FACTOR VIII OR FACTOR IX GENE KNOCKOUT RABBIT, METHOD FOR PREPARING SAME AND USE THEREOF

Abstract

The present invention relates to a factor VIII or factor IX gene knockout rabbit, a method for preparing the same and a use thereof and, more particularly, to a transgenic rabbit whose factor VIII or factor IX gene has been knocked out through the CRISPR/Cas9 system, a method for preparing the same and a use thereof. According to the present invention, in the transgenic rabbit, whose factor VIII and/or factor IX gene has been knocked out, the functions of factor VIII and/or factor IX, which are proteins that perform critical functions for the development of hemophilia, are inhibited, such that the transgenic rabbit is useful for the development of hemophilia treatments.

Claims

1. SgRNA comprising a targeting domain complementarily binding to an exon region of factor VIII (FVIII) or factor IX (FIX).

2. The SgRNA according to claim 1, wherein the exon region of the factor VIII (FVIII) gene is an exon region represented by a base sequence of SEQ ID NO: 1.

3. The SgRNA according to claim 1, wherein the exon region of the factor IX (FIX) gene is an exon region represented by a base sequence of SEQ ID NO: 2.

4. A polynucleotide encoding the sgRNA according to claim 1.

5. The polynucleotide according to claim 4, wherein the polynucleotide is represented by a base sequence of any one of SEQ ID NOS: 3 to 6.

6. A vector having the polynucleotide according to claim 4 inserted therein.

7. A CRISPR/Cas system comprising the vector according to claim 6.

8. A transgenic rabbit produced using the CRISPR/Cas9 system according to claim 7.

9. The transgenic rabbit according to claim 8, wherein the transgenic rabbit is produced by a method comprising: (a) transcribing the CRISPR/Cas9 system to produce sgRNA and Cas9 mRNA; (b) introducing the mRNA produced in step (a) into an embryo and culturing the embryo; and (c) transplanting the embryo obtained in step (b) into a surrogate mother to produce the transgenic rabbit.

10. The transgenic rabbit according to claim 9, wherein the transgenic rabbit is produced by a method further comprising determining whether or not transformation occurs after the rabbit production.

11. A transgenic rabbit progeny produced by a method comprising crossing the transgenic rabbit according to claim 9 to produce the transgenic rabbit progeny.

12. The transgenic rabbit progeny according to claim 11, wherein the crossing the transgenic rabbit is carried out by crossing with the transgenic rabbit or with a normal rabbit.

13. The transgenic rabbit progeny according to claim 8, wherein the transgenic rabbit or transgenic rabbit progeny exhibits a hemophilia phenotype since factor VIII or factor IX is knocked out.

14. A cell, tissue and byproduct isolated from the transgenic rabbit according to claim 8 or from a transgenic rabbit progeny of the transgenic rabbit that is produced by a method comprising crossing said transgenic rabbit to produce the transgenic rabbit prodigy, wherein said transgenic rabbit in said crossing is produced by a method comprising: (a) transcribing the CRISPR/Cas9 system to produce sgRNA and Cas9 mRNA, (b) introducing the mRNA produced in step (a) into an embryo and culturing the embryo; and (c) transplanting the embryo obtained in step (b) into a surrogate mother to produce the transgenic rabbit.

15. The cell, tissue and byproduct according to claim 14, wherein the byproduct is selected from the group consisting of blood, serum, urine, feces, saliva, organs and skin.

16. A method of producing a transgenic rabbit comprising: (a) transcribing the CRISPR/Cas9 system according to claim 7 to produce sgRNA and Cas9 mRNA; (b) introducing the mRNA produced in step (a) into an embryo and culturing the embryo; and (c) transplanting the embryo obtained in step (b) into a surrogate mother to produce the transgenic rabbit.

17. A method of producing a transgenic rabbit progeny comprising crossing the transgenic rabbit produced by the method according to claim 16 to produce the transgenic rabbit progeny.

18. The method according to claim 17, wherein the crossing the transgenic rabbit is carried out by crossing with the transgenic rabbit or with a normal rabbit.

Description

DESCRIPTION OF DRAWINGS

[0024] FIG. 1 is a schematic diagram (A) showing the position of a factor VIII gene targeted by sgRNA prepared for producing a transgenic rabbit according to an embodiment of the present invention and a schematic diagram (B) showing the position of a factor IX gene targeted by the sgRNA prepared for producing a transgenic rabbit according to an embodiment of the present invention.

[0025] FIG. 2 shows (A) the sequence of an amplicon used in NGS-based sequencing analysis to detect knockout of factor VIII in the transgenic rabbit prepared according to the present invention and (B) the sequence of an amplicon used in NGS-based sequencing analysis to detect knockout of factor IX in the transgenic rabbit prepared in the present invention.

[0026] FIG. 3 shows (A) a result confirming that 4 bp of the factor VIII gene is deleted from the second factor VIII knockout rabbit (#2) produced according to the present invention and (B) a result confirming the deletion mutation of the factor VIII gene in the third factor VIII knockout rabbit (#3) produced according to the present invention.

[0027] FIG. 4 shows (A) a result confirming the deletion mutation of the factor IX gene in the sixth factor IX knockout rabbit (#6) produced according to the present invention, (B) a result confirming the deletion mutation of the factor IX gene in the seventh factor IX knockout rabbit (#7) produced according to the present invention, and (C) a result confirming the deletion mutation of the factor IX gene in the eighth factor IX knockout rabbit (#8) produced according to the present invention.

[0028] FIG. 5 shows (A) a result confirming the deletion mutation of the factor IX gene in the ninth factor IX knockout rabbit (#9) produced according to the present invention, and (B) a result confirming the deletion mutation of the factor IX gene in the eleventh factor IX knockout rabbit (#11) produced according to the present invention.

[0029] FIG. 6 shows (A) a result confirming the deletion mutation of the factor IX gene in the twelfth factor IX knockout rabbit (#12) produced according to the present invention, (B) a result confirming the deletion mutation of the factor IX gene in the thirteenth factor IX knockout rabbit (#13) produced according to the present invention, and (C) a result confirming the deletion mutation of the factor IX gene in the fifth factor IX knockout rabbit (#5) produced according to the present invention.

[0030] FIG. 7 is (A) a graph showing the results of APTT analysis of the transgenic rabbit from which factor VIII or factor IX is knocked out, wherein experiments are performed two or three times with plasma of four normal rabbits, two rabbits from which factor VIII is knocked out, and seven rabbits from which factor IX is knocked out and (B) a graph showing the results of TGA analysis conducted two or three times with plasma of nine normal rabbits, three rabbits from which factor VIII is knocked out, and eight rabbits from which factor IX is knocked out, wherein the results are indicated as mean±s.e.m., statistical significance was determined using a two-tailed, unpaired t-test, ** represents p<0.01, and *** represents p<0.001.

[0031] FIG. 8 shows the breeding pedigree for the production of F1 and F2 generations.

[0032] FIG. 9 shows a result confirming the gene Indel mutation of female progeny obtained by crossing a male second factor VIII knockout rabbit (#2) produced according to the present invention with a normal female.

[0033] FIG. 10 shows a result confirming the gene deletion mutation of female progeny obtained by crossing a male sixth factor IX knockout rabbit (#6) produced according to the present invention with a normal female.

[0034] FIG. 11 shows a result confirming the gene Indel mutation of the F2 male obtained by crossing a female (X′X) F1-generation of the factor VIII knockout rabbit produced according to the present invention with a normal male.

[0035] FIG. 12 shows a result confirming the gene Indel mutation of the F2 male obtained by crossing a carrier female (X′X) F1-generation of the factor IX knockout rabbit produced according to the present invention with a normal male.

[0036] FIG. 13 is a schematic diagram illustrating the production of a rabbit claw bleeding model.

[0037] FIG. 14 shows the amount of hemoglobin in the blood measured from a hemolyzed sample.

BEST MODE

[0038] Unless defined otherwise, all technical and scientific terms used herein have the same meanings as appreciated by those skilled in the field to which the present invention pertains. In general, the nomenclature used herein is well-known in the art and is ordinarily used.

[0039] As used herein, the terms “nucleic acid” and “polynucleotide” refer to a deoxyribonucleotide or ribonucleotide polymer in a linear or cyclic three-dimensional form and in a single- or double-stranded form. For the objects of the present invention, these terms should not be construed as limiting the length of the polymer. These terms may encompass known analogues of natural nucleotides as well as nucleotides that are modified at base, sugar and/or phosphate moieties (e.g., phosphorothioate backbones). In general, analogues of certain nucleotides have the same base-pairing specificity; that is, analogues of A form a base pair with T.

[0040] As used herein, the term “nucleotide” refers to deoxyribonucleotide or ribonucleotide. The nucleotide may be a standard nucleotide (i.e., adenosine, guanosine, cytidine, thymidine and uridine) or a nucleotide analogue. The nucleotide analogue refer to a nucleotide having a modified purine or pyrimidine base or modified ribose moiety. The nucleotide analogue may be a naturally derived nucleotide (e.g., inosine) or an artificially derived nucleotide. Non-limiting examples of modifications of sugar or base moieties of the nucleotide include the addition (or removal) of acetyl groups, amino groups, carboxyl groups, carboxymethyl groups, hydroxyl groups, methyl groups, phosphoryl groups and thiol groups as well as substitution of carbon and nitrogen atoms of the base with other atoms (e.g., 7-deaza purine). Nucleotide analogues also include dideoxy nucleotides, 2′-O-methyl nucleotides, locked nucleic acids (LNA), peptide nucleic acids (PNA) and morpholino.

[0041] As used herein, the term “sgRNA” refers to a first region that complementarily binds to a target region in a guide RNA that guides a Cas protein to a target region in a CRISPR/Cas system.

[0042] In the present invention, the guide RNA interacts with the Cas protein to direct the Cas protein to a specific target site, wherein the 5′ end of the guide RNA forms a base pair with a particular protospacer sequence within the chromosomal sequence.

[0043] Each guide RNA includes three regions: the first region at the 5′ end, which is complementary to the target site within the chromosome sequence, the second inner region, which forms a stem loop structure, and the third 3′ region, which remains essentially as a single strand domain. The first regions of respective guide RNAs are different such that each guide RNA directs the fusion protein to a specific target site. The second and third regions of each guide RNA may be the same in all guide RNAs.

[0044] The first region of the guide RNA is complementary to the sequence (i.e., the protospacer sequence) at the target site within the chromosomal sequence, such that the first region of the guide RNA is capable of forming a base pair with the target site. In various embodiments, the first region of the guide RNA may include about 10 nucleotides or more than about 25 nucleotides. For example, the region of base pairing between the first region of the guide RNA and the target site in the chromosomal sequence may be about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 22, 23, 24 or 25 nucleotides, or more than 25 nucleotides in length. In an exemplary embodiment, the first region of the guide RNA is about 19, 20 or 21 nucleotides in length.

[0045] The guide RNA also includes the second region that forms a secondary structure. In some embodiments, the secondary structure includes a stem (or hairpin) and a loop. The lengths of the loop and stem may vary. For example, the loop may vary in the range of about 3 to about 10 nucleotides in length, and the stem may vary in the range of about 6 to about 20 base pairs in length. The stem may include one or more protrusions of 1 to about 10 nucleotides. Thus, the overall length of the second region may vary from about 16 to about 60 nucleotides in length. In an exemplary embodiment, the loop is about 4 nucleotides in length, and the stem includes about 12 base pairs.

[0046] The guide RNA also includes the third region at the 3′ end that remains essentially as a single strand. Thus, the third region has no complementarity to any chromosomal sequence in the cell of interest, and no complementarity to the rest of the guide RNA. The length of the third region may vary. Generally, the third region is more than about 4 nucleotides in length. For example, the length of the third region may vary from about 5 to about 60 nucleotides in length.

[0047] The total length of the second and third regions (also called “universal or skeletal regions”) of the guide RNA may vary in length from about 30 to about 120 nucleotides. In one aspect, the total length of the second and third regions of the guide RNA varies from about 70 to about 100 nucleotides in length.

[0048] In the present invention, whether or not a rabbit, from which factor VIII and/or factor IX is knocked out, can be produced using the CRISPR/Cas system was determined.

[0049] That is, in one embodiment of the present invention, an sgRNA including a targeting domain that complementarily binds to a part of the exon region of factor VIII (FVIII) or factor IX (FIX) is produced, the CRISPR/Cas system including the same is transcribed, and the sgRNA is injected into a rabbit embryo, cultured and transplanted into a surrogate mother to product a rabbit. The result showed that deletion mutations occur in the exon region of factor VIII or factor IX of the produced rabbit (FIGS. 3 to 7).

[0050] Thus, in one aspect, the present invention relates to an sgRNA including a targeting domain that complementarily binds to a part of the exon region of factor VIII (FVIII) or factor IX (FIX).

[0051] In the present invention, the exon region of the factor VIII (FVIII) gene may be an exon region represented by the base sequence of SEQ ID NO: 1, but is not limited thereto.

[0052] In the present invention, the exon region of the factor IX (FIX) gene may be an exon region represented by the base sequence of SEQ ID NO: 2, but is not limited thereto.

[0053] The present invention also relates to a polynucleotide encoding the sgRNA.

[0054] In the present invention, the polynucleotide may be represented by the base sequence of any one of SEQ ID NOS: 3 to 6, but is not limited thereto.

[0055] In the present invention, the polynucleotide encoding the sgRNA is generally operably linked to at least one transcriptional control sequence for expression of the sgRNA in the cell or embryo of interest. For example, DNA encoding sgRNA may be operably linked to a promoter sequence recognized by RNA polymerase III (Pol III). Examples of suitable Pol III promoters include, but are not limited to, mammalian U6, U3, H1 and 7SL RNA promoters.

[0056] The present invention also relates to a vector into which the polynucleotide is inserted.

[0057] DNA molecules encoding sgRNAs may be linear or cyclic. In some embodiments, the DNA sequence encoding sgRNA can be a part of a vector. Suitable vectors include plasmid vectors, phagemids, cosmids, artificial/mini chromosomes, transposons and viral vectors. In an exemplary embodiment, the DNA encoding the Cas protein is present in a plasmid vector. Non-limiting examples of suitable plasmid vectors include pUC, pBR322, pET, pBluescript and variants thereof. Vectors may include additional expression control sequences (e.g., enhancer sequences, Kozak sequences, polyadenylation sequences, or transcription termination sequences), selectable marker sequences (e.g., antibiotic-resistant genes), origins of replication, and the like.

[0058] In specific embodiments wherein both the Cas protein and the sgRNA are introduced into the cell as DNA molecules, each may be a part of a separate molecule (e.g., one vector including the fusion-protein-coding sequence and the second vector including the sgRNA-coding sequence), or both may be a part of the same molecule (e.g., one vector including coding (and control) sequences for both the fusion protein and the guide RNA).

[0059] The present invention also relates to a CRISPR/Cas system including the vector.

[0060] In the present invention, the CRISPR/Cas system may be a type I, type II or type III system. Non-limiting examples of suitable CRISPR/Cas proteins include Cas3, Cas4, Cas5, Cas5e (or CasD), Cas6, Cas6e, Cas6f, Cas7, Cas8a1, Cas8a2, Cas8b, Cas8c, Cas9, Cas10, Cas10d, CasF, CasG, CasH, Csy1, Csy2, Csy3, Cse1 (or CasA), Cse2 (or CasB), Cse3 (or CasE), Cse4 (or CasC), Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csz1, Csx15, Csf1, Csf2, Csf3, Csf4, and Cu1966.

[0061] In the present invention, the CRISPR/Cas protein is derived from the Cas9 protein. The Cas9 protein is derived from Streptococcus pyogenes, Streptococcus thermophilus, Streptococcus species, Nocardiopsis dassonvillei, Streptomyces pristinaespiralis, Streptomyces viridochromogenes, Streptosporangium roseum, Alicyclobacillus acidocaldarius, Bacillus pseudomycoides, Bacillus selenitireducens, EIXguobacterium sibiricum, Lactobacillus delbrueckii, Lactobacillus salivarius, Microscilla marina, Burkholderiales bacterium, Polaromonas naphthalenivorans, Polaromonas species, Crocosphaera watsonii, Cyanothece species, Microcystis aeruginosa, Synechococcus species, Acetohalobium arabaticum, Ammonifex degensii, Caldicellulosiruptor bescii, Candidatus Desulforudis, Clostridium botulinum, Clostridium difficile, Finegoldia magna, Natranaerobius thermophilus, Pelotomaculum thermopropionicum, Acidithiobacillus caldus, Acidithiobacillus ferrooIXdans, Allochromatium vinosum, Marinobacter species, Nitrosococcus halophilus, Nitrosococcus watsonii, Pseudoalteromonas haloplanktis, Ktedonobacter racemifer, Methanohalobium evestigatum, Anabaena variabilis, Nodularia spumigena, Nostoc species, Arthrospira maIXma, Arthrospira platensis, Arthrospira species, Lyngbya species, Microcoleus chthonoplastes, Oscillatoria species, Petrotoga mobilis, Thermosipho africanus, or Acaryochloris marina.

[0062] Generally, CRISPR/Cas proteins include at least one RNA recognition and/or RNA-binding domain. The RNA recognition and/or RNA-binding domain interacts with the guide RNA. CRISPR/Cas proteins also include nuclease domains (i.e., DNAase or RNAase domains), DNA-binding domains, helicase domains, RNAase domains, protein-protein interaction domains, dimerization domains and other domains. The CRISPR/Cas-like protein may be a wild-type CRISPR/Cas protein, a modified CRISPR/Cas protein, or a fragment of a wild-type or modified CRISPR/Cas protein. CRISPR/Cas-like proteins may be modified to improve nucleic acid binding affinity and/or specificity, change enzymatic activity, and/or change other protein properties. For example, the nuclease (i.e., DNAase, RNAase) domain of the CRISPR/Cas-like protein may be modified, deleted or inactivated. Alternatively, CRISPR/Cas-like proteins may be truncated to remove domains that are not essential for the function of the fusion protein. CRISPR/Cas-like proteins may also be truncated or modified to optimize the activity of the effector domain of the fusion protein.

[0063] In some embodiments, the CRISPR/Cas-like protein may be derived from a wild-type Cas9 protein or a fragment thereof. In other embodiments, the CRISPR/Cas-like protein may be derived from a modified Cas9 protein. For example, the amino acid sequence of a Cas9 protein may be modified to change one or more properties of the protein (e.g., nuclease activity, affinity and stability). Alternatively, domains of the Cas9 protein that are not involved in RNA-induced cleavage may be removed from the protein, so the modified Cas9 protein is smaller than the wild-type Cas9 protein.

[0064] In general, the Cas9 protein includes at least two nuclease (i.e., DNAase) domains. For example, the Cas9 protein may include a RuvC-like nuclease domain and an HNH-like nuclease domain. The RuvC and HNH domains work together to cut single strands and to thus produce double-stranded breaks in DNA (Jinek et al., Science, 337: 816-821). In some embodiments, the Cas9-derived protein may be modified to include only one functional nuclease domain (either the RuvC-like domain or HNH-like nuclease domain). For example, the Cas9-derived protein may be modified such that one of the nuclease domains is deleted or mutated and thus has no function any more (i.e., such that nuclease activity is not exhibited). In some embodiments, in which one of the nuclease domains is inactive, the Cas9-derived protein may introduce a gap into the double-stranded nucleic acid (such a protein is called a “nickase”), but does not cleave the double-stranded DNA. For example, conversion from aspartate to alanine (D10A) in the RuvC-like domain converts Cas9-derived proteins into ligase. Similarly, conversion from histidine to alanine (H840A or H839A) in the HNH domain converts Cas9-derived proteins into nickases. Each nuclease domain may be modified using well-known methods such as site-directed mutagenesis, PCR-mediated mutagenesis and overall gene synthesis, as well as other methods known in the art.

[0065] In the present invention, the DNA encoding the Cas protein may be operably linked to at least one promoter control sequence. In some repetitions, the DNA coding sequence may be operably linked to a promoter control sequence for expression in a eukaryotic cell or animal of interest. The promoter control sequence may be structural, regulated or tissue-specific. Suitable structural promoter control sequences include, but are not limited to, cytomegalovirus early promoters (CMV), simian virus (SV40) promoters, adenovirus major late promoters, Rouse sarcoma virus (RSV) promoters, mouse mammary tumor virus (MMTV) promoters, phosphoglycerate kinase (PGK) promoters, elongation factor (ED1)-alpha promoters, ubiquitin promoters, actin promoters, tubulin promoters, immunoglobulin promoters, fragments thereof, or any combinations thereof. Examples of suitable regulated promoter control sequences include, but are not limited to, those regulated by heat shock, metals, steroids, antibiotics or alcohols. Non-limiting examples of tissue specific promoters include B29 promoters, CD14 promoters, CD43 promoters, CD45 promoters, CD68 promoters, desmin promoters, elastase-1 promoters, endoglin promoters, fibrinectin promoters, Flt-1 promoters, GFAP promoters, GPIIb promoters, ICAM-2 promoters, INF-β promoters, Mb promoters, NphsI promoters, OG-2 promoters, SP-B promoters, SYN1 promoters and WASP promoters. Promoter sequences may be wild-type or modified for more efficient or effective expression. In one exemplary embodiment, the encoding DNA may be operably linked to a CMV promoter for structural expression in mammalian cells.

[0066] In the present invention, the sequence encoding the Cas protein may be operably linked to a promoter sequence recognized by a phage RNA polymerase for in-vitro mRNA synthesis. In such embodiments, the RNA transcribed in vitro can be purified and used by well-known methods. For example, the promoter sequence may be a mutation of the T7, T3 or SP6 promoter sequence or the T7, T3 or SP6 promoter sequence. In an exemplary embodiment, the DNA encoding the Cas protein is operably linked to the T7 promoter for in-vitro mRNA synthesis using T7 RNA polymerase.

[0067] In alternative embodiments, the sequence encoding the Cas protein may be operably linked to a promoter sequence for in-vitro expression of the Cas protein in bacterial or eukaryotic cells. In such embodiments, the expressed protein can be purified and used by known methods. Suitable bacterial promoters include, but are not limited to, T7 promoters, lac operon promoters, trp promoters, variants thereof and combinations thereof. An exemplary bacterial promoter is tac, which is a hybrid of the trp and lac promoters. Non-limiting examples of suitable eukaryotic promoters are listed above. In a further aspect, the DNA encoding the Cas protein may also be linked to a polyadenylation signal (e.g., an SV40 polyA signal or a bovine growth hormone (BGH) polyA signal) and/or at least one transcription termination sequence.

[0068] In various embodiments, the DNA encoding Cas protein may be present in the vector. Suitable vectors include plasmid vectors, phagemids, cosmids, artificial/mini chromosomes, transposons and viral vectors (e.g., lentiviral vectors, adeno-associated virus vectors). In an exemplary embodiment, the DNA encoding Cas protein is present in a plasmid vector. Non-limiting examples of suitable plasmid vectors include pUC, pBR322, pET, pBluescript and variants thereof. The vectors may include additional expression control sequences (e.g., enhancer sequences, Kozak sequences, polyadenylation sequences, transcription termination sequences), selectable marker sequences (e.g., antibiotic-resistant genes), origins of replication, and the like. Additional information is provided in “Current Protocols in Molecular Biology” Ausubel et al., John Wiley & Sons, New York, 2003 or “Molecular Cloning: A Laboratory Manual” Sambrook & Russell, Cold Spring Harbor Press, Cold Spring Harbor, N.Y., 3rd edition, 2001.

[0069] The Cas protein, along with the guide RNA, is directed to the target site within the chromosomal sequence, where the Cas protein introduces a double-stranded break in the chromosome sequence. The target site is not limited with regard to sequence, except that the sequence is right followed by a (downstream) consensus sequence. This consensus sequence is also known as a protospacer adjacent motif (PAM). Examples of the PAM include, but are not limited to, NGG, NGGNG and NNAGAAN, where N is defined as any nucleotide and W is defined as A or T. As detailed above, the first region (at the 5′ end) of the guide RNA is complementary to the protospacer of the target sequence.

[0070] Typically, the first region of the guide RNA is about 19 to 21 nucleotides in length. Thus, in certain aspects, the sequence of the target site within the chromosomal sequence is 5′-N19-21-NGG-3′. PAM is italicized. The target site may be present in a coding region of a gene, an intron of a gene, a control region of a gene, a noncoding region between genes or the like. The gene may be a protein-coding gene or an RNA-coding gene. The gene may be any gene of interest, and may preferably be factor VIII or IX.

[0071] In another aspect, the present invention is directed to a transformed rabbit produced using a CRISPR/Cas9 system including a vector inserted with a polynucleotide encoding an sgRNA including a targeting domain that complementarily binds to a part of the exon region of factor VIII (FVIII) or factor IX (FIX).

[0072] In another aspect, the transgenic rabbit is produced by a method including:

[0073] (a) transcribing the CRISPR/Cas9 system according to the present invention to produce sgRNA and Cas9 mRNA;

[0074] (b) introducing the mRNA produced in step (a) into an embryo and culturing the embryo; and

[0075] (c) transplanting the embryo obtained in step (b) to a surrogate mother to produce the transgenic rabbit.

[0076] In the present invention, the transgenic rabbit may be produced by a method further including determining whether or not transformation occurs after the rabbit production.

[0077] In another aspect, the present invention is directed to a transgenic rabbit progeny produced by a method including crossing the transgenic rabbit to produce the transgenic rabbit progeny.

[0078] In the present invention, “progeny” refers to any viable transgenic rabbit offspring obtained by crossing with the transgenic rabbit, and more specifically, may be an F1 generation produced by crossing the transgenic rabbit with another transgenic rabbit as parents, an F2 generation obtained by crossing the carrier rabbit of the F1 generation with a normal rabbit, or a subsequent generation, but is not limited thereto.

[0079] In the present invention, the crossing may be carried out by crossing with the transgenic rabbit or a normal rabbit.

[0080] In the present invention, the transgenic rabbit or transgenic rabbit progeny may exhibit a hemophilia phenotype since factor VIII or factor IX is knocked out therefrom.

[0081] The present invention is also directed to cells, tissues and byproducts isolated from the transgenic rabbit or transgenic rabbit progeny.

[0082] In the present invention, the byproduct is any substance derived from the transgenic rabbit, but may be preferably selected from the group consisting of blood, serum, urine, feces, saliva, organs and skin, but is not limited thereto.

[0083] In another aspect, the present invention is directed to a method of producing a transgenic rabbit from which factor VIII or factor IX is knocked out, including:

[0084] (a) transcribing the CRISPR/Cas9 system according to the present invention to produce sgRNA and Cas9 mRNA;

[0085] (b) introducing the mRNA produced in step (a) into an embryo and culturing the embryo; and

[0086] (c) transplanting the embryo obtained in step (b) to a surrogate mother to produce the transgenic rabbit.

[0087] The present invention is also directed to a method for producing a transgenic rabbit progeny including crossing the transgenic rabbit produced by the production method to produce a transgenic rabbit progeny.

[0088] In the present invention, the crossing may be carried out by crossing with the transgenic rabbit or a normal rabbit.

[0089] The present invention is also directed to a transgenic rabbit that exhibits a hemophilia A phenotype as desired since factor VIII is knocked out therefrom, and a method for producing the same.

[0090] The present invention is also directed to a transgenic rabbit that exhibits a hemophilia B phenotype as desired by knocking out factor IX therefrom, and a method for producing the same.

[0091] The present invention is also directed to a transgenic rabbit that is produced by crossing a rabbit from which factor VIII is knocked out or a rabbit from which factor IX is knocked out, and is thus used to study the immune response upon injection of the human factor VIII or IX, and a method of producing the same.

[0092] The rabbit from which factor VIII or factor IX is knocked out shows no activity related to factor VIII or factor IX thereof, and is thus useful for studying immune responses upon injection of the human factor VIII or IX and the development of hemophilia drugs.

[0093] Hereinafter, the present invention will be described in more detail with reference to examples. However, it will be obvious to those skilled in the art that these examples are provided only for illustration of the present invention and should not be construed as limiting the scope of the present invention.

EXAMPLE 1

sgRNA Design and CRISPR/Cas9 Vector Construction and In-Vitro Transcription

[0094] 1-1. sgRNA Design

[0095] In the case of factor VIII, sgRNAs represented by the nucleotide sequences of SEQ ID NO: 3 and SEQ ID NO: 4 were designed using the sequence represented by the following SEQ ID NO: 1 in the exon 1 region (FIG. 1).

TABLE-US-00001 SEQ ID NO 1: ATGCAAATAGAGCTCTCCACCTGTTTCTTTGTGTGTATTTTACAATTGA GCTTTAGTGCCACCAGAAGATACTACCTGGGTGCAGTGAACTGTCCTGG GACTATATGCACAGTGAC CTGCTCAGTGA SEQ ID NO 3: sgRNA 1 (+ Strand) 5′-GCCACCAGAAGATACTACCTGGG-3′ SEQ ID NO 4: sgRNA 2 (- Strand) 5′-GTCACTGTGCATATAGTCCCAGG-3′

[0096] In the case of factor IX, sgRNAs represented by the nucleotide sequences of SEQ ID NO: 5 and SEQ ID NO: 6 were designed using the sequence represented by the following SEQ ID NO: 2 in the exon 2 region.

TABLE-US-00002 SEQ ID NO 2: TTTTTCTTGATCATGAAAATGCCACCAAAATTCTGAATCGGGCAAAGAGG TACAATTCAGGTAAACTGGAAGAGTTTGTTTCAGGGAACCTTGAGAGAGA ATGTATAGAAGAAAGGTGTAGTITTGAAGAAGCTCGAGAAGTTTTTGAAA ACACTGAAAAAACT SEQ ID NO 5: sgRNA 1 (+ Strand) 5′-ATGCCACCAAAATTCTGAATCGG-3′ SEQ ID NO 6: sgRNA 2 (+ Strand) 5′ CGGGCAAAGAGGTACAATTCAGG-3′

[0097] 1-2. sgRNA and Cas9 mRNA Transcription

[0098] Oligonucleotides suitable for the sgRNA sequences designed in Example 1-1 were designed and cloned into the pUC57-T7 vector (Addgene ID 51306), and the completed sgRNA and the T7 promoter located therein were amplified by PCR with the primers of SEQ ID NOS: 7 and 8.

[0099] The PCR amplification product was obtained using T7 RNA polymerase (MAIXscript T7 Kit, Ambion) and then purified (miRNeasy Mini Kit, Qiagen).

TABLE-US-00003 SEQ ID NO 7: 17-F 5′-GAAATTAATACGACTCACTAT-3′ SEQ ID NO 8: 17-R 5′-AAAAAAAGCACCGACTCGGTGCCAC-3′

[0100] In the case of Cas9 mRNA, the Cas9 expression vector was linearized, and then capped mRNA was produced using a mMessage mMachine SP6 Kit (Ambion) and purified using an RNeasy Mini Kit (Qiagen).

EXAMPLE 2

Injection of Transcribed Cas9/sgRNA into Embryos

[0101] The Cas9/FVIII sgRNA or Cas9/FIX sgRNA obtained in Example 1 was introduced into fertilized rabbit eggs using a known method (Sci Rep. 2016; 6:222024).

[0102] ApproIXmately 18 to 20 hours after fertilization, the fertilized rabbit eggs were transferred to a embryo culture medium (9.5 g TCM-119, 0.05 g NaHCO.sub.3 (Sigma, S4019), 0.75 g Hepes (Sigma H3784), 0.05 g penicillin, 0.06 g streptomycin, 1.755 g NaCl, 3.0 g BSA and 1 L Milli Q distilled water) , FVIII sgRNA (25 ng/μl) and Cas9 mRNA (100 ng/μl) or FIX sgRNA (25 ng/μl) and Cas9 mRNA (100 ng/μl) were injected into the embryo cytoplasm and then the embryo cytoplasm was cultured in a culture medium at 5% carbon dioIXde for 30 to 60 minutes at 38.5° C., and then the embryo was transplanted into a surrogate mother to produce a rabbit.

EXAMPLE 3

Genotyping of Transgenic Rabbits

[0103] 3-1. Genotyping of Factor VIII Knockout Rabbit

[0104] The amplicons shown in (a) of FIG. 2 were amplified using the primers of SEQ ID NOS: 9 and 10, adaptors and tags were attached using secondary and tertiary PCR, deep sequencing was performed using MiSeq (Illumina, MiSeq Reagent Kit V), and the results were analyzed using Cas-Analyzer (Bioinformatics, 2017 Jan. 15; 333 (2): 286-288).

TABLE-US-00004 SEQ ID NO 9: F8-F 5′-gagccatgcaaatagagctc-3′ SEQ ID NO 10: F8-R 5′-atctttctccagccagagtc-3′

[0105] The result showed that indels were detected in the FVIII genes of Subjects 2# and 3#, as shown in Table 1 and FIG. 3.

TABLE-US-00005 TABLE 1 Number Number Number of of of insertion deletion Indel Rabbit Total containing containing containing Indel Sample Gene Read reads reads reads (%) Pattern #2 Blood F8 61151 0 61128 61128 −4 (100.0%) #3 Blood F8 55016 0 54919 54919 −3, −12  (99.8%)

[0106] In other words, a mutation in which nucleic acid fragment 4 bp long was deleted was detected in Subject #2, causing premature stop codons and nonsense-mediated decay and thus inhibiting gene expression. Mutations in which nucleic acid fragments 3 bp and 12 bp long were deleted were detected in Subject #3 (FIG. 3).

[0107] 3-2. Genotyping of Factor IX Knockout Rabbits

[0108] The amplicons shown in (b) of FIG. 2 were amplified using the primers of SEQ ID NOS: 11 and 12, adaptors and tags were attached using secondary and tertiary PCR, deep sequencing was performed using MiSeq (Illumina, MiSeq Reagent Kit V), and the results were analyzed using Cas-Analyzer (Bioinformatics, 2017 Jan. 15; 333 (2): 286-288). Subject #5 was primarily amplified using the F9-R2 primer of SEQ ID NO. 13.

TABLE-US-00006 SEQ ID NO 11: F9-F 5′-ttggctttgggattagttgg-3′ SEQ ID NO 12: F9-R 5′-tcaaaaacttctcgagcttc-3′ SEQ ID NO 13: F9-R2 5′-tctctgtctgtaactctacc-3′

[0109] The result showed that Indel was detected from the FIX genes of Subjects #5, #6, #7, #8, #9, #11, #12 and #13, as shown in Table 2 and FIGS. 4 to 6.

TABLE-US-00007 TABLE 2 # of # of # of insertion deletion Indel Main Rabbit Total containing containing containing muta- Sample Gene Read reads reads reads (%) tion 5 Blood F9 28 0   12 (42.9%) 6 Blood F9 46377 0 46358 46358 (100.0%) −6 7 Blood F9 38728 0 38728 38728 (100.0%) −6, 11 8 Blood F9 12386 0 12386 12386 (100.0%) −60 9 Blood F9 19659 0 19659 19659 (100.0%) −9, +2, −5 11 Blood F9 28955 2934 26021 28955 (100.0%) −20 12 Blood F9 27447 0 27447 27447 (100.0%) 27447 13 Blood F9 52827 93 52689 5278 to (99.9%) −37

EXAMPLE 4

Hemophilia Phenotyping of Transgenic Rabbits

[0110] 4-1. Activated Partial Thromboplastin Time (APTT) Analysis

[0111] In order to perform the APTT analysis, waveforms of APTT clots were observed in real time using Start 4Hemostasis Analyzer (Stago Inc., USA). That is, 50 μl of APTT reagent (Dade® Actin FSL, Siemens Medical Solutions Inc., USA) solution and 50 μl of plasma isolated from the transgenic rabbit were mixed in a cuvette and incubated at 37° C. for 3 minutes, 50 μl of an aqueous calcium chloride (CaCl.sub.2) solution (final concentration: 25 mM) was injected into the cuvette and then the time at which clots were formed was measured.

[0112] As a result, as can be seen from FIG. 7A, the clot formation time was 19.4±1.1 seconds for the FVIII knockout rabbit and was 18.9±2.5 seconds for the FIX knockout rabbit. These times indicate that the two rabbits suffer from hemophilia.

[0113] 4-2. Thrombin Generation Assay (TGA)

[0114] Thrombin production was measured by analyzing Fluoroskan Ascent (Thermo Scientific) fluorescent plate readers with Thrombinoscope BV software. That is, 80 μl of a transgenic rabbit plasma and 2 μl of PPP-reagent LOW containing tissue factor and phospholipid were mixed and cultured on a 37° C. Immulon microtiter 2HB-high binding 96-well plate (Thermo Nunc). A mixture of 80 μl of rabbit plasma and 20 μl of thrombin calibrator reagent was cultured in a control well, and a fluorescent thrombin substrate and a preheated Flu-Ca reagent were injected and mixed to homogeneity before the reaction. 20 μl of Flu-Ca reagent was injected to start the reaction and the amount of thrombin produced was analyzed with Thrombinoscope Analysis Version 3.0.

[0115] As a result, as shown in B of FIG. 7, 36.9±1.8 nM of thrombin was produced in the control group, while 0.1±0.1 nM of thrombin was produced in the FVIII knockout transgenic rabbit and no thrombin was produced in the FIX knockout transgenic rabbit.

[0116] Therefore, the transgenic rabbits from which the FVIII or FIX genes were removed were found to have a hemophilia phenotype.

EXAMPLE 5

Breeding Pedigree for F1 and F2 Generation Production

[0117] The hemophilia rabbit prepared in Example 2 was called “P” (or F0), and the following process was conducted to obtain F1 and F2 progeny thereof. In order to obtain the progeny of the transgenic rabbit from which factor VIII or IX was knocked out, the subjects were bred as shown in FIG. 8. That is, since hemophilia is a sex-linked heritable disease in which the hemophilia gene is present on the X chromosome, the factor VIII knockout and factor IX knockout transgenic rabbit father (P, X′Y) prepared in Example 2 was crossed with a normal rabbit female (XX) to produce progeny. The female progeny (F1) obtained from the first cross was identified to be a carrier (X′X) through genetic analysis and then the carrier (X′X) was crossed with a normal male (XY) to produce a male transgenic rabbit (F2, X′Y) from which factor VIII and factor IX were knocked out.

EXAMPLE 6

Genotyping of F1-Generation Transgenic Rabbit

[0118] 6-1. Genotyping of Factor VIII Knockout Rabbit Carrier

[0119] The male rabbit (X′Y), that is, Subject #2, in which the 4 bp nucleic acid deletion mutation shown in Table 1 was detected, was crossed with a normal female (XX) with an age of 10 to 12 weeks and a weight of 2 kg or more purchased from Samtako Inc., to obtain progeny. The progeny was identified to be a female carrier (X′X), the F1 generation through gene analysis in the same manner as in Example 3-1. As can be seen from Table 3 and FIG. 9, the indel patterns were detected in the FVIII genes of Subjects #1 and #5.

TABLE-US-00008 TABLE 3 Number of Number of Number of insertion deletion Indel Rabbit Total containing containing containing Indel Sample Gene Read reads reads reads (%) pattern #1 Blood F8 37549 0 18812 18812 −4 (50.1%) #5 Blood F8 56305 0 27308 27308 −4 (48.5%)

[0120] 6-2. Genotyping of Factor IX Knockout Rabbit Carrier

[0121] Male (X′Y), that is, Subject #6, having the 6 bp nucleic acid deletion mutation shown in Table 2, was crossed with a normal female (XX) to obtain F1 progeny, and the F1 progeny was identified to be a female carrier (X′X) through genetic analysis in the same manner as in Example 3-2. As shown in Table 4 and FIG. 10, indel patterns were detected in the FIX gene of Subject #4, and the indel patterns were a −6 bp deletion and a 1 bp insertion.

TABLE-US-00009 TABLE 4 Number of Number of Number insertion deletion of Indel Rabbit Total containing containing containing Indel Sample Gene Read reads reads reads (%) pattern #4 Blood F9 17,299 0 4,587 4,587 −6, +1 (66.8%)

EXAMPLE 7

Genotyping of F2-Generation Transgenic Rabbit

[0122] 7-1. Genotyping of Factor VIII Knockout Rabbit Carrier

[0123] The carrier female (X′X), the F1 generation was crossed with a normal male (XY) with an age of 10 to 12 weeks and a weight of 2 kg or more, purchased from Samtako Inc., to obtain an F2 male (X′Y). The F2 male (X′Y) was identified to be a female carrier (X′X), F1 generation, through gene analysis in the same manner as in Example 3-1. As can be seen from Table 5 and FIG. 11, the indel patterns were detected from the FVIII genes of Subjects #1-4 and #5-1.

TABLE-US-00010 TABLE 5 Number Number Number of of of insertion deletion Indel Rabbit Total containing containing containing Indel Sample Gene Read reads reads reads (%) pattern #1-4 Blood F8 5,850 0 4,587 4,587 −4 (78.4%) #5-1 Blood F8 5,865 0 5,467 5,467 −4 (93.2%)

[0124] 7-2. Genotyping of Factor IX Knockout Rabbit Carrier

[0125] An F2 male (X′Y) obtained by crossing the carrier female (X′X), F1 generation, with a normal male (XY) was subjected to gene analysis in the same manner as in Example 3-2. As can be seen from Table 6 and FIG. 12, indel patterns were detected from the FIX gene of Subject #4-1 and the indel patterns included 6 bp, 7 bp and 27 bp deletions, but the 7 bp and 27 bp deletions were present in 0.023% and 0.001%, respectively, and thus were considered to be sequencing errors. Thus, Subject #4-1 was identified to be a 6 bp nucleic acid deletion mutant.

TABLE-US-00011 TABLE 6 Number Number Number of of of Idel insertion deletion containing Rabbit Total containing containing reads Indel Sample Gene Read reads reads (%) pattern #4-1 Blood F9 279,860 0 278,366 278,298 −6 (99.4%)

EXAMPLE 8

Phenotyping of F2-Generation Transgenic Rabbit

[0126] 8-1. Claw Bleeding Model

[0127] In order to induce a claw bleeding model in rabbits, hemophilia rabbits of Example 7 with an age of 12 weeks or more and a weight of 2 kg or more and normal rabbits with an age of 10 to 12 weeks and a weight of 2 kg or more purchased from Samtako Inc. were anesthetized by injection of 0.4 mg/kg of diazepam and 25 mg/kg of pentobarbital sodium into the auricular vein thereof. One anterior paw of the anesthetized rabbit was depilated with a hair clipper, and a 2 mm proIXmal portion from the quick distal end of the middle toe claw was marked using an oil pen and a Digimatic caliper and then cut using a wire cutter (FIG. 13). Immediately after cutting the claw, the claw was put into a 50 mL conical tube containing a sterile saline solution maintained at 37° C. for 60 minutes, the blood was collected for 60 minutes, the supernatant was removed by centrifugation at 1500×g for 5 minutes, and tertiary distilled water was added up to 20 mL to a conical tube using a 10 mL pipette, and the blood was completely hemolyzed in a vortex.

[0128] 8-2. Hemoglobin Assay (HB) Analysis

[0129] The amount of hemoglobin in the blood was quantified with a hemoglobin assay kit (Sigma and Aldrich, MAK115-1KT, #BF03A26V) using the sample hemolyzed in Example 8-1 to measure blood loss. It was found that the concentration of hemoglobin of normal rabbits was 1,014 nM (range: 502-1503), the concentration of hemoglobin of the factor VIII knockout rabbit was 45,787 nM, and the hemoglobin concentration of the factor IX knockout rabbit was 4,620 nM (FIG. 14).

[0130] Although specific configurations of the present invention have been described in detail, those skilled in the art will appreciate that this description is provided to set forth preferred embodiments for illustrative purposes and should not be construed as limiting the scope of the present invention. Therefore, the substantial scope of the present invention is defined by the accompanying claims and equivalents thereto.

INDUSTRIAL APPLICABILITY

[0131] The transgenic rabbit, from which factor VIII and/or factor IX is knocked out according to the present invention, is inhibited in the function of factor VIII and/or factor IX, which is a protein that plays an important role in the development of hemophilia, thus being useful for the development of hemophilia drugs or hemophilia research.

SEQUENCE LISTING FREE TEXT

[0132] An electronic file is attached.