RECOMBINANT ESCHERICHIA COLI EXPRESSING FUSION PROTEIN OF FORMAMIDASE AND PHOSPHITE DEHYDROGENASE AND CONSTRUCTION METHOD AND USE THEREOF

20210163958 · 2021-06-03

Assignee

Inventors

Cpc classification

International classification

Abstract

The invention relates to a recombinant Escherichia coli expressing a fusion protein of formamidase and phosphite dehydrogenase, a construction method and use thereof. The invention includes adopting engineered E. coli DH5α as a host, amplifying a cloned formamidase gene and a cloned phosphite dehydrogenase gene into a fusion gene, ligating the fusion gene to a multiple cloning site of a vector, transforming the obtained recombinant plasmid into the E. coli DH5α, extracting the plasmid and transforming into an expression strain, and performing induction culture to obtain a recombinant E. coli. The recombinant E. coli can express a fusion protein of formamidase and phosphite dehydrogenase.

Claims

1. A construction method of a recombinant E. coli expressing a fusion protein of formamidase and phosphite dehydrogenase, comprising steps as follows: (1) designing a pair of primers and amplifying a formamidase gene containing a linker sequence by PCR: a forward primer is A 1 (5′-CGCGGATCCGATGAACGGACTGGGCGGCTTGAAC-3′), which an underlined and italic part GGATCC is a restriction enzyme cutting site of BamH I; and a reverse primer is A2 TABLE-US-00013 (5′-CGACCCACCACCGCCCGAGCCACCGCCACCTCGCGCCGCGCCTCCCT TCGC -3′), in which an underlined part TABLE-US-00014 CGACCCACCACCGCCCGAGCCACCGCCACC is the linker sequence; using a genome of Paenibacillus pasadenensis CS0611 as a template to clone a formamidase gene sequence for-Linker of 1041 bp containing the linker sequence; ligating the cloned gene sequence fir-Linker to a vector pMD-19T Simple, and then transforming a recombinant vector to E. coli DH5α competent cell to obtain a recombinant E. coli DH5α (pMD-19T Simple-for) containing the recombinant vector pMD-19T Simple-fir; and then amplifying a for-Linker fragment with A 1 and B1 TABLE-US-00015 (5′-TATAACGAGTTTCGGCAGCATCGACCCACCACCGCCCGAGCCA- 3′); (2) designing a pair of primers and amplifying a phosphite dehydrogenase gene by PCR: a forward primer is B2 TABLE-US-00016 (5′-TGGCTCGGGCGGTGGTGGGTCGATGCTGCCGAAACTCGTTATA- 3′), in which an underlined part TABLE-US-00017 TGGCTCGGGCGGTGGTGGGTCG is partial DNA of the Linker; and a reverse primer is B3 (5′-CCGGAATTCCGACATGCGGCAGGCTCGGCCTTGGGC-3′), in which an underlined and italic part GAATTC is a restriction enzyme cutting site of EcoR I; using a genome of Klebsiella pneumoniae OU7 as a template to clone a phosphite dehydrogenase gene sequence ptx of1008 bp to obtain a ptx fragment; (3) overlapping PCR amplification to obtain a fusion gene: using the for-Linker fragment and the ptx fragment that are obtained by amplification in the step (1) and the step (2) respectively as templates, and using the primer A1 and the primer B3 as the forward primer and the reverse primer respectively, amplifying to obtain a fusion gene for-Linker-ptx of the formamidase gene and the phosphite dehydrogenase gene; and performing double digestion on the fusion gene for-Linker ptx with BamH I and EcoR I, ligating the fusion gene to a pGEX-2T expression plasmid digested with the same enzyme and transforming a recombinant plasmid pGEX-for-Linker-ptx into E. coli DH5α competent cell to obtain a positive clone E. coli DH5α (pGEXfor-Linker-ptx); (4) transforming a recombinant expression strain: extracting the recombinant plasmid pGEX-for-Linker-ptx from the recombinant E. coli DH5α (pGEX-for-Linker-ptx), and transforming the recombinant plasmid pGEX-for-Linker-ptx into an expression strain E. coli BL21(DE3) competent cell to obtain a recombinant expression strain E. coli BL21(DE3)(pGEX-for-Linker-ptx); (5) performing induction culture on the recombinant E. coli: inoculating the obtained recombinant expression strain E. coli BL21(DE3)(pGEX-for-Linker-ptx) to a LB medium to perform induction culture, then collecting bacteria and adding the recombinant E. coli to a MOPS medium containing formamide and phosphite and continuing to culture to obtain the recombinant E. coli.

2. The construction method of the recombinant E. coli expressing the fusion protein of formamidase and phosphite dehydrogenase according to claim 1, wherein in the step (1), the formamidase gene sequence containing the linker sequence of the Paenibacillus pasadenensis CS0611 is shown in SEQ ID NO: 1 in sequence listing, which has a fragment length of 1041 bp, contains the linker sequence, and encodes 347 amino acids; and the Paenibacillus pasadenensis CS0611 was preserved in China Center for Type Culture Collection on Oct. 8, 2014 with a preservation number of CCTCC NO: M2014458.

3. The construction method of the recombinant E. coli expressing the fusion protein of formamidase and phosphite dehydrogenase according to claim 1, wherein in the step (2), the phosphite dehydrogenase gene sequence of the Klebsiella pneumoniae OU7 is shown in SEQ ID NO: 2 in sequence listing, which has a fragment length of 1008 bp and encodes 336 amino acids; and the Klebsiella pneumoniae OU7 was preserved in China Center for Type Culture Collection on Aug. 24, 2017 with a preservation number of CCTCC NO: M 2017449.

4. The construction method of the recombinant E. coli expressing the fusion protein of formamidase and phosphite dehydrogenase according to claim 1, wherein in the step (3), a gene sequence of the fusion gene for-Linker-ptx is shown in SEQ ID NO: 3 in sequence listing, which has a fragment length of 2049 bp, with the formamidase gene located at a 5′-end and the phosphite dehydrogenase gene located at a 3′-end, and a formamidase gene fragment is ligated to a phosphite dehydrogenase gene fragment by the linker sequence with a fragment length of 30 bp.

5. The construction method of the recombinant E. coli expressing the fusion protein of formamidase and phosphite dehydrogenase according to claim 1, wherein in the steps (1), (2) and (3), conditions for the PCR amplification are as follows: reacting at 94° C. for 5 minutes; reacting at 98° C. for 10 seconds, reacting at 55° C. for 5 seconds and reacting at 72° C. for 70 seconds, and repeating reactions for 30 times; then reacting at 72° C. for 7 minutes; and finally, cooling to 16° C.

6. The construction method of the recombinant E. coli expressing the fusion protein of formamidase and phosphite dehydrogenase according to claim 1, wherein in the step (5), the induction culture is as follows: culturing in the LB medium at 37° C. and 180 rpm for 12 hours to 16 hours, then inoculating in a fresh LB medium, and continuing to culture at 37° C. and 180 rpm until a concentration of the recombinant E. coli reaches OD.sub.600=0.6, and after cooling to 20° C., adding isopropyl-3-D-thiogalactoside with a final concentration of 0.2 mM for induction for 16 hours.

7. The construction method of the recombinant E. coli expressing the fusion protein of formamidase and phosphite dehydrogenase according to claim 1, wherein tin the step (5), the step of collecting bacteria is as follows: centrifuging the bacteria after the induction culture at 4° C. and 8000 rpm for 5 minutes, suspending the bacteria with physiological saline precooled to 4° C., centrifuging again at 4° C. and 8000 rpm for 5 minutes, repeating the step of suspending with physiological saline and centrifuging the bacteria twice, and then collecting the bacteria; wherein in the MOPS medium containing formamide and phosphite, a final concentration of the formamide is 200 mM and a final concentration of the phosphite is 1.32 mM.

8. The construction method of the recombinant E. coli expressing the fusion protein of formamidase and phosphite dehydrogenase according to claim 1, wherein in the step (5), after adding the collected bacteria into the MOPS medium containing formamide and phosphite, a concentration of the bacteria OD.sub.600 is 0.1 to 0.15; and after adding the isopropyl-β-D-thiogalactoside with a final concentration of 0.2 mM to the medium, it continues to culture at 30° C. and 180 rpm for 84 hours to 96 hours.

9. A recombinant E. coli expressing a fusion protein of formamidase and phosphite dehydrogenase constructed by the method according to claim 1.

10. The recombinant E. coli expressing the fusion protein of formamidase and phosphite dehydrogenase according to claim 9, wherein the recombinant E. coli is used in synthesizing an antibody or a valuable protein preparation by industrial fermentation of the recombinant E. coli.

11. A recombinant E. coli expressing a fusion protein of formamidase and phosphite dehydrogenase constructed by the method according to claim 2.

12. A recombinant E. coli expressing a fusion protein of formamidase and phosphite dehydrogenase constructed by the method according to claim 3.

13. A recombinant E. coli expressing a fusion protein of formamidase and phosphite dehydrogenase constructed by the method according to claim 4.

14. A recombinant E. coli expressing a fusion protein of formamidase and phosphite dehydrogenase constructed by the method according to claim 5.

15. A recombinant E. coli expressing a fusion protein of formamidase and phosphite dehydrogenase constructed by the method according to claim 6.

16. A recombinant E. coli expressing a fusion protein of formamidase and phosphite dehydrogenase constructed by the method according to claim 7.

17. A recombinant E. coli expressing a fusion protein of formamidase and phosphite dehydrogenase constructed by the method according to claim 8.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0044] FIG. 1 is a diagram illustrating a construction process of a recombinant fusion expression plasmid pGEX-for-Linker-ptx;

[0045] FIG. 2 is a growth curve graph of a recombinant Escherichia coli BL21 (DE3)(pGEX-for-Linker-ptx) in a MOPS medium;

[0046] FIG. 3 is a photofluorogram of the recombinant Escherichia coli BL21 (DE3)(pGEX-for-Linker-ptx) expressing a green fluorescent protein (GFP) in the MOPS medium.

DESCRIPTION OF THE EMBODIMENTS

[0047] In order to better understand the present invention, the technical solution of the present invention is further described hereinafter with reference to the embodiments and the accompanying drawings, but the description is only used for illustrating the present invention, and shall not and does not limit the present invention.

[0048] Paenibacillus pasadenensis. CS0611 used in the specific embodiments of the present invention was preserved in China Center for Type Culture Collection on Oct. 8, 2014 with a preservation number of CCTCC NO: M2014458, and a whole genome sequencing has been completed. A fragment of a formamidase gene containing a linker sequence obtained by amplification is shown in SEQ1, which has a fragment length of 1041 bp, contains the linker sequence, and encodes 347 amino acids.

[0049] Klebsiella pneumonia. OU7 used in the specific embodiments of the present invention was preserved in China Center for Type Culture Collection (Wuhan University, Luojia Mountain, Wuchang Road, Wuhan City, Hubei Province, postcode: 430072) on Aug. 24, 2017 with a preservation number of CCTCC NO: M 2017449, and the Klebsiella pneumonia. OU7 is obtained by culturing and self-screening by the following method. Through the sequence analysis of phosphite dehydrogenases on the NCBI database and PCR amplification, a fragment of a phosphite dehydrogenase gene is shown in SEQ2, which has a fragment length of 1008 bp and encodes 336 amino acids.

Embodiment 1

[0050] Acquisition of a formamidase gene for (containing a linker sequence)

[0051] Paenibacillus pasadenensis. CS0611 was cultured in a LB medium at 37° C. and 180 rpm for one day; cultured bacteria were centrifuged at 4° C. and 8000 rpm for 5 minutes to collect the bacteria, the bacteria were washed twice with physiological saline to remove residual medium, and then a genome of the Paenibacillus pasadenensis. CS0611 was extracted according to a specific method of an OMEGA bacterial genome DNA extraction kit.

[0052] The extracted genome of the Paenibacillus pasadenensis. CS0611 was used as a template, A1 (5′-CGCGGATCCGATGAACGGACTGGGCGGCTTGAAC-3′) and A2

TABLE-US-00008 (5′-CGACCCACCACCGCCCGAGCCACCGCCACCTCGCGCCGCGCCTCCCT TCGC-3′)
were respectively used as a forward primer and a reverse primer, and a formamidase gene for-Linker was amplified by PCR.

[0053] An enzyme reagent used for PCR was PrimeSTAR® HS DNA Polymerase with GC buffer from TaKaRa Company; and a PCR reaction system and conditions were as follows:

[0054] Composition of PCR reaction liquid (25 μL)

TABLE-US-00009 Volume 2 × Prime STAR buffer 12.5 μL dNTP mixture 2μ A1 primer 0.5 μL A2 primer 0.5 μL Template 1 μL PrimeSTAR HS DNA polymerase (2.5 U/μL) 0.25 μL Deionized water 8.25 μL

[0055] PCR reaction conditions were as follows: reacting at 94° C. for 5 minutes; reacting at 98° C. for 10 seconds, reacting at 55° C. for 5 seconds and reacting at 72° C. for 70 seconds in sequence, and repeating the reactions for 30 times; then reacting at 72° C. for 7 minutes; and finally, cooling to 16° C.

[0056] A DNA product obtained by the PCR amplification was subjected to electrophoresis with 1 wt % agarose gel, a gel extraction kit from the OMEGA Company was used to perform gel extraction purification according to steps in the instruction, then the DNA product was sent for sequencing, and the result showed that a formamidase gene sequence containing a linker sequence with a fragment length of 1041 bp was obtained, and was named as for-Linker.

Embodiment 2

[0057] Acquisition of a phosphite dehydrogenase gene ptx

[0058] A phosphite dehydrogenase gene was derived from self-screened Klebsiella pneumonia. OU7, and was screened by our laboratory.

[0059] A genome of the screened Klebsiella pneumonia. OU7 was extracted according to a specific method of an OMEGA bacterial genome DNA extraction kit, the genome of the screened Klebsiella pneumonia. OU7 was used as a template, B2 (5′-TGGCTCGGGCGGTGGTGGGTCGATGCTGCCGAAACTCGTTATA-3′) and B3 (5′-CCGGAATTCCGACATGCGGCAGGCTCGGCCTTGGGC-3′) were respectively used as a forward primer and a reverse primer, and a phosphite dehydrogenase gene ptx was amplified by PCR.

[0060] An enzyme reagent used for PCR was PrimeSTAR® HS DNA Polymerase with GC buffer from TaKaRa Company; and a PCR reaction system and conditions were as follows:

[0061] Composition of PCR reaction liquid (25 μL)

TABLE-US-00010 Volume 2 × Prime STAR buffer 12.5 μL dNTP substrate 2 μL B2 primer 0.5 μL B3 primer 0.5 μL Template 1 μL PrimeSTAR HS DNA polymerase (2.5 U/μL) 0.25 μL Deionized water 8.25 μL

[0062] PCR reaction conditions were as follows: reacting at 94° C. for 5 minutes; reacting at 98° C. for 10 seconds, reacting at 55° C. for 5 seconds and reacting at 72° C. for 70 seconds in sequence, and repeating the reactions for 30 times; then reacting at 72° C. for 7 minutes; and finally, cooling to 16° C.

[0063] A DNA product obtained by the PCR amplification was subjected to electrophoresis with 1 wt % agarose gel, a gel extraction kit from the OMEGA Company was used to perform gel extraction purification according to steps in the instruction, then the DNA product was sent for detection and sequencing, and the result showed that a phosphite dehydrogenase gene sequence with a fragment length of 1008 bp was obtained, and was named as ptx.

Embodiment 3

[0064] Acquisition of a fusion gene for-Linker-ptx by overlapping PCR amplification

[0065] The for-Linker and ptx fragments obtained by amplification were used as templates, A1 (5′-CGCGGATCCGATGAACGGACTGGGCGGCTTGAAC-3′) and B3 (5′-CCGGAATTCCGACATGCGGCAGGCTCGGCCTTGGGC-3′) were respectively used as a forward primer and a reverse primer, and a fusion gene for-Linker-ptx was obtained by amplification.

[0066] Amplification conditions were as follows: reacting at 94° C. for 5 minutes; reacting at 98° C. for 10 seconds, reacting at 55° C. for 5 seconds and reacting at 72° C. for 70 seconds in sequence, and repeating the reactions for 30 times; then reacting at 72° C. for 7 minutes; and finally, cooling to 16° C.

Embodiment 4

[0067] Construction of a recombinant E. coli BL21(DE3) (pGEX-for-Linker-ptx)

[0068] Double digestion was performed on the fusion gene for-Linker-ptx obtained in the embodiment 3 and a plasmid pGEX-2T respectively with BamH I and EcoR I, an underlined and italic part of a forward primer was a restriction enzyme cutting site of BamH I, an underlined and italic part of a reverse primer was a restriction enzyme cutting site of EcoR I, and digestion conditions were as follows: digesting at 37° C. for 120 minutes;

[0069] Digestion system:

TABLE-US-00011 Fusion gene (μL) Plasmid (μL) ddH.sub.2O 5 0 10 × buffer 3 2 Fragment/plasmid 20 16 BamH I + EcoR I 1 + 1 1 + 1 Total volume 30 20

[0070] Gel extraction purification was performed on a digested product respectively, and a extraction method and steps referred to a gel extraction kit from the OMEGA Company; the digested product was subjected to electrophoresis with 1 wt % agarose gel after extraction, and a extraction rate was detected; and then a extracted target fragment was ligated to a plasmid, T4 DNA Ligase from Thermo Fisher SCIENTIFIC Company was used as a ligation kit, and a ligation system was as follows:

TABLE-US-00012 DNA fragment 6 μL Plasmid 9 μL 10 × T4 buffer 2 μL T4 DNA ligase 1 Weiss U Deionized water 2 μL Total volume 20 μL

[0071] A molar ratio of the fusion gene to the pGEX-2T plasmid was 5:1.

[0072] A ligation product was transformed into an E. coli DH5α, and transformation steps were as follows: 10 μL of the ligation product was mixed with 100 μL of competent cells of the E. coli DH5α, the mixture was placed into ice bath for 30 minutes, heat shock at 42° C. for 90 seconds, and then ice bath for 2 minutes, then 890 μL of LB medium was added, and after shaking culture at 37° C. and 180 rpm for 1 hour, the mixture was centrifuged at 4000 rpm for 5 minutes to collect bacteria; 890 μL of supernatant medium was taken, the bacteria at a bottom of a tube were resuspended, evenly coated on a LB solid plate containing ampicillin (containing 100 μg/mL ampicillin sodium), and cultured at 37° C. for 16 hours; and after transformants grew on the plate, the transformants were selected for PCR verification and sent for detection and sequencing, and ORF search was performed on the sequencing result using DNAssist software.

[0073] The result shows that the obtained fusion gene sequence (for-Linker-ptx) has been correctly inserted into a multiple cloning site of pGEX-2T, and the pGEX-for-Linker-ptx plasmid has been successfully obtained and transformed into E. coli BL21(DE3) competent cell to obtain a recombinant E. coli BL21(DE3)(pGEX-for-Linker-ptx).

[0074] A construction process of the recombinant E. coli BL21(DE3)(pGEX-for-Linker-ptx) assimilating and metabolizing formamide and phosphite to become dominant engineered bacteria in a medium is shown in FIG. 1. Due to insertion of a fusion gene (a formamidase gene+Linker+a phosphite dehydrogenase gene) into the E. coli BL21(DE3)(pGEX-for-Linker-ptx), the modified E. coli BL21(DE3)(pGEX-for-Linker-ptx) not only can decompose formamide into NH.sub.4.sup.+ but also can oxidize phosphite to phosphate, thus providing a nitrogen source and a phosphorus source for the growth of the E. coli BL21(DE3)(pGEX-for-Linker-ptx), while other miscellaneous microorganisms cannot grow due to the lack of the two pathways.

Embodiment 5

[0075] Growth of an E. coli BL21(DE3)(pGEX-for-Linker-ptx) in a specific MOPS medium

[0076] Induction culture was performed on the obtained recombinant expression strain E. coli BL21(DE3)(pGEX-for-Linker-ptx), and a specific process was as follows:

[0077] E. coli BL21(DE3)(pGEX-for-Linker-ptx) was inoculated to 30 mL of LB medium according to a volume ratio of 1:100, and cultured at 37° C. and 180 rpm overnight for 16 hours; induction culture was performed, 1 mL of recombinant E. coli cultured overnight was inoculated to 100 mL of fresh LB medium, and cultured at 37° C. and 180 rpm until a concentration of recombinant bacteria reached OD.sub.600=0.6, and after cooling to 20° C., IPTG with a final concentration of 0.2 mM was added for induction for 16 hours, and bacteria were collected by centrifuging at 4° C. and 8000 rpm for 5 minutes.

[0078] The collected bacteria were suspended with physiological saline (precooled at 4° C.), and centrifuged at 4° C. and 8000 rpm for 5 minutes to collect bacteria, and this step was repeated twice to remove residual LB medium; the bacteria were added to a basic MOPS medium containing formamide (200 mM) and phosphite (1.32 mM) to make OD.sub.600 of the bacteria be 0.1, IPTG with a final concentration of 0.2 mM was added, and the recombinant E. coli was continued to be cultured at 30° C. and 180 rpm.

[0079] The growth of the recombinant E. coli in the MOPS medium is observed, a growth curve graph of the recombinant E. coli BL21(DE3)(pGEX-for-Linker-ptx) in the MOPS medium containing formamide (200 mM) and phosphite (1.32 mM) is shown in FIG. 2. It can be seen from FIG. 2 that the recombinant E. coli BL21(DE3)(pGEX-for-Linker-ptx) can grow in this medium, a concentration of bacteria reaches a maximum value after the third day, and A600 is 2.223, while a control strain E. coli BL21(DE3) basically does not grow in the MOPS medium.

[0080] In order to verify an express ability of the recombinant E. coli BL21(DE3)(pGEX-for-Linker-ptx) to synthesize exogenous gene in the MOPS medium, a green fluorescent protein (GFP) gene was used to verify an ability of the recombinant E. coli to express an exogenous gene. The pET-28a-GFP plasmid was transformed into E. coli BL21(DE3)(pGEX-for-Linker-ptx) to form the recombinant E. coli, which was named as E. coli BL21(DE3)(pGEX-for-Linker-ptx+pET-28a-GFP), and the obtained recombinant E. coli was induced to express GFP in the MOPS medium containing formamide and phosphite. Then, the cultured and fermented recombinant E. coli was observed with a fluorescence inversion microscope with an excitation wavelength of 488 nm and an emission wavelength of 507 nm. It can be seen from FIG. 3 that the recombinant E. coli can grow normally in the MOPS medium and can express an exogenous green fluorescent protein gene.