FUSION TAG FOR INCREASING WATER SOLUBILITY AND EXPRESSION LEVEL OF TARGET PROTEIN AND USES THEREOF
20210163914 · 2021-06-03
Assignee
Inventors
Cpc classification
C12Y402/01001
CHEMISTRY; METALLURGY
International classification
Abstract
A fusion tag according to an embodiment of the present invention may increase the water solubility and expression level of a target protein. As the water solubility and expression level of a target protein in host cell can be increased by a recombinant vector including the fusion tag, the fusion tag can be advantageously used in industry.
Claims
1. A recombinant vector comprising: a polynucleotide encoding a fusion tag including PLX.sub.1DLGX.sub.2E domain, where X.sub.1 is I or L and X.sub.2 is A or S, of the amino acid sequence of SEQ ID NO: 1 or a peptide having the amino acid sequence of SEQ ID NO: 20; and a gene sequentially linked to the polynucleotide, the gene encoding a target protein.
2. The recombinant vector according to claim 1, wherein the fusion tag has the amino acid sequence of SEQ ID NO: 2, 3 or 4.
3. The recombinant vector according to claim 2, wherein the polynucleotide encoding a fusion tag has the nucleotide sequence of SEQ ID NO: 5, 6 or 7.
4. The recombinant vector according to claim 1, wherein the target protein is a difficult-to-express protein.
5. A host cell transformed with the recombinant vector of claim 1.
6. A method for increasing water solubility and expression level of the target protein, the method comprising transforming a host cell with the recombinant vector of claim 1 to express the gene encoding the target protein.
7. A method for producing the target protein with increased water solubility and increased expression level in a host cell, the method comprising: transforming the host cell with the recombinant vector of claim 1; and culturing the transformed host cell to express the target protein.
8. (canceled)
9. The recombinant vector of claim 1, wherein the polynucleotide encodes the fusion tag including PLX.sub.1DLGX.sub.2E domain of the amino acid sequence of SEQ ID NO: 1.
10. The recombinant vector according to claim 9, wherein the fusion tag has the amino acid sequence of SEQ ID NO: 2.
11. The recombinant vector according to claim 9, wherein the fusion tag has the amino acid sequence of SEQ ID NO: 3.
12. The recombinant vector according to claim 9, wherein the fusion tag has the amino acid sequence of SEQ ID NO: 4.
13. The recombinant vector according to claim 9, wherein the polynucleotide encoding the fusion tag has the nucleotide sequence of SEQ ID NO: 5.
14. The recombinant vector according to claim 9, wherein the polynucleotide encoding the fusion tag has the nucleotide sequence of SEQ ID NO: 6.
15. The recombinant vector according to claim 9, wherein the polynucleotide encoding the fusion tag has the nucleotide sequence of SEQ ID NO: 7.
16. The recombinant vector of claim 1, wherein the polynucleotide encodes the fusion tag including the peptide having the amino acid sequence of SEQ ID NO: 20.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
DETAILED DESCRIPTION
[0025] In order to achieve the purpose of the invention described above, the present invention provides a recombinant vector characterized in that a polynucleotide encoding a fusion tag including PLX.sub.1DLGX.sub.2E domain (X.sub.1 is I or L and X.sub.2 is A or S) composed of the amino acid sequence of SEQ ID NO: 1 or a peptide composed of the amino acid sequence of SEQ ID NO: 20, and a gene encoding a target protein are sequentially linked to each other.
[0026] The recombinant vector according to the present invention may be a recombinant vector in which a polynucleotide encoding a fusion tag including PLX.sub.1DLGX.sub.2E domain composed of the amino acid sequence of SEQ ID NO: 1 or a peptide composed of the amino acid sequence of SEQ ID NO: 20 and a gene encoding a target protein are operably linked to each other. As described herein, the expression “operably linked” means a component of an expression cassette which functions as a unit for expressing an exogenous protein. For example, a promoter operably linked to an exogenous DNA encoding a protein promotes the production of a functional mRNA corresponding to the exogenous DNA. As for the method of linking the promoter to a gene encoding the target protein, a common technique like PCR, digestion using restriction enzyme, and ligation, which can be easily carried out by a person skilled in the art, can be used.
[0027] With regard to the recombinant vector of the present invention, PLX.sub.1DLGX.sub.2E domain composed of the amino acid sequence of SEQ ID NO: 1 may be a conserved sequence which is present in the N-terminus of a-carbonic anhydrase derived from microorganism. The microorganism may be a microorganism like bacteria of Hydrogenovibrio genus, Thiomicrospira genus, Thiomicrorhabdus genus, Sulfurivirga genus, or Piscirickettsiaceae family. It may be preferably Hydrogenovibrio marinus, Hydrogenovibrio crunogenus, Hydrogenovibrio kuenenii, Hydrogenovibrio halophilus, Thiomicrospira milos T1, Thiomicrospira milos T2, Thiomicrospira pelophila, Thiomicrospira microaerophila, Thiomicrospira genus Kp2, Thiomicrospira genus CG2_30_44_34, Thiomicrospira genus XS5, Thiomicrospira genus MA2-6, Thiomicrospira genus WB1, Thiomicrorhabdus chilensis, Thiomicrorhabdus arctica, Sulfurivirga caldicuralii) or Piscirickettsiaceae bacterium CG18_big_fil_WC_8_21_14_2_50_44_103, and it is more preferably Hydrogenovibrio marinus, Hydrogenovibrio crunogenus or Hydrogenovibrio kuenenii, but it is not limited thereto.
[0028] Although the N-terminus sequence of a-carbonic anhydrase has low sequence identity or sequence similarity among the above microorganisms and has different sequence length, the domain composed of the amino acid sequence of SEQ ID NO: 1 is included therein as a conserved sequence.
[0029] With regard to the recombinant vector of the present invention, the fusion tag including PLX.sub.1DLGX.sub.2E domain of SEQ ID NO: 1 can be a tag including PLX.sub.1DLGX.sub.2E domain that is present at the N-terminus of a-carbonic anhydrase derived from Hydrogenovibrio marinus (hereinbelow, referred to as NEXT tag), a tag including PLX.sub.1DLGX.sub.2E domain that is present at the N-terminus of α-carbonic anhydrase derived from Hydrogenovibrio crunogenus (hereinbelow, referred to as Cru tag), or a tag including PLX.sub.1DLGX.sub.2E domain that is present at the N-terminus of α-carbonic anhydrase derived from Hydrogenovibrio kuenenii (hereinbelow, referred to as Kue tag), and NEXT tag, Cru tag, and Kue tag can be composed of the amino acid sequence of SEQ ID NOs: 2, 3 and 4, respectively, but not limited thereto.
[0030] In addition, with regard to the recombinant vector of the present invention, a fusion tag including a peptide composed of the amino acid sequence of SEQ ID NO: 20 means a tag which is composed of the 17 amino acids that are present at the C-terminus of NEXT tag.
[0031] Also included in the scope of the fusion tag of the present invention are the tag having an amino acid sequence represented by SEQ ID NO: 2, 3 or 4, and functional equivalents thereof. As described herein, the term “functional equivalents” means a tag which has, as a result of addition, substitution, or deletion of an amino acid, at least 70%, preferably at least 80%, more preferably at least 90%, and even more preferably at least 95% sequence homology with the amino acid sequence represented by SEQ ID NO: 2, 3 or 4, and it indicates a tag which exhibits substantially the same physiological activity as the tag represented by SEQ ID NO: 2, 3 or 4. The expression “substantially the same physiological activity” indicates an activity of increasing the water solubility and expression level of a target protein.
[0032] In one embodiment of the present invention, the fusion tag composed of the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 3 indicates the PLX.sub.1DLGX.sub.2E domain in which X.sub.1 is isoleucine (I) and X.sub.2 is alanine (A), and the fusion tag composed of the amino acid sequence of SEQ ID NO: 4 indicates the PLX.sub.1DLGX.sub.2E domain in which X.sub.1 is leucine (L) and X.sub.2 is serine (S).
[0033] Furthermore, the polynucleotide encoding the fusion tag composed of the amino acid sequence of SEQ ID NO: 2, 3 or 4 may be composed of the nucleotide sequence of SEQ ID NO: 5, 6 or 7, but it is not limited thereto.
[0034] As described herein, the term “target protein” indicates a protein that is desired to be produced in large amount by a skilled person in the art, and it means any protein that can be expressed in a transformant as a result of inserting a polynucleotide encoding the target protein to a recombinant expression vector. With regard to the recombinant vector of the present invention, the target protein can be a difficult-to-express protein which is hardly in water soluble form in a host cell. Although not limited thereto, it may be a protein such as toxin, antigen, antibody, or enzyme.
[0035] As described herein, the term “recombinant” indicates a cell which replicates an exogenous nucleotide or expresses the nucleotide, or a cell which expresses a peptide, an exogenous peptide, or a protein encoded by an exogenous nucleotide. Recombinant cell can express a gene or a gene fragment which is not found in natural-state cell in the form of a sense or antisense. In addition, the recombinant cell can express a gene that is found in natural state, provided that said gene is modified and re-introduced into the cell by an artificial means.
[0036] According to the present invention, the polynucleotide encoding the fusion tag and the gene sequence encoding a target protein can be inserted to the recombinant expression vector. The expression “recombinant expression vector” means a bacteria plasmid, a phage, a yeast plasmid, a plant cell virus, a mammalian cell virus, or other vector. In general, as long as it can be replicated and stabilized in a host, any plasmid or vector can be used. Important characteristic of the expression vector is that it has a replication origin, a promoter, a marker gene, and a translation control element.
[0037] The expression vector including the polynucleotide encoding a fusion tag, the gene sequence encoding a target protein, and a suitable signal for regulating transcription/translation can be constructed by a method which is well known to a person skilled in the art. Examples of such method include an in vitro recombination DNA technique, a DNA synthesis technique, and an in vivo recombination technique. The DNA sequence can be effectively linked to a suitable promoter in the expression vector in order to induce synthesis of mRNA. Furthermore, the expression vector may contain, as a site for translation initiation, a ribosome binding site and a transcription terminator.
[0038] The present invention further provides a host cell transformed with the recombinant vector.
[0039] As a host cell allowing stable and continuous cloning and expression of the vector of the present invention in a prokaryotic cell, any host cell well known in the pertinent art can be used, and examples thereof include E. coli BL21, E. coli JM109, E. coli RR1, E. coli LE392, E. coli B, E. coli X 1776, E. coli W3110, a strain of Bacillus genus such as Bacillus subtilis or Bacillus thuringiensis, and enterobacetria and bacterial strains such as Salmonella typhimurium, Serratia marcescens, and various Pseudomonas.
[0040] Furthermore, in case of transforming an eukaryotic cell with the vector of the present invention, yeast (e.g., Saccharomyce cerevisiae; Pichia pastoris; Kluyveromyces lactis; Kluyveromyces marxianus; Yarrowia hpolytica; Hansenula polymorpha, or the like), an insect cell (e.g., Spodoptera frugiperda Sf9, Sf21, High Five™), an animal cell (e.g., CHO (Chinese hamster ovary) cell line, W138, BHK, COS-7, 293, HepG2, 3T3, RIN and MDCK cell line), a plant cell, or the like can be used.
[0041] The host cell transformed with the recombinant vector according to one embodiment of the present invention can be E. coli BL21 (DE3), but it is not limited thereto.
[0042] When the host cell is a prokaryotic cell, the method of delivering the vector of the present invention to a host cell can be carried out by CaC;.sub.2 method, Hanahan's method (Hanahan, D., 1983 J. Mol. Biol. 166, 557-580), electroporation, or the like. When the host cell is an eukaryotic cell, the vector can be incorporated to a host cell by microinjection, calcium phosphate precipitation, electroporation, liposome-mediated transfection, DEAE-dextran treatment, gene bombardment, or the like.
[0043] The present invention further provides a method for increasing the water solubility and expression level of a target protein including transforming a host cell with the recombinant vector to express a gene encoding a target protein.
[0044] In the method according to one embodiment of the present invention, the host cell can be E. coli BL21 (DE3), but it is not limited thereto.
[0045] The present invention further provides a method for producing a target protein with increased water solubility and increased expression level in a host cell including:
[0046] transforming a host cell with the aforementioned recombinant vector; and
[0047] culturing the transformed host cell to express a target protein.
[0048] With regard to the method of producing a target protein of the present invention, culturing the transformed host cell can be carried out, by using a known technique, on a medium suitable for the production of a target protein. The suitable culture medium can be either commercially obtained or prepared based on the components and compositional ratio that are described in publications like the catalogue of American Type Culture Collection, but it is not limited thereto.
[0049] The method for producing a target protein of the present invention may also include a step of isolating and purifying the target protein from a host cell expressing the target protein. As for the method for isolation, isolation from a medium can be achieved by a common method such as centrifuge, filtration, extraction, spray drying, evaporation, or precipitation, but the method is not limited thereto. Furthermore, the isolated protein can be purified by various well-known methods such as chromatography (e.g., ion exchange, affinity, hydrophobic, or size exclusion chromatography), dialysis, electrophoresis, fractional dissolution (e.g., ammonium sulfate precipitation), SDS-PAGE, or extraction.
[0050] The present invention still further provides a composition for producing a target protein with increased water solubility and increased expression level comprising, as an effective component, a recombinant vector in which a polynucleotide encoding a fusion tag including PLX.sub.1DLGX.sub.2E domain (X.sub.1 is I or L and X.sub.2 is A or S) composed of the amino acid sequence of SEQ ID NO: 1 or a peptide composed of the amino acid sequence of SEQ ID NO: 20 and a gene encoding a target protein are sequentially linked to each other. As the composition of the present invention comprises, as an effective component, a polynucleotide encoding the fusion tag that can increase the water solubility and expression level of a target protein for fusion, a target protein with increased water solubility and increased expression level can be produced.
[0051] With regard to the composition of the present invention, the fusion tag can be a tag composed of the amino acid sequence of SEQ ID NO: 2, 3 or 4, but it is not limited thereto.
[0052] Hereinbelow, the present invention is explained in detail in view of the Examples. However, it is evident that the following Examples are given only for exemplification of the present invention and by no means the present invention is limited to the following Examples.
Materials and Methods
1. Culture of Bacterial Strain
[0053] For constructing a gene recombinant vector, E. coli TOP10 strain was used. For protein expression, E. coli BL21 (DE3) strain was used. E. coli was cultured in Luria-Bertani (LB) medium at conditions of 37° C., 180 rpm, and 50 μg/mL ampicillin was added thereto as required.
2. Cloning of Water Soluble Tag for Constructing Plasmid Vector
[0054] For cloning a fusion tag from the a-carbonic anhydrase derived from Hydrogenovibrio marinus DSM 11271 strain (hereinbelow, NEXT), DNA fragments amplified by PCR, in which the genomic DNA of H marinus has been used as a template, were obtained. Similarly, by using as a template pMAL-c5X for MBP (maltose-binding protein) tag and pGEX-4T-1 for GST (glutathione S-transferase) tag, PCR was carried out to obtain DNA fragments. The primer sequences used for PCR are as described in the following Table 1.
[0055] Furthermore, for the fusion tag derived from H crunogenus and H kuenenii strains, respectively (hereinbelow, Cru, Kue), and Fhb tag, gene synthesis was carried out such that each tag contains its whole sequence (Genbank accession number: CP000109, WP_024851558, AF213970), a restriction enzyme sequence required for cloning, and GS linker sequence. All of the tags were designed such that they have NdeI restriction enzyme site in 5′ area and NcoI restriction enzyme site in 3′ area and also a flexible GS linker (GGGGSGGGGS (SEQ ID NO: 24)) is additionally added between the tag and a target protein.
[0056] The PCR amplified product was cloned in pGEM-T easy vector. After sequencing, it was cloned in the expression vector pET-22b(+) using the sequences of the restriction enzyme NdeI and NcoI. The complete vector was named pET-NEXT, pET-Cru, pET-Kue, pET-MBP, pET-GST, and pET-Fh8, respectively.
TABLE-US-00001 TABLE 1 Primer Sequence Information Primer Nucleotide Sequence (5′.fwdarw.3′) Name (SEQ ID NO:) NEXT tag_F CATATGGCTGTTCAACATAGCAATGCCCC (SEQ ID NO: 8) NEXT tag_R CCATGGAGCCTCCACCGCCGCTGCCACCT CCGCCCACAACGGGTTTTGGTTTAG (SEQ ID NO: 9) MBP tag_F CATATGAAAATCGAAGAAGGTAAACTG (SEQ ID NO: 10) MBP tag_R CCATGGAGCCTCCACCGCCGCTGCCACCT CCGCCAGTCTGCGCGTCTTTC (SEQ ID NO: 11) GST tag_F CATATGTCCCCTATACTAGGTTATTGG (SEQ ID NO: 12) GST tag_R CCATGGAGCCTCCACCGCCGCTGCCACCT CCGCCATCCGATTTTGGAGGATGG (SEQ ID NO: 13)
[0057] Under lined: Restriction enzyme site
[0058] Bold letters: GS linker sequence
3. Cloning of Target Protein for Constructing Plasmid Vector
[0059] In order to determine whether or not NEXT, Cru and Kue fusion tags of the present invention increase, as a fusion partner, the water solubility and expression level of a target protein, green fluorescent protein (GFP) and firefly luciferase, which show low water solubility after expression of a recombinant protein, and a-carbonic anhydrase derived from Thermovibrio ammonificans (taCA), which is expressed as a protein in water soluble form but shows low water solubility due to precipitation after protein purification, were selected as a target protein. Their genes were obtained by carrying out PCR by using pTrcHis-GFPuv, pGL-4-50, and pET-taCA, respectively, as a template.
[0060] PCR-amplified product was first cloned in pGEM-T Easy vector. After sequencing, it was cloned, by using the restriction enzyme NcoI-XhoI sequence, in pET-NEXT, pET-Cru, pET-Kue, pET-MBP, pET-GST, or pET-Fh8 vector which have been constructed as described in the above. Based on this process, 14 kinds of a plasmid for expressing total 14 kinds of proteins (NEXT tag-GFP, NEXT tag-luciferase, NEXT tag-taCA, Cm tag-taCA, Kue tag-taCA, MBP tag-GFP, MBP tag-luciferase, MBP tag-taCA, GST tag-GFP, GST tag-luciferase, GST tag-taCA, Fh8 tag-GFP, Fh8 tag-luciferase, Fh8 tag-taCA) were prepared. At the C-terminus of 14 kinds of the obtained recombinant protein, a histidine tag provided by pET-22b was fused for expression.
[0061] Furthermore, to construct an expression vector for taCA protein by using tmcNEXT fusion tag which is composed of 17 amino acid of the C-terminus of NEXT tag, tmcNEXT_F and taCA_R primers were used, and PCR was carried out by using a plasmid for expressing NEXT tag-taCA as a template. After that, by utilizing the restriction enzyme NcoI-XhoI sequence, it was cloned in pET-22b vector. In the complete vector, tmcNEXT fusion tag and taCA were fused to each other and expressed.
[0062] Meanwhile, as a β-carbonic anhydrase variant derived from Desulfovibrio vulgaris which is known to have excellent thermal stability, dvCA 8.0 was used as a comparison group for a test in which the stability is compared between the wild-type taCA protein not fused with NEXT tag and taCA protein fused with NEXT tag. pET-dvCA8 vector for expressing dvCA 8.0 was constructed by cloning dvCA 8.0 gene (SEQ ID NO: 22) in expression vector pET-22b by using restriction enzyme NdeI-XhoI sequence. The amino acid sequence of dvCA 8.0 was represented by SEQ ID NO: 23, and the primer sequences used for PCR are as described in the following Table 2.
TABLE-US-00002 Table 2 Primer Sequence Information Nucleotide Sequence Primer Name (5′.fwdarw.3′) (SEQ ID NO) GFP_F CCATGGGCAGTAAAGGAGAAGAACTT TTCACTG (SEQ ID NO: 14) GFP_R CTCGAGTTTGTAGAGCTCATCCATGC (SEQ ID NO: 15) Luciferase_F CCATGGAAGATGCCAAAAACATTAAG (SEQ ID NO: 16) Luciferase_R CTCGAGCACGGCGATCTTGCC (SEQ ID NO: 17) taCA_F CCATGGGTGGTGGCG (SEQ ID NO: 18) taCA_R CTCGAGCTTCATCACTTTAC (SEQ ID NO: 19) trncNEXT_F CATATGGCCGCGGAAGCCAAAAA (SEQ ID NO: 21)
[0063] Bold letters: Restriction enzyme site
4. Cell Fractionation and Protein Expression
[0064] The above-constructed recombinant vector was introduced to E. coli BL21 (DE3) strain and cultured at 37° C., 180 rpm. When the cell density was close to OD.sub.600 of 0.6 to 0.8, the expression was induced by adding IPTG (isopropyl-β-D-thiogalactopyranoside) (0.01 mM at 25° C., or 1 mM at 37° C.), and cultured for 20 hours and 10 hours, respectively. Upon the completion of the culture, centrifuge was carried out for 15 minutes at condition of 4° C., 4,000xg to collect the cells, which were then resuspended by using lysis buffer (50 mM sodium phosphate, 300 mM NaCl, 10 mM imidazole, pH 8.0). The resuspended cells were disrupted in cold state by ultrasonication, and the resulting solution was centrifuged for 10 minutes at a rate of 10,000xg at 4° C. After that, the supernatant was named soluble fraction (S), and the pellet was resuspended in the same amount of lysis buffer and named insoluble fraction (IS). Each cell fraction was then separated by using SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis), and, according to Coomassie blue staining, the expression pattern of the recombinant protein was analyzed. Furthermore, depending on the case, the protein on gel after SDS-PAGE was transferred to a nitrocellulose membrane, and subjected to Western blot using monoclonal anti-His6 antibody as a primary antibody and polyclonal anti-mouse IgG antibody linked with alkaline phosphatase as a secondary antibody.
5. Purification of Target Protein Including Tag
[0065] From the water soluble fraction (S) containing the wild-type taCA protein not including any tag, target protein taCA including tag or dvCA 8.0, proteins were purified and their properties were analyzed. To the water soluble fraction obtained from cell culture of E. coli which has been transformed with the plasmid containing the wild-type taCA, dvCA8.0 or taCA containing water soluble tag (NEXT tag-taCA, Cru tag-taCA, Kue tag-taCA, MBP tag-taCA, GST tag-taCA, Fh8 tag-taCA, trncNEXT tag-taCA), Ni.sup.2+-nitrilotriacetic acid agarose beads were added and the binding reaction was allowed to occur. After that, purified proteins were obtained by using elution buffer (50 mM sodium phosphate, 300 mM NaCl, 250 mM imidazole, pH 8.0). The obtained proteins were subjected to buffer exchange using dialysis buffer (20 mM sodium phosphate buffer, pH 7.5), and, depending on the case, 300 mM sodium chloride was added to the dialysis buffer.
6. Protein Quantification
[0066] To adjust the purified protein concentration at the same level, protein quantification was carried out. Specifically, proteins obtained after the dialysis were denatured by mixing with a denaturing buffer (6 M guanidine hydrochloride GuHCl/20 mM sodium phosphate buffer, pH 7.5) and heating at 100° C. for 5 minutes, and the absorbance at 280 nm was measured. Based on the measured absorbance and the extinction coefficient at 280 nm which has been calculated from the amino acid sequence of protein, the protein concentration was determined. Calculation of the extinction coefficient was performed by using ProtParam (http://web.expasy.org/protparam/).
7. Measurement of Enzyme Activity and Stability
[0067] Activity of the taCA protein was measured by CO.sub.2 hydration assay. 600 μl of 20 mM Tris buffer (100 μM phenol red, pH 8.3) which has been kept cold was admixed with 10 μl of a protein sample. After adding the mixture to a disposable cuvette, it was placed in a spectrometer kept at 4° C. Five minutes later, 400 μl of cold CO.sub.2 saturated solution were rapidly added thereto and a change in absorbance at 570 nm was measured. Time (t) for having the absorbance drop from 1.2, which is the absorbance corresponding to pH 7.5, to 0.18, which is the absorbance corresponding to pH 6.5, was obtained. In addition, by using the dialysis buffer instead of a protein sample, time required for natural CO.sub.2 reaction was obtained (i.e., to: blank), and the enzyme activity was calculated using the formula (t.sub.0−t)/t. To measure the stability, a sample at the same concentration was heated at 70° C. or 90° C. for a certain period of time. Then, the activity was measured and the result was compared with the activity of a sample not treated with heat. The relative activity was obtained accordingly.
8. Analysis of Predicted Phosphorylation Site
[0068] Analysis of the predicted phosphorylation site in each tag sequence was performed by using NetPhos 3.1 server (http://www.cbs.dtu.dk/services/NetPhos/).
Example 1. Analysis of Expression Pattern of Target Protein Including Water Soluble Tag
1-1. Expression of Target Protein GFP
[0069] Analysis was made to see the expression of target protein GFP (NEXT tag-GFP, MBP tag-GFP, GST tag-GFP, Fh8 tag-GFP) in the cells transformed with a recombinant vector, which includes the fusion tag (NEXT) of the present invention, or MBP, GST or Fh8 tag that are conventionally used.
[0070] As a result, when the expression was induced at a condition including addition of 1 mM IPTG and 37° C., it was found that the target protein fused with the tag of the present invention (NEXT tag-GFP) has a higher expression amount of the recombinant protein in water soluble fraction compared to the target protein fused with other tag (i.e., MBP tag-GFP, GST tag-GFP and Fh8 tag-GFP), and also it is most excellent in terms of the total protein expression amount (A of
[0071] Meanwhile, Coomassie blue staining is dependent on the size (kDa) and composition of a protein, and thus, based on the intensity of a protein band only, the protein expression level cannot be accurately compared. As such, analysis of the fluorescence intensity of GFP protein was carried out. As a result, it was observed that the fluorescence is the strongest from NEXT tag-GFP (C of
1-2. Expression of Target Protein Luciferase
[0072] Expression pattern of a recombinant protein fused with different tag was analyzed in the same manner as Example 1-1 except that the type of a target protein is changed.
[0073] As a result, same as the result of GFP protein, it was recognized that significantly increased water solubility and expression of a recombinant luciferase protein can be obtained when NEXT tag of the present invention is fused to a target protein (
1-3. Expression of Target Protein taCA
[0074] Analysis was made to see the expression of target protein taCA in the cells transformed with a recombinant vector, which includes the fusion tag (NEXT, Cru and Kue) of the present invention, or MBP, GST or Fh8 tag that are conventionally used.
[0075] When the expression was induced at a condition including addition of 1 mM IPTG and 37° C. followed by Coomassie blue staining, it was found that the taCA protein fused with any one of the 6 kinds of tag is overexpressed in water soluble fraction. It is particularly found that the highest expression level is shown when NEXT tag or Cru tag of the present invention is used (A and B of
Example 2. Activity and Stability of Target Protein taCA Protein
[0076] It is important for a water soluble tag not only to increase the water solubility of a target protein but also to exhibit the minimum influence on the intrinsic property of a target protein. As such, the activity and stability of a target protein taCA, which has been expressed in cells transformed with the recombinant vector including the fusion tag (NEXT) of the present invention or MBP, GST or Fh8 tag that are conventionally used, were analyzed.
[0077] taCA protein itself is expressed in water soluble form. However, after undergoing a dialysis process following protein purification, insoluble precipitates are produced again in large amounts, thus showing low yield. As such, after purifying at the same condition the recombinant proteins fused with different tags, precipitation pattern of the proteins was analyzed via a dialysis process.
[0078] As a result, it was found that, in case of the wild-type taCA protein which has not been fused with any tag or taCA protein containing GST tag, most of the protein has precipitated in insoluble form after the dialysis process, but taCA protein containing NEXT tag, Cru tag, Kue tag, MBP tag or Fh8 tag maintained the water soluble form without being precipitated in insoluble form even after the dialysis process (A and B of
[0079] Furthermore, the protein volume remained after removing the precipitates was almost the same, and, as a result of measuring the protein concentration remained after the removal of the precipitates, the concentration was found to be as follows: NEXT-taCA; 113.7 μM, MBP-taCA; 61.4 μM, GST-taCA; 2.7 μM, and Fh8-taCA; 64.2 μM. As such, it was recognized that the most excellent production amount is obtained from NEXT-taCA fused with the tag of the present invention. Based on this result, it is believed that NEXT tag of the present invention exhibits an excellent effect of increasing the water solubility of recombinant protein not only during the expression process but also during the purification process of protein.
[0080] To measure the activity of the wild-type taCA protein not fused with any tag and also the target protein NEXT-taCA, a dialysis buffer added with 300 mM sodium chloride was used. Salt was added to prevent the loss of activity of the wild-type taCA protein which is caused by precipitation occurring during the dialysis process.
[0081] As a result, it was found that the enzyme activity of target protein NEXT-taCA has increased by 10% approximately compared to the wild-type taCA protein, and the result was standardized against the measurement result of activity of target protein NEXT-taCA, Fh8-taCA and MBP-taCA, which have been obtained by using dialysis buffer not added with any sodium chloride. MBP-taCA protein showed the enzyme activity of about 250% compared to the wild-type taCA protein and Fh8-taCA protein showed the enzyme activity of about 127% compared to the wild-type taCA protein. NEXT-taCA protein showed the enzyme activity of about 110% compared to the wild-type taCA protein, representing the closest value to the original enzyme activity (
[0082] In addition, after the measurement of the enzyme activity, each recombinant protein was heated at 90° C. for 2 hours and the residual activity was measured again to analyze the thermal stability of the recombinant protein. As a result, the residual activity was about 56% for NEXT-taCA, about 41% for Fh8-taCA, and about 16% for MBP-taCA. Even though it has been shown in
[0083] Moreover, to determine whether or not the stability of a target protein can be maintained for an extended period of time in case of using NEXT tag, the wild-type taCA not fused with any tag, NEXT tag-taCA, and dvCA 8.0 were purified and dialyzed against the dialysis buffer which has been added with 300 mM sodium chloride. Enzyme activity was measured for each recombinant protein, which was then heated for an extended period of time at 70° C., and then the residual activity was measured again to analyze the thermal stability.
[0084] As a result, the residual activity of dvCA 8.0 has decreased to less than half of the initial activity within 3 days. On the other hand, the wild-type taCA and NEXT tag-taCA showed the residual activity of about 80%. After 40 days, both the wild-type taCA and dvCA 8.0 lost the entire activity, but NEXT tag-taCA exhibited the residual activity of about 30% (
Example 3. Analysis of Phosphorylation Site in Water Soluble Tag
[0085] As shown in the following Table 3, as a result of comparing the peptide tag of the present invention (NEXT) with a water soluble tag (MBP, GST, NusA, SUMO, Fh8) that is conventionally known, it was found that NEXT tag is free of any predicted phosphorylation site.
[0086] This result means that, in NEXT tag which has a smaller size than a conventional water soluble tag, a predicted phosphorylation site possibly allowing post-translational modification like phosphorylation is absent. Furthermore, since the water soluble tags which have been conventionally used have a large size, they may exhibit an influence on the intrinsic properties of a target protein for fusion. However, as the fusion tag of the present invention (i.e., NEXT) has a relatively small size, it is believed to exhibit no influence on the functional property of a target property.
TABLE-US-00003 TABLE 3 Comparison of Predicted Phosphorylation Sites in Each Tag Predicted Tag Size (a, a) phosphorylation sites NEXT 53 0 MBP 367 26 GST 220 12 NusA 495 33 SUMO 98 9 Fh8 69 3
Example 4. Analysis of Effect of Small-sized NEXT Tag Variant
[0087] trncNEXT tag is composed of the 17 amino acids that are present at C-terminus of NEXT tag. Although it has a size of about ⅓ of NEXT tag, it was found to have the almost the same function as NEXT tag.
[0088] First, by using trncNEXT tag, the water solubility and expression level of the target protein taCA were analyzed. As a result, it was found that, although the expression level of target protein taCA to which trncNEXT is fused is slightly lower than the expression level of target protein taCA to which NEXT tag is fused, it is still expressed at higher level compared to the wild-type taCA shown in
[0089] Furthermore, as a result of carrying out the dialysis process using a buffer not added with sodium chloride after purifying the target proteins to which trncNEXT tag or NEXT tag is fused, it was found that trncNEXT-taCA and NEXT-taCA maintain the water soluble form without any precipitation even after the dialysis process (B of
[0090] Moreover, as a result of measuring the relative enzyme activity of the target protein to which trncNEXT tag or NEXT tag is fused followed by measurement of the residual activity after heating the protein for 1 hour at 90° C., it was found that, between trncNEXT-taCA and NEXT-taCA, the enzyme activity (A of
[0091] It is recognized based on the above result that, similar to NEXT tag, trncNEXT tag can be also used as a fusion tag which is favorable in terms of increasing the water solubility and expression level of a target protein while exhibiting no influence on the intrinsic properties of a target protein.
[0092] A sequence listing electronically submitted with the present application on Jun. 15, 2020 as an ASCII text file named 20200615_Q33520GR07_TU_SEQ, created on Jun. 12, 2020 and having a size of 56,000 bytes, is incorporated herein by reference in its entirety.