comprising any one of the gene set: (a) bmi gene, human papilloma virus E6 gene and TERT; (b) human papilloma virus E6 gene, human papilloma virus E7 gene and TERT.

(21) Among the genes described above, TERT is the gene of telomere sequence coding an enzyme for extending telomere that is shortened age dependently. Both of human papilloma viruses E6 and E7 are the early genes of human papillomavirus; it is known that E6 reactivates TERT or decompose a protein having PDZ domain. The gene, bmi-1, is known as that it is one of polycomb group member, and relates to self-replication or differentiation control of the stem cells.

(22) By transducing the gene set as mentioned above, it enables to confirm that which combination of the genes gives the efficient expression thereof or immortalization of the cells

(23) Hereinbelow, preparation of the lentivirus vector and insertion of 2 genes into them are explained below. In order to insert papilloma virus E7 gene and telomerase reverse transcriptase (hTERT), the set (a), for example, the double strand DNA of EcoRI/KoZal/E7/T2A4/hTERT/BamHI (Sequence No. 1 in the sequence listing) is synthesized by using the standard procedure according to the sequence information. Obtained DNA fragments are cloned into the multi-cloning sites of the lenti plasmid vector (pLVSIN-CMV Neo) by using the standard procedure to obtain a lenti vector (E7T), which has 2 genes described above.

(24) As the same as described above, other 2 genes are inserted. For example, when the set (b) is used, firstly, EcoRI/KoZal/Bmi-1/T2A4/hTERT/BamHI double strands DNA including Bmi-1 (Sequence No. 2 in the sequence listing) is synthesized by using the standard procedure. Obtained DNA fragments are cloned into the multi-cloning sites of the lenti plasmid vector (pLVSIN-CMV Neo) by using the standard procedure to obtain a lenti vector (BT), which has 2 genes described above.

(25) As the same as described above, other 3 genes are inserted. For example, T2A3E6 double strand DNA is synthesized according to the sequence information, and then it is inserted between Bmi-1 and T2A4 included in the lentivirus vector manufactured in the (v2) to prepare EcoRI/KoZal/Bmi-1/T2A3/E6/T2A4/hTERT/BamHI double strand (Sequence No. 3 in the sequence listing). Obtained DNA fragments are cloned into the multi-cloning sites of the lenti plasmid vector (pLVSIN-CMV Neo) by using the standard procedure to obtain a lenti vector (BE6T), which has 2 genes described above.

(26) As the same as described above, other 4 genes are inserted. For example, E6T2A3 double strand DNA is synthesized, and then it is inserted between Kozak sequence of E7T and E7 included in the lentivirus vector (E7T) manufactured in the (d) to prepare EcoRI/KoZal/E6/T2A3/E7/T2A4/hTERT/BamHI double strand (Sequence No. 4 in the sequence listing). Obtained DNA fragments are cloned into the multi-cloning sites of the lenti plasmid vector (pLVSIN-CMV Neo) by using the standard procedure to obtain a lenti vector (E6E7T), which has 3 genes described above. Above-mentioned DNA fragment synthesis may be order to a consignee who accepts such DNA synthesis.

(27) When the retrovirus is used, the procedure is different from that the lentivirus is used. It is conducted that vectors inserted each gene is prepared and then they are co-infected for transduction. For example, 5 immortalized genes to which Kozak sequence (gccacc) is respectively added to the upstream of a start codon (hTERT (Seq. No. 5 in the sequence listing), human papilloma virus E6 (Seq. No. 6 in the sequence listing), and human papilloma virus E7 (Seq. No. 7 in the sequence listing), pigTERT (Seq. No. 8 in the sequence listing), and hBmi-1 (Seq. No. 9 in the sequence listing) are prepared by using the conventional method. Then they are closed into the PmaC I-Hpa I site of pDON-5 N EO DNA (TaKaRa Code 3657: see FIG. 7) to obtain retrovirus plasmid vectors (pDON-5 Neo hTERT vector, pDON-5 Neo HPV16E6 vector, pDON-5 Neo HPV16E7 vector, pDON-5 Neo pHTERT vector and pDON-5 Neo hBmi1 vector).

(28) After that, E. coli is transformed by using 5 plasmid DNAs as prepared above according to the conventional method. Then the obtained transformants are cultured in a CO.sub.2 incubator to obtain plasmid DNA with transfection grade.

(29) Next, G3T-hi cells are plated in a desirable size plate at 5.5 to 6.5×10.sup.6 cells/dish, and cultures in the 5% CO.sub.2 incubator at about 37° C. for about 20 to 28 hours. Then, desirable transfection agent, for example, 0.3 to 0.5 mL of TransIT-293, is added into the medium to choose 3 plasmid vectors among 5 of them. After that, both of pGP and pE-Ampho (both of them are vectors attached to Retrovirus Packaging Kit Ampho) are co-transfected and then cultures for 40 to 56 hours under the same conditions to insert these genes into the cells.

(30) 1.2 Preparation of the Vector Producing Cells

(31) In parallel with the above-mentioned procedures, recombinant lentivirus vector production cells are prepared. As the cell lines, for example, Lenti-X 293T (Clontech Laboratories, Code No.: 632180) and other commercially available lined cells may be used. For the culture of Lenti-X 293T, a medium supplemented with fetal bovine serum and antibiotics may be used. As the medium, for example, minimal essential medium (MEM), Dulbecco's modified Eagle medium (DMEM) and the like are mentioned. For example, DMEM (SIGMA Inc., St. Louis, Mo.) containing 5 to 15% of fetal bovine serum (FBS, Hyclone), 0.5 to 2% of antibiotics (penicillin/Streptomycin, GIBCO) and the like may be preferably used because of cell growth efficiency.

(32) For example, DMEM supplemented with 10% of fetal bovine serum and 1% of penicillin/Streptomycin is prepared for the used as a basal medium. In the specification, it is referred to as “293T basal medium”.

(33) For example, when Lenti-X 293T is used as the cell line, cell suspension including 1 to 5×10.sup.5 cells/mL is prepared, and 10 mL of the suspension is plated into dish with 10 cm diameter. Then, the dish is incubated in 5% CO.sub.2 incubator for about 24 hours, and then passed until use depending on their cell conditions. When they are used, firstly, supernatant of the cultured cells, which are actually passed, are removed and then cells are washed with PBS. After that, a commercially available release agent is added to the cells to release them from the bottom surface of the dish to collect. Next, a desirable volume of the cell suspension, which is diluted 3 to 5 times, is takes out, and trypan blue staining solution is added for cell counting on a hemocytometer. About 5×10.sup.5 cells/mL of the cell suspension is prepared by using the basal medium, and for example, the cells are plated in the dish at desirable concentration, and then incubated under the desirable conditions. For example, 1 to 4×10.sup.6 cells/mL of the cells are plated into the collagen coat dish with the diameter of 6 cm, and then they are incubated in the 5% CO.sub.2 incubator at about 37° C. for about 24 hours. After that, culture medium is changed with fresh one for further incubation.

(34) As the retrovirus preparation cells, G3T-hi cell (Takara Bio Inc.) is preferably used. The cell is prepared from a cell line of 293T (G418-resistant) derived from human kidney cell transformed with hygromycin resistant gene to be inserted human N-acetyl glucosaminyl transferase III (N-acetyl glucosaminyl transferase II: GnT-III).

(35) The G3T-hi cell is designed so as to transiently produce high titer of recombinant viruses by co-transfecting a vector plasmid for gag-pol gene and env gene, and a recombinant retro virus vector plasmid to which target genes are inserted by using Retrovirus Packaging Kit Eco or Ampho (Takara Bio Inc., Code Nos.: 6160, 6161). Because, the G3T-hi cell is 293T origin, it has T-antigen genes of SV40 and they functions to amplify retrovirus RNA, thereby virus solution has high titer is obtained. In general, the virus solution including 10.sup.5 to 10.sup.7 cfu/mL is obtained in transient expression by using Retrovirus Packaging Kit.

(36) Sugar chains on the G3T-hi cell membrane are modified with GnT-III. Since budded retrovirus wears host cell membrane, it is assumed that the sugar chain on the membrane protein of the recombinant retrovirus obtained from the G3T-hi cell is modified with GnT-III. By glycosylation, the retrovirus prepared by using the G3T-hi cell has high affinity to RetroNectin (a recombinant fibronectin fragmernt). Therefore, the use of RetroNectin as a coating agent of culture vessel highly improves the gene transduction efficiency to the target cells. RetroNectin is particularly effective for the gene transduction for hematopoietic cell as the target.

(37) When G3T-hi cell is used, the medium which is composed of DMEM containing glucose (4.5 g/L) and L-glutamine (584 mg/L) supplemented with 10% FBS and 1% penicillin/Streptomycin is preferably used instead of the 293T basal medium, because of the retrovirus production efficiency.

(38) 1.3 Preparation of the Virus Vector

(39) Hereinbelow, it is explained by using the lentivirus vector as an example.

(40) As described above, the lentivirus vector plasmid prepared as described above is added to the dishes containing culture cells respectively for co-transfection. For such a co-transfection, commercially available packaging system, for example, Lenti-X HTX packaging system (Clontech Laboratories Inc.) and the like may be used. According to manuals attached to them, concrete procedures may be conducted.

(41) After co-transfection, the medium are replaced with fresh complete medium, and incubated at about 37° C. for 24 to 28 hours. Titration of the virus vector is conducted for deciding the timing for recovery, and the culture supernatant including virus vector is recovered when the virus titer becomes maximal. For the titration of the virus vector, the commercially available convenient titration kit, for example, there are mentioned such as Lenti-X GoStix (Clontech Laboratories Inc.) and the like.

(42) For example, next day of the medium change, the culture supernatant in a petri dish is taken out by using desired size of a syringe to collect them. The collected supernatant is filtrated to obtain the virus vector. For example, the supernatant is taken out by using 10 mL of disposable syringe (Terumo Corporation), and then, for example, 0.45 μm of a filter (MILEX-HV, Millipore limited) is attached to the syringe, the virus vector solution is collected into, for example, 15 mL of tube, filtrating the culture supernatant in the syringe.

(43) Next, a reagent included in the commercially available convenient titration lit is used for confirming whether the recombinant lentivirus vector is present or not. For example, the desirable volume of the virus vector solution, for example, 20 μL, is added to S of the Lenti-X GoStix, and Chase Buffer 1 is further added to the solution, and reacted at the desirable temperature and time, for example 10 minutes. Presence of the recombinant lentivirus vector is confirmed with/without appearance of bands.

(44) Cells harboring 4 plasmids (E7T, BT, BE6T and E6E7T) obtained as described above are streaked on an agar medium. Formed colonies are picked up for plating in the desirable medium, for example, 2 mL of LB medium containing antibiotics, and then they are vigorously cultured in a shaker at about 37° C. for 8 hours.

(45) Next, for example, the described volume, 100 μL, of cultivated solution of the cells cultured as describe above is inoculated into 50 mL of LB medium containing a different antibiotic, for example, ampicillin. Then they are vigorously cultured in a shaker at about 37° C. for about 14 to 18 hours.

(46) Volume of the plasmid eluted with water is determined by using the commercially available kit, for example, MN NucleoBond Xtra Mid Kit (Clontech Laboratories Inc.). Together with this procedure, analysis for confirming that the inserted DNA are mutually different is conducted by using the desirable gel, for example, about 1% agarose gel. As the analysis marker for the gel electrophoresis, for example, supercoil DNA ladder, λ-Hind II digested DNA and the like maybe used. As described above, the virus vector may be prepared.

(47) 2. Preparation for Mammal Stem Cells

(48) 2.1 Preparation for the Swine Dental Pulp Stem Cell

(49) Swine jaw (which has teeth on lower jaw) from the swine of 5 to 6 month old and mesentery are obtained. According to the following procedure, swine dental pulp stem cells (herein below, they are sometimes referred to as “SHED”) are obtained from the swine teeth and the lower jaw.

(50) Firstly, the swine teeth and the lower jaw are disinfected by using appropriate disinfection agent such as Isodine. Then, a crown of the tooth is cut in horizontal direction by using, for example, a diamond point for a dentist and the like. Then, the dental pulp is collected both from the dental crown and dental root portions treated as mentioned above by using, for example, a hand scaler for the dentist and the like.

(51) Obtained dental pulps are chopped by using such as an ophthalmic knife to be suspended in a predetermined concentration of collagenase solution, for example, 1 to 3 mg/mL to stand for 1 hour into single cell. Then, they are preliminary cultured in DMEM containing 10% FBS, and 1% of Anti-Anti (Invitrogen, Carlsbad, Calif.) for at 37° C. in 5% CO.sub.2 incubator for obtaining the cells for passage.

(52) Until the cell numbers are increased to sub-confluent, the medium is exchanged 2 to 3 times per week. Then, the cells in subconfluent state are released from the dish by using the releasing agent such as Hepes solution containing 0.05% trypsin. After that, the cells are collected under the desirable conditions such as at room temperature, and centrifuged at 1,500 rpm for 3 minutes to be collected. The obtained cells are transferred into the fresh medium and conducted cell passage by using the desirable amount, for example, entire volume.

(53) 2.2 Preparation of the Swine Adipose Stem Cell

(54) Adipose tissues are excised from the swine mesenteric by using, for example, a dissecting scissors and knife. The excess tissues are removed and then blood is washed out from them by using saline. Obtained adipose cells are transferred into the desirable medium, for example, DMEM supplemented 5 to 15% of bovine serum and desirable concentration of antibiotics. Then, they are preliminary cultured under the same conditions as described above. Subsequently, they are cultured in the DMEM described above at 37° C., 5% CO.sub.2 until they become subconfluent. All of the added amounts are shown as the final concentrations. As such medium, for example, DMEM supplemented with about 10% bovine serum, about 100 U/mL of penicillin and about 100 μg/mL of streptomycin may be used.

(55) Similarly to the swine SHED, the cells were released from the dish by using the releasing agent, and then subjected to centrifugation. Then, the obtained cells are passaged to obtain the adipose stem cells.

(56) 2.3 Preparation for Dental Pulp Stem Cells from Human Exfoliated Dens Deciduous Teeth

(57) Exfoliated or extracted dens deciduous teeth are obtained from healthy children. These dens deciduous teeth are disinfected by using appropriate disinfection agent, for example, Isodine solution, and then the dental pulp tissues are collected as the same as those for obtaining the swine dental pulp tissues. Obtained dental pulp tissues are digested with in the solution including the desired concentrations of collagenase and dispase, for example, about 3 mg/mL of type I collagenase and about 4 mg/mL of dispase at desired temperature for the desired time, for example, about 37° C. for about 1 hour. Next, the solution is filtrated by using, for example, 70 mm of a cell strainer (Falcon) to separate cells.

(58) The cells thus filtrated are re-suspended, for example, in 4 mL of the above-mentioned medium, and plated into the culture dish for adherent cell culture with desirable diameter, for example, 6 cm. Desirable medium, for example, DMEM supplemented with about 10% FCS, is added to the dish and cultured for desirable period, for example, 2 weeks in the incubator under the conditions of 5% CO.sub.2, at 37° C. Adherent cells formed colonies, the dental pulp stem cells, are treated with the desirable releasing agent, for example, about 0.2 mM EDTA containing about 0.05% of trypsin for desirable time period, for example, 5 minutes, at about 37° C. to collect the cells released from the dishes.

(59) Next, the adherent cells collected as described above is plated in such as the dish for the adherent cells (collagen-coat dish), and they are primarily cultured in the incubator under the conditions of, for example, 5% CO.sub.2, 37° C. to obtain primary cultured cells. When the cells became subconfluent or confluent by macroscopic observation, the cells are treated as the same as those described above by using the releasing agent to collect the cells in the dish.

(60) After that, the primarily cultured cells are passaged by using the above-mentioned medium at the desirable concentration, for example, about 1×10.sup.4 cells/cm.sup.2. The cells passaged 1 to 3 times are employed in experiments. As described above, human exfoliated dens deciduous dental pulp stem cells (SHED) are obtained.

(61) Depending on the necessity, dental pulp stem cells from the swine dens deciduous dental pulp stem cells as described above, swine adipose stem cells and th dental pulp stem cell from the human exfoliated dens deciduous dental pulp stem cells may be poured into vials respectively, and may be cryopreserved −80° C.

(62) 3. Preparation of Gene Introduced Cells

(63) 3.1 Transgenesis by the Lentivirus Vector

(64) The swine dental pulp stem cells, the swine adipose stem cells and human dental pulp stem cells obtained as described above are respectively cultured as mentioned above. The cells reached about 70 to 90% confluent, mycoplasma check are conducted by using a commercially available kit. As the kit, there are mentioned, for example, MycoAlert Mycoplasma Detection Kit (Lonza, LT07-318) and the like.

(65) Next, the lentivirus vector prepared as described above is infected to the cells respectively by using Polybrene reagent, and then the cells stably expressing the target genes are selected under selection pressure of the reagent.

(66) The culture supernatant of the cells is respectively removed, and then the cells are respectively washed by using, for example, PBS (pH 7.4). After that, the cells are released from the dish by using the desirable releasing agent, and then respectively collected. As the releasing agent, for example, StemPro (Registered trademark: GIBCO) may be used for the swine dens deciduous dental pulp stem cells and the swine adipose stem cells; and trypsin—EDTA and then like may be used for human dental pulp stem cells.

(67) Obtained cells are counted according to the conventional method, and then they are plated into each well of, for example, 6-well plate (CORNING) with tissue culture treatment (T. C. treatment) so as to be about 1×10.sup.5 cells/well. They are incubated in the CO.sub.2 incubator at about 37° C. for about 24 hours to confirm even distribution of the cells in the well.

(68) After that, the culture supernatant is removed. The desired volume of the desired medium containing desired concentration of Polybrene, for example, the desirable amount of DMEM containing about 8 μg/mL of Polybrene and about 10% of FBS, is added for the dental pulp stem cell of the swine dens deciduous dental pulp stem cells or the swine adipocyte stem cells at 750 μL/well. Next, the lentivirus vector solution described above is added into each cell, for example, at about 250 μL/well.

(69) In the case of the human dental pulp stem cell of the dens deciduous teeth, DMEM containing the same amount of Polybrene and FBS is added into the wells at desirable amount, for example, about 1.2 mL/well, and then, the lentivirus vector solution is added to each cell at the desirable amount, for example, about 400 μL/well.

(70) Each plate to which the virus vectors are added as described above is centrifuged under the desirable conditions such as at about 1,000×g for about 30 minutes, at about 32° C. for virus infection of the cells. After that, they are cultured under the desirable conditions such as at about 37° C. in CO.sub.2 incubator for about 4 to about 6 hours; and desirable volume of the fresh culture medium, for example, about 1 mL/well, is added into each well. Then, they are cultured under the desirable conditions, for example, at 37° C. in the CO.sub.2 incubator for about 24 hours to conduct the gene transduction.

(71) 3.2 Selection Under the Presence of the Agents

(72) The culture supernatant of the cultured stem cells (the swine dental pulp stem cells, swine adipose stem cells, and human dental pulp stem cells), which are cultured as described above, are removed from each well of the culture plate. Then, the desirable concentration of the agents for selection, for example, selection medium containing either of about 0.4 mg/mL or about 0.8 mg/mL of GENETICIN (G418, GIBCO) is added into each well in the desirable volume, for example, about 2 mL/well to exchange the culture medium. After that, the cells are cultured for desirable period, for example, about 3 to 5 days exchanging the culture medium for selecting the gene transduced cells.

(73) A portion of the cultured cells are subjected to the cloning, and remains are subsequently cultured in the selection medium as pool cells. The cloning may be conducted as follows.

(74) For example, the selection medium without the antibiotics such as that does not contain penicillin/Streptomycin and G418 is used for cell dilution. The cells are diluted to the desirable concentration, for example, about 1×10.sup.3 cells/4 mL or about 5×10.sup.3 cells/4 mL is plated into each dish, and then, they are incubated at about 37° C. in the CO.sub.2 incubator for about 24 hours. Formed colonies are marked from the rear side of the dish, and they become the desirable number, for example, about 100; the culture supernatant in the well is removed for washing the cultured cells with PBS. Cloning rings are set in the dishes and the cells from the colonies which are released by using the releasing agent is respectively placed in each well of 48 well plate at the desirable amount, such as about 1 mL.

(75) 3.3 Preparation of Total RNA

(76) In order to confirm the gene expression, total RNA is prepared by using, for example, NucleoSpin RNA II (a kit provided by MACHEREY-NAGEL). It is preferable to use the buffers employed in below, the ring filter and the like which are included in the kit, and to perform the procedure according to the manual included in the kit; because those bring total RNA with high purity.

(77) Lysate of cell pellet is prepared from the desirable number, for example, about 5×10.sup.5 cells, and it is poured into the ring filter with purple color. Then, it is centrifuged under the desirable conditions such as at about 11,000×g for about 1 minute. After the centrifugation, the filter was discarded and then, the desirable amount of ethanol, for example, about 350 μL of about 70% ethanol is added into the collection tube. The solution is mixed with pipetting in desirable numbers such as about 5 times.

(78) Next, the desirable amount of the obtained solution is taken out, for example, about 700 μL and then it is loaded on the ring column with pale blue color set in the collection tube. Then, the tube is centrifuged under the desirable conditions such as about 11,000×g for about 30 seconds to bind RNA. After the centrifugation, the column is set in the new collection tube. Then, the desirable reagent such as about 350 μL of MDB is added into the tube, and centrifuged under the desirable conditions such as at about 11,000×g for about 1 minute for desalination.

(79) After the centrifugation, DNA reaction mixture is prepared by mixing lightly, for example, the desirable amount of rDNase, for example, about 10 μL with that of DNase reaction buffer, for example, about 90 μL. The desirable amount of the mixture, for example, about 95 μL is added to the column, and incubated under the desirable conditions such as at room temperature for about 15 minutes to digest DNA. Subsequently, the desirable amount, for example, 200 μL of buffer RA2 is the column and they are centrifuged under the desirable conditions such as about 11,000×g at about 30 seconds to wash. Subsequently, the column is set in the new collection tube, and the desirable amount such as about 700 μL of buffer RA3 is added to the column for the further centrifugation under the desirable conditions such as about 11,000×g for about 30 seconds.

(80) Subsequently, eluted solution in the collection tube is discarded, and the desirable amount, for example, about 250 μL of the buffer RA3 is again added to the column for the centrifugation under the desirable condition, for example, at about 11,000×g for about 2 minutes to sir-dry a silica membrane of the column. The column is set in the desirable size such as about 1.5 mL of the collection tube, and the desirable amount of RNAase-free water, for example, about 60 μL is added to the column. Then, the column is centrifuged under the desirable conditions such as about 11,000×g for about 1 minute to obtain total RNA sample.

(81) 3.4 Reverse Transcription

(82) The total RNA sample obtained as describe above is subjected to reverse transcription. Subsequently, it is subjected to real time PCR to obtain PCR products. In order to conduct the reverse transcription, for example, commercially available kit such as PrimeScript RT reagent Kit (Perfect Real time, TaKaRa Bio) according to the manual attached thereof.

(83) The real time PCR is conducted by using the commercially available kit, for example, SYBR Premix Ex Taq and the like. Also, as the genes employed here, there are mentioned, for example, such as swine β-actin, human β-actin and the like. As primers, for example, those listed in the sequence Nos. 10 to 15 are prepared for use.

(84) Firstly, the desirable amount, for example, Premix for real time PCR is prepared by mixing about 350 μL of SYBR Premix Ex Taq II (×2), about 28 μL of Primer mix (about 10 μL) and about 266 μL of redistilled water. Next, the desirable amount of Premix, for example, about 23 L is poured into each tube for real time PCR, and about 2 μL of the template cDNA into each tube. Then, real time PCR is conducted under the desirable conditions, for example, at about 95° C. for about 30 seconds, about 40 cycles of (at about 95° C. for about 5 seconds, and then at about 60° C. for about 30 seconds). Subsequently, amplified products are released under the desirable conditions, for example, at about 95° C. for about 15 seconds, at about 60° C. for about 30 seconds, at about 95° C. for about 15 seconds to obtain a melting curve. For the human dental pulp stem cells, the same procedures are conducted.

(85) From the calibration curve described above, the expression levels of the transduced gene by using each virus vectors may be obtained. By using the calibration of internal standards, accurate results may be obtained.

(86) In each gene-transduced stem cell, it is confirmed that the transduced genes are expressed. By this, insertion efficiency of the genes by using each plasmid may be obtained.

(87) Next, the gene-transduced cells (hereinbelow, they are sometimes referred to as the “transduced-gene stably expression cell population” or the “pool cells”.) is subjected to single cell cloning.

(88) Firstly, the pool cells are plated in the desirable size dish with desirable concentration, for example, in the dish having 60 mm diameter with about 1×10.sup.3 cells/dish and they are cultured in CO.sub.2 incubator at the desirable temperature and time, for example, at 37° C. for 24 hours. After that, the growth medium containing the selection reagents described above are exchanged, and further cultured to form colonies. Each formed colonies are respectively taken out by using both of the cloning ring and the releasing agent and to desirable plate, for example, 24-well plate.

(89) The plated cells are grown and then, they are plated into the culture dish and the like to grown for expanding culture (cell expansion). By this, the transduced-gene stably expression cell is obtained as a single clone. Next, the obtained clone is cultured as described above for grown then to obtain total mRNA. The obtained total RNA is used as the template for reverse transcription by using the desirable kit, for example, PrimeScript RT reagent Kit to obtain template cDNA.

(90) After that, real time PCR is conducted similarly to those described above by using, for example, cDNA (reverse transcription products) as the template, the above-mentioned SYBR Premix Ex TaqII (Tli RNaseH Plus), the primers (specific primers for the gene-transduced cells or the internal standard genes respectively, for example, the primers shown as Seq. Nos. 10 to 15).

(91) Ct value obtained by using the secondary differentiation curve from the real time PCR is plotted on X-axis, and the relative total RNA value is plotted on Y-axis to prepare the calibration curve for expression determination amount of each gene. When the expression amount of the pool cell equals 1, relative index of these of the transduced-genes derived from the swine dental pulp stem cell or these derived from human dental pulp stem cell is obtained. By this, it is confirmed whether all of the transduced-genes are expressed, or obtain the expression amount thereof is obtained for selecting the clone as the target.

(92) As described above, both of the immortalized stem cell population and cloned immortalized stem cell therefrom may be obtained.

EXAMPLE

(Example 1) the Preparation of Virus Vector (No. 1)

(93) (1) The Preparation of Cells for Virus Preparation

(94) (1-1) The Reagents and the Like, and Wake-Up of the Cells

(95) As the recombinant lentivirus vector production cell line, Lenti-X 293T (Clontech Laboratories Inc., code No.: 632180) is used. For culturing Lenti-X 293T, DMEM (SIGMA, code No.: D5796-500ML) containing 10% fetal bovine serum (FBS, Hyclone, Lot No.: GRD0051) and antibiotics (1% penicillin/Streptomycin, GIBCO, code No. 15140-122) was used. In the present specification, hereinbelow, the medium is referred to as “293T basal medium”. Freeze dried cells (Cellbanker, code No.: BLC-1) was purchased from Nippon Zenyaku Kogyo Co., Ltd.

(96) Firstly, Lenti-X 293T cells were suspended in 293T basal medium, and a portion thereof was taken out and diluted 8 times. 140 μL of trypan blue staining solution was added into 20 μL of the diluted medium for cell counting by using the hemocytometer. Cell concentration was 2.94×10.sup.6 cells/mL. 10 mL of the obtained suspension was transferred into the centrifuge tube together with 4 stored vials including 2.0×10.sup.6 cells. The centrifuged tubes were centrifuged at 200×g for 3 minutes, at room temperature to collect the cells. The supernatant of the collected cells were removed completely, and the cells were suspended in necessary amount of the cell stage solution to prepare the cell suspension. The suspension was dispensed at 1 mL/vial, and then they were stored at −80° C. Depending on the necessity, they were transferred into liquid nitrogen in a container on next day for the stage.

(97) (1-2) Preparation of the Recombinant Lentivirus Vector Production Cells

(98) DMEM, the antibiotics, and FBS were the same as those used in (1-1). Also, phosphate buffered saline (PBS (−), code No.: 10010-049, hereinbelow, it is sometimes simply referred to as “PBS”.) were purchased from GIBCO. The T. C.-treated dishes having 10 cm diameter were purchased from Iwaki & Co. Ltd. The releasing agent, 0.25% trypsin—EDTA (1×) was purchased from GIBCO.

(99) 10 mL of 293T basal medium was added into 15 mL tube. The suspension in the vials stores in (1-1) was rapidly thawed in a water bath at 37° C., and then they were added into the centrifuge tube. They were centrifuged at 200×g for 3 minutes, at room temperature to collect the cells. As the same as those in (1-1), trypan blue staining was conducted to count the cell numbers by using hemocytometer. The cell number per vial was 2.0×10.sup.6 cells.

(100) The cells were plated in the concentration from 1 to 5×10.sup.6 cells/10 mL/10 cm dish, and they were cultured for about 24 hours in the 5% CO.sub.2 incubator. After that, they were passes until use according to the cell conditions.

(101) (2) The Preparation of the Recombinant Lentivirus Vector

(102) (2-1) Reagents and the Like

(103) DMEM, the antibiotics, FBS, the releasing agent, and PBS were the same as those used in (1-1). Collagen coated dishes having the diameter of 6 cm are purchased from Iwaki & Co. Ltd., and the transfection reagents (TransIT-293, code No.: MIR2700) was purchased from Mirus Bio LCC., respectively. Both of the recombinant lentivirus vector production reagent (Lenti-X™ HTX Packaging System, code No.: 631247, Clontech Laboratories Inc.) and Lenti-X HTX Packaging Mix (VSV-G) were purchased from Clontech Laboratories Inc.

(104) (2-2) Preparation of the Recombinant Lentivirus Vector (Transfection Plasmid)

(105) The following 4 lentivirus vectors were constructed. Those were constructed on the basis of pLVSIN vector sequence information downloaded from the Takara Web Catalogue, according to the following procedures.

(106) (v1) the Lenti Vector E7T (EcoRI/KoZal/E72A4/hTERT/BamHI)

(107) According to the sequence information, the double strand DNS of EcoRI/KoZal/E7/T2A4/hTERT/BamHI (Seq. 1) was synthesized. Then, they were cloned into multi cloning sites of (pLVSIN-CMV Neo, see FIG. 1) by using standard procedure to obtain SYN4122-1-7 (Seq. No. 1 in the sequence listing).

(108) (v2) the Lenti Vector BT (EcoRI/KoZal/Bmi-1/T2A4/hTERT/BamHI)

(109) According to the sequence information, the double strand DNA of Bmi-1 was synthesized and replaced with E7 of the lentivirus vector E7T (Seq. No. 2 in the sequence listing), which was prepared in (v1).

(110) (v3) the Lenti Vector BE6T (EcoRI/KoZal/Bmi-1/T2A3/E6/T2A4/hTERT/BamHI)

(111) According to the sequence information, the double strand DNA of T2A3E6 was synthesized and inserted between Bmi-1 of the lentivirus vector, which was prepared in (v2), and T2A4 (Seq. No. 3 in the sequence listing).

(112) (v4) the Lenti Vector E6E7T (EcoRI/KoZal/E6/T2A3/E7/T2A4/hTERT/BamHI)

(113) According to the sequence information, the double strand DNA of E6T2A3 was synthesized and inserted between Kozak sequence of the lentivirus vector E7T, which was prepared in (v1) and E7 (Seq. No. 4 in the sequence listing).

(114) (2-3) Preparation of the Cells for Co-Transfection

(115) The supernatant of Lenti-X 293T cells passed as described in the (1) (1-2) was removed. Then cells were washed by using PBS and collected by adding the releasing agent into the dish.

(116) From 4 times diluted cell suspension, 50 μL of the portion was taken out, and the equal amount of trypan blue was added thereto. Then, cell numbers counted by using the hemocytometer was 2.38×10.sup.6 cells/mL. The basal medium as mentioned above was added into the suspension to adjust the cell numbers to 5×10.sup.5 cells/mL; and then plated into the collagen coat-dishes having 6 cm of the diameter at the concentration of 2×10.sup.6 cells/4 mL/dish. After that, they were incubated in the 5% CO.sub.2 incubator at 37° C. for about 24 hours. The culture medium was exchanged for further incubation.

(117) (2-4) The Transfection of the Lentivirus Vector and Packaging

(118) Co-transfection was conducted by using Lenti-X HTX packaging system (hereinbelow, it is sometimes simply referred to as the “packaging system”.). Xfect Polymer was sufficiently vortexed, and 2 micro tubes for each transfection sample (the tube 1 and 2) were prepared. In the tube 1, 179 to 182 μL of Xfect Reaction buffer was added, and 15 μL of Lenti-X 293 T Packaging Mix was further added, and then finally, 3 to 6 μL of the vector plasmid shown in Table 1 (plasmid solution, 200 μL in total). Also, in the tube 2, 197 μL of Xfect Reaction buffer was added, and 3 μL of Xfect Polymer was further added (polymer solution, 200 μL).

(119) TABLE-US-00001 TABLE 1 Seq, Modification length at 5′ terminal/3′ Conc. Vector No. Name (bp) terminal (ng/mL) SYN4122-1-7 LVE7T 3,780 EcoRI/BamHI 543 SYN4122-2-2 LVBT 975 — 650 SYN4122-3-3 LVBE6T 537 — 736 SYN4122-4-4 LVE6E7T 537 — 569

(120) These 2 tubes were respectively fully mixed by using vortex; and then the polymer solution was added into the plasmid solution and vortexed with moderate strength to obtain DNA-Xfect mixture. The DNA-Xfect mixture was stood in ambient for 10 minutes to form nanoparticles. Lenti-X 293T cells prepared in (2-3) as mentioned above were taken out from the CO.sub.2 incubator, and 2 mL of the medium was removed. Then, entire amount of the DNA-Xfect mixture (400 μL) was dropped therein. The dish was gently swung to penetrate the DNA-Xfect mixture inside of the whole dish.

(121) Subsequently, the dish was again placed in the CO.sub.2 incubator and incubated at 37° C. After 4 hours, 2 mL of the Lenti-X 293 T cell strain growth medium, which is composed of DMEM containing the high concentration of the glucose (4.5 g/L), 4 mM L-glutamine, and 3.7 g/L of sodium bicarbonate supplemented with 10% of Tet System Aproved FBS, 1 mM sodium pyruvate (hereinbelow, it is sometimes simply referred to as the “complete medium”.) was added, and incubated at 37° C. for overnight.

(122) Next, the medium was exchanged with the fresh complete medium (4 mL), and incubated at 37° C. for 24 to 48 hours. Recovery timing was determined, conducting convenient titer measurement of the virus vector by using Lenti-X GoStix (for 3 tests, Clontech Laboratories Inc.). The culture supernatant containing the lenti virus was collected at the time point when the virus titer became maximal.

(123) (2-5) The Collection of the Lentivirus Vector

(124) In the next day of the medium exchange, the culture supernatant in the dish was aspirated by using 10 mL of the disposable syringe (Terumo Corporation) for the collection. The virus vector solution was collected in the 15 mL of the tube by filtration of the culture medium in the syringe through 0.45 m pore size (MILEX-HV, Millipore) attached thereto. The filtrated culture supernatant collected in the tube was mixed, and then dispensed at 1 ml/vial for storing at −80° C. About 200 μL portion was separately stored as the virus vector solution for titration.

(125) (2-6) Convenient Titration of the Lentivirus Vector

(126) 20 μL of the virus vector solution for titration was added to Lenti-X GoStix, and then 4 drops of Chase Buffer 1 were added. Next, they were reacted at ambient for 10 minutes, and then band formation was confirmed. As shown in FIGS. 2 (A) to (E), all of measured SYN4122-1-7, SYN4122-2-2, SYN4122-3-3 and SYN4122-4-4 showed 2 bands, which confirms the existence of the recombinant lentivirus vectors. In the figure, left band shows the reference, and right one shows the recombinant lentivirus vector.

(127) (3) SYN4122 Transfection Plasmid

(128) Lenti-X 293 T cells including 4 plasmids obtained described above (SYN4122-1-7, SYN4122-2-2, SYN4122-3-3 and SYN4122-4-4) were streaked on the agar medium to form colonies. Formed colonies were picked up and plated in 2 mL of LB medium containing antibiotics and cultured with vigorous shaking (200 rpm) at 37° C. for about 8 hours.

(129) Next, 100 μL of the culture broth of the cells cultured described above was transferred into 50 mL of LB medium containing ampicillin, and cultured with vigorous shaking (200 rpm) at 37° C. for about 16 hours.

(130) By using MN NucleoBond Xtra Mid Kit (Clontech Laboratories Inc.), the plasmid was eluted with water and its amount was measured. Along with this, it was analyzed on agarose gel (1%). As the markers, M1 was the supercoil DNA ladder, and M2 was λ-Hind m digested DNA. Results were shown in Table 1 and FIG. 3. Agarose gel electrophoresis result showed that the incorporated DNAs were respectively different.

(Example 2) Preparation of the Virus Vector (No. 2)

(131) (1) Preparation of the Cells for the Retrovirus Preparation

(132) (1-1) Reagents, Wake-Up of the Cells, Etc.

(133) As the retrovirus preparation cell line, G3T-hi cells were used. In order to culture G3T-hi cells, DMEM (SIGMA, code No.: D5796-500 mL) containing glucose (4.5 g/L). L-glutamine (584 mg/L), 10% fetal bovine serum (FBS, Hyclone, lot No.: GRD0051) and the antibiotics (1% of penicillin/Streptomycin, GIBCO, code No. 15140-122) was used.

(134) The cell culture was conducted as the same as those in the case that Lenti-X 293T cells were suspended in the 293T basal medium. From the collected cells, culture supernatant was completely removed and then the cells were suspended in the necessary amount of the cell storage medium to prepare the cell suspension. It was dispensed at 1 mL/vial and stored at −80° C. Depending on the necessity, they were transferred into the container including liquid nitrogen to be stored on the next day.

(135) (1-2) Preparation of the Retrovirus Vector Producing Cells

(136) DMEM, the antibiotics, FBS, glucose and L-glutamine were the same those used in (1-1). PBS, T. C. treated dish having 10 cm diameter of the diameter, and 0.25% trypsin—EDTA (1×) were the same as those used in Example 1.

(137) 10 mL of the medium was added into 15 mL size centrifuge tube. The cell suspension in the stored vials in (1-1) were rapidly thawed by warming in the water bath at 37° C. was added into the centrifuge tube. It was centrifuged at 200×g for 3 minutes at ambient to collect the cells. The cells were stained by using trypan blue as the same as those in (1-1) and cell numbers were counted by using the hemocytometer. The cell number per vial was 3.0×10.sup.6 cells.

(138) The cells were plated at the concentration from 1 to 5×10.sup.6 ells/10 mL/10 cm dish, and incubated in the 5% CO.sub.2 incubator for about 24 hours. After that, they were passed until use, according to the cell condition.

(139) (2) Preparation of the Recombinant Retrovirus Vector

(140) (2-1) Reagents and the Like

(141) DMEM, the antibiotics, FBS, the releasing agent, and PBS were the same as those used in (1-1). Collagen coated dishes (6 cm), and the transfection reagents (TransIT-293, code No.: MIR2700) were employed those as the same as Example 1. All of Retrovirus Packaging Kit Ampho, Retrovirus Titer Set (for Real Time PCR), and One Step SYBR PrimeScript RT-PCR Kit (all of them were from Takara Bio Inc.) were used.

(142) (2-2) Preparation of the Retrovirus Vector (Transfection Plasmid)

(143) The following 5 retrovirus vectors were constructed. Those were constructed on the basis of pDON-5 NEO vector sequence information, according to the following procedures.

(144) Five immortalized genes to which Kozak sequence (gccacc) was added to the upstream of the initial codon (hTERT (Seq. No. 5 in the sequence listing), E6 of human papilloma virus (Seq. No. 6 in the sequence listing) and E7 (Seq. No. 7 in the sequence listing), pig TERT (Seq. No. 8 in the sequence listing), and hBmi-1 (Seq. No. 9 in the sequence listing)) were prepared according to the conventional method, and then they were cloned into PmaC I-Hpa I site of pDON-5 NEO DNA (TaKaRa Code 3657: see, FIG. 7) to obtain 5 retrovirus vectors (pDON-5 Neo hTERT vector, pDON-5 Neo HPV16E6 vector, pDON-5 Neo HPV16E7 vector, pDON-5 Neo pHTERT vector, and pDON-5 Neo hBmi1 vector).

(145) E. coli was transformed with 5 plasmid DNAs prepared as described above, according to the conventional method, and the transformants were incubated at 37° C. in the CO.sub.2 incubator to prepare respectively the plasmid DNA (about 50 μg) of transfection grade. Each plasmid DNA was dissolved in the sterile water to prepare DNA solution.

(146) (2-3) The Production of the Recombinant Retrovirus Vector

(147) G3T-hi cells were plated in 5 tissue culture dish (100 mm) at the concentration of 6×10.sup.6 cells/dish, and cultured in the 5% CO.sub.2 incubator at 37° C. for about 24 hours. Then, 0.4 mL of the transfection reagent (TransIT-293) was added, and 3 plasmid vectors were chosen from 5 of them for co-introduction of pGP and pE-Ampho (both of them were included in Retrovirus Packaging Kit Ampho). After that, they were further incubated for 40 to 56 hours under the same conditions for introduction of the genes. Then, the cells were further cultured for 48 hours under the same conditions. After the termination of the culture, the culture supernatant including the retrovirus vector was collected and then it is subjected to sterile filtration by using 0.45 μm (Millipore), and then 1 mL of them were dispensed into the tubes.

(148) (2-4) Calculation of the Titer of the Recombinant Retrovirus Vector

(149) The titer of the recombinant retrovirus vector was determined by using Retrovirus Titer Set (for Real Time PCR) or One Step SYBR PrimeScript RT-PCR Kit (Perfect Real Time) (both of them were from Takara Bio Inc.), according to their manuals. Copy numbers of the RNA control template attached in each kit were plotted on X-axis, and the Ct values obtained from the secondary differentiation curve (2.sup.nd Derivative) were plotted on Y-axis to prepare the calibration curve. By using the calibration curve, the titers of the test samples were obtained.

(150) DNase I treatment was conducted at 37° C. for 30 minutes, next at 70° C. for 10 minutes, and then cooled to 4° C. by using 12.5 μL of the recombinant retrovirus vector, 2.5 μL of 10×DNase I buffer, 2.0 μL of DNase I (5 U/μL), 0.5 μL of RNase inhibitor (40 U/μL) and 7.5 μL of RNase free sterile distilled water (total amount 25.0 μL). After completion of DNase I treatment, they were rapidly subjected to the real time PCR.

(151) 4 primers shown in the following Table 2 were designed and prepared for PCR. The composition of the primer mix for PCR (each 10 μL) was follows: 40 μL of the forward primer (50 μM; the target gene: CH000987-F, the reference gene: HA067803-F)), 40 μL of the reverse primer (50 μM; the target gene: CH000987-R, the reference gene: HA067803-R)), and 120 μL of the sterile distilled water. By using the primer mix for PCR, the real time PCR was performed under the same conditions as those in Example 1.

(152) TABLE-US-00002 TABLE 2 Type of Primers Symbols Sequences Seq. Nos. Target Genes CH000987-F GCACTGCCCTCAGACTTCAAGA 16 CH000987-R GCGGGACTATGGTTGCTGAC 17 Reference gene HA067803-F TGGCACCCAGCACAATGAA 18 (human β-actin) HA067803-R CTAAGTCATAGTCCGCCTAGAAGCA 19

(153) Subsequently, the real time PCR was conducted under the conditions at 42° C. for 5 minutes, at 95° C. for 10 seconds, and then 40 cycles of (at 95° C. for 5 seconds, and then at 60° C. for 30 seconds) by using 12.5 μL of 2× One Step SYBR RT-PCR buffer HI, 0.5 μL of TaKaRa ExTaq HS (5 U/μL), 0.5 μL of PrimeScript RT Enzyme Mix II, 0.5 μL of forward titer primer FRT-1 (10 pmol/μL), 0.5 μL of reverse titer primer FRT-1 (10 pmol/μL), 8.5 μL of RNase free sterile distilled water, and 2 μL of the template (total amount was 25.0 μL). Subsequently, the PCR products were denatured under the conditions such as at 95° C. for 15 seconds, at 60° C. for 30 seconds, and at 95° C. for 15 seconds to obtain renaturation curve. The titer of the test samples (the vectors) are shown in the following Table 3.

(154) TABLE-US-00003 TABLE 3 Vector Nos. Name of Seq. Average Titer (copies/mL) SYN5587-1-4 pDON-5 Neo hTERT 1.46 × 10.sup.10 SYN5587-2-10 pDON-5 Neo HPV16E6 1.15 × 10.sup.10 SYN5587-3-7 pDON-5 Neo HPV16E7 4.05 × 10.sup.10 SYN5587-4-9 pDON-5 Neo pTERT 1.27 × 10.sup.10 SYN5587-5-1 pDON-5 Neo hBmi1 2.83 × 10.sup.10

(Example 3) Preparation of the Stem Cells

(155) The lentivirus vectors obtained in Example 1 were infected to the swine dental pulp stem cells, the swine adipose stem cells, or human dental pulp stem cells prepared as described below respectively to prepare the strain stably expressing the target genes.

(156) (1) Preparation of the Stem Cells

(157) (1-1) The Swine Dental Pulp Stem Cell

(158) From Shokuniku Kosha Co. Ltd. (Minato-ku, Nagoya city, Japan), the jaw (the lower jaw with tooth) and mesentery of 5 to 6 month of swine were obtained. Those immediate after slaughtering were transported in the ice box including the thermal gel (−30° C.). From the swine tooth and the lower jaw, the swine dental pulp stem cells (SHED) were obtained according to the following procedure and transferred to the laboratory.

(159) The transferred swine tooth and the lower jaw were sterilized with Isodine. Then, the crowns of the tooth in the lower jaw were cut in horizontal direction by using the diamond point for the dentist, and cut in the vertical direction along with the pulp space to delete the overcanopy. The dental pulps were collected from the crowns and roots of the tooth treated as described above by the scaler for the dentist.

(160) The obtained dental pulps were chopped by using the ophthalmic knife to be suspended in 2 mg/L of collagenase solution. The solution was placed in the incubator at 37° C. for 1 hr, and the cells were separated. In order to obtain the cells for passage, the separated cells were preliminarily cultured in DMEM (SIGMA, St. Louis, Mo.) supplemented 10% FBS and 1% Anti-Anti (Invitrogen, Carlsbad, Calif.) under the conditions at 37° C. and 5% CO.sub.2.

(161) Firstly, in the initial stage of the culture, the cells were cultured until sub-confluent, replacing the medium 2 to 3 times per week. The sub-confluent cells were detached from the flask by using Hepes solution including 0.05% trypsin, and then, the cells were collected by the centrifugation in 1,500 rpm for 3 minutes at room temperature. The obtained cells were transferred into the fresh medium and the entire of the cells were used to the passage culture under the same conditions as described above.

(162) (1-2) The Swine Adipose Stem Cell

(163) From the swine mesenteric, adipose tissues were excised by using a dissecting scissors or knife, and collected. Excess tissues were removed for them and then remains were washed with saline to wash out blood. Obtained adipose cells are transferred into DMEM containing 10% bovine serum, 100 U/mL of penicillin and 100 μg/mL of streptomycin for the preliminary culture under the same conditions as described above. Next, they were cultures in the DME as mentioned above until they became subconfluent under the conditions of 37° C., 5% CO.sub.2. All of the added amounts were shown in final concentrations. Similarly to the swine SHED, the cells were detached by using 0.05% trypsin solution to be centrifuged for 3 minutes in 1,500 rpm to be subjected to the passage culture.

(164) (1-3) Dental Pulp Stem Cells from Human Dense Deciduous Teeth

(165) Exfoliated dense deciduous teeth from a healthy 10 years old boy were used. After the teeth were disinfected by using appropriate disinfection agent such as Isodine, the crown of the tooth was cut in horizontal direction by using the diamond point for a dentist. Then, the dental pulp tissue was collected both from the dental crown and dental root portions by using dental reamer. The obtained dental pulp tissue was digested in the solution containing 3 mg/mL of type I collagenase and 4 mg/mL of dispase at 37° C. for 1 hour. Then, they were filtrated by using the cell strainer with 70 mm (Falcon).

(166) The filtrated cells were resuspended in 4 mL of the medium, and plated in the culture dish for the adherent cell having the diameter of 6 cm. DMEM containing 10% FCS was added into the dish, and then incubated for about 2 weeks in the incubator under the presence of 5% CO.sub.2 at 37° C. The adherent cells formed the colonies (the dental pulp stem cells) were treated with 0.2 mM EDTA containing 0.05% trypsin for 5 minutes at 37° C., and then release cells from the dish were collected.

(167) Next, the collected cells described above were plated in the culture dish for the adherent cells (the collagen coated dish), and then conducted primary culture in the incubator under the presence of 5% CO.sub.2, at 37° C. to obtain the primary cultured cells. When the cells became subconfluent (about 70% of the surface was covered by the cells) or confluent by macroscopic observation, they were treated with 0.2 mM EDTA containing 0.05% of trypsin for 5 minutes, at 37° C. for releasing the cells from the culture dish and then to be collected.

(168) Thus obtained cells were again plated in the dich containing above medium, and passed several times to be grown until the cell number became about 1×10.sup.7 cells/mL. Obtained cells were stored in the liquid nitrogen.

(169) After that, the primary culture cells were cultured by using the above-mentioned medium at the concentration of about 1×10.sup.4 cells/cm.sup.2. The cells passed 1 to 3 times were used for the experiments. As described above, the human exfoliated dens deciduous dental pulp stem cells (SHED) were obtained. The swine dens deciduous dental pulp stem cells, the swine adipose stem cells, or human dens deciduous dental pulp stem cells were cryopreserved at −80° C.

(Example 4) Preparation of the Cells for Gene Transduction

(170) (1) Set Up of the Cells

(171) (1-1) Culture of the Swine Dental Pulp Stem Cell and Swine Adipose Stem Cells

(172) The culture medium (DMEM containing 10% FBS (GIBCO)) was used for the swine dental pulp stem cells or the swine adipose stem cells. 10 mL of the culture medium was added into the 15 mL size tube. The stored vials containing the swine dental pulp stem cells were rapidly thawed in the water bath at 37° C., and they were added into the tube. They were centrifuged at 200×g for 3 minutes in ambient. After removing the culture supernatant, 10 mL of the culture medium was added to have the suspension. A portion of the suspension was taken out and subjected to trypan blue staining, and then cell numbers were counted by using the hemocytometer. As a result, it was 5×10.sup.5 cells/vial.

(173) Next, the suspension was plated at the concentration of 1 to 5×10.sup.5 cells/10 mL/dish in the dish having the diameter of 10 cm (Iwaki & Co. Ltd., T. C. treated) and then incubated in the 5% CO.sub.2 incubator at 37° C. for about 24 hours. Then, the cells were observed by using the microscope. The medium in the dish was completely removed, and then 10 mL of the fresh culture medium was added. After that, they were incubated in 5% CO.sub.2 incubator at 37° C. for about 24 hours. After that, the cells were continuously passed until use depending on their conditions. The cells were released from the dish by using 0.25% trypsin—EDTA (GIBCO). Further to the swine adipose stem cells, the same procedures were conducted.

(174) (1-2) Human Dental Pulp Stem Cells

(175) For the human dental pulp stem cells, DMEM containing 10% FBS (SIGMA INC.,) was used. Other than that, the same procedures were the same as those in (1-1). Note that the result of the cell counting was 1.0×10.sup.5 cells/vial.

(Example 5) Selection of the Gene-Transduced Cells and Gene Expression Analysis (the Preparation of the Pool Cells)

(176) (1) Construct of the Lentivirus Vector Gene Transduced Cells

(177) Viable cell numbers among the set up cells described above were counted by using both of the trypan blue staining and the hemocytometer. They were plated in the dishes having the diameter of 10 cm at the concentration of 1×10.sup.6 cells/10 mL and then they were incubated in the CO.sub.2 incubator at 37° C. for about 24 hours. When the cell density reached 70 to 90 percent, confluent, the cells were diluted to the concentration of 1×10.sup.4 cells/mL and then used to passage. Also, the mycoplasma infection was checked as described in below.

(178) (2) Mycoplasma Check of the Culture Cells

(179) Mycoplasma infection of the cells was checked by using MycoAlert Mycoplasma Detection Kit (Lonza, LT07-318).

(180) Mycoplasma Alert reagent was added into each well of the 96-well plate (Corning, flat bottom) at 100 μL/well. Into the wells, the culture supernatant of the swine dental pulp stem cell or that of the swine adipose stem cell was added at 100 μL/well (6-well each). Pipetting was conducted 5 times for each well. The plate was placed in ambient for 5 minutes; bubbles were removed by using dryer. The measurement A was conducted by using Kinetic Cycles 5 with illuminometer (Tecan (infinite 200, microplate reader with multi-detection mode)).

(181) Next, MycoAlert substrate was added at 100 μL/well, and pipetting was conducted 5 times for each well. The plate was placed in ambient for 5 minutes; bubbles were removed by using dryer. The measurement B was conducted by using Kinetic Cycles 5 with illuminometer. Viable mycoplasma in the sample was lyzed to treat the MycoAlert substrate with enzyme of mycoplasma (Luciferin) to convert ADP to ATP. ATP levels before and after MycoAlert addition were measured, and then results were obtained by using the following equation. When R becomes not less than 1, the result was evaluated as positive; and when R becomes less than 1, it was evaluated as negative. Excitation wavelength was 565 nm. Results are shown in the following Table 4.

(182) R=Average of the measured value B/Average of the measured value A

(183) TABLE-US-00004 TABLE 4 Measured Measured Sample value A value B B/A Decision Medium (DMEM) 269 136 0.50 Negative Supernatant of Swine 266 115 0.43 Negative Dental Pulp Stem Cell Supernatant of Swine 257 131 0.51 Negative Adipose Cell Positive Control 1201 3712 3.09 Positive Negative Control 1253 183 0.15 Negative (without reagents)

(184) Further to the human dental pulp stem cells, the same tests were conducted. Results are shown in Table 5. It was confirmed that either cell were not infected by mycoplasma.

(185) TABLE-US-00005 TABLE 5 Measured Measured Sample value A value B B/A Decision Medium (DMEM) 250 106 0.42 Negative Supernatant of Human 264 115 0.43 Negative Dental Pulp Stem Cell Supernatant of Human 276 115 0.42 Negative Dental Pulp Stem Cell Positive Control 1256 3971 3.16 Positive Negative Control 1298 173 0.13 Negative (without reagents)
(2) Introduction of the Lentivirus Vector Genes

(186) The lentivirus vector constructed in Example 1 was infected to each stem cell obtained in Example 3 by using polybrene reagent, and then the cells were cultured in the medium supplemented with GENETICIN to select the cell line, which stably expresses the target genes.

(187) After the culture supernatant of respective stem cells as described above was removed, the stem cells were washed with PBS (pH 7.4). Then, the stem cells were release from the dishes by using the releasing agent (StemPro (Registered trademark: GIBCO) for the swine dens deciduous dental pulp stem cells or the swine adipose stem cells; trypsin-EDTA for the human dens deciduous dental pulp stem cells) to be respectively collected. Similarly to those described above, the cell number was counted by using trypan blue staining and the hemocytometer. Then, they were plated in the tissue culture-treatment (T. C. treatment-) 6-well plate (CORNING) of which wells respectively contain suitable volume of the culture medium so as to be 1×10.sup.5 cells/well, and incubated at 37° C. in the CO.sub.2 incubator for about 24 hours. It was confirmed that the cells were evenly grown in entire of the dish.

(188) After that, the supernatant was removed, for the swine dens deciduous dental pulp stem cells or the swine adipose stem cells, DMEM containing 8 μg/mL of polybrene and 10% FBS were added into each well at 750 μL/well, and then, the lentivirus vector solution obtained in Example 1 was added into each well at 250 μL/well.

(189) For the human dental pulp stem cells, DMEM containing 8 μg/mL of polybrene and 10% of FBS was added into each well at 1.2 mL/well, and then the lentivirus vector solution was added into each well at 400 μL/well. As described above, the plate to which the virus vector was added were centrifuged at 1,000×g for 30 minutes at 32° C. for viral infection to the cells. They were incubated at 37° C. in the CO.sub.2 incubator for about 4 to 6 hours, and then the culture medium was added into each well at 1 mL/well. Next, they were incubated at 37° C. in the CO.sub.2 incubator for about 24 hours for gene transduction.

(190) (3) Selection by Using Drugs

(191) The culture supernatant in the 6 well plate incubated as describe above was removed, and then the medium was exchanged to the selection medium containing 0.4 mg/mL or 0.8 mg/mL of GENETICIN (G418, GIBCO) (2 mL/well). After that, they were cultured for 3 to 5 days for selecting the gene-transduced cells, exchanging the medium. The selection by using the drugs was conducted as the same as those for all of the swine dental pulp stem cell, the swine adipose stem cells and human dental pulp stem cells.

(192) Portions of the respective cultured cells were used for cloning, and remains were continuously cultured in the selection medium as the pool cells. In order for cloning, the cells were diluted by using the selection medium without all of penicillin/Streptomycin and G418, and plated in the dish having the diameter of 60 mm at the concentration of 1×10.sup.3 cells/4 mL/dish or 5×10.sup.3 cells/4 mL/dish. Next, they were incubated at 37° C. in the CO.sub.2 incubator for 24 hours.

(193) The formed colonies were marked from the rear side of the dish. When marked colony numbers reached about 100, the culture supernatant was removed and colonies were washed with PBS. The cloning ring was set in the dish, and cells from the colonies released from the dish were respectively put in each well of 48-well plate containing 1 mL of the medium. They were continuously cultured at 37° C. in the CO.sub.2 incubator for scale-up, observing the cell density therein. After about 2 to 3 weeks from the start of the selection by using the drugs, the grown cell population which became drug resistant, were respectively cryopreserved. They were stored at the concentration of 2×10.sup.6 cells/vial, when their concentration reached about 5×10.sup.6 cells/mL.

(194) As the cryopreservation solution, Cellbanker (Zenyaku Kogyo Co. Ltd.) was used for both of the swine des deciduous dental pulp stem cells and the swine adipose stem cells; and for the human dens deciduous dental pulp stem cells, Bambancer (Nippon Genetics)) was used. By using the cryopreservation solution, respective stem cells were frozen at the concentration of 0.5×10.sup.6 cells//s/vial (for the swine dens deciduous dental pulp stem cells or the swine adipose stem cells) or 1×10.sup.6 cells/vial (for the human dens deciduous dental pulp stem cells), and then stored at −80° C. until use.

(195) (4) Preparation of the Total RNA

(196) For the total RNA (total RNA), NucleoSpin RNA II (kit purchased from MACHEREY-NAGEL) was used. Firstly, in order to extract RNA for the expression confirmation, cell pellet containing 5×10.sup.5 cells were prepared. Both of 350 μL of RA1 buffer (included in the kit) and 7 μL of IM DTT (dithiothreitol) sterilized with 0.22 μm filter were added onto the pellet and mixed well to lyze the cells to prepare lysate. The lysate was put in the ring filter with violet color (included in the kit) set in the collection tube, and then they were centrifuges at 11,000×g for 1 minute. After that, the filter was discarded, and 350 μL of 70% ethanol was added into the collection tube. They were pipetted for 5 timed to adjust binding conditions of RNA.

(197) Next, 700 μL of the mixture was loaded on the ring column with pale blue color (included in the kit) set in the collection tube, they were centrifuged at 11,000×g for 30 seconds to bind RNA. After the centrifugation, the column was set in fresh collection tube, and 350 μL of MDB (included in the kit) was added therein, and they were centrifuged 11,000×g for 1 minute to desalt.

(198) After the centrifugation, 10 μL of rDNase (540 μL/vial) and 90 μL of DNase reaction buffer (included in the kit) were gently mixed to prepare DNA reaction mixture. Then, 95 μL of the buffer was added to the column and incubated for 15 minutes in ambient to digest DNA. After the incubation, 200 μL of RA2 buffer (included in the kit) was added to the column, and they were centrifuged at 11,000×g for 30 seconds to wash. Subsequently, the column was set into the fresh collection tube, and 700 μL of RA3 buffer (included in the kit) was added into the column, and then they were centrifuged at 11,000×g for 30 seconds to wash.

(199) After the centrifugation, the solution eluted into the collection tube was discarded and 250 μL of RA3 buffer was again added into the column and further centrifuged at 11,000×g for 2 minutes, and then the silica membrane of the column was air-dried. The column was set in the 1.5 mL size collection tube, and 60 μL of RNAase-free water was added to the column, and they were centrifuged at 11,000×g for 1 minute to obtain total RNA sample with high purity (40 to 60 μL).

(200) (5) Reverse Transcription Reaction

(201) Reverse transcription was conducted by using total RNA sample as described above and PrimeScript RT reagent Kit (Perfect Real time, TaKaRa Bio).

(202) (5-1) Reverse Transcription for PrimeScript RT Reagent Kit

(203) The total RNA sample was diluted to the concentration of 20 ng/μL by using EASY Dilution included in the kit as shown in the following Table 6.

(204) TABLE-US-00006 TABLE 6 RNA Dilution EASY Conc. Ratio to Sample Dilution Sample (ng/μL) 20 ng/μL vol.(μL) Added vol.(μL) 1 Swine Dental 446.5 22.33 1 21.3 Pulp NGMC 2 Swine Dental 224.4 11.22 2 20.4 Pulp Virus #1 3 Swine Dental 332.6 16.63 1 15.6 Pulp Virus #2 4 Swine Dental 361.1 18.06 1 17.1 Pulp Virus #3 5 Swine Dental 286.2 14.31 1 13.3 Pulp Virus #4 6 Swine Adipocyte 264.1 13.21 1 12.2 NGMC 7 Swine Adipocyte 117.2 5.86 3 14.6 Virus #1 8 Swine Adipocyte 131.5 6.58 3 16.7 Virus #2 9 Swine Adipocyte 227.4 11.37 2 20.7 Virus #3 10 Swine Adipocyte 154.9 7.75 3 20.2 Virus #4 11 Human dental 428.3 21.42 2 40.8 pulp NGMC 12 Human dental 266.0 13.30 2 24.6 pulp Virus #1 13 Human dental 309.0 15.50 2 29.0 pulp Virus #2 14 Human dental 265.7 13.29 2 24.6 pulp Virus #3 15 Human dental 375.0 18.75 2 35.5 pulp Virus #4

(205) 180 μL of Premix (the reaction mixture) including 72 μL of 5× PrimeScript Buffer, 18 μL of PrimeScript RT Enzyme Mix, 18 μL of Random 6 mer (100 μM), and 72 μL of double distilled water (D2W) was prepared. Next, Premix was dispended into PCR tube at 10 μL, and 10 μL of the template RNA was added into each tube. Then, reverse transcription was conducted under the conditions of 37° C. for 15 minutes, at 85° C. for 5 seconds, and cooled to 4° C. The obtained products were subjected to the real time PCR.

(206) (5-2) Real Time PCR by Using SYBR Premix Ex Taq

(207) Premix for real time PCR were prepared by mixing 350 μL of SYBR Premix Ex Taq II (×2), 28 μL of Primer mix (10 μM), and 266 μL of double distilled water. The primers were used at final concentration of 0.4 μM. As the reference genes, both of the swine β-actin and human β-actin were used. The primers having the sequences (Seq. Nos. 10 to 15 in the sequence listing) shown in the following Table 7 were used for PCR. Also, the reference samples were prepared as shown in the following Table 8.

(208) TABLE-US-00007 TABLE 7 Nos. Nucleotide Sequence Seq. Nos. 1 GGCACTGCCCTCAGACTTCA 10 2 CTGCTAAAGCGCATGCTCCA 11 3 CTGCGGCATCCACGAACTA 12 4 ACAGCACCGTGTTGGCGTA 13 5 TTGGTCAAGCAGCATAATCCAAAG 14 6 GTCAAGGGCATAGCCTACCACAA 15

(209) TABLE-US-00008 TABLE 8 EASY RNA Dilution Sample Dilution Conc. ratio−> 100 Amount added Sample Nos. (ng/μL) ng/μL (μL) Amount (μL) 7 Swine Adipose 117.2 1.17 15 2.6 Virus #1 12 Human Dental 266.0 2.66 10 16.6 Pulp

(210) Premix as describes above was dispensed into the tubes for the real time PCR at 23 μL, and 2 μL of the template cDNA were added into each tube. Next, the real time PCT was conducted under the conditions of at 95° C. for 30 seconds, and 40 cycles of (at 95° C. for 5 seconds, and then at 60° C. for 30 seconds). Subsequently, the products were denatured under the conditions of at 95° C. for 15 seconds, at 60° C. for 30 seconds, and at 95° C. for 15 seconds to obtain the melting curve. The human dental pulp stem cells were treated as the same procedures. Results are shown in the following Tables 9 to 11 and FIGS. 4 and 5.

(211) TABLE-US-00009 TABLE 9 Relative index of total RNA Titer (Log (2)) Ct (STD) *.sup.1 Calibration 1.28 × 10.sup.1 3.7 30.01 Curve 6.40 × 10.sup.1 6.0 27.75 3.20 × 10.sup.2 8.3 25.22 1.60 × 10.sup.3 10.6 22.94 8.00 × 10.sup.3 13.0 20.64 4.00 × 10.sup.4 15.3 18.45 2.00 × 10.sup.5 17.6 16.23 Slope −1.007 Segment 33.844 Amplification Efficiency 1.010 Relative index (R) −1.00 RSQ (Coefficient of determination, R.sup.2) 1.00 *.sup.1 Obtained from the amplification curve of the reference inserted gene sample derived from swine (secondary differentiation curve)

(212) TABLE-US-00010 TABLE 10 Stem Sample Genes Value of Swine Relative Cell Nos. in LV*.sup.2 β - Actin index Swine Virus #1 E7T*.sup.3 0.7758 1.00 Dental Virus #2 BT*.sup.4 0.3017 0.39 Pulp Virus #3 BE6T*.sup.5 0.1587 0.20 Virus #4 B6E7T*.sup.6 0.6144 0.79 Swine Virus #1 E7T*.sup.3 1.0719 1.00 Adipose Virus #2 BT*.sup.4 0.3004 0.28 Virus #3 BE6T*.sup.5 0.1559 0.15 Virus #4 B6E7T*.sup.6 0.5922 0.55 *.sup.2lentivirus *.sup.3Human papillomavirus E7, human telomerase reverse transcriptase (hTERT) *.sup.4bmi, hTERT *.sup.5bmi, human papilloma virus E6, hTERT *.sup.6bmi, human papilloma virus E6, human papilloma virus E7, hTERT

(213) TABLE-US-00011 TABLE 11 Stem Sample Gene Value of Human - Relative Cells Nos in LV β-Actin index Human Virus #1 E7T*.sup.3 1.1715 1.00 Dental Virus #2 BT*.sup.4 0.2227 0.19 Pulp Virus #3 BE6T*.sup.5 0.0960 0.08 Virus #4 B6E7T*.sup.6 1.0422 0.89
(7) Results

(214) Ct values calculated from the secondary differentiation curve of the real time PCR were plotted on X axis, and relative values of the total RNA were plotted on Y axis, respectively to prepare the calibration curved for each gene. From these calibration curves, the expression amount of each gene was calculated, and then variations among the samples were compensated by dividing the expression amount of each gene with that of β-actin, the internal standard gene, for each of them.

(215) From the result of the real time PCR of the swine derived gene-introduced sample, the swine dental pulp stem cell with the transduced genes was introduced, showed the amplification of the transduced genes. In contrast, the cellos without them did not show such amplification. These mean that the genes introduced by using the lentivirus vector construct in Example 1 were expressed in the swine dental pulp stem cells to which those genes were transduced.

(216) Also, the results of the real time PCR of the swine derived gene-introduced sample showed that the internal standard genes were amplified. In FIGS. 4 and 5, the relative values of the respective transduced gene expression amount in the swine dental pulp stem cells or the swine adipose stem cells, when that of Virus #1 was 1. As far as the relative expression amount of the transduced genes, that of Virus #4 was closed to that of Virus #1. However, in other vectors, those were less than half of that of Virus #1. In the swine adipose stem cells, that of Virus #4 was almost 1 half of that of Virus #1; in Virus #2 or Virus #3, the expression amount was lower such as ⅓ to ⅕ of that of Virus #1.

(217) Table 10, FIG. 6 (A), and FIG. 6 (B) showed the expression statuses of genes in the human dental pulp stem cells. They showed that even in the human dental pulp stem cells, those of Virus #4 was more closed to those of Virus #1 similar to the cases of the stem cells from the swine. Also, it was shown that the expression ratios when other two vectors were used were lower such as less than ⅕ to 1/10, compared to the case of the swine stem cells.

(218) As described above, it was confirmed that the expression efficiencies were different and have species difference, however, all of the transduced genes were expressed in the transduced cells.

(Example 6) Selection of the Gene Transduced Cell Line by Using the Drugs and Gene Expression Analysis (Preparation of the Pooled Cells)

(219) (1) Preparation of the Retrovirus Vector Gene-Transduced Cells

(220) The viable cells among the set up cells as described above were counted by using trypan blue staining and the hemocytometer. Then, they were plated in the dish having the diameter of 10 cm containing the culture medium at the concentration of 6×10.sup.6 cells/10 mL, and then incubated at 37° C. in the CO.sub.2 incubator for about 24 hours. When the cell density reached 70 to 90%, confluent, they were diluted to the concentration of 6×10.sup.4 cells/mL for the passage. Mycoplasma infection was tested as described above, and all of the determination results were negative.

(221) (2) Introduction of the Retrovirus Vector Genes and the Selection by Using the Drugs

(222) The retrovirus vectors constructed in Example 2 were infected to the stem cells obtained in Example 3 respectively, and they were cultured in the medium including GENETICIN for the selection of the stable expression cell lines of the target genes. Combinations of the genes in the retrovirus incorporating immortalization genes were as follows: in the cells A-1 and A-2, 3 genes (hTERT, HPV16_E6, and HPV16_E7); in the cell B-1 and B-2, 4 genes (hTERT, hBmi-1, HPV16_E6, and HPV16_E7). The retrovirus vector solution was prepared by diluting 4 timed for both of the cells A-1 and B-1; and prepared by diluting 10 times for both of A-2 and B-2.

(223) Introduction of the retrovirus vector into each of the stem cells (the target cells), and the selection of the cells after the introduction of the vectors were conducted according to those in Example 5. The cell population after selected by using the drugs were collected as the drug resistant pooled cells and then cryopreserved. For the real time PCR analysis, the pellet including 5×10.sup.5 cells were prepared and stored at −80° C.

(224) (3) Preparation of Total RNA

(225) The preparation of the total RNA was conducted by using NucleoSpin RNA II (the kit of MACHEREY-NAGEL) as the same as those in Example 5. Extraction results of the total RNA obtained from the pellets of respective cells are shown in the following Table 12.

(226) TABLE-US-00012 TABLE 12 Sample Name of Conc. Absorbance Relative Index Yield Nos. Cells (μg/μL) A260 A280 260/280 260/230 (μg) 1 A-1 239.77 5.994 2.833 2.12 2.19 9.59 2 A-2 277.83 6.946 3.275 2.12 2.19 11.11 3 B-1 353.89 8.847 4.205 2.10 2.22 14.16 4 B-2 219.66 5.492 2.587 2.12 2.19 8.79 5 NT* 332.44 8.311 3.867 2.15 2.31 13.30 *Target cell line without treatment
(4) Reverse Transcription and the Real Time PCR
(4-1) Reverse Transcription

(227) Reverse transcription was conducted by using the total RNA sample obtained as described above and the reverse transcription kit (PrimeScript RT reagent Kit (Perfect Real time, TaKaRa Bio)).

(228) 20 μL of the Premix (the reaction mixture) containing 4 μL of 5× PrimeScript buffer (final conc. was ×1), 1 μL of PrimeScript RT Enzyme Mix, 1 μL of Random 6 mer (100 μM, final conc. was 5 μM), 10 μL of the total RNA and 4 μL of the double distilled water (D2W). Next, the Premix was dispensed into the PCR tubes at 10 μL each, and 10 μL of the template RNA was added to them. Then they were subjected to the revers transcription under the conditions of at 37° C. for 15 minutes, at 85° C. for 5 seconds, and cooled to 4° C. The obtained products (the reverse transcription products) were subjected to the following real time PCR.

(229) (4-2) The Real Time PCR by Using SYBR Premix Ex Taq

(230) The Premix for real time PCR (25.0 μL) was prepared by mixing 12.5 μL of SYBR Premix Ex Taq II (×2, final conc. was ×1), 0.5 μL of PCR Primer mix (10 μM, final conc. was 0.2 μM of each), 2.0 μL of the reverse transcription solution, and 10.0 μL of the sterile distilled water. The primers were used at final concentration of 0.4 μM of each. As the reference gene, human β-action was used. The primers having the nucleotide sequences shown in Table 7 were used in PCR (Seq. Nos. 10 to 15 in the sequence listing); the reference samples were prepared as shown in Table 8.

(231) The Premix was dispensed into the tubed for the real time PCR at 25 μL of each. Then, the real time PCR was conducted by using the real time PCR apparatus (Thermal Cycler Dice Real Time System: Takara Bio Inc.) under the conditions of at 95° C. for 30 seconds, and 40 cycles of (at 95° C. for 5 seconds, and then at 60° C. for 30 seconds). Subsequently, DNAs were denatured under the conditions of at 95° C. for 15 seconds, at 60° C. for 30 seconds, and 95° C. for 15 seconds to obtain the melting curve.

(232) The melting curve is the graph composed of the temperature plotted on X axis and fluorescence intensity on Y axis, when the temperature is increased after PCR. Alternatively, the peak of the primary differentiation curve shows Tm value (melting temperature), which is the temperature that the double strand DNAs as the PCR amplification products are denatured into single strand DNAs, and it is an indicator that the amplified PCR products are not mixture. In the present example, human dental pulp stem cells were treated. Results were shown in the following Table 13, FIGS. 8 and 9 (n=2). The relative expression amount in Table 13 shows the relative expression amounts when that of the sample 1 was 1 after compensated with that of β-actin.

(233) TABLE-US-00013 TABLE 13 TERT Human β Actin TERT/β-Actin Total RNA Ct Calculate Ct Calculate Normalization Relative Sample Amount (pg) RT (SDM)*.sup.1 Value (pg) (SDM) Value (pg) (Calculate Value) expression value STD 1 100,000 + 16.84 86010.0 12.54 86930.0 0.99 STD 2 20,000 + 19.13 19130.0 14.64 20830.0 0.92 STD 3 4,000 + 21.39 4344.0 16.94 4383.0 0.99 STD 4 800 + 23.70 953.9 19.36 856.0 1.11 STD 5 160 + 26.24 179.7 21.77 167.8 1.07 STD 6 32 + 28.77 34.3 24.30 30.2 1.14 STD 7 6.4 + 31.69 5.1 26.70 6.0 0.85 STD 8 − − −− −− −− −− −− 1 20,000 + 18.80 23690.0 14.73 19620.0 1.21 1.00 2 20,000 + 18.96 21320.0 14.31 26040.0 0.82 0.68 3 20,000 + 19.14 18950.0 14.70 20000.0 0.95 0.78 4 20,000 + 19.63 13780.0 14.68 20270.0 0.68 0.56 5 20,000 + −− −− 15.23 13930.0 −− −− *.sup.1Secondary differentiation curve (the graph of fluorescence intensity of PCR products were twice differentiated)
(5) Results

(234) Ct values calculated from the secondary differentiation curve of the real time PCR were plotted on X axis, and relative values of the total RNA were plotted on Y axis, respectively to prepare the calibration curved for each gene. From these calibration curves, the expression amount of each gene was calculated, and then variations among the samples were compensated by dividing the expression amount of each gene with that of β-actin, the internal standard gene, for each of them.

(235) From the result of the real time PCR of the human derived gene-introduced sample, the human dental pulp stem cell with the transduced genes was introduced, showed the amplification of the transduced genes. In contrast, the cellos without them did not show such amplification. These mean that the genes introduced by using the lentivirus vector construct in Example 1 were expressed in the swine dental pulp stem cells to which those genes were transduced.

(236) Also, the results of the real time PCR of the human derived gene-introduced sample showed that the internal standard genes. In FIG. 9, the relative value of the respective transduced gene expression amount in the human dental pulp stem cells, when that of the sample 1 was 1. As far as the relative expression amount of the transduced genes, that of the sample 3 was closed to that of the sample 1. However, in other two showed around 60%.

(237) As shown in Table 13 and FIG. 9, it was confirmed that hTERT was expressed either case that 3 genes were introduced or 4 genes were introduced.

(Example 7) Single Cell Cloning and Gene Expression Analysis

(238) (1) Materials and Methods

(239) As the cells for the single cell cloning, the gene-transduced cells prepared in Example 5 were used. The culture medium, drugs for the selection, the kit or the reagent used for the real time PCR were the same as those used in Example 1 to Example 6. Culture method or other experimental procedures and other conditions were the same as those.

(240) (2) Expansion Culture

(241) The cell population stably expressing the introduced genes were plated into the dish having the diameter of 60 mm at the concentration of 1×10.sup.3 cells/dish, and incubated in the CO.sub.2 incubator at 37° C. for 24 hours. After that, the medium was exchanged to the growth medium (DMEM supplemented with 10% FBS) including the drug for the selection (G418) and cultured for forming colonies. As the same as those in Example 4 and Example 5, each of the colonies formed was released from the dish by using both of the cloning ring and the releasing agent, and then respectively inoculated in the 24-well plate. After growing them in the 24-well plate, they were plated into the dish having the diameter of 60 mm and then grown. Subsequently, they were plated in the dish having the diameter of 100 mm and then transferred to T-225 flask for expansion culture. The virus vectors used for the gene introduction were the same as described above.

(242) (3) Results of the Single Cell Cloning

(243) For the cell line derived from the swine adipose stem cells which stably express introduced genes, single cell cloning was conducted twice and 5 clones shown in the following Table 14 were obtained. For the cell line derived from the swine dens deciduous dental pulp stem cells which stably express introduced genes, the single cell cloning was conducted twice. However, all of the cells were died during the culture so that any clones were obtained.

(244) On the other and, for the cell line derived from the human dens deciduous dental pulp stem cells, 5 clones shown in Table 14 were obtained by using one of Virus #1, Virus #3 or Virus #4, respectively. However, the cells infected by Virus #2 were enlarged and they were not grown until the necessary numbers during the expanding culture caused. Therefore, the procedures were stopped.

(245) TABLE-US-00014 TABLE 14 Name of Clone Derived from Swine Virus #1-1 Virus #1-9 Virus #2-7 Virus #2-14 Virus #4-1 Dental Pulp Derived from Human Virus #1-2 Virus #1-9 Virus #1-10 Virus #1-11 Virus #1-21 Dental Pulp Virus #3-1 Virus #3-2 Virus #3-7 Virus #3-11 Virus #3-19 Virus #4-2 Virus #4-6 Virus #4-14 Virus #4-19 Virus #4-24
(4) Gene Expression Analysis

(246) For the clone cell of these cell lines which stably express the gene obtained in above-mentioned (3), the expressions both of the introduced genes and implied standard genes were measured by using the real time PCR. As the same as Example 3, total RNA was prepared from about 5×10.sup.5 cells of each clone shown in Table 14 by using NucleoSpin RNA. Obtained total RNA was used as the template, reverse transcription was conducted by using PrimeScript RT reagent Kit to obtain template cDNA.

(247) After that, the real time PCR was conducted under the same conditions as those in Example 3 by using SYBR Premix Ex TaqII (Tli RNaseH Plus), specific primers against the introduced genes or the internal standard gene (Seq. Nos. 16 to 19 in the sequence listing), and the reverse transcription products as the template with the real time PCR apparatus (Thermal Cycler Dice Real Time System). Procedures were conducted according to the manual included in the kit.

(248) (5) Results of the Introduced Gene Expressions

(249) As the same as those in Example 5 Ct values calculated from the secondary differentiation curve of the real time PCR were plotted on X axis, and relative values of the total RNA were plotted on Y axis, respectively to prepare the calibration curved for each gene expression. Compensation for the validation among the samples was conducted as the same as those in Example 6(5).

(250) The following Tables 15 to 17, and FIGS. 6 (A) and 6(B) show the relative values of the introduced gene expressions derived from the swine dental pulp stem cells, or the human dental pulp stem cells, when the expression amount of the genes in the pooled cells to be introduced the genes by using Virus #1 equals 1.

(251) TABLE-US-00015 TABLE 15 Relative Index of Total RNA Titer (Log (2)) Ct (STD) *1 Calibration 1.00 × 10.sup.5 16.6 16.68 Curve 2.00 × 10.sup.4 14.3 18.95 4.00 × 10.sup.3 12.0 21.25 8.00 × 10.sup.2 9.6 23.71 1.60 × 10.sup.2 7.3 25.99 3.20 × 10.sup.1 5.0 28.21 6.40 × 10.sup.0 2.7 30.87 Slope −1.074 Segment 32.629 Amplification Efficiency 0.997 Relative index (R) −1.000 RSQ (Coefficient of Determination, R.sup.2) 1.000 *1: Obtained from an amplification curve (secondary differential curve) of the reference insert gene derived from swine.

(252) TABLE-US-00016 TABLE 16 Average expression amount Stem Sample Gene GOI/human Relative cells Nos. in LV β actin index Swine Virus #1-1 E7T*.sup.3 1.22263 1.244 dental Virus #1-9 E7T*.sup.3 1.22367 1.245 pulp Virus #2-7 BT*.sup.4 0.16424 0.167 clone Virus #2-14 BT*.sup.4 0.24875 0.253 Virus #4-1 BE6T*.sup.5 0.00126 0.001 swine Virus #1 E7T*.sup.3 0.98276 1.000 dental Virus #2 BT*.sup.4 0.36631 0.373 pulp Virus #3 BE6T*.sup.5 0.18431 0.188 pool Virus #4 B6E7T*.sup.6 0.72732 0.740

(253) TABLE-US-00017 TABLE 17 Average expression amount Stem Sample Gene GOI/human Relative cells Nos. in LV β actin index human Virus #1-2 E7T*.sup.3 1.8848 1.65 dental Virus #1-9 E7T*.sup.3 0.1932 0.17 pulp Virus #1-10 E7T*.sup.3 0.3508 0.31 clone Virus #1-11 E7T*.sup.3 2.6537 2.32 Virus #1-22 E7T*.sup.3 3.0048 2.63 Virus #2-2 BT*.sup.4 0.0094 0.01 Virus #2-5 BT*.sup.4 0.1566 0.14 Virus #2-14 BT*.sup.4 0.7429 0.65 Virus #2-17 BT*.sup.4 0.8024 0.70 Virus #2-24 BT*.sup.4 0.1639 0.14 Virus #3-1 BE6T*.sup.5 0.0395 0.03 Virus #3-2 BE6T*.sup.5 0.0437 0.04 Virus #3-7 BE6T*.sup.5 0.0398 0.03 Virus #3-11 BE6T*.sup.5 0.0857 0.07 Virus #3-19 BE6T*.sup.5 0.0283 0.02 Virus #4-2 B6E7T*.sup.6 0.8966 0.79 Virus #4-6 B6E7T*.sup.6 0.5563 0.49 Virus #4-14 B6E7T*.sup.6 1.4187 1.24 Virus #4-19 B6E7T*.sup.6 0.2320 0.20 Virus #4-24 B6E7T*.sup.6 1.2183 1.07 human Virus #1 E7T*.sup.3 0.98276 1.00 dental Virus #2 BT*.sup.4 0.36631 0.24 pulp Virus #3 BE6T*.sup.5 0.18431 0.12 pool Virus #4 B6E7T*.sup.6 0.72732 0.84

(254) From the above, it was shown that the introduced genes are expresses in all of the cell lines; the cell lines stably express the introduced genes derived from the human dens deciduous dental pulp stem cells. Alto the results showed that the expression amounts of the genes are very different depending on the genes introduced.

(255) Also, FIGS. 10 (A) to (E) are the microscope images when the obtained clones were cultured. It was confirmed that all of the cell have almost equal sizes, and confluent without irregular sized cells, and they are normally grown.

INDUSTRIAL APPLICABILITY

(256) The present invention is useful in the field of the pharmaceuticals and diagnostics.

SEQUENCE LISTING FREE TEXT

(257) Seq. No. 1: Nucleotide sequence of the DNA fragment including genes to be inserted into the cells (1).

(258) Seq. No. 2: Nucleotide sequence of the DNA fragment including genes to be inserted into the cells (2).

(259) Seq. No. 3: Nucleotide sequence of the DNA fragment including genes to be inserted into the cells (3).

(260) Seq. No. 4: Nucleotide sequence of the DNA fragment including genes to be inserted into the cells (4).

(261) Seq. No. 5: Nucleotide sequence of the DNA fragment including genes to be inserted into the cells (5).

(262) Seq. No. 6: Nucleotide sequence of the DNA fragment including genes to be inserted into the cells (1).

(263) Seq. No. 7: Nucleotide sequence of the DNA fragment including genes to be inserted into the cells (7).

(264) Seq. No. 8: Nucleotide sequence of the DNA fragment including genes to be inserted into the cells (8).

(265) Seq. No. 9: Nucleotide sequence of the DNA fragment including genes to be inserted into the cells (9).

(266) Seq. No. 10: Primer for PCR (1).

(267) Seq. No. 11: Primer for PCR (2).

(268) Seq. No. 12: Primer for PCR (3).

(269) Seq. No. 13: Primer for PCR (4).

(270) Seq. No. 14: Primer for PCR (5).

(271) Seq. No. 15: Primer for PCR (6).

(272) Seq. No. 16: Primer for PCR (7).

(273) Seq. No. 17: Primer for PCR (8).

(274) Seq. No. 18: Primer for PCR (9).

(275) Seq. No. 19: Primer for PCR (10).